longamp taq pcr kit  (New England Biolabs)

Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    LongAmp Taq PCR Kit
    LongAmp Taq PCR Kit 100 rxns
    Catalog Number:
    100 rxns
    Long distance PCR Kits
    Buy from Supplier

    Structured Review

    New England Biolabs longamp taq pcr kit
    LongAmp Taq PCR Kit
    LongAmp Taq PCR Kit 100 rxns
    https://www.bioz.com/result/longamp taq pcr kit/product/New England Biolabs
    Average 97 stars, based on 14 article reviews
    Price from $9.99 to $1999.99
    longamp taq pcr kit - by Bioz Stars, 2019-08
    97/100 stars


    Related Articles

    Clone Assay:

    Article Title: Identification of Theileria lestoquardi Antigens Recognized by CD8+ T Cells
    Article Snippet: Contaminating DNA was removed with the Turbo DNA-free™ kit (Applied Biosystems) before cDNA synthesis, which was carried out using the AMV LongAmp® Taq RT-PCR kit (New England Biolabs). .. Contaminating DNA was removed with the Turbo DNA-free™ kit (Applied Biosystems) before cDNA synthesis, which was carried out using the AMV LongAmp® Taq RT-PCR kit (New England Biolabs).

    Article Title: Antagonistic Effects of Cellular Poly(C) Binding Proteins on Vesicular Stomatitis Virus Gene Expression
    Article Snippet: VSV P with a Flag tag at the amino (N) terminus was cloned into the pHygeGFP vector. .. Coding sequences of PCBP1 ( ) and PCBP2 ( ) were amplified using total RNA recovered from HEK293 cells by using a LongAmp kit (New England BioLabs).


    Article Title: A Mitogenomic Re-Evaluation of the Bdelloid Phylogeny and Relationships among the Syndermata
    Article Snippet: Degenerate primers from Min and Park (2009) initially amplified small fragments of the cox1 , cox2 , and 16s mitochondrial genes from M. quadricornifera , A. vaga , and H. constricta . .. The NEB LongAmp PCR kit (NEB, Ipswich, MA) generated 5–12 Kb amplicons.

    Article Title: Induction of Stress Granule-Like Structures in Vesicular Stomatitis Virus-Infected Cells
    Article Snippet: Alexa Fluor 594-labeled donkey anti-goat IgG (A-11058), Alexa Fluor 488-labeled donkey anti-mouse IgG (A-21202), Alexa Fluor 488-labeled donkey anti-rabbit IgG (A-21206), Alexa Fluor 647-labeled donkey anti-rabbit IgG (A-31573), Alexa Fluor 594-labeled goat anti-mouse IgG (A-11005), and Alexa Fluor 488-labeled goat anti-rabbit IgG (A-11034) were obtained from Invitrogen. .. Coding sequences of TIA1a (variant 2; ) and TIARb (variant 1; ) were amplified using total RNA from HeLa cells and a LongAmp kit (New England Biolabs) with the specific primers shown in . .. The PCR products were digested with KpnI and EcoRI and were cloned into pcDHA (a plasmid carrying an HA epitope tag) as described previously ( ).

    Article Title: Lack of Association of the Serotonin Transporter Polymorphism With the Sudden Infant Death Syndrome in the San Diego Dataset
    Article Snippet: The 5-HTTLPR was genotyped using polymerase chain reaction (PCR) and with a LongAmp Taq PCR Kit (New England Biolabs, Ipswich, MA). .. Temperature cycling was performed using a Bio-Rad iCycler (Bio-Rad Laboratories, Hercules, CA) with the block preheated to 95°C using the following protocol: initial denaturing at 95°C for 30 s, followed by 35 cycles of 95°C for 10 s, 62°C for 45 s, and 65°C for 50 s, with a final extension at 65°C for 10 min.

    Article Title: Development and validation of a sample sparing strategy for HLA typing utilizing next generation sequencing
    Article Snippet: Paragraph title: 2.2 PCR amplification ... A 46 µl PCR master mix was prepared for each sample containing 10 µl of 5× Crimson LongAmp Taq Reaction Buffer (Crimson LongAmp Taq kit; New England BioLabs, Ipswich, MA), 1.5 µl of 10 mM dNTPs (New England Biolabs, Ispswich, MA), 2 µl (5 units) Crimson LongAmp Taq, 4 µl primer mix (final concentration 0.8 µM for each primer), and 28 µl nuclease-free water (Qiagen).

    Article Title: The ability of human nuclear DNA to cause false positive low-abundance heteroplasmy calls varies across the mitochondrial genome
    Article Snippet: DNA was isolated using DNeasy Blood and Tissue kit (Qiagen, CA, USA). .. The isolated DNA was amplified using the LongAmp Taq PCR Kit (New England Bio Labs, MA, USA) under three conditions, varying the annealing temperature. .. More details including the PCR amplification conditions can be found in the Additional file .

    Article Title: Antagonistic Effects of Cellular Poly(C) Binding Proteins on Vesicular Stomatitis Virus Gene Expression
    Article Snippet: VSV P with a Flag tag at the amino (N) terminus was cloned into the pHygeGFP vector. .. Coding sequences of PCBP1 ( ) and PCBP2 ( ) were amplified using total RNA recovered from HEK293 cells by using a LongAmp kit (New England BioLabs). .. The reverse transcription-PCRs (RT-PCRs) for PCBP1 amplification were performed using the forward primer NheI-HA-KpnI-PCBP1F containing two restriction sites flanking the sequence for the HA epitope tag (shown in italics) and the reverse primer EcoRI-PCBP1R ( ).

    Article Title: An abundance of Epsilonproteobacteria revealed in the gut microbiome of the laboratory cultured sea urchin, Lytechinus variegatus
    Article Snippet: Paragraph title: Metacommunity DNA purification and generation of 16S rRNA amplicon library ... The individual PCR reactions were set up as follows: 10 μL of 5X Reaction Buffer; 1.5 μL (200 μM) of each of the dNTPs; 2 μL (1.5 μM) of each of the oligonucleotide primers; 1.5 μL (5 U) of the “LongAmp” enzyme kit (New England Biolabs, Ipswich, MA; cat # E5200S); 30 μL (2–5 ng/μl) of the template DNA; and 3 μL of sterile H2 O to a total reaction volume of 50 μL.

    Article Title: A loss-of-function and H2B-Venus transcriptional reporter allele for Gata6 in mice
    Article Snippet: The ES cell line was based on a previously described KH2 clone [ ], in which an inducible Gata4-mCherry cDNA had previously been integrated into the Col1a1 locus [ ]. .. Correct targeting to the Gata6 locus was determined by long-range PCR amplification of the 5’ arm junction using the LongAmp Taq PCR Kit (NEB, #e5200) and the following primers: Gata6_genomic_fwd2: CTTTGAGAGTCTACACCCTTC, R1RN_rev: TGATATCGTGGTATCGTTATGCGCCT (correctly targeted: ~5 kb product). .. ColA1 TetO-Gata4-mCherry/+ ;R26 M2rtTA/+ ;Gata6 H2B-Venus/+ ES cells were cultured under standard ES cell conditions; Knockout DMEM (Life Technologies 10829), 10 % FBS (Hyclone), 1 % L-glutamine (Life Technologies 25030), 1 % non-essential amino acids (Life Technologies 11140), 1 % sodium pyruvate (Life Technologies 11360), 0.1 % β-mercaptoethanol (Life Technologies 21985), 0.01 % LIF (ESGRO, Millipore ESG1107).

    Article Title: Drosophila KDEL Receptor Function in the Embryonic Salivary Gland and Epidermis
    Article Snippet: All other images were taken on a Zeiss Axiophot microscope with a Nikon Coolpix 4500 digital camera. .. Full length and KDEL/KEEL deleted boca and wbl ORFs were PCR amplified from cDNAs SD08653 (boca ) and IP02648 (wbl ) using the LongAmp Taq PCR kit (NEB) and the primers in . .. Amplified PCR products were first cloned into pENTR/D-TOPO (Invitrogen) and subsequently into pAW Gateway vector ( http://emb.carnegiescience.edu/labs/murphy/Gateway%20vectors.html ) using the LR clonase II kit (Invitrogen).

    Article Title: piggyBac as a high-capacity transgenesis and gene-therapy vector in human cells and mice
    Article Snippet: Primers RT-BAC-F and RT-BAC-B were used for the amplification. .. To examine the integrity of BAC transgenes, long-range PCR was carried out using the LongAmp Taq PCR kit (NEB).


    Article Title: The ability of human nuclear DNA to cause false positive low-abundance heteroplasmy calls varies across the mitochondrial genome
    Article Snippet: The isolated DNA was amplified using the LongAmp Taq PCR Kit (New England Bio Labs, MA, USA) under three conditions, varying the annealing temperature. .. Sequencing has been performed using Illumina MiSeq instrument at 151 cycles.


    Article Title: The Analysis of the Inflorescence miRNome of the Orchid Orchis italica Reveals a DEF-Like MADS-Box Gene as a New miRNA Target
    Article Snippet: The MADS-box degenerate primer MADS_F ( ) and a poly-T primer were used to amplify 1 µl of first strand cDNA using the LongAmp Taq PCR Kit (New England Biolabs) , . .. Virtual translation of the coding sequence of the OitaDEF -like genes was aligned to other DEF-like and GLO-like (class B MADS-box proteins) sequences present in GenBank using ClustalW.

    Article Title: Resolving TYK2 locus genotype-to-phenotype differences in autoimmunity
    Article Snippet: Tyk2-Ala-1124-encoding targeting construct was generated by the Gene Recombineering Facility (Monash University). .. Successful homologous recombination between vector and endogenous Tyk2 locus was detected by long-range PCR using the 5HR-F2 (5’-GGGGCTCC TGTCTACAGCTC-3’) and 5HR-R2 (5’-TGTCGATCAGGATGATCTGG-3’), and the 3HR-F1 (5’-CGCGGGGATCTCA TGCTGGAGTTC-3’) and 3HR-R1 (5’-CCCATGTGTGTCCCTTGA TCCTGC-3’) primers and the LongAmp™ Taq PCR kit (New England Biolabs).

    Article Title: Induction of Stress Granule-Like Structures in Vesicular Stomatitis Virus-Infected Cells
    Article Snippet: Paragraph title: Plasmid constructs. ... Coding sequences of TIA1a (variant 2; ) and TIARb (variant 1; ) were amplified using total RNA from HeLa cells and a LongAmp kit (New England Biolabs) with the specific primers shown in .

    Article Title: An ancient selective sweep linked to reproductive life history evolution in sockeye salmon
    Article Snippet: Long range PCRs were conducted using the LongAmp® Taq PCR kit (NEB) for eight individuals of each homozygous genotype at the 68810 SNP from Okanagan Lake shore- and stream-spawning kokanee, respectively. .. These PCR products were purified using a Qiagen MinElute gel extraction kit and individuals for each PCR product were pooled.

    Article Title: Antagonistic Effects of Cellular Poly(C) Binding Proteins on Vesicular Stomatitis Virus Gene Expression
    Article Snippet: Paragraph title: Plasmid constructs. ... Coding sequences of PCBP1 ( ) and PCBP2 ( ) were amplified using total RNA recovered from HEK293 cells by using a LongAmp kit (New England BioLabs).

    Real-time Polymerase Chain Reaction:

    Article Title: MLL leukemia induction by genome editing of human CD34+ hematopoietic cells
    Article Snippet: Paragraph title: Reverse transcription PCR and qPCR ... MLL oncogene knock-in was assessed by genomic PCR with the LongAmp Taq PCR kit (New England BioLabs).

    Article Title: piggyBac as a high-capacity transgenesis and gene-therapy vector in human cells and mice
    Article Snippet: To measure the copy number of BAC, genomic DNA extracted from mouse tails were used as the template for real-time PCR. .. To examine the integrity of BAC transgenes, long-range PCR was carried out using the LongAmp Taq PCR kit (NEB).


    Article Title: The ability of human nuclear DNA to cause false positive low-abundance heteroplasmy calls varies across the mitochondrial genome
    Article Snippet: The isolated DNA was amplified using the LongAmp Taq PCR Kit (New England Bio Labs, MA, USA) under three conditions, varying the annealing temperature. .. Sequencing has been performed using Illumina MiSeq instrument at 151 cycles.

    In Silico:

    Article Title: The ability of human nuclear DNA to cause false positive low-abundance heteroplasmy calls varies across the mitochondrial genome
    Article Snippet: Primer validation was performed using in-silico PCR using MFEprimer-3.0 [ ]. .. The isolated DNA was amplified using the LongAmp Taq PCR Kit (New England Bio Labs, MA, USA) under three conditions, varying the annealing temperature.


    Article Title: Induction of Stress Granule-Like Structures in Vesicular Stomatitis Virus-Infected Cells
    Article Snippet: Coding sequences of TIA1a (variant 2; ) and TIARb (variant 1; ) were amplified using total RNA from HeLa cells and a LongAmp kit (New England Biolabs) with the specific primers shown in . .. The resulting constructs express the inserted genes with an HA epitope at the N-terminal ends of the proteins.

    Article Title: Drosophila KDEL Receptor Function in the Embryonic Salivary Gland and Epidermis
    Article Snippet: Paragraph title: Expression and analysis of wild-type and mutant ER proteins in S2 cells ... Full length and KDEL/KEEL deleted boca and wbl ORFs were PCR amplified from cDNAs SD08653 (boca ) and IP02648 (wbl ) using the LongAmp Taq PCR kit (NEB) and the primers in .

    Article Title: piggyBac as a high-capacity transgenesis and gene-therapy vector in human cells and mice
    Article Snippet: Expression of GAPDH was used as the baseline standard. .. To examine the integrity of BAC transgenes, long-range PCR was carried out using the LongAmp Taq PCR kit (NEB).


    Article Title: MLL leukemia induction by genome editing of human CD34+ hematopoietic cells
    Article Snippet: Colony-forming cell (CFC) assays were performed as previously described., Identical conditions were used for CFC assays with explanted leukemic cells from MPAL or AML mice. .. MLL oncogene knock-in was assessed by genomic PCR with the LongAmp Taq PCR kit (New England BioLabs). .. For each PCR, 200 to 1000 ng of gDNA was used with genomic-specific primers (proof of genomic integration): MLL primer: 5′ATCCCTGTAAAACAAAAACCAAAA3′; AF9 primer: 5′TTGTCATCAGAATGCAGATCTTTC3′, ENL2 primer: 5′GTACCCCGACTCCTCTACTTTGTA3′, ENL7 primer: 5′GTAGGTGCCCTTCTTGAGGATCT3′; and for the detection of the wild-type (WT) MLL gene: 5′ACAACTTTGGATGGAAAATAAGGA3′ PCR products were visualized on agarose gel and extracted for Sanger sequencing.

    Transformation Assay:

    Article Title: A Mitogenomic Re-Evaluation of the Bdelloid Phylogeny and Relationships among the Syndermata
    Article Snippet: The NEB LongAmp PCR kit (NEB, Ipswich, MA) generated 5–12 Kb amplicons. .. Qiagen PCR Qiaquick purification columns removed enzymes after each reaction (Qiagen, Valencia, CA, USA).

    Blocking Assay:

    Article Title: Lack of Association of the Serotonin Transporter Polymorphism With the Sudden Infant Death Syndrome in the San Diego Dataset
    Article Snippet: The 5-HTTLPR was genotyped using polymerase chain reaction (PCR) and with a LongAmp Taq PCR Kit (New England Biolabs, Ipswich, MA). .. The PCR mixture consisted of 1 µL (2.5 units) of LongAmp Taq DNA polymerase [containing 100 mM KCl, 10 mM Tris-HCl (pH 7.4 at 25°C), 0.1 mM EDTA, 1 mM DTT, 0.5% Tween 20, 0.5% NP-40, and 50% glycerol], 5 µL of the accompanying PCR buffer [containing 60 mM Tris-SO4 (pH 9.0 at 25°C), 20 mM (NH4 )2 SO4 , 2 mM MgSO4 , 3% glycerol, 0.06% NP-40, 0.05% Tween-20], 0.75 µL of 10 mM dNTP mix (300 µM final concentration), 1.5 µL of 10 µM forward and reverse primers (0.4 µM final concentration), and 2 µL (40–60 ng) of DNA in a total volume of 25 µL.


    Article Title: Drosophila KDEL Receptor Function in the Embryonic Salivary Gland and Epidermis
    Article Snippet: Full length and KDEL/KEEL deleted boca and wbl ORFs were PCR amplified from cDNAs SD08653 (boca ) and IP02648 (wbl ) using the LongAmp Taq PCR kit (NEB) and the primers in . .. Full length and KDEL/KEEL deleted boca and wbl ORFs were PCR amplified from cDNAs SD08653 (boca ) and IP02648 (wbl ) using the LongAmp Taq PCR kit (NEB) and the primers in .

    Gas Chromatography:

    Article Title: Genome-Wide Association Mapping in Dogs Enables Identification of the Homeobox Gene, NKX2-8, as a Genetic Component of Neural Tube Defects in Humans
    Article Snippet: PCR was performed using 40 ng of DNA, 1 unit of AccuPrime GC-Rich DNA Polymerase, 5 ul of buffer A (AccuPrime high GC DNA polymerase kit; life technologies, Grand Island, NY 14072, USA), 50 ng forward and reverse primers, in 25 ul reaction volume. .. The sequence upstream of the gene was missing on the May 2005 CanFAm2.0 genome assembly (viewed using the UCSC genome browser), and was captured using the LongAmp Taq PCR Kit (New England BioLabs Ipswich, MA 01938, USA).

    Concentration Assay:

    Article Title: Development and validation of a sample sparing strategy for HLA typing utilizing next generation sequencing
    Article Snippet: A primer mix was prepared for each primer set. .. A 46 µl PCR master mix was prepared for each sample containing 10 µl of 5× Crimson LongAmp Taq Reaction Buffer (Crimson LongAmp Taq kit; New England BioLabs, Ipswich, MA), 1.5 µl of 10 mM dNTPs (New England Biolabs, Ispswich, MA), 2 µl (5 units) Crimson LongAmp Taq, 4 µl primer mix (final concentration 0.8 µM for each primer), and 28 µl nuclease-free water (Qiagen). .. Four µl of DNA (Qiagen purified or REPLI-G material) were added to 46 µl of the PCR master mix in a 96 well PCR tray.

    Article Title: Getting Started with Microbiome Analysis: Sample Acquisition to Bioinformatics
    Article Snippet: New England Biolabs LongAmp Taq PCR kit ( , cat # E5200S). .. Set up individual reactions as follows: 10 μL of 5× Reaction Buffer 1.5μLof dNTPs 2μL of the 5 ‘Primer diluted as described above 2 μL of the 3′ Primer diluted as described above 1.5 μL of the “LongAmp” enzyme supplied in the kit 30 μL of the Template DNA prepared using the “Fecal DNA Isolation kit.


    Article Title: Identification of Theileria lestoquardi Antigens Recognized by CD8+ T Cells
    Article Snippet: Total RNA was extracted with the Qiagen RNeasy Mini kit from cryopreserved lymphocytes of T . lestoquardi -infected sheep. .. Contaminating DNA was removed with the Turbo DNA-free™ kit (Applied Biosystems) before cDNA synthesis, which was carried out using the AMV LongAmp® Taq RT-PCR kit (New England Biolabs).

    Hemagglutination Assay:

    Article Title: Induction of Stress Granule-Like Structures in Vesicular Stomatitis Virus-Infected Cells
    Article Snippet: Coding sequences of TIA1a (variant 2; ) and TIARb (variant 1; ) were amplified using total RNA from HeLa cells and a LongAmp kit (New England Biolabs) with the specific primers shown in . .. The PCR products were digested with KpnI and EcoRI and were cloned into pcDHA (a plasmid carrying an HA epitope tag) as described previously ( ).

    Article Title: Antagonistic Effects of Cellular Poly(C) Binding Proteins on Vesicular Stomatitis Virus Gene Expression
    Article Snippet: HA-ubiquitin was expressed from the plasmid pMT123-HA-ubiquitin, which was described previously ( ). .. Coding sequences of PCBP1 ( ) and PCBP2 ( ) were amplified using total RNA recovered from HEK293 cells by using a LongAmp kit (New England BioLabs).


    Article Title: Resolving TYK2 locus genotype-to-phenotype differences in autoimmunity
    Article Snippet: Tyk2-Ala-1124-encoding targeting construct was generated by the Gene Recombineering Facility (Monash University). .. Successful homologous recombination between vector and endogenous Tyk2 locus was detected by long-range PCR using the 5HR-F2 (5’-GGGGCTCC TGTCTACAGCTC-3’) and 5HR-R2 (5’-TGTCGATCAGGATGATCTGG-3’), and the 3HR-F1 (5’-CGCGGGGATCTCA TGCTGGAGTTC-3’) and 3HR-R1 (5’-CCCATGTGTGTCCCTTGA TCCTGC-3’) primers and the LongAmp™ Taq PCR kit (New England Biolabs).

    Article Title: A Mitogenomic Re-Evaluation of the Bdelloid Phylogeny and Relationships among the Syndermata
    Article Snippet: The sequences generated from these amplicons then directed the design of primers specific to these taxa. .. The NEB LongAmp PCR kit (NEB, Ipswich, MA) generated 5–12 Kb amplicons. .. Either the hydroshear (GeneMachines, San Carlos, CA, USA) or the Covaris S2 (Covaris Inc, Woburn, MA, USA) sheared PCR products into 500–1500 Kb pieces.

    Article Title: Development and validation of a sample sparing strategy for HLA typing utilizing next generation sequencing
    Article Snippet: For Class II, amplicons specific for exons 2 and 3 from the appropriate HLA Class II genes were generated by PCR using locus-specific primers designed to amplify most polymorphic HLA genes. .. A 46 µl PCR master mix was prepared for each sample containing 10 µl of 5× Crimson LongAmp Taq Reaction Buffer (Crimson LongAmp Taq kit; New England BioLabs, Ipswich, MA), 1.5 µl of 10 mM dNTPs (New England Biolabs, Ispswich, MA), 2 µl (5 units) Crimson LongAmp Taq, 4 µl primer mix (final concentration 0.8 µM for each primer), and 28 µl nuclease-free water (Qiagen).

    Transplantation Assay:

    Article Title: MLL leukemia induction by genome editing of human CD34+ hematopoietic cells
    Article Snippet: MLL oncogene knock-in was assessed by genomic PCR with the LongAmp Taq PCR kit (New England BioLabs). .. For each PCR, 200 to 1000 ng of gDNA was used with genomic-specific primers (proof of genomic integration): MLL primer: 5′ATCCCTGTAAAACAAAAACCAAAA3′; AF9 primer: 5′TTGTCATCAGAATGCAGATCTTTC3′, ENL2 primer: 5′GTACCCCGACTCCTCTACTTTGTA3′, ENL7 primer: 5′GTAGGTGCCCTTCTTGAGGATCT3′; and for the detection of the wild-type (WT) MLL gene: 5′ACAACTTTGGATGGAAAATAAGGA3′ PCR products were visualized on agarose gel and extracted for Sanger sequencing.

    Transmission Assay:

    Article Title: A loss-of-function and H2B-Venus transcriptional reporter allele for Gata6 in mice
    Article Snippet: Correct targeting to the Gata6 locus was determined by long-range PCR amplification of the 5’ arm junction using the LongAmp Taq PCR Kit (NEB, #e5200) and the following primers: Gata6_genomic_fwd2: CTTTGAGAGTCTACACCCTTC, R1RN_rev: TGATATCGTGGTATCGTTATGCGCCT (correctly targeted: ~5 kb product). .. All Gata6 H2B-Venus/+ mice used in this study contained the Neomycin selection cassette, which has not yet been excised by crossing with Dre-expressing mice [ ].

    Polymerase Chain Reaction:

    Article Title: The Analysis of the Inflorescence miRNome of the Orchid Orchis italica Reveals a DEF-Like MADS-Box Gene as a New miRNA Target
    Article Snippet: One microgram of total RNA extracted from floral buds of O. italica was reverse transcribed using the Advantage RT-PCR kit (Clontech) and an oligo dT primer. .. The MADS-box degenerate primer MADS_F ( ) and a poly-T primer were used to amplify 1 µl of first strand cDNA using the LongAmp Taq PCR Kit (New England Biolabs) , . .. The amplification products were cloned into the pGEM-T Easy vector (Promega); more than 50 clones were sequenced using the plasmid primers T7 and SP6 and sequencing reactions were run on an ABI 310 Automated Sequencer (Applied Biosystems).

    Article Title: Identification of Theileria lestoquardi Antigens Recognized by CD8+ T Cells
    Article Snippet: Contaminating DNA was removed with the Turbo DNA-free™ kit (Applied Biosystems) before cDNA synthesis, which was carried out using the AMV LongAmp® Taq RT-PCR kit (New England Biolabs). .. Partial MHC class I sequences were amplified from cDNA samples using class I generic primers 416 (5' CGGCTACGTGGACGACAYG 3') and Cr (5' ATGGGTCACATGTGYCTTTG 3'), which bind within exons 1 and 3 [ ], generating a 500 bp product.

    Article Title: Mitochondrial genomes organization in alloplasmic lines of sunflower (Helianthus annuus L.) with various types of cytoplasmic male sterility
    Article Snippet: Validation of discovered rearrangements was made by PCR analysis and Sanger sequencing. .. PCR reactions were performed with LongAmp Taq PCR Kit (New England Biolabs, Ipswich, MA, USA) for reactions with expected amplicons more than 1.5 kb, and with Tersus Plus PCR kit (Evrogen, Moscow, Russia) for other reactions, including Sanger sequencing. .. For 28–29 cycles of PCR, we used 0.4 uM of primers ( ) and one ng of extracted DNA.

    Article Title: Resolving TYK2 locus genotype-to-phenotype differences in autoimmunity
    Article Snippet: Gene targeting was performed in the embryonic stem (ES) cell line JM8F6. .. Successful homologous recombination between vector and endogenous Tyk2 locus was detected by long-range PCR using the 5HR-F2 (5’-GGGGCTCC TGTCTACAGCTC-3’) and 5HR-R2 (5’-TGTCGATCAGGATGATCTGG-3’), and the 3HR-F1 (5’-CGCGGGGATCTCA TGCTGGAGTTC-3’) and 3HR-R1 (5’-CCCATGTGTGTCCCTTGA TCCTGC-3’) primers and the LongAmp™ Taq PCR kit (New England Biolabs). .. Positive clones were further validated by Southern blotting using standard methods with probe amplification using the 5’-GGATCCGA ACATGGTCCCTTGGATGT-3’ and 5’-GCTAGCGGCTTCACCTGTATCCCACT-3’ primers.

    Article Title: A Mitogenomic Re-Evaluation of the Bdelloid Phylogeny and Relationships among the Syndermata
    Article Snippet: The sequences generated from these amplicons then directed the design of primers specific to these taxa. .. The NEB LongAmp PCR kit (NEB, Ipswich, MA) generated 5–12 Kb amplicons. .. Either the hydroshear (GeneMachines, San Carlos, CA, USA) or the Covaris S2 (Covaris Inc, Woburn, MA, USA) sheared PCR products into 500–1500 Kb pieces.

    Article Title: The AP2-Like Gene OitaAP2 Is Alternatively Spliced and Differentially Expressed in Inflorescence and Vegetative Tissues of the Orchid Orchis italica
    Article Snippet: After DNase treatment (Ambion), RNA was quantified using a Nanodrop 2000c spectrophotometer (ThermoScientific) and reverse-transcribed (1 µg) using the Advantage RT-PCR kit (Clontech) and oligo dT primer. .. The degenerate forward primer AP2F2 (Table 1), which matches a region of the nucleotide sequence encoding the conserved AP2 domain, and the oligo dT primer were used to amplify 1 µl of cDNA using the LongAmp Taq PCR Kit (New England Biolabs), following the manufacturer instructions. .. The amplification products were cloned into the pGEM-T Easy vector (Promega), and several clones were sequenced using the plasmid primers T7 and SP6 and an ABI 310 Automated Sequencer (Applied Biosystems).

    Article Title: Genome-Wide Association Mapping in Dogs Enables Identification of the Homeobox Gene, NKX2-8, as a Genetic Component of Neural Tube Defects in Humans
    Article Snippet: Primers ( ) were used to generate overlapping sequences to complete the genomic sequence of NKX2-8 . .. The sequence upstream of the gene was missing on the May 2005 CanFAm2.0 genome assembly (viewed using the UCSC genome browser), and was captured using the LongAmp Taq PCR Kit (New England BioLabs Ipswich, MA 01938, USA). .. The PCR products were electrophoresed on 1–2% agarose, and cleaned using ExoSAP-IT.

    Article Title: Missing Genes, Multiple ORFs, and C-to-U Type RNA Editing in Acrasis kona (Heterolobosea, Excavata) Mitochondrial DNA
    Article Snippet: These contigs were used for a baiting and iterative mapping approach using Illumina sequencing data to correct base-calling errors known to be associated with long single-nucleotide repeats in 454 reads with Mira ( ). .. Long range PCR was carried out using nested primers to cross gap regions using the LongAmp Taq PCR Kit (NEB) ( supplementary table S1 , Supplementary Material online). .. PCR products ranging from 2 to 7 kb were cloned using the CloneJET PCR Cloning Kit (Fermentas) ( supplementary fig. S1 , Supplementary Material online).

    Article Title: Lack of Association of the Serotonin Transporter Polymorphism With the Sudden Infant Death Syndrome in the San Diego Dataset
    Article Snippet: Genomic DNA from the San Diego cases was isolated from brainstem tissue using a standard Puregene solid tissue protocol (Genomic DNA Purification Kit, Gentra Systems, Minneapolis, MN). .. The 5-HTTLPR was genotyped using polymerase chain reaction (PCR) and with a LongAmp Taq PCR Kit (New England Biolabs, Ipswich, MA). .. The PCR mixture consisted of 1 µL (2.5 units) of LongAmp Taq DNA polymerase [containing 100 mM KCl, 10 mM Tris-HCl (pH 7.4 at 25°C), 0.1 mM EDTA, 1 mM DTT, 0.5% Tween 20, 0.5% NP-40, and 50% glycerol], 5 µL of the accompanying PCR buffer [containing 60 mM Tris-SO4 (pH 9.0 at 25°C), 20 mM (NH4 )2 SO4 , 2 mM MgSO4 , 3% glycerol, 0.06% NP-40, 0.05% Tween-20], 0.75 µL of 10 mM dNTP mix (300 µM final concentration), 1.5 µL of 10 µM forward and reverse primers (0.4 µM final concentration), and 2 µL (40–60 ng) of DNA in a total volume of 25 µL.

    Article Title: An ancient selective sweep linked to reproductive life history evolution in sockeye salmon
    Article Snippet: The resulting sequences of the immediate flanking regions, along with the S. salar and O. mykiss alignment, were used to design two sets of primers in PRIMER3 for long-range PCRs in each direction targeting two overlapping fragments each of ~11 kbp (total contiguous sequence length of ~21 kbp). .. Long range PCRs were conducted using the LongAmp® Taq PCR kit (NEB) for eight individuals of each homozygous genotype at the 68810 SNP from Okanagan Lake shore- and stream-spawning kokanee, respectively. .. Each long-range PCR was carried out in 25 μl reactions containing: ~100 ng of template DNA, 60 mM Tris-SO4 , 20 mM (NH4 )2 SO4 , 2 mM MgSO4 , 3% Glycerol, 0.06% IGEPAL® CA-630, 0.05% Tween® 20, 300 µM dNTPs, 0.5 μM of each primer, and 5 U LongAmp® Taq polymerase.

    Article Title: Development and validation of a sample sparing strategy for HLA typing utilizing next generation sequencing
    Article Snippet: A primer mix was prepared for each primer set. .. A 46 µl PCR master mix was prepared for each sample containing 10 µl of 5× Crimson LongAmp Taq Reaction Buffer (Crimson LongAmp Taq kit; New England BioLabs, Ipswich, MA), 1.5 µl of 10 mM dNTPs (New England Biolabs, Ispswich, MA), 2 µl (5 units) Crimson LongAmp Taq, 4 µl primer mix (final concentration 0.8 µM for each primer), and 28 µl nuclease-free water (Qiagen). .. Four µl of DNA (Qiagen purified or REPLI-G material) were added to 46 µl of the PCR master mix in a 96 well PCR tray.

    Article Title: Getting Started with Microbiome Analysis: Sample Acquisition to Bioinformatics
    Article Snippet: Storage stock diluted with 10 mM Tris pH 8.0 to 100 μM, then diluted 10× in water to 10μM for use in PCR reactions). .. New England Biolabs LongAmp Taq PCR kit ( , cat # E5200S). .. The kit contains all of the necessary reagents for the PCR reactions.

    Article Title: The ability of human nuclear DNA to cause false positive low-abundance heteroplasmy calls varies across the mitochondrial genome
    Article Snippet: DNA was isolated using DNeasy Blood and Tissue kit (Qiagen, CA, USA). .. The isolated DNA was amplified using the LongAmp Taq PCR Kit (New England Bio Labs, MA, USA) under three conditions, varying the annealing temperature. .. More details including the PCR amplification conditions can be found in the Additional file .

    Article Title: Antagonistic Effects of Cellular Poly(C) Binding Proteins on Vesicular Stomatitis Virus Gene Expression
    Article Snippet: Coding sequences of PCBP1 ( ) and PCBP2 ( ) were amplified using total RNA recovered from HEK293 cells by using a LongAmp kit (New England BioLabs). .. The reverse transcription-PCRs (RT-PCRs) for PCBP1 amplification were performed using the forward primer NheI-HA-KpnI-PCBP1F containing two restriction sites flanking the sequence for the HA epitope tag (shown in italics) and the reverse primer EcoRI-PCBP1R ( ).

    Article Title: MLL leukemia induction by genome editing of human CD34+ hematopoietic cells
    Article Snippet: Colony-forming cell (CFC) assays were performed as previously described., Identical conditions were used for CFC assays with explanted leukemic cells from MPAL or AML mice. .. MLL oncogene knock-in was assessed by genomic PCR with the LongAmp Taq PCR kit (New England BioLabs). .. For each PCR, 200 to 1000 ng of gDNA was used with genomic-specific primers (proof of genomic integration): MLL primer: 5′ATCCCTGTAAAACAAAAACCAAAA3′; AF9 primer: 5′TTGTCATCAGAATGCAGATCTTTC3′, ENL2 primer: 5′GTACCCCGACTCCTCTACTTTGTA3′, ENL7 primer: 5′GTAGGTGCCCTTCTTGAGGATCT3′; and for the detection of the wild-type (WT) MLL gene: 5′ACAACTTTGGATGGAAAATAAGGA3′ PCR products were visualized on agarose gel and extracted for Sanger sequencing.

    Article Title: An abundance of Epsilonproteobacteria revealed in the gut microbiome of the laboratory cultured sea urchin, Lytechinus variegatus
    Article Snippet: The oligonucleotide primers used for the PCR amplification of the V4 region of the 16S rRNA gene were as follows: Forward primer V4: 5′-AAT GATACGGCGACCACCGAGATCTACACTATGGTAATTGTGTGCCAGCMGCCGCGG TAA-3′; and Reverse primer V4: 5′-CAA GAGAAGACGGCATACGAGATNNNNNNAGTCAGTCAGCCGGACTACHVGGGTWTC TAAT-3′ (Eurofins Genomics, Inc., Huntsville, AL) (Kumar et al., ). .. The individual PCR reactions were set up as follows: 10 μL of 5X Reaction Buffer; 1.5 μL (200 μM) of each of the dNTPs; 2 μL (1.5 μM) of each of the oligonucleotide primers; 1.5 μL (5 U) of the “LongAmp” enzyme kit (New England Biolabs, Ipswich, MA; cat # E5200S); 30 μL (2–5 ng/μl) of the template DNA; and 3 μL of sterile H2 O to a total reaction volume of 50 μL. .. The PCR cycling parameters were as follows: initial denature 94°C for 1 min; 32 cycles of amplification in which each cycle consisted of 94°C for 30 s, 50°C for 1 min, 65°C for 1 min; followed by final extension of 65°C for 3 min; then a final hold at 4°C.

    Article Title: A loss-of-function and H2B-Venus transcriptional reporter allele for Gata6 in mice
    Article Snippet: The ES cell line was based on a previously described KH2 clone [ ], in which an inducible Gata4-mCherry cDNA had previously been integrated into the Col1a1 locus [ ]. .. Correct targeting to the Gata6 locus was determined by long-range PCR amplification of the 5’ arm junction using the LongAmp Taq PCR Kit (NEB, #e5200) and the following primers: Gata6_genomic_fwd2: CTTTGAGAGTCTACACCCTTC, R1RN_rev: TGATATCGTGGTATCGTTATGCGCCT (correctly targeted: ~5 kb product). .. ColA1 TetO-Gata4-mCherry/+ ;R26 M2rtTA/+ ;Gata6 H2B-Venus/+ ES cells were cultured under standard ES cell conditions; Knockout DMEM (Life Technologies 10829), 10 % FBS (Hyclone), 1 % L-glutamine (Life Technologies 25030), 1 % non-essential amino acids (Life Technologies 11140), 1 % sodium pyruvate (Life Technologies 11360), 0.1 % β-mercaptoethanol (Life Technologies 21985), 0.01 % LIF (ESGRO, Millipore ESG1107).

    Article Title: Drosophila KDEL Receptor Function in the Embryonic Salivary Gland and Epidermis
    Article Snippet: All other images were taken on a Zeiss Axiophot microscope with a Nikon Coolpix 4500 digital camera. .. Full length and KDEL/KEEL deleted boca and wbl ORFs were PCR amplified from cDNAs SD08653 (boca ) and IP02648 (wbl ) using the LongAmp Taq PCR kit (NEB) and the primers in . .. Amplified PCR products were first cloned into pENTR/D-TOPO (Invitrogen) and subsequently into pAW Gateway vector ( http://emb.carnegiescience.edu/labs/murphy/Gateway%20vectors.html ) using the LR clonase II kit (Invitrogen).

    Article Title: piggyBac as a high-capacity transgenesis and gene-therapy vector in human cells and mice
    Article Snippet: Primers RT-BAC-F and RT-BAC-B were used for the amplification. .. To examine the integrity of BAC transgenes, long-range PCR was carried out using the LongAmp Taq PCR kit (NEB). .. We prepared metaphase chromosome spreads from ES cells.


    Article Title: Resolving TYK2 locus genotype-to-phenotype differences in autoimmunity
    Article Snippet: Successful homologous recombination between vector and endogenous Tyk2 locus was detected by long-range PCR using the 5HR-F2 (5’-GGGGCTCC TGTCTACAGCTC-3’) and 5HR-R2 (5’-TGTCGATCAGGATGATCTGG-3’), and the 3HR-F1 (5’-CGCGGGGATCTCA TGCTGGAGTTC-3’) and 3HR-R1 (5’-CCCATGTGTGTCCCTTGA TCCTGC-3’) primers and the LongAmp™ Taq PCR kit (New England Biolabs). .. Positive clones were further validated by Southern blotting using standard methods with probe amplification using the 5’-GGATCCGA ACATGGTCCCTTGGATGT-3’ and 5’-GCTAGCGGCTTCACCTGTATCCCACT-3’ primers.

    Article Title: A loss-of-function and H2B-Venus transcriptional reporter allele for Gata6 in mice
    Article Snippet: Correct targeting to the Gata6 locus was determined by long-range PCR amplification of the 5’ arm junction using the LongAmp Taq PCR Kit (NEB, #e5200) and the following primers: Gata6_genomic_fwd2: CTTTGAGAGTCTACACCCTTC, R1RN_rev: TGATATCGTGGTATCGTTATGCGCCT (correctly targeted: ~5 kb product). .. ColA1 TetO-Gata4-mCherry/+ ;R26 M2rtTA/+ ;Gata6 H2B-Venus/+ ES cells were cultured under standard ES cell conditions; Knockout DMEM (Life Technologies 10829), 10 % FBS (Hyclone), 1 % L-glutamine (Life Technologies 25030), 1 % non-essential amino acids (Life Technologies 11140), 1 % sodium pyruvate (Life Technologies 11360), 0.1 % β-mercaptoethanol (Life Technologies 21985), 0.01 % LIF (ESGRO, Millipore ESG1107).


    Article Title: The AP2-Like Gene OitaAP2 Is Alternatively Spliced and Differentially Expressed in Inflorescence and Vegetative Tissues of the Orchid Orchis italica
    Article Snippet: After DNase treatment (Ambion), RNA was quantified using a Nanodrop 2000c spectrophotometer (ThermoScientific) and reverse-transcribed (1 µg) using the Advantage RT-PCR kit (Clontech) and oligo dT primer. .. The degenerate forward primer AP2F2 (Table 1), which matches a region of the nucleotide sequence encoding the conserved AP2 domain, and the oligo dT primer were used to amplify 1 µl of cDNA using the LongAmp Taq PCR Kit (New England Biolabs), following the manufacturer instructions.

    DNA Extraction:

    Article Title: Getting Started with Microbiome Analysis: Sample Acquisition to Bioinformatics
    Article Snippet: New England Biolabs LongAmp Taq PCR kit ( , cat # E5200S). .. Qiagen QIAquick Gel Extraction Kit (cat # 28704).

    Article Title: An abundance of Epsilonproteobacteria revealed in the gut microbiome of the laboratory cultured sea urchin, Lytechinus variegatus
    Article Snippet: Microbial community DNA was isolated using the Fecal DNA isolation kit from Zymo Research (Irvine, CA; catalog # D6010) following the manufacturer's instructions. .. The individual PCR reactions were set up as follows: 10 μL of 5X Reaction Buffer; 1.5 μL (200 μM) of each of the dNTPs; 2 μL (1.5 μM) of each of the oligonucleotide primers; 1.5 μL (5 U) of the “LongAmp” enzyme kit (New England Biolabs, Ipswich, MA; cat # E5200S); 30 μL (2–5 ng/μl) of the template DNA; and 3 μL of sterile H2 O to a total reaction volume of 50 μL.

    Nucleic Acid Electrophoresis:

    Article Title: Lack of Association of the Serotonin Transporter Polymorphism With the Sudden Infant Death Syndrome in the San Diego Dataset
    Article Snippet: The 5-HTTLPR was genotyped using polymerase chain reaction (PCR) and with a LongAmp Taq PCR Kit (New England Biolabs, Ipswich, MA). .. Temperature cycling was performed using a Bio-Rad iCycler (Bio-Rad Laboratories, Hercules, CA) with the block preheated to 95°C using the following protocol: initial denaturing at 95°C for 30 s, followed by 35 cycles of 95°C for 10 s, 62°C for 45 s, and 65°C for 50 s, with a final extension at 65°C for 10 min.

    In Vivo:

    Article Title: The ability of human nuclear DNA to cause false positive low-abundance heteroplasmy calls varies across the mitochondrial genome
    Article Snippet: An in-vivo validation of the proposed primers was performed using human DNA from a de-identified archived specimen. .. The isolated DNA was amplified using the LongAmp Taq PCR Kit (New England Bio Labs, MA, USA) under three conditions, varying the annealing temperature.

    DNA Purification:

    Article Title: Lack of Association of the Serotonin Transporter Polymorphism With the Sudden Infant Death Syndrome in the San Diego Dataset
    Article Snippet: Genomic DNA from the San Diego cases was isolated from brainstem tissue using a standard Puregene solid tissue protocol (Genomic DNA Purification Kit, Gentra Systems, Minneapolis, MN). .. The 5-HTTLPR was genotyped using polymerase chain reaction (PCR) and with a LongAmp Taq PCR Kit (New England Biolabs, Ipswich, MA).

    Article Title: An abundance of Epsilonproteobacteria revealed in the gut microbiome of the laboratory cultured sea urchin, Lytechinus variegatus
    Article Snippet: Paragraph title: Metacommunity DNA purification and generation of 16S rRNA amplicon library ... The individual PCR reactions were set up as follows: 10 μL of 5X Reaction Buffer; 1.5 μL (200 μM) of each of the dNTPs; 2 μL (1.5 μM) of each of the oligonucleotide primers; 1.5 μL (5 U) of the “LongAmp” enzyme kit (New England Biolabs, Ipswich, MA; cat # E5200S); 30 μL (2–5 ng/μl) of the template DNA; and 3 μL of sterile H2 O to a total reaction volume of 50 μL.


    Article Title: Genome-Wide Association Mapping in Dogs Enables Identification of the Homeobox Gene, NKX2-8, as a Genetic Component of Neural Tube Defects in Humans
    Article Snippet: The primers, E2F2: 5′ CTGGTAGGCGGGGAAGAG ; and E2R2: 5′ GGTTCCAGAACCATCGCTAC , were used to generate PCR products which flank the frameshift mutation within exon 2 of the NKX2-8 gene. .. The sequence upstream of the gene was missing on the May 2005 CanFAm2.0 genome assembly (viewed using the UCSC genome browser), and was captured using the LongAmp Taq PCR Kit (New England BioLabs Ipswich, MA 01938, USA).

    Article Title: Drosophila KDEL Receptor Function in the Embryonic Salivary Gland and Epidermis
    Article Snippet: Paragraph title: Expression and analysis of wild-type and mutant ER proteins in S2 cells ... Full length and KDEL/KEEL deleted boca and wbl ORFs were PCR amplified from cDNAs SD08653 (boca ) and IP02648 (wbl ) using the LongAmp Taq PCR kit (NEB) and the primers in .


    Article Title: The Analysis of the Inflorescence miRNome of the Orchid Orchis italica Reveals a DEF-Like MADS-Box Gene as a New miRNA Target
    Article Snippet: Using more stringent search parameters (maximum expectation 0.0), the cleaned reads were analyzed also against different transcripts of genes involved in flower development of O. italica that we have previously isolated (OrcLFY [GenBank: AB088851], OitaAP2 [GenBank: KF152921], OrcPI [GenBank: AB094985], OrcPI2 [GenBank: AB537504], OitaAG [GenBank: JX205496], OitaSTK [GenBank: JX205497]). .. The MADS-box degenerate primer MADS_F ( ) and a poly-T primer were used to amplify 1 µl of first strand cDNA using the LongAmp Taq PCR Kit (New England Biolabs) , .

    Article Title: The AP2-Like Gene OitaAP2 Is Alternatively Spliced and Differentially Expressed in Inflorescence and Vegetative Tissues of the Orchid Orchis italica
    Article Snippet: Paragraph title: Isolation of the OitaAP2 cDNA ... The degenerate forward primer AP2F2 (Table 1), which matches a region of the nucleotide sequence encoding the conserved AP2 domain, and the oligo dT primer were used to amplify 1 µl of cDNA using the LongAmp Taq PCR Kit (New England Biolabs), following the manufacturer instructions.

    Article Title: Lack of Association of the Serotonin Transporter Polymorphism With the Sudden Infant Death Syndrome in the San Diego Dataset
    Article Snippet: Genomic DNA from the San Diego cases was isolated from brainstem tissue using a standard Puregene solid tissue protocol (Genomic DNA Purification Kit, Gentra Systems, Minneapolis, MN). .. The 5-HTTLPR was genotyped using polymerase chain reaction (PCR) and with a LongAmp Taq PCR Kit (New England Biolabs, Ipswich, MA).

    Article Title: The ability of human nuclear DNA to cause false positive low-abundance heteroplasmy calls varies across the mitochondrial genome
    Article Snippet: DNA was isolated using DNeasy Blood and Tissue kit (Qiagen, CA, USA). .. The isolated DNA was amplified using the LongAmp Taq PCR Kit (New England Bio Labs, MA, USA) under three conditions, varying the annealing temperature. .. More details including the PCR amplification conditions can be found in the Additional file .

    Article Title: MLL leukemia induction by genome editing of human CD34+ hematopoietic cells
    Article Snippet: MLL oncogene knock-in was assessed by genomic PCR with the LongAmp Taq PCR kit (New England BioLabs). .. Bone marrow (BM) cells were obtained from the Division of Blood and Marrow Transplantation at Stanford University (under institutional review board–approved research protocol).

    Article Title: An abundance of Epsilonproteobacteria revealed in the gut microbiome of the laboratory cultured sea urchin, Lytechinus variegatus
    Article Snippet: Microbial community DNA was isolated using the Fecal DNA isolation kit from Zymo Research (Irvine, CA; catalog # D6010) following the manufacturer's instructions. .. The individual PCR reactions were set up as follows: 10 μL of 5X Reaction Buffer; 1.5 μL (200 μM) of each of the dNTPs; 2 μL (1.5 μM) of each of the oligonucleotide primers; 1.5 μL (5 U) of the “LongAmp” enzyme kit (New England Biolabs, Ipswich, MA; cat # E5200S); 30 μL (2–5 ng/μl) of the template DNA; and 3 μL of sterile H2 O to a total reaction volume of 50 μL.


    Article Title: The Analysis of the Inflorescence miRNome of the Orchid Orchis italica Reveals a DEF-Like MADS-Box Gene as a New miRNA Target
    Article Snippet: The MADS-box degenerate primer MADS_F ( ) and a poly-T primer were used to amplify 1 µl of first strand cDNA using the LongAmp Taq PCR Kit (New England Biolabs) , . .. The MADS-box degenerate primer MADS_F ( ) and a poly-T primer were used to amplify 1 µl of first strand cDNA using the LongAmp Taq PCR Kit (New England Biolabs) , .

    Article Title: Mitochondrial genomes organization in alloplasmic lines of sunflower (Helianthus annuus L.) with various types of cytoplasmic male sterility
    Article Snippet: Validation of discovered rearrangements was made by PCR analysis and Sanger sequencing. .. PCR reactions were performed with LongAmp Taq PCR Kit (New England Biolabs, Ipswich, MA, USA) for reactions with expected amplicons more than 1.5 kb, and with Tersus Plus PCR kit (Evrogen, Moscow, Russia) for other reactions, including Sanger sequencing. .. For 28–29 cycles of PCR, we used 0.4 uM of primers ( ) and one ng of extracted DNA.

    Article Title: Resolving TYK2 locus genotype-to-phenotype differences in autoimmunity
    Article Snippet: Successful homologous recombination between vector and endogenous Tyk2 locus was detected by long-range PCR using the 5HR-F2 (5’-GGGGCTCC TGTCTACAGCTC-3’) and 5HR-R2 (5’-TGTCGATCAGGATGATCTGG-3’), and the 3HR-F1 (5’-CGCGGGGATCTCA TGCTGGAGTTC-3’) and 3HR-R1 (5’-CCCATGTGTGTCCCTTGA TCCTGC-3’) primers and the LongAmp™ Taq PCR kit (New England Biolabs). .. Correctly targeted ES cells were injected into albino C57BL6/J blastocysts.

    Article Title: A Mitogenomic Re-Evaluation of the Bdelloid Phylogeny and Relationships among the Syndermata
    Article Snippet: The NEB LongAmp PCR kit (NEB, Ipswich, MA) generated 5–12 Kb amplicons. .. The NEB LongAmp PCR kit (NEB, Ipswich, MA) generated 5–12 Kb amplicons.

    Article Title: The AP2-Like Gene OitaAP2 Is Alternatively Spliced and Differentially Expressed in Inflorescence and Vegetative Tissues of the Orchid Orchis italica
    Article Snippet: After DNase treatment (Ambion), RNA was quantified using a Nanodrop 2000c spectrophotometer (ThermoScientific) and reverse-transcribed (1 µg) using the Advantage RT-PCR kit (Clontech) and oligo dT primer. .. The degenerate forward primer AP2F2 (Table 1), which matches a region of the nucleotide sequence encoding the conserved AP2 domain, and the oligo dT primer were used to amplify 1 µl of cDNA using the LongAmp Taq PCR Kit (New England Biolabs), following the manufacturer instructions. .. The amplification products were cloned into the pGEM-T Easy vector (Promega), and several clones were sequenced using the plasmid primers T7 and SP6 and an ABI 310 Automated Sequencer (Applied Biosystems).

    Article Title: Genome-Wide Association Mapping in Dogs Enables Identification of the Homeobox Gene, NKX2-8, as a Genetic Component of Neural Tube Defects in Humans
    Article Snippet: Primers ( ) were used to generate overlapping sequences to complete the genomic sequence of NKX2-8 . .. The sequence upstream of the gene was missing on the May 2005 CanFAm2.0 genome assembly (viewed using the UCSC genome browser), and was captured using the LongAmp Taq PCR Kit (New England BioLabs Ipswich, MA 01938, USA). .. The PCR products were electrophoresed on 1–2% agarose, and cleaned using ExoSAP-IT.

    Article Title: Missing Genes, Multiple ORFs, and C-to-U Type RNA Editing in Acrasis kona (Heterolobosea, Excavata) Mitochondrial DNA
    Article Snippet: Paragraph title: mtDNA Sequencing ... Long range PCR was carried out using nested primers to cross gap regions using the LongAmp Taq PCR Kit (NEB) ( supplementary table S1 , Supplementary Material online).

    Article Title: An ancient selective sweep linked to reproductive life history evolution in sockeye salmon
    Article Snippet: Paragraph title: Flanking region sequencing and comparison ... Long range PCRs were conducted using the LongAmp® Taq PCR kit (NEB) for eight individuals of each homozygous genotype at the 68810 SNP from Okanagan Lake shore- and stream-spawning kokanee, respectively.

    Article Title: The ability of human nuclear DNA to cause false positive low-abundance heteroplasmy calls varies across the mitochondrial genome
    Article Snippet: The isolated DNA was amplified using the LongAmp Taq PCR Kit (New England Bio Labs, MA, USA) under three conditions, varying the annealing temperature. .. More details including the PCR amplification conditions can be found in the Additional file .

    Mouse Assay:

    Article Title: MLL leukemia induction by genome editing of human CD34+ hematopoietic cells
    Article Snippet: MLL oncogene knock-in was assessed by genomic PCR with the LongAmp Taq PCR kit (New England BioLabs). .. Mononuclear cells (MNCs) were isolated by using Ficoll-Paque plus and further enriched for B-cell subpopulations by sorting for CD10+ CD19+ or CD10− CD19+ cells.

    Article Title: A loss-of-function and H2B-Venus transcriptional reporter allele for Gata6 in mice
    Article Snippet: Paragraph title: Mice ... Correct targeting to the Gata6 locus was determined by long-range PCR amplification of the 5’ arm junction using the LongAmp Taq PCR Kit (NEB, #e5200) and the following primers: Gata6_genomic_fwd2: CTTTGAGAGTCTACACCCTTC, R1RN_rev: TGATATCGTGGTATCGTTATGCGCCT (correctly targeted: ~5 kb product).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: The Analysis of the Inflorescence miRNome of the Orchid Orchis italica Reveals a DEF-Like MADS-Box Gene as a New miRNA Target
    Article Snippet: One microgram of total RNA extracted from floral buds of O. italica was reverse transcribed using the Advantage RT-PCR kit (Clontech) and an oligo dT primer. .. The MADS-box degenerate primer MADS_F ( ) and a poly-T primer were used to amplify 1 µl of first strand cDNA using the LongAmp Taq PCR Kit (New England Biolabs) , .

    Article Title: Identification of Theileria lestoquardi Antigens Recognized by CD8+ T Cells
    Article Snippet: Total RNA was extracted with the Qiagen RNeasy Mini kit from cryopreserved lymphocytes of T . lestoquardi -infected sheep. .. Contaminating DNA was removed with the Turbo DNA-free™ kit (Applied Biosystems) before cDNA synthesis, which was carried out using the AMV LongAmp® Taq RT-PCR kit (New England Biolabs). .. Partial MHC class I sequences were amplified from cDNA samples using class I generic primers 416 (5' CGGCTACGTGGACGACAYG 3') and Cr (5' ATGGGTCACATGTGYCTTTG 3'), which bind within exons 1 and 3 [ ], generating a 500 bp product.

    Article Title: The AP2-Like Gene OitaAP2 Is Alternatively Spliced and Differentially Expressed in Inflorescence and Vegetative Tissues of the Orchid Orchis italica
    Article Snippet: After DNase treatment (Ambion), RNA was quantified using a Nanodrop 2000c spectrophotometer (ThermoScientific) and reverse-transcribed (1 µg) using the Advantage RT-PCR kit (Clontech) and oligo dT primer. .. The degenerate forward primer AP2F2 (Table 1), which matches a region of the nucleotide sequence encoding the conserved AP2 domain, and the oligo dT primer were used to amplify 1 µl of cDNA using the LongAmp Taq PCR Kit (New England Biolabs), following the manufacturer instructions.


    Article Title: Drosophila KDEL Receptor Function in the Embryonic Salivary Gland and Epidermis
    Article Snippet: Full length and KDEL/KEEL deleted boca and wbl ORFs were PCR amplified from cDNAs SD08653 (boca ) and IP02648 (wbl ) using the LongAmp Taq PCR kit (NEB) and the primers in . .. Full length and KDEL/KEEL deleted boca and wbl ORFs were PCR amplified from cDNAs SD08653 (boca ) and IP02648 (wbl ) using the LongAmp Taq PCR kit (NEB) and the primers in .

    De-Phosphorylation Assay:

    Article Title: A Mitogenomic Re-Evaluation of the Bdelloid Phylogeny and Relationships among the Syndermata
    Article Snippet: The NEB LongAmp PCR kit (NEB, Ipswich, MA) generated 5–12 Kb amplicons. .. Either the hydroshear (GeneMachines, San Carlos, CA, USA) or the Covaris S2 (Covaris Inc, Woburn, MA, USA) sheared PCR products into 500–1500 Kb pieces.


    Article Title: A Mitogenomic Re-Evaluation of the Bdelloid Phylogeny and Relationships among the Syndermata
    Article Snippet: I extracted DNA using a bead-beater and 0.1 mm silica beads to break open the rotifers, followed by lysis in an SDS/proteinase K (20 mg/ml) solution and a standard phenol chloroform extraction with ethanol/sodium acetate precipitation. .. The NEB LongAmp PCR kit (NEB, Ipswich, MA) generated 5–12 Kb amplicons.

    Polymerase Cycling Assembly:

    Article Title: Mitochondrial genomes organization in alloplasmic lines of sunflower (Helianthus annuus L.) with various types of cytoplasmic male sterility
    Article Snippet: Paragraph title: Validation of genome assembly—PCR and Sanger sequencing ... PCR reactions were performed with LongAmp Taq PCR Kit (New England Biolabs, Ipswich, MA, USA) for reactions with expected amplicons more than 1.5 kb, and with Tersus Plus PCR kit (Evrogen, Moscow, Russia) for other reactions, including Sanger sequencing.


    Article Title: Identification of Theileria lestoquardi Antigens Recognized by CD8+ T Cells
    Article Snippet: Contaminating DNA was removed with the Turbo DNA-free™ kit (Applied Biosystems) before cDNA synthesis, which was carried out using the AMV LongAmp® Taq RT-PCR kit (New England Biolabs). .. Contaminating DNA was removed with the Turbo DNA-free™ kit (Applied Biosystems) before cDNA synthesis, which was carried out using the AMV LongAmp® Taq RT-PCR kit (New England Biolabs).

    Article Title: Mitochondrial genomes organization in alloplasmic lines of sunflower (Helianthus annuus L.) with various types of cytoplasmic male sterility
    Article Snippet: PCR reactions were performed with LongAmp Taq PCR Kit (New England Biolabs, Ipswich, MA, USA) for reactions with expected amplicons more than 1.5 kb, and with Tersus Plus PCR kit (Evrogen, Moscow, Russia) for other reactions, including Sanger sequencing. .. For 28–29 cycles of PCR, we used 0.4 uM of primers ( ) and one ng of extracted DNA.

    Article Title: A Mitogenomic Re-Evaluation of the Bdelloid Phylogeny and Relationships among the Syndermata
    Article Snippet: The NEB LongAmp PCR kit (NEB, Ipswich, MA) generated 5–12 Kb amplicons. .. The NEB LongAmp PCR kit (NEB, Ipswich, MA) generated 5–12 Kb amplicons.

    Article Title: Genome-Wide Association Mapping in Dogs Enables Identification of the Homeobox Gene, NKX2-8, as a Genetic Component of Neural Tube Defects in Humans
    Article Snippet: The sequence upstream of the gene was missing on the May 2005 CanFAm2.0 genome assembly (viewed using the UCSC genome browser), and was captured using the LongAmp Taq PCR Kit (New England BioLabs Ipswich, MA 01938, USA). .. The PCR products were electrophoresed on 1–2% agarose, and cleaned using ExoSAP-IT.

    Article Title: An ancient selective sweep linked to reproductive life history evolution in sockeye salmon
    Article Snippet: All PCR products were purified by ExoSAP-IT (USB Products, Santa Clara, CA, USA) and Sanger sequenced using an ABI 3130XL Genetic Analyzer (Applied Biosystems). .. Long range PCRs were conducted using the LongAmp® Taq PCR kit (NEB) for eight individuals of each homozygous genotype at the 68810 SNP from Okanagan Lake shore- and stream-spawning kokanee, respectively.

    Article Title: Development and validation of a sample sparing strategy for HLA typing utilizing next generation sequencing
    Article Snippet: A 46 µl PCR master mix was prepared for each sample containing 10 µl of 5× Crimson LongAmp Taq Reaction Buffer (Crimson LongAmp Taq kit; New England BioLabs, Ipswich, MA), 1.5 µl of 10 mM dNTPs (New England Biolabs, Ispswich, MA), 2 µl (5 units) Crimson LongAmp Taq, 4 µl primer mix (final concentration 0.8 µM for each primer), and 28 µl nuclease-free water (Qiagen). .. The PCR reaction products were analyzed for the correct size fragment on a 1% agarose gel electrophoresed at 125 volts for 30 minutes.

    Article Title: Getting Started with Microbiome Analysis: Sample Acquisition to Bioinformatics
    Article Snippet: The primers were ordered at 50 nmol scale with desalting purification. .. New England Biolabs LongAmp Taq PCR kit ( , cat # E5200S).

    Article Title: An abundance of Epsilonproteobacteria revealed in the gut microbiome of the laboratory cultured sea urchin, Lytechinus variegatus
    Article Snippet: The individual PCR reactions were set up as follows: 10 μL of 5X Reaction Buffer; 1.5 μL (200 μM) of each of the dNTPs; 2 μL (1.5 μM) of each of the oligonucleotide primers; 1.5 μL (5 U) of the “LongAmp” enzyme kit (New England Biolabs, Ipswich, MA; cat # E5200S); 30 μL (2–5 ng/μl) of the template DNA; and 3 μL of sterile H2 O to a total reaction volume of 50 μL. .. The PCR product (approximately 380 bp predicted product size) was visualized by UV illumination.

    Plasmid Preparation:

    Article Title: Identification of Theileria lestoquardi Antigens Recognized by CD8+ T Cells
    Article Snippet: Contaminating DNA was removed with the Turbo DNA-free™ kit (Applied Biosystems) before cDNA synthesis, which was carried out using the AMV LongAmp® Taq RT-PCR kit (New England Biolabs). .. Contaminating DNA was removed with the Turbo DNA-free™ kit (Applied Biosystems) before cDNA synthesis, which was carried out using the AMV LongAmp® Taq RT-PCR kit (New England Biolabs).

    Article Title: Resolving TYK2 locus genotype-to-phenotype differences in autoimmunity
    Article Snippet: Gene targeting was performed in the embryonic stem (ES) cell line JM8F6. .. Successful homologous recombination between vector and endogenous Tyk2 locus was detected by long-range PCR using the 5HR-F2 (5’-GGGGCTCC TGTCTACAGCTC-3’) and 5HR-R2 (5’-TGTCGATCAGGATGATCTGG-3’), and the 3HR-F1 (5’-CGCGGGGATCTCA TGCTGGAGTTC-3’) and 3HR-R1 (5’-CCCATGTGTGTCCCTTGA TCCTGC-3’) primers and the LongAmp™ Taq PCR kit (New England Biolabs). .. Positive clones were further validated by Southern blotting using standard methods with probe amplification using the 5’-GGATCCGA ACATGGTCCCTTGGATGT-3’ and 5’-GCTAGCGGCTTCACCTGTATCCCACT-3’ primers.

    Article Title: A Mitogenomic Re-Evaluation of the Bdelloid Phylogeny and Relationships among the Syndermata
    Article Snippet: The NEB LongAmp PCR kit (NEB, Ipswich, MA) generated 5–12 Kb amplicons. .. Qiagen PCR Qiaquick purification columns removed enzymes after each reaction (Qiagen, Valencia, CA, USA).

    Article Title: Genome-Wide Association Mapping in Dogs Enables Identification of the Homeobox Gene, NKX2-8, as a Genetic Component of Neural Tube Defects in Humans
    Article Snippet: The sequence upstream of the gene was missing on the May 2005 CanFAm2.0 genome assembly (viewed using the UCSC genome browser), and was captured using the LongAmp Taq PCR Kit (New England BioLabs Ipswich, MA 01938, USA). .. Purified PCR products were sequenced using the Big Dye terminator mix on ABI 3500 Genetic Analyzer (Applied Biosystems, CA 92008).

    Article Title: Induction of Stress Granule-Like Structures in Vesicular Stomatitis Virus-Infected Cells
    Article Snippet: Paragraph title: Plasmid constructs. ... Coding sequences of TIA1a (variant 2; ) and TIARb (variant 1; ) were amplified using total RNA from HeLa cells and a LongAmp kit (New England Biolabs) with the specific primers shown in .

    Article Title: Antagonistic Effects of Cellular Poly(C) Binding Proteins on Vesicular Stomatitis Virus Gene Expression
    Article Snippet: Paragraph title: Plasmid constructs. ... Coding sequences of PCBP1 ( ) and PCBP2 ( ) were amplified using total RNA recovered from HEK293 cells by using a LongAmp kit (New England BioLabs).

    Article Title: A loss-of-function and H2B-Venus transcriptional reporter allele for Gata6 in mice
    Article Snippet: Exon 2 was flanked by loxP sites, while an FRT site positioned upstream of the reporter remained as a remnant of the original EUCOMM knockout-first vector design. .. Correct targeting to the Gata6 locus was determined by long-range PCR amplification of the 5’ arm junction using the LongAmp Taq PCR Kit (NEB, #e5200) and the following primers: Gata6_genomic_fwd2: CTTTGAGAGTCTACACCCTTC, R1RN_rev: TGATATCGTGGTATCGTTATGCGCCT (correctly targeted: ~5 kb product).


    Article Title: The Analysis of the Inflorescence miRNome of the Orchid Orchis italica Reveals a DEF-Like MADS-Box Gene as a New miRNA Target
    Article Snippet: The MADS-box degenerate primer MADS_F ( ) and a poly-T primer were used to amplify 1 µl of first strand cDNA using the LongAmp Taq PCR Kit (New England Biolabs) , . .. Virtual translation of the coding sequence of the OitaDEF -like genes was aligned to other DEF-like and GLO-like (class B MADS-box proteins) sequences present in GenBank using ClustalW.

    Article Title: The AP2-Like Gene OitaAP2 Is Alternatively Spliced and Differentially Expressed in Inflorescence and Vegetative Tissues of the Orchid Orchis italica
    Article Snippet: The degenerate forward primer AP2F2 (Table 1), which matches a region of the nucleotide sequence encoding the conserved AP2 domain, and the oligo dT primer were used to amplify 1 µl of cDNA using the LongAmp Taq PCR Kit (New England Biolabs), following the manufacturer instructions. .. The degenerate forward primer AP2F2 (Table 1), which matches a region of the nucleotide sequence encoding the conserved AP2 domain, and the oligo dT primer were used to amplify 1 µl of cDNA using the LongAmp Taq PCR Kit (New England Biolabs), following the manufacturer instructions.

    Article Title: Genome-Wide Association Mapping in Dogs Enables Identification of the Homeobox Gene, NKX2-8, as a Genetic Component of Neural Tube Defects in Humans
    Article Snippet: The sequence upstream of the gene was missing on the May 2005 CanFAm2.0 genome assembly (viewed using the UCSC genome browser), and was captured using the LongAmp Taq PCR Kit (New England BioLabs Ipswich, MA 01938, USA). .. Purified PCR products were sequenced using the Big Dye terminator mix on ABI 3500 Genetic Analyzer (Applied Biosystems, CA 92008).

    SYBR Green Assay:

    Article Title: piggyBac as a high-capacity transgenesis and gene-therapy vector in human cells and mice
    Article Snippet: After reverse transcription (TaKaRa), real-time PCR were performed with Brilliant II Fast Sybr Green QPCR Master Mix (Stratagene) on an Mx3000P Quantitative PCR System (Stratagene). .. To examine the integrity of BAC transgenes, long-range PCR was carried out using the LongAmp Taq PCR kit (NEB).


    Article Title: A loss-of-function and H2B-Venus transcriptional reporter allele for Gata6 in mice
    Article Snippet: The H2B-Venus reporter and Neomycin selection cassette were targeted to Intron 1 of the mouse Gata6 gene in ES cells of a C57BL6 x 129Sv genetic background. .. Correct targeting to the Gata6 locus was determined by long-range PCR amplification of the 5’ arm junction using the LongAmp Taq PCR Kit (NEB, #e5200) and the following primers: Gata6_genomic_fwd2: CTTTGAGAGTCTACACCCTTC, R1RN_rev: TGATATCGTGGTATCGTTATGCGCCT (correctly targeted: ~5 kb product).

    Agarose Gel Electrophoresis:

    Article Title: Lack of Association of the Serotonin Transporter Polymorphism With the Sudden Infant Death Syndrome in the San Diego Dataset
    Article Snippet: The 5-HTTLPR was genotyped using polymerase chain reaction (PCR) and with a LongAmp Taq PCR Kit (New England Biolabs, Ipswich, MA). .. Temperature cycling was performed using a Bio-Rad iCycler (Bio-Rad Laboratories, Hercules, CA) with the block preheated to 95°C using the following protocol: initial denaturing at 95°C for 30 s, followed by 35 cycles of 95°C for 10 s, 62°C for 45 s, and 65°C for 50 s, with a final extension at 65°C for 10 min.

    Article Title: Development and validation of a sample sparing strategy for HLA typing utilizing next generation sequencing
    Article Snippet: A 46 µl PCR master mix was prepared for each sample containing 10 µl of 5× Crimson LongAmp Taq Reaction Buffer (Crimson LongAmp Taq kit; New England BioLabs, Ipswich, MA), 1.5 µl of 10 mM dNTPs (New England Biolabs, Ispswich, MA), 2 µl (5 units) Crimson LongAmp Taq, 4 µl primer mix (final concentration 0.8 µM for each primer), and 28 µl nuclease-free water (Qiagen). .. After mixing, the PCR was performed on a thermocycler (BioRad or Applied Biosystems).

    Transgenic Assay:

    Article Title: Resolving TYK2 locus genotype-to-phenotype differences in autoimmunity
    Article Snippet: Successful homologous recombination between vector and endogenous Tyk2 locus was detected by long-range PCR using the 5HR-F2 (5’-GGGGCTCC TGTCTACAGCTC-3’) and 5HR-R2 (5’-TGTCGATCAGGATGATCTGG-3’), and the 3HR-F1 (5’-CGCGGGGATCTCA TGCTGGAGTTC-3’) and 3HR-R1 (5’-CCCATGTGTGTCCCTTGA TCCTGC-3’) primers and the LongAmp™ Taq PCR kit (New England Biolabs). .. Correctly targeted ES cells were injected into albino C57BL6/J blastocysts.

    Chromosome Walking:

    Article Title: Missing Genes, Multiple ORFs, and C-to-U Type RNA Editing in Acrasis kona (Heterolobosea, Excavata) Mitochondrial DNA
    Article Snippet: Long range PCR was carried out using nested primers to cross gap regions using the LongAmp Taq PCR Kit (NEB) ( supplementary table S1 , Supplementary Material online). .. Colonies containing inserts were sent for sequencing with ABI 3730 sequencer (Applied Biosystems) at Macrogen (Seoul, South Korea).


    Article Title: A loss-of-function and H2B-Venus transcriptional reporter allele for Gata6 in mice
    Article Snippet: Exon 2 was flanked by loxP sites, while an FRT site positioned upstream of the reporter remained as a remnant of the original EUCOMM knockout-first vector design. .. Correct targeting to the Gata6 locus was determined by long-range PCR amplification of the 5’ arm junction using the LongAmp Taq PCR Kit (NEB, #e5200) and the following primers: Gata6_genomic_fwd2: CTTTGAGAGTCTACACCCTTC, R1RN_rev: TGATATCGTGGTATCGTTATGCGCCT (correctly targeted: ~5 kb product).


    Article Title: Antagonistic Effects of Cellular Poly(C) Binding Proteins on Vesicular Stomatitis Virus Gene Expression
    Article Snippet: VSV P with a Flag tag at the amino (N) terminus was cloned into the pHygeGFP vector. .. Coding sequences of PCBP1 ( ) and PCBP2 ( ) were amplified using total RNA recovered from HEK293 cells by using a LongAmp kit (New England BioLabs).

    BAC Assay:

    Article Title: piggyBac as a high-capacity transgenesis and gene-therapy vector in human cells and mice
    Article Snippet: Primers RT-BAC-F and RT-BAC-B were used for the amplification. .. To examine the integrity of BAC transgenes, long-range PCR was carried out using the LongAmp Taq PCR kit (NEB). .. We prepared metaphase chromosome spreads from ES cells.

    Gel Extraction:

    Article Title: Identification of Theileria lestoquardi Antigens Recognized by CD8+ T Cells
    Article Snippet: Contaminating DNA was removed with the Turbo DNA-free™ kit (Applied Biosystems) before cDNA synthesis, which was carried out using the AMV LongAmp® Taq RT-PCR kit (New England Biolabs). .. The cycling conditions for PCR were 94°C for 4 min, 30 cycles 94°C for 30 s, 55°C for 30 s, and 72°C for 30 s, with Promega Go Taq DNA polymerase.

    Article Title: An ancient selective sweep linked to reproductive life history evolution in sockeye salmon
    Article Snippet: Long range PCRs were conducted using the LongAmp® Taq PCR kit (NEB) for eight individuals of each homozygous genotype at the 68810 SNP from Okanagan Lake shore- and stream-spawning kokanee, respectively. .. Each long-range PCR was carried out in 25 μl reactions containing: ~100 ng of template DNA, 60 mM Tris-SO4 , 20 mM (NH4 )2 SO4 , 2 mM MgSO4 , 3% Glycerol, 0.06% IGEPAL® CA-630, 0.05% Tween® 20, 300 µM dNTPs, 0.5 μM of each primer, and 5 U LongAmp® Taq polymerase.

    Article Title: Getting Started with Microbiome Analysis: Sample Acquisition to Bioinformatics
    Article Snippet: New England Biolabs LongAmp Taq PCR kit ( , cat # E5200S). .. The kit contains all of the necessary reagents for the PCR reactions.

    Article Title: An abundance of Epsilonproteobacteria revealed in the gut microbiome of the laboratory cultured sea urchin, Lytechinus variegatus
    Article Snippet: The individual PCR reactions were set up as follows: 10 μL of 5X Reaction Buffer; 1.5 μL (200 μM) of each of the dNTPs; 2 μL (1.5 μM) of each of the oligonucleotide primers; 1.5 μL (5 U) of the “LongAmp” enzyme kit (New England Biolabs, Ipswich, MA; cat # E5200S); 30 μL (2–5 ng/μl) of the template DNA; and 3 μL of sterile H2 O to a total reaction volume of 50 μL. .. The PCR product (approximately 380 bp predicted product size) was visualized by UV illumination.

    Variant Assay:

    Article Title: Induction of Stress Granule-Like Structures in Vesicular Stomatitis Virus-Infected Cells
    Article Snippet: Alexa Fluor 594-labeled donkey anti-goat IgG (A-11058), Alexa Fluor 488-labeled donkey anti-mouse IgG (A-21202), Alexa Fluor 488-labeled donkey anti-rabbit IgG (A-21206), Alexa Fluor 647-labeled donkey anti-rabbit IgG (A-31573), Alexa Fluor 594-labeled goat anti-mouse IgG (A-11005), and Alexa Fluor 488-labeled goat anti-rabbit IgG (A-11034) were obtained from Invitrogen. .. Coding sequences of TIA1a (variant 2; ) and TIARb (variant 1; ) were amplified using total RNA from HeLa cells and a LongAmp kit (New England Biolabs) with the specific primers shown in . .. The PCR products were digested with KpnI and EcoRI and were cloned into pcDHA (a plasmid carrying an HA epitope tag) as described previously ( ).

    Homologous Recombination:

    Article Title: Resolving TYK2 locus genotype-to-phenotype differences in autoimmunity
    Article Snippet: Gene targeting was performed in the embryonic stem (ES) cell line JM8F6. .. Successful homologous recombination between vector and endogenous Tyk2 locus was detected by long-range PCR using the 5HR-F2 (5’-GGGGCTCC TGTCTACAGCTC-3’) and 5HR-R2 (5’-TGTCGATCAGGATGATCTGG-3’), and the 3HR-F1 (5’-CGCGGGGATCTCA TGCTGGAGTTC-3’) and 3HR-R1 (5’-CCCATGTGTGTCCCTTGA TCCTGC-3’) primers and the LongAmp™ Taq PCR kit (New England Biolabs). .. Positive clones were further validated by Southern blotting using standard methods with probe amplification using the 5’-GGATCCGA ACATGGTCCCTTGGATGT-3’ and 5’-GCTAGCGGCTTCACCTGTATCCCACT-3’ primers.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    New England Biolabs longamp taq pcr kit
    Longamp Taq Pcr Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/longamp taq pcr kit/product/New England Biolabs
    Average 97 stars, based on 14 article reviews
    Price from $9.99 to $1999.99
    longamp taq pcr kit - by Bioz Stars, 2019-08
    97/100 stars
      Buy from Supplier

    Image Search Results