anti myc antibody (Cell Signaling Technology Inc)

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Cell Signaling Technology Inc anti myc antibody
Anti Myc Antibody, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti myc antibody/product/Cell Signaling Technology Inc
Average 97 stars, based on 1 article reviews
Price from $9.99 to $1999.99

anti myc antibody - by Bioz Stars, 2021-09

97/100 stars

Images

Immunoprecipitation:

Article Title: SOX4 facilitates PGR protein stability and FOXO1 expression conducive for human endometrial decidualization
Article Snippet: .. Anti-PGR (CST, 8757), Anti-HA (CST, c29F4), Anti-Myc (CST, 2276), Anti-Flag (Sigma, F1804) and mouse IgG or rabbit IgG (Mouse Anti-Rabbit IgG (Conformation Specific, L27A9 mAb) were used for immunoprecipitation. ..

other:

Article Title: K63-linked ubiquitination of DYRK1A by TRAF2 alleviates Sprouty 2-mediated degradation of EGFR
Article Snippet: Antibodies Antibodies used in the study were as follows: anti-Flag (F3165/F7425, Sigma), anti-Myc (9B11/71D10, Cell Signaling Technology (CST)), anti-HA (16B12, Biolegend and H6908, Sigma), anti-TRAF2 (sc-136999, Santa Cruz), anti-Rab5 (sc-46692, Santa Cruz), anti-Rab7 (sc-376362, Santa Cruz), anti-Sprouty 2 (sc-100862, Santa Cruz/ab85670, Abcam), anti-EGFR (sc-373746, Santa Cruz), anti-p-Tyr (9411, CST), anti-p-Ser/Thr (ab9344, Abcam and 05-368, Sigma), anti-Ser (sc-81514, Santa Cruz), anti-Thr (sc-5267, Santa Cruz), anti-Ubiquitin (sc-8017, Santa Cruz), anti-β-Actin (AC026, Abclonal), anti-GFP (AE011, Abclonal), anti-glutathione S-transferase (GST) (2622 S, CST), anti-V5 (R960-25, Thermo Fisher and 30801ES10, Yeasen), anti-Mouse/Rabbit IgG-peroxidase secondary antibody (A0545/A9044, Sigma), anti-Mouse IgG (light chain specific)-peroxidase secondary antibody (115-005-174, Jackson), and anti-DYRK1A polyclonal antibody has been previously described [ ].

Western Blot:

Article Title: An autoregulatory negative feedback loop controls thermomorphogenesis in Arabidopsis
Article Snippet: .. Western blots using anti-myc (Cell Signaling Technologies, Danvers, MA) or anti-GFP antibody (Abcam, Cambridge, MA) were used to detect the proteins. ..

Article Title: Mechanism of actin-dependent activation of nucleotidyl cyclase toxins from bacterial human pathogens
Article Snippet: .. Analysis of protein expression in yeast was performed by total protein extraction , followed by SDS-PAGE, Western blotting, and incubation with anti-myc (9B11, CST) or anti-RPS9 serum (polyclonal rabbit antibodies were a generous gift of Prof. S. Rospert). ..

Expressing:

Protein Extraction:

SDS Page:

Incubation:

Transfection:

Article Title: OGA is associated with deglycosylation of NONO and the KU complex during DNA damage repair
Article Snippet: .. Antibodies used in this study include the following: anti-O-GlcNAc (CTD 110.6, Cell Signaling Technology), anti-PAR (Trevigen), anti-GAPDH (Proteintech), anti-OGA antibody (Proteintech), anti-NONO (Proteintech), anti-Ku70 (Proteintech), anti-Ku80 (Proteintech), anti-FLAG (Sigma), anti-Myc (Cell Signaling Technology), anti-H3 (Proteintech). siRNA sequences were used to target human OGA (5′- GAAATCTATCAGTACCTAGGA−3′ or 5′-TGAATAAATAATTTCAATTTG-3′). siRNAs were transfected into cells using oligofectamine2000 (Invitrogen) according to the manufacturer’s instructions. ..