q5  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    NEBNext Ultra II Q5 Master Mix
    Description:
    NEBNext Ultra II Q5 Master Mix 250 rxns
    Catalog Number:
    M0544L
    Price:
    395
    Size:
    250 rxns
    Category:
    Thermostable DNA Polymerases
    Buy from Supplier
    Name:
    Q5 High Fidelity DNA Polymerase
    Description:
    Q5 High Fidelity DNA Polymerase 500 units
    Catalog Number:
    M0491L
    Price:
    432
    Size:
    500 units
    Category:
    Thermostable DNA Polymerases
    Buy from Supplier


    Structured Review

    New England Biolabs q5
    Q5 High Fidelity DNA Polymerase
    Q5 High Fidelity DNA Polymerase 500 units
    https://www.bioz.com/result/q5/product/New England Biolabs
    Average 99 stars, based on 41 article reviews
    Price from $9.99 to $1999.99
    q5 - by Bioz Stars, 2019-07
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Rap2 and TNIK control Plexin-dependent tiled synaptic innervation in C. elegans
    Article Snippet: Paragraph title: Cloning of rap-1, rap-2 and mig-15 ... Phusion (NEB) or Q5 (NEB) DNA polymerases were used for all PCR reactions for amplifying cDNA and genomic DNA fragments.

    Article Title: Structural decoding of netrin-4 reveals a regulatory function towards mature basement membranes
    Article Snippet: To design Net4 containing LNγ1 binding domains we generated chimeric molecules by overlap PCR using the Q5 (New England Biolabs) polymerase. .. To design Net4 containing LNγ1 binding domains we generated chimeric molecules by overlap PCR using the Q5 (New England Biolabs) polymerase.

    Article Title: Long-term hepatitis B infection in a scalable hepatic co-culture system
    Article Snippet: Paragraph title: Cloning, expression, and purification of hTDP2 ... The coding sequence of human TDP2 was PCR amplified from a hTDP2 expression plasmid (NM_016614.2) with Q5 (NEB, Ipswich, MA) and inserted into a pQLinkH (Addgene, plasmid #13667) expression plasmid via restriction digest with Bam HI and Hin dIII and ligated ON at 16 °C.

    Article Title: Three F-actin assembly centers regulate organelle inheritance, cell-cell communication and motility in Toxoplasma gondii
    Article Snippet: Paragraph title: Cloning of DNA constructs ... All amplifications were performed with Q5 (New England Biolabs) polymerase; the primers used are listed in .

    Article Title: Helicobacter pylori modulates host cell responses by CagT4SS-dependent translocation of an intermediate metabolite of LPS inner core heptose biosynthesis
    Article Snippet: PCRs were run in Biometra thermocyclers (Biometra, Goettingen, Germany) using Taq polymerase (GE Healthcare). .. Pfu (Agilent Technologies), FastStart HF (Roche) and Q5 (NEB) DNA polymerases were used for accurate amplification of longer DNA fragments and for cloning. .. Protein separation and detection by denaturing SDS polyacrylamide gel electrophoresis (SDS PAGE) and Western blotting were performed according to standard methods [ ; ].

    Article Title: Self-oligomerization regulates stability of survival motor neuron protein isoforms by sequestering an SCFSlmb degron
    Article Snippet: In short, a ∼3 kb fragment containing the entire Smn coding region was cloned from the Drosophila genome into the pAttB vector ( ). .. Point mutations were introduced into this construct using Q5 (NEB) site-directed mutagenesis according to manufacturer’s instructions.

    Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner
    Article Snippet: The wild-type algR genomic region was amplified using Q5 (NEB) and primers algRXbaIR and algRHindIIIF and cloned into pEX18Tc. .. The primers were phosphorylated and used in site-directed mutagenesis, in accordance with the manufacturer's instructions, using Q5 (NEB).

    Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner
    Article Snippet: Hemagglutinin (HA) tagging of proteins was accomplished using primers containing the HA tag at the 3′ end of the gene and introduced as described above using the suicide vector pEX18Gm. .. The wild-type algR genomic region was amplified using Q5 (NEB) and primers algRXbaIR and algRHindIIIF and cloned into pEX18Tc. .. Site-directed mutagenesis was performed using the algRD54XbaIF/algRD54NR primers for the D54N allele or the algRD54EF/algRD54ER primer pair for the D54E mutation.

    Centrifugation:

    Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner
    Article Snippet: The algR gene was PCR amplified using Q5 (NEB) and PAO1 chromosomal DNA using oligonucleotides algRSal1F and algRNot1R ( ). .. The colonies from this transformation were collected, inoculated into LB supplemented with 100 μg/ml ampicillin, and grown to an optical density at 600 nm (OD600 ) of 0.6; 0.2 mM isopropyl-β- d -galactopyranoside (IPTG) was added to induce AlgR expression for 4 h at 15°C.

    Amplification:

    Article Title: Rap2 and TNIK control Plexin-dependent tiled synaptic innervation in C. elegans
    Article Snippet: Trizol (Invitrogen) was used to purify total RNA from N2, and the SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen) was used for the reverse-transcription. mig-15 genomic DNA was amplified from the N2 genomic DNA purified using GeneJET Genomic DNA Purification Kit (Thermo Scientific). .. Phusion (NEB) or Q5 (NEB) DNA polymerases were used for all PCR reactions for amplifying cDNA and genomic DNA fragments.

    Article Title: Ubiquitin A-52 residue ribosomal protein fusion product 1 (Uba52) is essential for preimplantation embryo development
    Article Snippet: A T7 promoter sequence was added upstream of the guide for in vitro transcription. .. Each gBlock was diluted to final concentration 0.1 ng/μl and PCR amplified with a gBlock F primer (ACTGGCACCTATGCGGGACGAC) and a gBlock R primer (AAAAGCACCGACTCGGTGCCAC) with Q5 (New England Biolabs, Ipswich, MA) following standard protocol. .. PCR conditions consisted of an initial denaturation of 98°C for 1 min followed by 35 cycles of 98°C (10 s), 68°C (30 s) and 72°C (30 s).

    Article Title: Structural decoding of netrin-4 reveals a regulatory function towards mature basement membranes
    Article Snippet: To design Net4 containing LNγ1 binding domains we generated chimeric molecules by overlap PCR using the Q5 (New England Biolabs) polymerase. .. To design Net4 containing LNγ1 binding domains we generated chimeric molecules by overlap PCR using the Q5 (New England Biolabs) polymerase.

    Article Title: A comprehensive benchmarking study of protocols and sequencing platforms for 16S rRNA community profiling
    Article Snippet: The amplicon libraries were cleaned to remove excess nucleotides, salts and enzymes using 20 μ l of the Agencourt AMPure XP system (Beckman Coulter Genomics) and eluted in 10 μ l of TE buffer. .. The 10 μ l of the first step reaction was submitted to a second amplification step using the following conditions: 0.1 μ M forward barcoded primer for the dual index strategy or a forward not barcoded primer for the single index strategy; 0.1 μ M primer barcoded reverse primer; 1x HiFi (Kapa) or Q5 (NEB) polymerase ready mix. .. The PCR for each variable region was carried out in triplicate in a 25 μ l reaction in the above-mentioned thermal cycler with the following parameters: initial denaturation at 94 °C for 5 min, followed by 15 cycles of 98 °C for 20 s, 60 °C for 15 s, and 72 °C for 40 s with a final extension at 72 °C for 1 min.

    Article Title: Long-term hepatitis B infection in a scalable hepatic co-culture system
    Article Snippet: After incubation, the cells were washed five times with 1× PBS and then had 300 μl of sterile 1× PBS added and the cells were stored at 4 °C until imaging. .. The coding sequence of human TDP2 was PCR amplified from a hTDP2 expression plasmid (NM_016614.2) with Q5 (NEB, Ipswich, MA) and inserted into a pQLinkH (Addgene, plasmid #13667) expression plasmid via restriction digest with Bam HI and Hin dIII and ligated ON at 16 °C. .. The sequence of the N -terminally 7x His-tagged TDP2 was confirmed by DNA sequencing.

    Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching
    Article Snippet: To add the glutamine tag the pHSso PoxTyr plasmid was digested with NheI and SacI. .. The Sso Pox gene was amplified with Q5 (NEB, Ipswich, MA, USA) using the same forward primer as used previously and a new reverse primer, Sso PoxR-Gln was used to add the glutamine tag. .. This PCR product was digested and ligated into the previously digested backbone.

    Article Title: Three F-actin assembly centers regulate organelle inheritance, cell-cell communication and motility in Toxoplasma gondii
    Article Snippet: All amplifications were performed with Q5 (New England Biolabs) polymerase; the primers used are listed in . .. All cloning were performed using E. coli XL-1 Gold chemo-competent bacteria.

    Article Title: Helicobacter pylori modulates host cell responses by CagT4SS-dependent translocation of an intermediate metabolite of LPS inner core heptose biosynthesis
    Article Snippet: PCRs were run in Biometra thermocyclers (Biometra, Goettingen, Germany) using Taq polymerase (GE Healthcare). .. Pfu (Agilent Technologies), FastStart HF (Roche) and Q5 (NEB) DNA polymerases were used for accurate amplification of longer DNA fragments and for cloning. .. Protein separation and detection by denaturing SDS polyacrylamide gel electrophoresis (SDS PAGE) and Western blotting were performed according to standard methods [ ; ].

    Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner
    Article Snippet: The wild-type algR genomic region was amplified using Q5 (NEB) and primers algRXbaIR and algRHindIIIF and cloned into pEX18Tc. .. The primers were phosphorylated and used in site-directed mutagenesis, in accordance with the manufacturer's instructions, using Q5 (NEB).

    Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner
    Article Snippet: Hemagglutinin (HA) tagging of proteins was accomplished using primers containing the HA tag at the 3′ end of the gene and introduced as described above using the suicide vector pEX18Gm. .. The wild-type algR genomic region was amplified using Q5 (NEB) and primers algRXbaIR and algRHindIIIF and cloned into pEX18Tc. .. Site-directed mutagenesis was performed using the algRD54XbaIF/algRD54NR primers for the D54N allele or the algRD54EF/algRD54ER primer pair for the D54E mutation.

    Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner
    Article Snippet: The translational/leader fusion backbone CTXCPlacUV5 had no background activity. .. The algR gene was PCR amplified using Q5 (NEB) and PAO1 chromosomal DNA using oligonucleotides algRSal1F and algRNot1R ( ). .. A 754-bp SalI/NotI fragment was cloned into pGEX-4T-3 (Novagen) to be expressed as a glutathione S -transferase–AlgR (GST-AlgR) fusion protein.

    Article Title: CRISPR–Cas ribonucleoprotein mediated homology-directed repair for efficient targeted genome editing in microalgae Nannochloropsis oceanica IMET1
    Article Snippet: The 10X Cas buffer is composed of 1 M Nacl, 500 mM Tris–HCl, 100 mM MgCl2 and 1 mg/mL BSA at pH 7.9. .. After 15 min incubation, 100 ng of the template DNA was added into the reaction mixture and incubated again for 1 h. The target DNA was amplified from the host genomic DNA with Q5 (NEB) PCR by using primers NR Fw: 5′-GTGGTGCGTAGTCGGAATGG-3′ and NR Rv: 5′-GTCGGCCAATCCAGTTCGTGTC-3′. .. The template DNA was 1207 bp long and the digestion with Cas9 could result in fragments of size 183 and 1022 bp with sp1 and 200 and 1005 bp with sp2.

    Article Title: Analysis of error profiles in deep next-generation sequencing data
    Article Snippet: Paragraph title: Amplicon sequencing of diluted COLO829 cell line ... PCR was performed with the KAPA HiFi HotStart ReadyMix PCR Kit and NEBNext Q5 Hot Start HiFi PCR Master Mix, 10 μM of each primer, 50 ng of COLO829BL, COLO829, two replicates of 0.1% mixture, and two replicates of 0.02% mixture DNA for each target by using the following PCR conditions: 95 °C for 5 min, 26 cycles of 98 °C for 20 s, 63 °C for 15 s, 72 °C for 15 s, and 72 °C for 1 min before storage at 4 °C (Kapa HiFi HotStart); 98 °C for 30 s, 26 cycles of 98 °C for 10 s, 65 °C for 15 s, 72 °C for 20 s, and 72 °C for 2 min before storage at 4 °C (NEBNext Q5).

    Synthesized:

    Article Title: Ubiquitin A-52 residue ribosomal protein fusion product 1 (Uba52) is essential for preimplantation embryo development
    Article Snippet: Template guide DNA was first synthesized by Integrated DNA Technologies in the form of a gBlock. .. Each gBlock was diluted to final concentration 0.1 ng/μl and PCR amplified with a gBlock F primer (ACTGGCACCTATGCGGGACGAC) and a gBlock R primer (AAAAGCACCGACTCGGTGCCAC) with Q5 (New England Biolabs, Ipswich, MA) following standard protocol.

    Construct:

    Article Title: Structural decoding of netrin-4 reveals a regulatory function towards mature basement membranes
    Article Snippet: Paragraph title: Design of chimeric constructs and site-directed mutagenesis ... To design Net4 containing LNγ1 binding domains we generated chimeric molecules by overlap PCR using the Q5 (New England Biolabs) polymerase.

    Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching
    Article Snippet: To construct the tyrosine-tagged Sso Pox, the gBlock was amplified using F-Sso Pox and Sso PoxR-Tyr. .. The Sso Pox gene was amplified with Q5 (NEB, Ipswich, MA, USA) using the same forward primer as used previously and a new reverse primer, Sso PoxR-Gln was used to add the glutamine tag.

    Article Title: Three F-actin assembly centers regulate organelle inheritance, cell-cell communication and motility in Toxoplasma gondii
    Article Snippet: Paragraph title: Cloning of DNA constructs ... All amplifications were performed with Q5 (New England Biolabs) polymerase; the primers used are listed in .

    Article Title: Self-oligomerization regulates stability of survival motor neuron protein isoforms by sequestering an SCFSlmb degron
    Article Snippet: A 3X FLAG tag was inserted immediately downstream of the start codon of dSMN. .. Point mutations were introduced into this construct using Q5 (NEB) site-directed mutagenesis according to manufacturer’s instructions. .. The basal Smn construct used, vSmn, contained three single-amino-acid changes, and the addition of the MGLR motif to make fruit fly Smn more similar to the evolutionarily conserved vertebrate Smn.

    Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner
    Article Snippet: The algZ mutant was constructed using the algZHSDMF/algZHSDMR primers. .. The primers were phosphorylated and used in site-directed mutagenesis, in accordance with the manufacturer's instructions, using Q5 (NEB).

    Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner
    Article Snippet: The wild-type algR genomic region was amplified using Q5 (NEB) and primers algRXbaIR and algRHindIIIF and cloned into pEX18Tc. .. Site-directed mutagenesis was performed using the algRD54XbaIF/algRD54NR primers for the D54N allele or the algRD54EF/algRD54ER primer pair for the D54E mutation.

    Article Title: Selective modulation of local linkages between active transcription and oxidative demethylation activity shapes cardiomyocyte-specific gene-body epigenetic status in mice
    Article Snippet: Biotinylated DNA was then purified, captured with streptavidin beads, washed and eluted. .. The eluted DNA was then purified and employed to construct a DNA library using the ChIP-seq Library Prep Master Mix Set with Q5 (NEB). .. Library quality was determined using a BioAnalyzer2000, and quantification was performed via qPCR using KAPA Library Quantification Kits (Illumina) followed by Illumina sequencing using the MiSeq and Hiseq2500 platforms; the sequences and processed data are available from the NCBI GEO repository (Accession no.: [GEO: GSE87165]).

    Article Title: LARP7-like protein Pof8 regulates telomerase assembly and poly(A)+TERRA expression in fission yeast
    Article Snippet: Original sources of published strains and details on strain construction for newly generated strains are indicated in Supplementary Table . .. Various point mutation and truncation constructs were generated by Q5 (NEB, E0554) or QuikChange Lightning (Agilent, 210513) site-directed mutagenesis. .. Genomic DNA was prepared by resuspending cell pellets in equal volumes of DNA buffer (100 mM Tris pH 8.0, 1 mM EDTA pH 8.0, 100 mM NaCl, 1% SDS) and Phenol:chloroform:isoamyl alcohol (25:24:1) saturated wit h 10 mM Tris, pH 8.0 and 1 mM EDTA, and cells were lysed with glass beads.

    cDNA Library Assay:

    Article Title: Rap2 and TNIK control Plexin-dependent tiled synaptic innervation in C. elegans
    Article Snippet: cDNAs of rap-1 and rap-2 were obtained from cDNA library prepared from N2 RNA. .. Phusion (NEB) or Q5 (NEB) DNA polymerases were used for all PCR reactions for amplifying cDNA and genomic DNA fragments.

    Incubation:

    Article Title: Long-term hepatitis B infection in a scalable hepatic co-culture system
    Article Snippet: The coding sequence of human TDP2 was PCR amplified from a hTDP2 expression plasmid (NM_016614.2) with Q5 (NEB, Ipswich, MA) and inserted into a pQLinkH (Addgene, plasmid #13667) expression plasmid via restriction digest with Bam HI and Hin dIII and ligated ON at 16 °C. .. The coding sequence of human TDP2 was PCR amplified from a hTDP2 expression plasmid (NM_016614.2) with Q5 (NEB, Ipswich, MA) and inserted into a pQLinkH (Addgene, plasmid #13667) expression plasmid via restriction digest with Bam HI and Hin dIII and ligated ON at 16 °C.

    Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner
    Article Snippet: The algR gene was PCR amplified using Q5 (NEB) and PAO1 chromosomal DNA using oligonucleotides algRSal1F and algRNot1R ( ). .. A 754-bp SalI/NotI fragment was cloned into pGEX-4T-3 (Novagen) to be expressed as a glutathione S -transferase–AlgR (GST-AlgR) fusion protein.

    Article Title: CRISPR–Cas ribonucleoprotein mediated homology-directed repair for efficient targeted genome editing in microalgae Nannochloropsis oceanica IMET1
    Article Snippet: The 10X Cas buffer is composed of 1 M Nacl, 500 mM Tris–HCl, 100 mM MgCl2 and 1 mg/mL BSA at pH 7.9. .. After 15 min incubation, 100 ng of the template DNA was added into the reaction mixture and incubated again for 1 h. The target DNA was amplified from the host genomic DNA with Q5 (NEB) PCR by using primers NR Fw: 5′-GTGGTGCGTAGTCGGAATGG-3′ and NR Rv: 5′-GTCGGCCAATCCAGTTCGTGTC-3′. .. The template DNA was 1207 bp long and the digestion with Cas9 could result in fragments of size 183 and 1022 bp with sp1 and 200 and 1005 bp with sp2.

    Article Title: Selective modulation of local linkages between active transcription and oxidative demethylation activity shapes cardiomyocyte-specific gene-body epigenetic status in mice
    Article Snippet: Fragmented DNA and UDP-azide-glucose were incubated overnight with T4 BGT (NEB) at 37 °C followed by biotin conjugation. .. The eluted DNA was then purified and employed to construct a DNA library using the ChIP-seq Library Prep Master Mix Set with Q5 (NEB).

    Gel Extraction:

    Article Title: Helicobacter pylori modulates host cell responses by CagT4SS-dependent translocation of an intermediate metabolite of LPS inner core heptose biosynthesis
    Article Snippet: Isolation of highly pure genomic DNA, purification of plasmid DNA and gel extraction of DNA from enzymatic reactions were accomplished by QIAGEN DNA purification columns (QIAGEN, Hilden, Germany). .. Pfu (Agilent Technologies), FastStart HF (Roche) and Q5 (NEB) DNA polymerases were used for accurate amplification of longer DNA fragments and for cloning.

    Activity Assay:

    Article Title: CRISPR–Cas ribonucleoprotein mediated homology-directed repair for efficient targeted genome editing in microalgae Nannochloropsis oceanica IMET1
    Article Snippet: After 15 min incubation, 100 ng of the template DNA was added into the reaction mixture and incubated again for 1 h. The target DNA was amplified from the host genomic DNA with Q5 (NEB) PCR by using primers NR Fw: 5′-GTGGTGCGTAGTCGGAATGG-3′ and NR Rv: 5′-GTCGGCCAATCCAGTTCGTGTC-3′. .. After 15 min incubation, 100 ng of the template DNA was added into the reaction mixture and incubated again for 1 h. The target DNA was amplified from the host genomic DNA with Q5 (NEB) PCR by using primers NR Fw: 5′-GTGGTGCGTAGTCGGAATGG-3′ and NR Rv: 5′-GTCGGCCAATCCAGTTCGTGTC-3′.

    Expressing:

    Article Title: Long-term hepatitis B infection in a scalable hepatic co-culture system
    Article Snippet: After incubation, the cells were washed five times with 1× PBS and then had 300 μl of sterile 1× PBS added and the cells were stored at 4 °C until imaging. .. The coding sequence of human TDP2 was PCR amplified from a hTDP2 expression plasmid (NM_016614.2) with Q5 (NEB, Ipswich, MA) and inserted into a pQLinkH (Addgene, plasmid #13667) expression plasmid via restriction digest with Bam HI and Hin dIII and ligated ON at 16 °C. .. The sequence of the N -terminally 7x His-tagged TDP2 was confirmed by DNA sequencing.

    Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching
    Article Snippet: Paragraph title: 4.1. SsoPox Expression Plasmids ... The Sso Pox gene was amplified with Q5 (NEB, Ipswich, MA, USA) using the same forward primer as used previously and a new reverse primer, Sso PoxR-Gln was used to add the glutamine tag.

    Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner
    Article Snippet: The algR gene was PCR amplified using Q5 (NEB) and PAO1 chromosomal DNA using oligonucleotides algRSal1F and algRNot1R ( ). .. The resulting plasmid (pGEX-4TAlgR) was transformed into E. coli BL21(DE3) (NEB) cells and incubated overnight.

    Article Title: LARP7-like protein Pof8 regulates telomerase assembly and poly(A)+TERRA expression in fission yeast
    Article Snippet: For most experiments, cells are grown in YES (Yeast Extract with Supplements) media at 32 o C, while they are grown in PMG (Pombe Minimal Glutamate) with appropriate supplements to allow for selection of either LEU2 or ura4 + plasmid at 32 o C for experiments involving TER1 expression plasmids . .. Various point mutation and truncation constructs were generated by Q5 (NEB, E0554) or QuikChange Lightning (Agilent, 210513) site-directed mutagenesis.

    BIA-KA:

    Article Title: Helicobacter pylori modulates host cell responses by CagT4SS-dependent translocation of an intermediate metabolite of LPS inner core heptose biosynthesis
    Article Snippet: Pfu (Agilent Technologies), FastStart HF (Roche) and Q5 (NEB) DNA polymerases were used for accurate amplification of longer DNA fragments and for cloning. .. Protein separation and detection by denaturing SDS polyacrylamide gel electrophoresis (SDS PAGE) and Western blotting were performed according to standard methods [ ; ].

    Modification:

    Article Title: Helicobacter pylori modulates host cell responses by CagT4SS-dependent translocation of an intermediate metabolite of LPS inner core heptose biosynthesis
    Article Snippet: DNA modification and restriction enzymes were purchased from Invitrogen (Life Technologies, Germany), New England Biolabs (NEB) or Roche. .. Pfu (Agilent Technologies), FastStart HF (Roche) and Q5 (NEB) DNA polymerases were used for accurate amplification of longer DNA fragments and for cloning.

    Transformation Assay:

    Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching
    Article Snippet: The Sso Pox gene was amplified with Q5 (NEB, Ipswich, MA, USA) using the same forward primer as used previously and a new reverse primer, Sso PoxR-Gln was used to add the glutamine tag. .. The Sso Pox gene was amplified with Q5 (NEB, Ipswich, MA, USA) using the same forward primer as used previously and a new reverse primer, Sso PoxR-Gln was used to add the glutamine tag.

    Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner
    Article Snippet: The algR gene was PCR amplified using Q5 (NEB) and PAO1 chromosomal DNA using oligonucleotides algRSal1F and algRNot1R ( ). .. The algR gene was PCR amplified using Q5 (NEB) and PAO1 chromosomal DNA using oligonucleotides algRSal1F and algRNot1R ( ).

    Electron Microscopy:

    Article Title: A comprehensive benchmarking study of protocols and sequencing platforms for 16S rRNA community profiling
    Article Snippet: 1−10 ng of EM or UM community DNA was used in the first amplification step using the following conditions: 0.1 μ M forward tailed target specific primer; 0.1 μ M reverse tailed target specific primer; and 1x HiFi or Q5 polymerase ready mix. .. The 10 μ l of the first step reaction was submitted to a second amplification step using the following conditions: 0.1 μ M forward barcoded primer for the dual index strategy or a forward not barcoded primer for the single index strategy; 0.1 μ M primer barcoded reverse primer; 1x HiFi (Kapa) or Q5 (NEB) polymerase ready mix.

    Flow Cytometry:

    Article Title: Coupling bimolecular PARylation biosensors with genetic screens to identify PARylation targets
    Article Snippet: Finally they were re-suspended in 25 μl water and 5 μl were used in a 50 μl Q5 (NEB) PCR reaction with 0.2 μM SPL1 and 0.2 μM HmSp1 primers—98 °C/30”, 20 × (98 °C/20”, 70 °C/20”, 72 °C/1’), 72 °C/2’. .. PCR products were obtained only from Tol2-containing gDNA.

    Article Title: Analysis of error profiles in deep next-generation sequencing data
    Article Snippet: PCR was performed with the KAPA HiFi HotStart ReadyMix PCR Kit and NEBNext Q5 Hot Start HiFi PCR Master Mix, 10 μM of each primer, 50 ng of COLO829BL, COLO829, two replicates of 0.1% mixture, and two replicates of 0.02% mixture DNA for each target by using the following PCR conditions: 95 °C for 5 min, 26 cycles of 98 °C for 20 s, 63 °C for 15 s, 72 °C for 15 s, and 72 °C for 1 min before storage at 4 °C (Kapa HiFi HotStart); 98 °C for 30 s, 26 cycles of 98 °C for 10 s, 65 °C for 15 s, 72 °C for 20 s, and 72 °C for 2 min before storage at 4 °C (NEBNext Q5). .. A total of 100 ng of each pooled amplicon was end-repaired, adapter-ligated, and enriched via 8 cycles of PCR by using either KAPA HiFi HotStart ReadyMix PCR Kit or NEBNext Q5 Hot Start HiFi PCR Master Mix.

    Ligation:

    Article Title: Coupling bimolecular PARylation biosensors with genetic screens to identify PARylation targets
    Article Snippet: Biotinylated products were collected on streptavidin beads (Life Technologies 11205D), washed, and re-suspended in a ligation mastermix, containing 25% w/v PEG8000 (Sigma 89510-250G-F), 1 μM ssAdapter, 1 mM Co(NH2 )6 Cl3 (Sigma H7891-5G), 1 × T4 ligation buffer and 20 U T4 ligase (NEB), for 16 h at 25 °C and 300 rpm shaking. .. Finally they were re-suspended in 25 μl water and 5 μl were used in a 50 μl Q5 (NEB) PCR reaction with 0.2 μM SPL1 and 0.2 μM HmSp1 primers—98 °C/30”, 20 × (98 °C/20”, 70 °C/20”, 72 °C/1’), 72 °C/2’.

    Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching
    Article Snippet: The purified PCR product was digested with SacI and NheI for sticky-end ligation into the pET200 (Invitrogen, Waltham, MA, USA) backbone to create pHSso PoxTyr. .. The Sso Pox gene was amplified with Q5 (NEB, Ipswich, MA, USA) using the same forward primer as used previously and a new reverse primer, Sso PoxR-Gln was used to add the glutamine tag.

    Cell Culture:

    Article Title: Self-oligomerization regulates stability of survival motor neuron protein isoforms by sequestering an SCFSlmb degron
    Article Snippet: All stocks were cultured on molasses and agar at room temperature (24 ± 1°C) in half-pint bottles. .. Point mutations were introduced into this construct using Q5 (NEB) site-directed mutagenesis according to manufacturer’s instructions.

    Article Title: LARP7-like protein Pof8 regulates telomerase assembly and poly(A)+TERRA expression in fission yeast
    Article Snippet: Fission yeast strains used in this study were constructed and cultured using standard methods . .. Various point mutation and truncation constructs were generated by Q5 (NEB, E0554) or QuikChange Lightning (Agilent, 210513) site-directed mutagenesis.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Rap2 and TNIK control Plexin-dependent tiled synaptic innervation in C. elegans
    Article Snippet: Trizol (Invitrogen) was used to purify total RNA from N2, and the SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen) was used for the reverse-transcription. mig-15 genomic DNA was amplified from the N2 genomic DNA purified using GeneJET Genomic DNA Purification Kit (Thermo Scientific). .. Phusion (NEB) or Q5 (NEB) DNA polymerases were used for all PCR reactions for amplifying cDNA and genomic DNA fragments.

    Generated:

    Article Title: Twin-primer non-enzymatic DNA assembly: an efficient and accurate multi-part DNA assembly method
    Article Snippet: For each DNA fragment to be assembled, two PCR products were generated: one with primers LF and SR, the other with primers SF and LR. .. PCR reactions were performed using either KOD Xtreme Hotstart (Merck, Darmstadt, Germany) or Q5 (NEB, Ipswich, MA, USA) DNA polymerase according to the respective manufacturer's recommended protocol.

    Article Title: Structural decoding of netrin-4 reveals a regulatory function towards mature basement membranes
    Article Snippet: Protein concentrations were measured using extinction coefficient and molecular weight values derived from the ProtParam utility available on the ExPaSy server . .. To design Net4 containing LNγ1 binding domains we generated chimeric molecules by overlap PCR using the Q5 (New England Biolabs) polymerase. .. The domains from Net4 (Net4: NP_067295) were replaced by the corresponding laminin γ1 sequences (laminin γ1: NP_034813).

    Article Title: Three F-actin assembly centers regulate organelle inheritance, cell-cell communication and motility in Toxoplasma gondii
    Article Snippet: All amplifications were performed with Q5 (New England Biolabs) polymerase; the primers used are listed in . .. Vectors were digested with restriction enzymes ApaI /SbfI and ApaI /NsiI, respectively, and cloned into ASP5-3Ty-DHFR ( ) digested with KpnI or MfeI and NsiI .

    Article Title: Self-oligomerization regulates stability of survival motor neuron protein isoforms by sequestering an SCFSlmb degron
    Article Snippet: Point mutations were introduced into this construct using Q5 (NEB) site-directed mutagenesis according to manufacturer’s instructions. .. The basal Smn construct used, vSmn, contained three single-amino-acid changes, and the addition of the MGLR motif to make fruit fly Smn more similar to the evolutionarily conserved vertebrate Smn.

    Article Title: Analysis of error profiles in deep next-generation sequencing data
    Article Snippet: COLO829BL and COLO829 DNA was extracted by using the DNeasy Blood & Tissue Kit (Qiagen), and the mixture DNA samples were generated by spiking-in 0.1% and 0.02% of COLO829 into COLO829BL. .. PCR was performed with the KAPA HiFi HotStart ReadyMix PCR Kit and NEBNext Q5 Hot Start HiFi PCR Master Mix, 10 μM of each primer, 50 ng of COLO829BL, COLO829, two replicates of 0.1% mixture, and two replicates of 0.02% mixture DNA for each target by using the following PCR conditions: 95 °C for 5 min, 26 cycles of 98 °C for 20 s, 63 °C for 15 s, 72 °C for 15 s, and 72 °C for 1 min before storage at 4 °C (Kapa HiFi HotStart); 98 °C for 30 s, 26 cycles of 98 °C for 10 s, 65 °C for 15 s, 72 °C for 20 s, and 72 °C for 2 min before storage at 4 °C (NEBNext Q5).

    Article Title: Selective modulation of local linkages between active transcription and oxidative demethylation activity shapes cardiomyocyte-specific gene-body epigenetic status in mice
    Article Snippet: The eluted DNA was then purified and employed to construct a DNA library using the ChIP-seq Library Prep Master Mix Set with Q5 (NEB). .. The eluted DNA was then purified and employed to construct a DNA library using the ChIP-seq Library Prep Master Mix Set with Q5 (NEB).

    Article Title: LARP7-like protein Pof8 regulates telomerase assembly and poly(A)+TERRA expression in fission yeast
    Article Snippet: Original sources of published strains and details on strain construction for newly generated strains are indicated in Supplementary Table . .. Various point mutation and truncation constructs were generated by Q5 (NEB, E0554) or QuikChange Lightning (Agilent, 210513) site-directed mutagenesis. .. Genomic DNA was prepared by resuspending cell pellets in equal volumes of DNA buffer (100 mM Tris pH 8.0, 1 mM EDTA pH 8.0, 100 mM NaCl, 1% SDS) and Phenol:chloroform:isoamyl alcohol (25:24:1) saturated wit h 10 mM Tris, pH 8.0 and 1 mM EDTA, and cells were lysed with glass beads.

    Protein Concentration:

    Article Title: Helicobacter pylori modulates host cell responses by CagT4SS-dependent translocation of an intermediate metabolite of LPS inner core heptose biosynthesis
    Article Snippet: Pfu (Agilent Technologies), FastStart HF (Roche) and Q5 (NEB) DNA polymerases were used for accurate amplification of longer DNA fragments and for cloning. .. Protein separation and detection by denaturing SDS polyacrylamide gel electrophoresis (SDS PAGE) and Western blotting were performed according to standard methods [ ; ].

    Sequencing:

    Article Title: Ubiquitin A-52 residue ribosomal protein fusion product 1 (Uba52) is essential for preimplantation embryo development
    Article Snippet: A T7 promoter sequence was added upstream of the guide for in vitro transcription. .. Each gBlock was diluted to final concentration 0.1 ng/μl and PCR amplified with a gBlock F primer (ACTGGCACCTATGCGGGACGAC) and a gBlock R primer (AAAAGCACCGACTCGGTGCCAC) with Q5 (New England Biolabs, Ipswich, MA) following standard protocol.

    Article Title: Structural decoding of netrin-4 reveals a regulatory function towards mature basement membranes
    Article Snippet: To design Net4 containing LNγ1 binding domains we generated chimeric molecules by overlap PCR using the Q5 (New England Biolabs) polymerase. .. To design Net4 containing LNγ1 binding domains we generated chimeric molecules by overlap PCR using the Q5 (New England Biolabs) polymerase.

    Article Title: Long-term hepatitis B infection in a scalable hepatic co-culture system
    Article Snippet: After incubation, the cells were washed five times with 1× PBS and then had 300 μl of sterile 1× PBS added and the cells were stored at 4 °C until imaging. .. The coding sequence of human TDP2 was PCR amplified from a hTDP2 expression plasmid (NM_016614.2) with Q5 (NEB, Ipswich, MA) and inserted into a pQLinkH (Addgene, plasmid #13667) expression plasmid via restriction digest with Bam HI and Hin dIII and ligated ON at 16 °C. .. The sequence of the N -terminally 7x His-tagged TDP2 was confirmed by DNA sequencing.

    Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching
    Article Snippet: The primer sequences and the gBlock sequence are found in . .. The Sso Pox gene was amplified with Q5 (NEB, Ipswich, MA, USA) using the same forward primer as used previously and a new reverse primer, Sso PoxR-Gln was used to add the glutamine tag.

    Article Title: Helicobacter pylori modulates host cell responses by CagT4SS-dependent translocation of an intermediate metabolite of LPS inner core heptose biosynthesis
    Article Snippet: Plasmids and oligonucleotide primers for cloning, sequencing and site-directed mutagenesis are depicted in and Tables, respectively. .. Pfu (Agilent Technologies), FastStart HF (Roche) and Q5 (NEB) DNA polymerases were used for accurate amplification of longer DNA fragments and for cloning.

    Article Title: Prophage-Driven Genomic Structural Changes Promote Bartonella Vertical Evolution
    Article Snippet: Then, primers were designed to validate each of the events ( , online), using conventional PCR (Synthezza, Jerusalem, ISR) or Q5 (New England BioLabs, Massachusetts, USA) long PCR reactions. .. PCR products were visualized in TAE (0.4–1%) agarose gels stained with ethidium bromide.

    Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner
    Article Snippet: The wild-type algR genomic region was amplified using Q5 (NEB) and primers algRXbaIR and algRHindIIIF and cloned into pEX18Tc. .. The primers were phosphorylated and used in site-directed mutagenesis, in accordance with the manufacturer's instructions, using Q5 (NEB).

    Article Title: Analysis of error profiles in deep next-generation sequencing data
    Article Snippet: Paragraph title: Amplicon sequencing of diluted COLO829 cell line ... PCR was performed with the KAPA HiFi HotStart ReadyMix PCR Kit and NEBNext Q5 Hot Start HiFi PCR Master Mix, 10 μM of each primer, 50 ng of COLO829BL, COLO829, two replicates of 0.1% mixture, and two replicates of 0.02% mixture DNA for each target by using the following PCR conditions: 95 °C for 5 min, 26 cycles of 98 °C for 20 s, 63 °C for 15 s, 72 °C for 15 s, and 72 °C for 1 min before storage at 4 °C (Kapa HiFi HotStart); 98 °C for 30 s, 26 cycles of 98 °C for 10 s, 65 °C for 15 s, 72 °C for 20 s, and 72 °C for 2 min before storage at 4 °C (NEBNext Q5).

    Article Title: Selective modulation of local linkages between active transcription and oxidative demethylation activity shapes cardiomyocyte-specific gene-body epigenetic status in mice
    Article Snippet: For the sequencing analysis of pull-down DNA (BGT-seq or hMe_Seal) [ ], genomic DNA was fragmented to a length of approximately 300 bp using the Covaris system. .. The eluted DNA was then purified and employed to construct a DNA library using the ChIP-seq Library Prep Master Mix Set with Q5 (NEB).

    Injection:

    Article Title: Self-oligomerization regulates stability of survival motor neuron protein isoforms by sequestering an SCFSlmb degron
    Article Snippet: The Smn transgenic constructs were injected into embryos by BestGene (Chino Hills, CA) as described in . .. Point mutations were introduced into this construct using Q5 (NEB) site-directed mutagenesis according to manufacturer’s instructions.

    Binding Assay:

    Article Title: Structural decoding of netrin-4 reveals a regulatory function towards mature basement membranes
    Article Snippet: Protein concentrations were measured using extinction coefficient and molecular weight values derived from the ProtParam utility available on the ExPaSy server . .. To design Net4 containing LNγ1 binding domains we generated chimeric molecules by overlap PCR using the Q5 (New England Biolabs) polymerase. .. The domains from Net4 (Net4: NP_067295) were replaced by the corresponding laminin γ1 sequences (laminin γ1: NP_034813).

    Article Title: Long-term hepatitis B infection in a scalable hepatic co-culture system
    Article Snippet: The coding sequence of human TDP2 was PCR amplified from a hTDP2 expression plasmid (NM_016614.2) with Q5 (NEB, Ipswich, MA) and inserted into a pQLinkH (Addgene, plasmid #13667) expression plasmid via restriction digest with Bam HI and Hin dIII and ligated ON at 16 °C. .. The coding sequence of human TDP2 was PCR amplified from a hTDP2 expression plasmid (NM_016614.2) with Q5 (NEB, Ipswich, MA) and inserted into a pQLinkH (Addgene, plasmid #13667) expression plasmid via restriction digest with Bam HI and Hin dIII and ligated ON at 16 °C.

    ChIP-sequencing:

    Article Title: Selective modulation of local linkages between active transcription and oxidative demethylation activity shapes cardiomyocyte-specific gene-body epigenetic status in mice
    Article Snippet: Biotinylated DNA was then purified, captured with streptavidin beads, washed and eluted. .. The eluted DNA was then purified and employed to construct a DNA library using the ChIP-seq Library Prep Master Mix Set with Q5 (NEB). .. Library quality was determined using a BioAnalyzer2000, and quantification was performed via qPCR using KAPA Library Quantification Kits (Illumina) followed by Illumina sequencing using the MiSeq and Hiseq2500 platforms; the sequences and processed data are available from the NCBI GEO repository (Accession no.: [GEO: GSE87165]).

    Cleavage Assay:

    Article Title: CRISPR–Cas ribonucleoprotein mediated homology-directed repair for efficient targeted genome editing in microalgae Nannochloropsis oceanica IMET1
    Article Snippet: After 15 min incubation, 100 ng of the template DNA was added into the reaction mixture and incubated again for 1 h. The target DNA was amplified from the host genomic DNA with Q5 (NEB) PCR by using primers NR Fw: 5′-GTGGTGCGTAGTCGGAATGG-3′ and NR Rv: 5′-GTCGGCCAATCCAGTTCGTGTC-3′. .. The activity of the RNP complex for cleaving the target DNA was assayed at 37 °C and 25 °C to assess the activity of RNP at the optimum temperature of Cas protein and temperature for in vivo experiment, respectively.

    In Vivo:

    Article Title: CRISPR–Cas ribonucleoprotein mediated homology-directed repair for efficient targeted genome editing in microalgae Nannochloropsis oceanica IMET1
    Article Snippet: After 15 min incubation, 100 ng of the template DNA was added into the reaction mixture and incubated again for 1 h. The target DNA was amplified from the host genomic DNA with Q5 (NEB) PCR by using primers NR Fw: 5′-GTGGTGCGTAGTCGGAATGG-3′ and NR Rv: 5′-GTCGGCCAATCCAGTTCGTGTC-3′. .. After 15 min incubation, 100 ng of the template DNA was added into the reaction mixture and incubated again for 1 h. The target DNA was amplified from the host genomic DNA with Q5 (NEB) PCR by using primers NR Fw: 5′-GTGGTGCGTAGTCGGAATGG-3′ and NR Rv: 5′-GTCGGCCAATCCAGTTCGTGTC-3′.

    Conjugation Assay:

    Article Title: Selective modulation of local linkages between active transcription and oxidative demethylation activity shapes cardiomyocyte-specific gene-body epigenetic status in mice
    Article Snippet: Fragmented DNA and UDP-azide-glucose were incubated overnight with T4 BGT (NEB) at 37 °C followed by biotin conjugation. .. The eluted DNA was then purified and employed to construct a DNA library using the ChIP-seq Library Prep Master Mix Set with Q5 (NEB).

    Mutagenesis:

    Article Title: Structural decoding of netrin-4 reveals a regulatory function towards mature basement membranes
    Article Snippet: Paragraph title: Design of chimeric constructs and site-directed mutagenesis ... To design Net4 containing LNγ1 binding domains we generated chimeric molecules by overlap PCR using the Q5 (New England Biolabs) polymerase.

    Article Title: Helicobacter pylori modulates host cell responses by CagT4SS-dependent translocation of an intermediate metabolite of LPS inner core heptose biosynthesis
    Article Snippet: Plasmids and oligonucleotide primers for cloning, sequencing and site-directed mutagenesis are depicted in and Tables, respectively. .. Pfu (Agilent Technologies), FastStart HF (Roche) and Q5 (NEB) DNA polymerases were used for accurate amplification of longer DNA fragments and for cloning.

    Article Title: Self-oligomerization regulates stability of survival motor neuron protein isoforms by sequestering an SCFSlmb degron
    Article Snippet: A 3X FLAG tag was inserted immediately downstream of the start codon of dSMN. .. Point mutations were introduced into this construct using Q5 (NEB) site-directed mutagenesis according to manufacturer’s instructions. .. The basal Smn construct used, vSmn, contained three single-amino-acid changes, and the addition of the MGLR motif to make fruit fly Smn more similar to the evolutionarily conserved vertebrate Smn.

    Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner
    Article Snippet: The algZ mutant was constructed using the algZHSDMF/algZHSDMR primers. .. The primers were phosphorylated and used in site-directed mutagenesis, in accordance with the manufacturer's instructions, using Q5 (NEB). .. Constructs were analyzed by restriction enzyme analysis and sequencing.

    Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner
    Article Snippet: Paragraph title: algR mutant construction. ... The wild-type algR genomic region was amplified using Q5 (NEB) and primers algRXbaIR and algRHindIIIF and cloned into pEX18Tc.

    Article Title: LARP7-like protein Pof8 regulates telomerase assembly and poly(A)+TERRA expression in fission yeast
    Article Snippet: Original sources of published strains and details on strain construction for newly generated strains are indicated in Supplementary Table . .. Various point mutation and truncation constructs were generated by Q5 (NEB, E0554) or QuikChange Lightning (Agilent, 210513) site-directed mutagenesis. .. Genomic DNA was prepared by resuspending cell pellets in equal volumes of DNA buffer (100 mM Tris pH 8.0, 1 mM EDTA pH 8.0, 100 mM NaCl, 1% SDS) and Phenol:chloroform:isoamyl alcohol (25:24:1) saturated wit h 10 mM Tris, pH 8.0 and 1 mM EDTA, and cells were lysed with glass beads.

    Isolation:

    Article Title: Three F-actin assembly centers regulate organelle inheritance, cell-cell communication and motility in Toxoplasma gondii
    Article Snippet: Genomic DNA was isolated with the Wizard SV genomic DNA purification system (Promega). .. All amplifications were performed with Q5 (New England Biolabs) polymerase; the primers used are listed in .

    Article Title: Helicobacter pylori modulates host cell responses by CagT4SS-dependent translocation of an intermediate metabolite of LPS inner core heptose biosynthesis
    Article Snippet: Isolation of highly pure genomic DNA, purification of plasmid DNA and gel extraction of DNA from enzymatic reactions were accomplished by QIAGEN DNA purification columns (QIAGEN, Hilden, Germany). .. Pfu (Agilent Technologies), FastStart HF (Roche) and Q5 (NEB) DNA polymerases were used for accurate amplification of longer DNA fragments and for cloning.

    Transfection:

    Article Title: Long-term hepatitis B infection in a scalable hepatic co-culture system
    Article Snippet: The coding sequence of human TDP2 was PCR amplified from a hTDP2 expression plasmid (NM_016614.2) with Q5 (NEB, Ipswich, MA) and inserted into a pQLinkH (Addgene, plasmid #13667) expression plasmid via restriction digest with Bam HI and Hin dIII and ligated ON at 16 °C. .. The sequence of the N -terminally 7x His-tagged TDP2 was confirmed by DNA sequencing.

    Purification:

    Article Title: Rap2 and TNIK control Plexin-dependent tiled synaptic innervation in C. elegans
    Article Snippet: Trizol (Invitrogen) was used to purify total RNA from N2, and the SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen) was used for the reverse-transcription. mig-15 genomic DNA was amplified from the N2 genomic DNA purified using GeneJET Genomic DNA Purification Kit (Thermo Scientific). .. Phusion (NEB) or Q5 (NEB) DNA polymerases were used for all PCR reactions for amplifying cDNA and genomic DNA fragments.

    Article Title: Ubiquitin A-52 residue ribosomal protein fusion product 1 (Uba52) is essential for preimplantation embryo development
    Article Snippet: Each gBlock was diluted to final concentration 0.1 ng/μl and PCR amplified with a gBlock F primer (ACTGGCACCTATGCGGGACGAC) and a gBlock R primer (AAAAGCACCGACTCGGTGCCAC) with Q5 (New England Biolabs, Ipswich, MA) following standard protocol. .. Each gBlock was diluted to final concentration 0.1 ng/μl and PCR amplified with a gBlock F primer (ACTGGCACCTATGCGGGACGAC) and a gBlock R primer (AAAAGCACCGACTCGGTGCCAC) with Q5 (New England Biolabs, Ipswich, MA) following standard protocol.

    Article Title: Coupling bimolecular PARylation biosensors with genetic screens to identify PARylation targets
    Article Snippet: Finally they were re-suspended in 25 μl water and 5 μl were used in a 50 μl Q5 (NEB) PCR reaction with 0.2 μM SPL1 and 0.2 μM HmSp1 primers—98 °C/30”, 20 × (98 °C/20”, 70 °C/20”, 72 °C/1’), 72 °C/2’. .. PCR products were obtained only from Tol2-containing gDNA.

    Article Title: Structural decoding of netrin-4 reveals a regulatory function towards mature basement membranes
    Article Snippet: To design Net4 containing LNγ1 binding domains we generated chimeric molecules by overlap PCR using the Q5 (New England Biolabs) polymerase. .. To design Net4 containing LNγ1 binding domains we generated chimeric molecules by overlap PCR using the Q5 (New England Biolabs) polymerase.

    Article Title: Long-term hepatitis B infection in a scalable hepatic co-culture system
    Article Snippet: Paragraph title: Cloning, expression, and purification of hTDP2 ... The coding sequence of human TDP2 was PCR amplified from a hTDP2 expression plasmid (NM_016614.2) with Q5 (NEB, Ipswich, MA) and inserted into a pQLinkH (Addgene, plasmid #13667) expression plasmid via restriction digest with Bam HI and Hin dIII and ligated ON at 16 °C.

    Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching
    Article Snippet: The purified PCR product was digested with SacI and NheI for sticky-end ligation into the pET200 (Invitrogen, Waltham, MA, USA) backbone to create pHSso PoxTyr. .. The Sso Pox gene was amplified with Q5 (NEB, Ipswich, MA, USA) using the same forward primer as used previously and a new reverse primer, Sso PoxR-Gln was used to add the glutamine tag.

    Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner
    Article Snippet: Paragraph title: AlgR purification. ... The algR gene was PCR amplified using Q5 (NEB) and PAO1 chromosomal DNA using oligonucleotides algRSal1F and algRNot1R ( ).

    Article Title: Selective modulation of local linkages between active transcription and oxidative demethylation activity shapes cardiomyocyte-specific gene-body epigenetic status in mice
    Article Snippet: Biotinylated DNA was then purified, captured with streptavidin beads, washed and eluted. .. The eluted DNA was then purified and employed to construct a DNA library using the ChIP-seq Library Prep Master Mix Set with Q5 (NEB). .. Library quality was determined using a BioAnalyzer2000, and quantification was performed via qPCR using KAPA Library Quantification Kits (Illumina) followed by Illumina sequencing using the MiSeq and Hiseq2500 platforms; the sequences and processed data are available from the NCBI GEO repository (Accession no.: [GEO: GSE87165]).

    Polymerase Chain Reaction:

    Article Title: Rap2 and TNIK control Plexin-dependent tiled synaptic innervation in C. elegans
    Article Snippet: Trizol (Invitrogen) was used to purify total RNA from N2, and the SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen) was used for the reverse-transcription. mig-15 genomic DNA was amplified from the N2 genomic DNA purified using GeneJET Genomic DNA Purification Kit (Thermo Scientific). .. Phusion (NEB) or Q5 (NEB) DNA polymerases were used for all PCR reactions for amplifying cDNA and genomic DNA fragments. .. Amplified fragments were cloned into the Asc I and Kpn I sites of pSM vector using SLiCE method , Gibson assembly ( ) or T4 ligase (NEB).

    Article Title: Ubiquitin A-52 residue ribosomal protein fusion product 1 (Uba52) is essential for preimplantation embryo development
    Article Snippet: A T7 promoter sequence was added upstream of the guide for in vitro transcription. .. Each gBlock was diluted to final concentration 0.1 ng/μl and PCR amplified with a gBlock F primer (ACTGGCACCTATGCGGGACGAC) and a gBlock R primer (AAAAGCACCGACTCGGTGCCAC) with Q5 (New England Biolabs, Ipswich, MA) following standard protocol. .. PCR conditions consisted of an initial denaturation of 98°C for 1 min followed by 35 cycles of 98°C (10 s), 68°C (30 s) and 72°C (30 s).

    Article Title: Coupling bimolecular PARylation biosensors with genetic screens to identify PARylation targets
    Article Snippet: Biotinylated products were collected on streptavidin beads (Life Technologies 11205D), washed, and re-suspended in a ligation mastermix, containing 25% w/v PEG8000 (Sigma 89510-250G-F), 1 μM ssAdapter, 1 mM Co(NH2 )6 Cl3 (Sigma H7891-5G), 1 × T4 ligation buffer and 20 U T4 ligase (NEB), for 16 h at 25 °C and 300 rpm shaking. .. Finally they were re-suspended in 25 μl water and 5 μl were used in a 50 μl Q5 (NEB) PCR reaction with 0.2 μM SPL1 and 0.2 μM HmSp1 primers—98 °C/30”, 20 × (98 °C/20”, 70 °C/20”, 72 °C/1’), 72 °C/2’. .. One microliter of this PCR reaction was used as a template in a subsequent reaction: 50 μl Q5 PCR reaction with 0.2 μM P1trunc and 0.2 μM IonTorrent_index primers—98 °C/30”, 10 × (98 °C/10”, 61 °C/10”, 72 °C/1’), 10 × (98 °C/10”, 69 °C/10”, 72 °C/1’), 72 °C/2’.

    Article Title: Twin-primer non-enzymatic DNA assembly: an efficient and accurate multi-part DNA assembly method
    Article Snippet: For each DNA fragment to be assembled, two PCR products were generated: one with primers LF and SR, the other with primers SF and LR. .. PCR reactions were performed using either KOD Xtreme Hotstart (Merck, Darmstadt, Germany) or Q5 (NEB, Ipswich, MA, USA) DNA polymerase according to the respective manufacturer's recommended protocol. .. Depending on PCR purity, either gel purification (QIAquick Gel Extraction Kit, Qiagen, Hilden, Germany) or PCR purification (QIAquick PCR Purification Kit, Qiagen, Hilden, Germany) were used to clean up the products.

    Article Title: Structural decoding of netrin-4 reveals a regulatory function towards mature basement membranes
    Article Snippet: Protein concentrations were measured using extinction coefficient and molecular weight values derived from the ProtParam utility available on the ExPaSy server . .. To design Net4 containing LNγ1 binding domains we generated chimeric molecules by overlap PCR using the Q5 (New England Biolabs) polymerase. .. The domains from Net4 (Net4: NP_067295) were replaced by the corresponding laminin γ1 sequences (laminin γ1: NP_034813).

    Article Title: A comprehensive benchmarking study of protocols and sequencing platforms for 16S rRNA community profiling
    Article Snippet: The PCR for each variable region was carried out in triplicate in a 25 μ l reaction in a thermal cycler (Applied Biosystem GeneAmp PCR system 9700) with the following parameters: initial denaturation at 94 °C for 5 mins, followed by 5, 8, and 10 cycles of 98 °C for 20 s, 60 °C for 15 s, and 72 °C for 40 s with a final extension at 72 °C for 1 min. .. The 10 μ l of the first step reaction was submitted to a second amplification step using the following conditions: 0.1 μ M forward barcoded primer for the dual index strategy or a forward not barcoded primer for the single index strategy; 0.1 μ M primer barcoded reverse primer; 1x HiFi (Kapa) or Q5 (NEB) polymerase ready mix.

    Article Title: Long-term hepatitis B infection in a scalable hepatic co-culture system
    Article Snippet: After incubation, the cells were washed five times with 1× PBS and then had 300 μl of sterile 1× PBS added and the cells were stored at 4 °C until imaging. .. The coding sequence of human TDP2 was PCR amplified from a hTDP2 expression plasmid (NM_016614.2) with Q5 (NEB, Ipswich, MA) and inserted into a pQLinkH (Addgene, plasmid #13667) expression plasmid via restriction digest with Bam HI and Hin dIII and ligated ON at 16 °C. .. The sequence of the N -terminally 7x His-tagged TDP2 was confirmed by DNA sequencing.

    Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching
    Article Snippet: The purified PCR product was digested with SacI and NheI for sticky-end ligation into the pET200 (Invitrogen, Waltham, MA, USA) backbone to create pHSso PoxTyr. .. The Sso Pox gene was amplified with Q5 (NEB, Ipswich, MA, USA) using the same forward primer as used previously and a new reverse primer, Sso PoxR-Gln was used to add the glutamine tag.

    Article Title: Three F-actin assembly centers regulate organelle inheritance, cell-cell communication and motility in Toxoplasma gondii
    Article Snippet: All amplifications were performed with Q5 (New England Biolabs) polymerase; the primers used are listed in . .. All cloning were performed using E. coli XL-1 Gold chemo-competent bacteria.

    Article Title: Prophage-Driven Genomic Structural Changes Promote Bartonella Vertical Evolution
    Article Snippet: Sequences involved in each detected SV event were identified. .. Then, primers were designed to validate each of the events ( , online), using conventional PCR (Synthezza, Jerusalem, ISR) or Q5 (New England BioLabs, Massachusetts, USA) long PCR reactions. .. PCR products were visualized in TAE (0.4–1%) agarose gels stained with ethidium bromide.

    Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner
    Article Snippet: The primers were phosphorylated and used in site-directed mutagenesis, in accordance with the manufacturer's instructions, using Q5 (NEB). .. The primers were phosphorylated and used in site-directed mutagenesis, in accordance with the manufacturer's instructions, using Q5 (NEB).

    Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner
    Article Snippet: The translational/leader fusion backbone CTXCPlacUV5 had no background activity. .. The algR gene was PCR amplified using Q5 (NEB) and PAO1 chromosomal DNA using oligonucleotides algRSal1F and algRNot1R ( ). .. A 754-bp SalI/NotI fragment was cloned into pGEX-4T-3 (Novagen) to be expressed as a glutathione S -transferase–AlgR (GST-AlgR) fusion protein.

    Article Title: CRISPR–Cas ribonucleoprotein mediated homology-directed repair for efficient targeted genome editing in microalgae Nannochloropsis oceanica IMET1
    Article Snippet: The 10X Cas buffer is composed of 1 M Nacl, 500 mM Tris–HCl, 100 mM MgCl2 and 1 mg/mL BSA at pH 7.9. .. After 15 min incubation, 100 ng of the template DNA was added into the reaction mixture and incubated again for 1 h. The target DNA was amplified from the host genomic DNA with Q5 (NEB) PCR by using primers NR Fw: 5′-GTGGTGCGTAGTCGGAATGG-3′ and NR Rv: 5′-GTCGGCCAATCCAGTTCGTGTC-3′. .. The template DNA was 1207 bp long and the digestion with Cas9 could result in fragments of size 183 and 1022 bp with sp1 and 200 and 1005 bp with sp2.

    Article Title: Analysis of error profiles in deep next-generation sequencing data
    Article Snippet: Primers for SNV targets (Additional file : Table S2d) sized 130 bp to 170 bp were designed by using Primer3. .. PCR was performed with the KAPA HiFi HotStart ReadyMix PCR Kit and NEBNext Q5 Hot Start HiFi PCR Master Mix, 10 μM of each primer, 50 ng of COLO829BL, COLO829, two replicates of 0.1% mixture, and two replicates of 0.02% mixture DNA for each target by using the following PCR conditions: 95 °C for 5 min, 26 cycles of 98 °C for 20 s, 63 °C for 15 s, 72 °C for 15 s, and 72 °C for 1 min before storage at 4 °C (Kapa HiFi HotStart); 98 °C for 30 s, 26 cycles of 98 °C for 10 s, 65 °C for 15 s, 72 °C for 20 s, and 72 °C for 2 min before storage at 4 °C (NEBNext Q5). .. All amplicons were quality-checked on a 2% agarose E-gel (Invitrogen), then pooled in bins and purified by Agencourt Ampure XP Beads.

    Blocking Assay:

    Article Title: Coupling bimolecular PARylation biosensors with genetic screens to identify PARylation targets
    Article Snippet: Finally they were re-suspended in 25 μl water and 5 μl were used in a 50 μl Q5 (NEB) PCR reaction with 0.2 μM SPL1 and 0.2 μM HmSp1 primers—98 °C/30”, 20 × (98 °C/20”, 70 °C/20”, 72 °C/1’), 72 °C/2’. .. DNA libraries were purified with a PCR purification kit (Qiagen) and sequenced on Ion Torrent PGM 318 chip, 400 flow.

    CRISPR:

    Article Title: Ubiquitin A-52 residue ribosomal protein fusion product 1 (Uba52) is essential for preimplantation embryo development
    Article Snippet: Paragraph title: In vitro transcription of single guide RNAs for the CRISPR/Cas9 system ... Each gBlock was diluted to final concentration 0.1 ng/μl and PCR amplified with a gBlock F primer (ACTGGCACCTATGCGGGACGAC) and a gBlock R primer (AAAAGCACCGACTCGGTGCCAC) with Q5 (New England Biolabs, Ipswich, MA) following standard protocol.

    IA:

    Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching
    Article Snippet: The Sso Pox genetic sequence was optimized for E. coli using the IDT codon optimization tool and the gBlock and primers for insertion into pET200 plasmid were ordered from IDT (Coralville, IA, USA). .. The Sso Pox gene was amplified with Q5 (NEB, Ipswich, MA, USA) using the same forward primer as used previously and a new reverse primer, Sso PoxR-Gln was used to add the glutamine tag.

    Chromatin Immunoprecipitation:

    Article Title: Coupling bimolecular PARylation biosensors with genetic screens to identify PARylation targets
    Article Snippet: Finally they were re-suspended in 25 μl water and 5 μl were used in a 50 μl Q5 (NEB) PCR reaction with 0.2 μM SPL1 and 0.2 μM HmSp1 primers—98 °C/30”, 20 × (98 °C/20”, 70 °C/20”, 72 °C/1’), 72 °C/2’. .. PCR products were obtained only from Tol2-containing gDNA.

    Plasmid Preparation:

    Article Title: Long-term hepatitis B infection in a scalable hepatic co-culture system
    Article Snippet: After incubation, the cells were washed five times with 1× PBS and then had 300 μl of sterile 1× PBS added and the cells were stored at 4 °C until imaging. .. The coding sequence of human TDP2 was PCR amplified from a hTDP2 expression plasmid (NM_016614.2) with Q5 (NEB, Ipswich, MA) and inserted into a pQLinkH (Addgene, plasmid #13667) expression plasmid via restriction digest with Bam HI and Hin dIII and ligated ON at 16 °C. .. The sequence of the N -terminally 7x His-tagged TDP2 was confirmed by DNA sequencing.

    Article Title: Modification and Assembly of a Versatile Lactonase for Bacterial Quorum Quenching
    Article Snippet: To add the glutamine tag the pHSso PoxTyr plasmid was digested with NheI and SacI. .. The Sso Pox gene was amplified with Q5 (NEB, Ipswich, MA, USA) using the same forward primer as used previously and a new reverse primer, Sso PoxR-Gln was used to add the glutamine tag.

    Article Title: Three F-actin assembly centers regulate organelle inheritance, cell-cell communication and motility in Toxoplasma gondii
    Article Snippet: All amplifications were performed with Q5 (New England Biolabs) polymerase; the primers used are listed in . .. Vectors were digested with restriction enzymes ApaI /SbfI and ApaI /NsiI, respectively, and cloned into ASP5-3Ty-DHFR ( ) digested with KpnI or MfeI and NsiI .

    Article Title: Helicobacter pylori modulates host cell responses by CagT4SS-dependent translocation of an intermediate metabolite of LPS inner core heptose biosynthesis
    Article Snippet: Isolation of highly pure genomic DNA, purification of plasmid DNA and gel extraction of DNA from enzymatic reactions were accomplished by QIAGEN DNA purification columns (QIAGEN, Hilden, Germany). .. Pfu (Agilent Technologies), FastStart HF (Roche) and Q5 (NEB) DNA polymerases were used for accurate amplification of longer DNA fragments and for cloning.

    Article Title: Self-oligomerization regulates stability of survival motor neuron protein isoforms by sequestering an SCFSlmb degron
    Article Snippet: In short, a ∼3 kb fragment containing the entire Smn coding region was cloned from the Drosophila genome into the pAttB vector ( ). .. Point mutations were introduced into this construct using Q5 (NEB) site-directed mutagenesis according to manufacturer’s instructions.

    Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner
    Article Snippet: The algR gene was PCR amplified using Q5 (NEB) and PAO1 chromosomal DNA using oligonucleotides algRSal1F and algRNot1R ( ). .. A 754-bp SalI/NotI fragment was cloned into pGEX-4T-3 (Novagen) to be expressed as a glutathione S -transferase–AlgR (GST-AlgR) fusion protein.

    Article Title: LARP7-like protein Pof8 regulates telomerase assembly and poly(A)+TERRA expression in fission yeast
    Article Snippet: For most experiments, cells are grown in YES (Yeast Extract with Supplements) media at 32 o C, while they are grown in PMG (Pombe Minimal Glutamate) with appropriate supplements to allow for selection of either LEU2 or ura4 + plasmid at 32 o C for experiments involving TER1 expression plasmids . .. Various point mutation and truncation constructs were generated by Q5 (NEB, E0554) or QuikChange Lightning (Agilent, 210513) site-directed mutagenesis.

    Software:

    Article Title: Prophage-Driven Genomic Structural Changes Promote Bartonella Vertical Evolution
    Article Snippet: Then, primers were designed to validate each of the events ( , online), using conventional PCR (Synthezza, Jerusalem, ISR) or Q5 (New England BioLabs, Massachusetts, USA) long PCR reactions. .. PCR products were visualized in TAE (0.4–1%) agarose gels stained with ethidium bromide.

    Selection:

    Article Title: LARP7-like protein Pof8 regulates telomerase assembly and poly(A)+TERRA expression in fission yeast
    Article Snippet: For most experiments, cells are grown in YES (Yeast Extract with Supplements) media at 32 o C, while they are grown in PMG (Pombe Minimal Glutamate) with appropriate supplements to allow for selection of either LEU2 or ura4 + plasmid at 32 o C for experiments involving TER1 expression plasmids . .. Various point mutation and truncation constructs were generated by Q5 (NEB, E0554) or QuikChange Lightning (Agilent, 210513) site-directed mutagenesis.

    Agarose Gel Electrophoresis:

    Article Title: Ubiquitin A-52 residue ribosomal protein fusion product 1 (Uba52) is essential for preimplantation embryo development
    Article Snippet: Each gBlock was diluted to final concentration 0.1 ng/μl and PCR amplified with a gBlock F primer (ACTGGCACCTATGCGGGACGAC) and a gBlock R primer (AAAAGCACCGACTCGGTGCCAC) with Q5 (New England Biolabs, Ipswich, MA) following standard protocol. .. Purified gBlock amplicons were used as template for in vitro transcription by standard protocol with the MEGAshortscript T7 transcription kit (Ambion; Thermo Fisher Scientific) followed by purification using the MEGAclear T7 clean-up kit (Ambion).

    In Vitro:

    Article Title: Ubiquitin A-52 residue ribosomal protein fusion product 1 (Uba52) is essential for preimplantation embryo development
    Article Snippet: Paragraph title: In vitro transcription of single guide RNAs for the CRISPR/Cas9 system ... Each gBlock was diluted to final concentration 0.1 ng/μl and PCR amplified with a gBlock F primer (ACTGGCACCTATGCGGGACGAC) and a gBlock R primer (AAAAGCACCGACTCGGTGCCAC) with Q5 (New England Biolabs, Ipswich, MA) following standard protocol.

    Article Title: CRISPR–Cas ribonucleoprotein mediated homology-directed repair for efficient targeted genome editing in microalgae Nannochloropsis oceanica IMET1
    Article Snippet: Paragraph title: In vitro assays of RNP complex ... After 15 min incubation, 100 ng of the template DNA was added into the reaction mixture and incubated again for 1 h. The target DNA was amplified from the host genomic DNA with Q5 (NEB) PCR by using primers NR Fw: 5′-GTGGTGCGTAGTCGGAATGG-3′ and NR Rv: 5′-GTCGGCCAATCCAGTTCGTGTC-3′.

    Transgenic Assay:

    Article Title: Self-oligomerization regulates stability of survival motor neuron protein isoforms by sequestering an SCFSlmb degron
    Article Snippet: The Smn transgenic constructs were injected into embryos by BestGene (Chino Hills, CA) as described in . .. Point mutations were introduced into this construct using Q5 (NEB) site-directed mutagenesis according to manufacturer’s instructions.

    Spectrophotometry:

    Article Title: Ubiquitin A-52 residue ribosomal protein fusion product 1 (Uba52) is essential for preimplantation embryo development
    Article Snippet: Each gBlock was diluted to final concentration 0.1 ng/μl and PCR amplified with a gBlock F primer (ACTGGCACCTATGCGGGACGAC) and a gBlock R primer (AAAAGCACCGACTCGGTGCCAC) with Q5 (New England Biolabs, Ipswich, MA) following standard protocol. .. Purified gBlock amplicons were used as template for in vitro transcription by standard protocol with the MEGAshortscript T7 transcription kit (Ambion; Thermo Fisher Scientific) followed by purification using the MEGAclear T7 clean-up kit (Ambion).

    Concentration Assay:

    Article Title: Ubiquitin A-52 residue ribosomal protein fusion product 1 (Uba52) is essential for preimplantation embryo development
    Article Snippet: A T7 promoter sequence was added upstream of the guide for in vitro transcription. .. Each gBlock was diluted to final concentration 0.1 ng/μl and PCR amplified with a gBlock F primer (ACTGGCACCTATGCGGGACGAC) and a gBlock R primer (AAAAGCACCGACTCGGTGCCAC) with Q5 (New England Biolabs, Ipswich, MA) following standard protocol. .. PCR conditions consisted of an initial denaturation of 98°C for 1 min followed by 35 cycles of 98°C (10 s), 68°C (30 s) and 72°C (30 s).

    Article Title: Twin-primer non-enzymatic DNA assembly: an efficient and accurate multi-part DNA assembly method
    Article Snippet: PCR reactions were performed using either KOD Xtreme Hotstart (Merck, Darmstadt, Germany) or Q5 (NEB, Ipswich, MA, USA) DNA polymerase according to the respective manufacturer's recommended protocol. .. PCR reactions were performed using either KOD Xtreme Hotstart (Merck, Darmstadt, Germany) or Q5 (NEB, Ipswich, MA, USA) DNA polymerase according to the respective manufacturer's recommended protocol.

    DNA Purification:

    Article Title: Rap2 and TNIK control Plexin-dependent tiled synaptic innervation in C. elegans
    Article Snippet: Trizol (Invitrogen) was used to purify total RNA from N2, and the SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen) was used for the reverse-transcription. mig-15 genomic DNA was amplified from the N2 genomic DNA purified using GeneJET Genomic DNA Purification Kit (Thermo Scientific). .. Phusion (NEB) or Q5 (NEB) DNA polymerases were used for all PCR reactions for amplifying cDNA and genomic DNA fragments.

    Article Title: Three F-actin assembly centers regulate organelle inheritance, cell-cell communication and motility in Toxoplasma gondii
    Article Snippet: Genomic DNA was isolated with the Wizard SV genomic DNA purification system (Promega). .. All amplifications were performed with Q5 (New England Biolabs) polymerase; the primers used are listed in .

    Article Title: Helicobacter pylori modulates host cell responses by CagT4SS-dependent translocation of an intermediate metabolite of LPS inner core heptose biosynthesis
    Article Snippet: Isolation of highly pure genomic DNA, purification of plasmid DNA and gel extraction of DNA from enzymatic reactions were accomplished by QIAGEN DNA purification columns (QIAGEN, Hilden, Germany). .. Pfu (Agilent Technologies), FastStart HF (Roche) and Q5 (NEB) DNA polymerases were used for accurate amplification of longer DNA fragments and for cloning.

    FLAG-tag:

    Article Title: Self-oligomerization regulates stability of survival motor neuron protein isoforms by sequestering an SCFSlmb degron
    Article Snippet: A 3X FLAG tag was inserted immediately downstream of the start codon of dSMN. .. Point mutations were introduced into this construct using Q5 (NEB) site-directed mutagenesis according to manufacturer’s instructions.

    Staining:

    Article Title: Helicobacter pylori modulates host cell responses by CagT4SS-dependent translocation of an intermediate metabolite of LPS inner core heptose biosynthesis
    Article Snippet: Pfu (Agilent Technologies), FastStart HF (Roche) and Q5 (NEB) DNA polymerases were used for accurate amplification of longer DNA fragments and for cloning. .. Protein samples were separated on 10.6% or 11.5% SDS polyacrylamide gels, depending on the molecular mass of the protein or other molecules to be analyzed.

    Homologous Recombination:

    Article Title: The Pseudomonas aeruginosa Two-Component Regulator AlgR Directly Activates rsmA Expression in a Phosphorylation-Independent Manner
    Article Snippet: The primers were phosphorylated and used in site-directed mutagenesis, in accordance with the manufacturer's instructions, using Q5 (NEB). .. The primers were phosphorylated and used in site-directed mutagenesis, in accordance with the manufacturer's instructions, using Q5 (NEB).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs q5 site directed mutagenesis kit
    Q5 Site Directed Mutagenesis Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 864 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/q5 site directed mutagenesis kit/product/New England Biolabs
    Average 99 stars, based on 864 article reviews
    Price from $9.99 to $1999.99
    q5 site directed mutagenesis kit - by Bioz Stars, 2019-07
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs site directed mutagenesis kit
    Site Directed Mutagenesis Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/site directed mutagenesis kit/product/New England Biolabs
    Average 99 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    site directed mutagenesis kit - by Bioz Stars, 2019-07
    99/100 stars
      Buy from Supplier

    Image Search Results