neb golden gate assembly mix  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85
    Name:
    NEB Golden Gate Assembly Mix
    Description:
    The NEB Golden Gate Assembly Kit BsaI HFv2 contains an optimized mix of BsaI HFv2 and T4 DNA Ligase Together these enzymes along with an optimal buffer can direct the assembly of multiple inserts modules using the Golden Gate approach Also provided is the pGGA destination plasmid which provides a backbone for your assembly features convenient restriction enzyme sites for subcloning and has T7 SP6 promoter sequences to enable in vitro transcription
    Catalog Number:
    e1600s
    Price:
    400
    Size:
    100 rxns
    Category:
    DNA Fragment Analysis Kits
    Buy from Supplier


    Structured Review

    New England Biolabs neb golden gate assembly mix
    NEB Golden Gate Assembly Mix
    The NEB Golden Gate Assembly Kit BsaI HFv2 contains an optimized mix of BsaI HFv2 and T4 DNA Ligase Together these enzymes along with an optimal buffer can direct the assembly of multiple inserts modules using the Golden Gate approach Also provided is the pGGA destination plasmid which provides a backbone for your assembly features convenient restriction enzyme sites for subcloning and has T7 SP6 promoter sequences to enable in vitro transcription
    https://www.bioz.com/result/neb golden gate assembly mix/product/New England Biolabs
    Average 85 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    neb golden gate assembly mix - by Bioz Stars, 2020-01
    85/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Double Selection Enhances the Efficiency of Target-AID and Cas9-Based Genome Editing in Yeast
    Article Snippet: .. The inserts were cloned into pDYSCKO using the Golden Gate Assembly Mix (New England Biolabs, Ipswich, USA) with the following parameters: 1 ul pDYSCKO vector (50 ng/ul), 1 ul insert (∼0.5 ng/ul) using the standard manufacturer assembly reaction conditions, which was incubated for 1 hr at 37° followed by 5 min at 55°. .. The ligated plasmids were transformed in bacteria and positive clones were confirmed by Sanger sequencing (CHUL sequencing platform, Québec, Canada) using the DYSCKO_rev or DYSCKO_For oligonucleotide.

    Article Title: Oxidative cyclization of prodigiosin by an alkylglycerol monooxygenase-like enzyme
    Article Snippet: Assembly of DNA fragments ( ) was performed using NEBuilder HiFi DNA Assembly Master Mix or NEB Golden Gate Assembly Mix (NEB) per manufacturer’s directions. .. The 11 kb pigBCDE fragment was cloned behind a T7 promoter using the Zero Blunt TOPO PCR Cloning Kit (ThermoFisher).

    Article Title: Evolution of neuronal anatomy and circuitry in two highly divergent nematode species
    Article Snippet: .. To make a Ppa-odr-3 reporter plasmid, a ~ 1.7 kb long region upstream of the first ATG codon of Ppa-odr-3 (PPA14189) (FP: GAGCGAGTGAAATGAGCTCAGTCC , RP: GGGTGATCGATACGAGGAGTGTTC ) and the coding sequence of TurboRFP fused to the 3’ UTR of the ribosomal gene Ppa-rpl-23 ( ) were cloned into the pUC19 plasmid using Golden Gate Assembly Mix (New England BioLabs, E1600S) following the manufacturer’s instructions. .. To make the Ppa-daf-6 reporter, a 2.4 kb promoter sequence upstream of the start codon Ppa-daf-6 (PPA15978) (FP: CTCGCCCGTGGATCATGTG , RP: TGCAAATCATTGATTGAATCATGG ) was fused with rfp and Venus by fusion PCR ( ; ).

    Amplification:

    Article Title: Double Selection Enhances the Efficiency of Target-AID and Cas9-Based Genome Editing in Yeast
    Article Snippet: Amplification reactions were pooled and purified using the EZ-10 Column PCR Products Purification Kit (Biobasic, Markham, Canada). .. The inserts were cloned into pDYSCKO using the Golden Gate Assembly Mix (New England Biolabs, Ipswich, USA) with the following parameters: 1 ul pDYSCKO vector (50 ng/ul), 1 ul insert (∼0.5 ng/ul) using the standard manufacturer assembly reaction conditions, which was incubated for 1 hr at 37° followed by 5 min at 55°.

    Article Title: Evolution of neuronal anatomy and circuitry in two highly divergent nematode species
    Article Snippet: To make a Ppa-odr-3 reporter plasmid, a ~ 1.7 kb long region upstream of the first ATG codon of Ppa-odr-3 (PPA14189) (FP: GAGCGAGTGAAATGAGCTCAGTCC , RP: GGGTGATCGATACGAGGAGTGTTC ) and the coding sequence of TurboRFP fused to the 3’ UTR of the ribosomal gene Ppa-rpl-23 ( ) were cloned into the pUC19 plasmid using Golden Gate Assembly Mix (New England BioLabs, E1600S) following the manufacturer’s instructions. .. The best BLASTP hit of Cel-odr-7 was Contig1-aug1055.t1 (Contig1:2723982–2725788) and the Ppa-odr-7 promoter was amplified and fused to rfp (FP: AACCAATGCATTGGCTTAGTTGGTTTCACTAATCACTACTG , RP: CCCTTGTCATTCAGATGAGCGAGCTGATCAAGGAG ).

    Polymerase Chain Reaction:

    Article Title: Double Selection Enhances the Efficiency of Target-AID and Cas9-Based Genome Editing in Yeast
    Article Snippet: Amplification reactions were pooled and purified using the EZ-10 Column PCR Products Purification Kit (Biobasic, Markham, Canada). .. The inserts were cloned into pDYSCKO using the Golden Gate Assembly Mix (New England Biolabs, Ipswich, USA) with the following parameters: 1 ul pDYSCKO vector (50 ng/ul), 1 ul insert (∼0.5 ng/ul) using the standard manufacturer assembly reaction conditions, which was incubated for 1 hr at 37° followed by 5 min at 55°.

    Article Title: Oxidative cyclization of prodigiosin by an alkylglycerol monooxygenase-like enzyme
    Article Snippet: Assembly of DNA fragments ( ) was performed using NEBuilder HiFi DNA Assembly Master Mix or NEB Golden Gate Assembly Mix (NEB) per manufacturer’s directions. .. The 11 kb pigBCDE fragment was cloned behind a T7 promoter using the Zero Blunt TOPO PCR Cloning Kit (ThermoFisher).

    Article Title: Evolution of neuronal anatomy and circuitry in two highly divergent nematode species
    Article Snippet: To make a Ppa-odr-3 reporter plasmid, a ~ 1.7 kb long region upstream of the first ATG codon of Ppa-odr-3 (PPA14189) (FP: GAGCGAGTGAAATGAGCTCAGTCC , RP: GGGTGATCGATACGAGGAGTGTTC ) and the coding sequence of TurboRFP fused to the 3’ UTR of the ribosomal gene Ppa-rpl-23 ( ) were cloned into the pUC19 plasmid using Golden Gate Assembly Mix (New England BioLabs, E1600S) following the manufacturer’s instructions. .. To make the Ppa-daf-6 reporter, a 2.4 kb promoter sequence upstream of the start codon Ppa-daf-6 (PPA15978) (FP: CTCGCCCGTGGATCATGTG , RP: TGCAAATCATTGATTGAATCATGG ) was fused with rfp and Venus by fusion PCR ( ; ).

    Purification:

    Article Title: Double Selection Enhances the Efficiency of Target-AID and Cas9-Based Genome Editing in Yeast
    Article Snippet: Amplification reactions were pooled and purified using the EZ-10 Column PCR Products Purification Kit (Biobasic, Markham, Canada). .. The inserts were cloned into pDYSCKO using the Golden Gate Assembly Mix (New England Biolabs, Ipswich, USA) with the following parameters: 1 ul pDYSCKO vector (50 ng/ul), 1 ul insert (∼0.5 ng/ul) using the standard manufacturer assembly reaction conditions, which was incubated for 1 hr at 37° followed by 5 min at 55°.

    Transgenic Assay:

    Article Title: Evolution of neuronal anatomy and circuitry in two highly divergent nematode species
    Article Snippet: Paragraph title: Transgenic reporter strains ... To make a Ppa-odr-3 reporter plasmid, a ~ 1.7 kb long region upstream of the first ATG codon of Ppa-odr-3 (PPA14189) (FP: GAGCGAGTGAAATGAGCTCAGTCC , RP: GGGTGATCGATACGAGGAGTGTTC ) and the coding sequence of TurboRFP fused to the 3’ UTR of the ribosomal gene Ppa-rpl-23 ( ) were cloned into the pUC19 plasmid using Golden Gate Assembly Mix (New England BioLabs, E1600S) following the manufacturer’s instructions.

    Incubation:

    Article Title: Double Selection Enhances the Efficiency of Target-AID and Cas9-Based Genome Editing in Yeast
    Article Snippet: .. The inserts were cloned into pDYSCKO using the Golden Gate Assembly Mix (New England Biolabs, Ipswich, USA) with the following parameters: 1 ul pDYSCKO vector (50 ng/ul), 1 ul insert (∼0.5 ng/ul) using the standard manufacturer assembly reaction conditions, which was incubated for 1 hr at 37° followed by 5 min at 55°. .. The ligated plasmids were transformed in bacteria and positive clones were confirmed by Sanger sequencing (CHUL sequencing platform, Québec, Canada) using the DYSCKO_rev or DYSCKO_For oligonucleotide.

    CRISPR:

    Article Title: Double Selection Enhances the Efficiency of Target-AID and Cas9-Based Genome Editing in Yeast
    Article Snippet: This target in ADE1 was previously used by Nishida et al. ( ) to create LOFs using Target-AID and is also well suited to CRISPR-Cas9 gene disruption. .. The inserts were cloned into pDYSCKO using the Golden Gate Assembly Mix (New England Biolabs, Ipswich, USA) with the following parameters: 1 ul pDYSCKO vector (50 ng/ul), 1 ul insert (∼0.5 ng/ul) using the standard manufacturer assembly reaction conditions, which was incubated for 1 hr at 37° followed by 5 min at 55°.

    Sequencing:

    Article Title: Double Selection Enhances the Efficiency of Target-AID and Cas9-Based Genome Editing in Yeast
    Article Snippet: The inserts were cloned into pDYSCKO using the Golden Gate Assembly Mix (New England Biolabs, Ipswich, USA) with the following parameters: 1 ul pDYSCKO vector (50 ng/ul), 1 ul insert (∼0.5 ng/ul) using the standard manufacturer assembly reaction conditions, which was incubated for 1 hr at 37° followed by 5 min at 55°. .. The ligated plasmids were transformed in bacteria and positive clones were confirmed by Sanger sequencing (CHUL sequencing platform, Québec, Canada) using the DYSCKO_rev or DYSCKO_For oligonucleotide.

    Article Title: Evolution of neuronal anatomy and circuitry in two highly divergent nematode species
    Article Snippet: .. To make a Ppa-odr-3 reporter plasmid, a ~ 1.7 kb long region upstream of the first ATG codon of Ppa-odr-3 (PPA14189) (FP: GAGCGAGTGAAATGAGCTCAGTCC , RP: GGGTGATCGATACGAGGAGTGTTC ) and the coding sequence of TurboRFP fused to the 3’ UTR of the ribosomal gene Ppa-rpl-23 ( ) were cloned into the pUC19 plasmid using Golden Gate Assembly Mix (New England BioLabs, E1600S) following the manufacturer’s instructions. .. To make the Ppa-daf-6 reporter, a 2.4 kb promoter sequence upstream of the start codon Ppa-daf-6 (PPA15978) (FP: CTCGCCCGTGGATCATGTG , RP: TGCAAATCATTGATTGAATCATGG ) was fused with rfp and Venus by fusion PCR ( ; ).

    Transformation Assay:

    Article Title: Double Selection Enhances the Efficiency of Target-AID and Cas9-Based Genome Editing in Yeast
    Article Snippet: The inserts were cloned into pDYSCKO using the Golden Gate Assembly Mix (New England Biolabs, Ipswich, USA) with the following parameters: 1 ul pDYSCKO vector (50 ng/ul), 1 ul insert (∼0.5 ng/ul) using the standard manufacturer assembly reaction conditions, which was incubated for 1 hr at 37° followed by 5 min at 55°. .. The ligated plasmids were transformed in bacteria and positive clones were confirmed by Sanger sequencing (CHUL sequencing platform, Québec, Canada) using the DYSCKO_rev or DYSCKO_For oligonucleotide.

    Plasmid Preparation:

    Article Title: Double Selection Enhances the Efficiency of Target-AID and Cas9-Based Genome Editing in Yeast
    Article Snippet: .. The inserts were cloned into pDYSCKO using the Golden Gate Assembly Mix (New England Biolabs, Ipswich, USA) with the following parameters: 1 ul pDYSCKO vector (50 ng/ul), 1 ul insert (∼0.5 ng/ul) using the standard manufacturer assembly reaction conditions, which was incubated for 1 hr at 37° followed by 5 min at 55°. .. The ligated plasmids were transformed in bacteria and positive clones were confirmed by Sanger sequencing (CHUL sequencing platform, Québec, Canada) using the DYSCKO_rev or DYSCKO_For oligonucleotide.

    Article Title: Oxidative cyclization of prodigiosin by an alkylglycerol monooxygenase-like enzyme
    Article Snippet: Paragraph title: Plasmid construction ... Assembly of DNA fragments ( ) was performed using NEBuilder HiFi DNA Assembly Master Mix or NEB Golden Gate Assembly Mix (NEB) per manufacturer’s directions.

    Article Title: Evolution of neuronal anatomy and circuitry in two highly divergent nematode species
    Article Snippet: .. To make a Ppa-odr-3 reporter plasmid, a ~ 1.7 kb long region upstream of the first ATG codon of Ppa-odr-3 (PPA14189) (FP: GAGCGAGTGAAATGAGCTCAGTCC , RP: GGGTGATCGATACGAGGAGTGTTC ) and the coding sequence of TurboRFP fused to the 3’ UTR of the ribosomal gene Ppa-rpl-23 ( ) were cloned into the pUC19 plasmid using Golden Gate Assembly Mix (New England BioLabs, E1600S) following the manufacturer’s instructions. .. To make the Ppa-daf-6 reporter, a 2.4 kb promoter sequence upstream of the start codon Ppa-daf-6 (PPA15978) (FP: CTCGCCCGTGGATCATGTG , RP: TGCAAATCATTGATTGAATCATGG ) was fused with rfp and Venus by fusion PCR ( ; ).

    Software:

    Article Title: Oxidative cyclization of prodigiosin by an alkylglycerol monooxygenase-like enzyme
    Article Snippet: Plasmid construction DNA assembly protocols were designed using j5 and DeviceEditor software . .. Assembly of DNA fragments ( ) was performed using NEBuilder HiFi DNA Assembly Master Mix or NEB Golden Gate Assembly Mix (NEB) per manufacturer’s directions.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85
    New England Biolabs neb golden gate assembly mix
    Neb Golden Gate Assembly Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 85/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/neb golden gate assembly mix/product/New England Biolabs
    Average 85 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    neb golden gate assembly mix - by Bioz Stars, 2020-01
    85/100 stars
      Buy from Supplier

    Image Search Results