Review



e coli k12  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 91

    Structured Review

    ATCC e coli k12
    E Coli K12, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 31 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/CRL-1663/UMR-108/pm39431850-263-12-21
    Average 91 stars, based on 31 article reviews
    e coli k12 - by Bioz Stars, 2026-09
    91/100 stars

    Images



    Similar Products

    91
    ATCC e coli k12
    E Coli K12, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/CRL-1663/UMR-108/pm39431850-263-12-21
    Average 91 stars, based on 1 article reviews
    e coli k12 - by Bioz Stars, 2026-09
    91/100 stars
      Buy from Supplier

    91
    ATCC paper cd 1663 s praecaptivus δtyrr
    Paper Cd 1663 S Praecaptivus δtyrr, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/CRL-1663/UMR-108/10__2139_slash_ssrn__4082412-397-26-13
    Average 91 stars, based on 1 article reviews
    paper cd 1663 s praecaptivus δtyrr - by Bioz Stars, 2026-09
    91/100 stars
      Buy from Supplier

    91
    ATCC c albicans atcc 1663 80
    C Albicans Atcc 1663 80, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/CRL-1663/UMR-108/pm34229246-78-9-11
    Average 91 stars, based on 1 article reviews
    c albicans atcc 1663 80 - by Bioz Stars, 2026-09
    91/100 stars
      Buy from Supplier

    91
    ATCC france ad5 cag cre
    France Ad5 Cag Cre, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/CRL-1663/UMR-108/10__7554_slash_elife__53550-301-97-114
    Average 91 stars, based on 1 article reviews
    france ad5 cag cre - by Bioz Stars, 2026-09
    91/100 stars
      Buy from Supplier

    91
    ATCC jxb article 69 7 1663 4770216
    Jxb Article 69 7 1663 4770216, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/CRL-1663/UMR-108/pm29281115-188-6-33
    Average 91 stars, based on 1 article reviews
    jxb article 69 7 1663 4770216 - by Bioz Stars, 2026-09
    91/100 stars
      Buy from Supplier

    91
    ATCC 9742 prrsv 7f cgtacgccactgcctgtg 9661 9678 1663 bp prrsv 7r gggagggactcagcaacttct
    9742 Prrsv 7f Cgtacgccactgcctgtg 9661 9678 1663 Bp Prrsv 7r Gggagggactcagcaacttct, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/CRL-1663/UMR-108/pmc06783987__viruses___11___00875___s001-0-54-97
    Average 91 stars, based on 1 article reviews
    9742 prrsv 7f cgtacgccactgcctgtg 9661 9678 1663 bp prrsv 7r gggagggactcagcaacttct - by Bioz Stars, 2026-09
    91/100 stars
      Buy from Supplier

    91
    ATCC t5 caption a7 primer name blasto fwd f5 ggtccggtgaacactttggattt 1641 1663
    Primers used for PCR amplification
    T5 Caption A7 Primer Name Blasto Fwd F5 Ggtccggtgaacactttggattt 1641 1663, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/CRL-1663/UMR-108/pmc06389295-125-30-6
    Average 91 stars, based on 1 article reviews
    t5 caption a7 primer name blasto fwd f5 ggtccggtgaacactttggattt 1641 1663 - by Bioz Stars, 2026-09
    91/100 stars
      Buy from Supplier

    92
    ATCC wh 8109
    Primers used for PCR amplification
    Wh 8109, supplied by ATCC, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/CRL-1663/Aureobasidium+pullulans+(de+Bary)+Arnaud/pmc06202449__mgen___4___212___s001-501-21-8
    Average 92 stars, based on 1 article reviews
    wh 8109 - by Bioz Stars, 2026-09
    92/100 stars
      Buy from Supplier

    91
    ATCC wheat cultivar bz9wm09 1663
    Primers used for PCR amplification
    Wheat Cultivar Bz9wm09 1663, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/CRL-1663/UMR-108/us09504223-671-4-22
    Average 91 stars, based on 1 article reviews
    wheat cultivar bz9wm09 1663 - by Bioz Stars, 2026-09
    91/100 stars
      Buy from Supplier

    Image Search Results


    Primers used for PCR amplification

    Journal: The Turkish Journal of Gastroenterology

    Article Title: The role of Blastocystis hominis in the activation of ulcerative colitis

    doi: 10.5152/tjg.2018.18498

    Figure Lengend Snippet: Primers used for PCR amplification

    Article Snippet: The B. hominis Brumpt (subtype 1, ATCC®50752 ™ ) strain from the American Type Culture Collection was used as the reference strain in the present study. table ft1 table-wrap mode="anchored" t5 caption a7 Primer name Blasto FWD F5 GGTCCGGTGAACACTTTGGATTT 1641–1663 in {"type":"entrez-nucleotide","attrs":{"text":"AY244621","term_id":"37935750","term_text":"AY244621"}} AY244621 Blasto R F2 CCTACGGAAACCTTGTTACGACTTCA 1734–1759 in {"type":"entrez-nucleotide","attrs":{"text":"AY244621","term_id":"37935750","term_text":"AY244621"}} AY244621 Blastocystis probe FAM TCGTGTAAATCTTACCATTTAGAGGA-BHQ1 1705–1730 in AY244321b Open in a separate window Primers used for PCR amplification Statistical analysis Descriptive statistics are presented as frequency (n), percentage (%), median (minimum-maximum), and mean±standard deviation.

    Techniques: