Structured Review

Cell Signaling Technology Inc anti myc antibody
Anti Myc Antibody, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti myc antibody/product/Cell Signaling Technology Inc
Average 97 stars, based on 1 article reviews
Price from $9.99 to $1999.99
anti myc antibody - by Bioz Stars, 2021-09
97/100 stars

Images

Related Articles

Immunoprecipitation:

Article Title: SOX4 facilitates PGR protein stability and FOXO1 expression conducive for human endometrial decidualization
Article Snippet: .. Anti-PGR (CST, 8757), Anti-HA (CST, c29F4), Anti-Myc (CST, 2276), Anti-Flag (Sigma, F1804) and mouse IgG or rabbit IgG (Mouse Anti-Rabbit IgG (Conformation Specific, L27A9 mAb) were used for immunoprecipitation. ..

other:

Article Title: K63-linked ubiquitination of DYRK1A by TRAF2 alleviates Sprouty 2-mediated degradation of EGFR
Article Snippet: Antibodies Antibodies used in the study were as follows: anti-Flag (F3165/F7425, Sigma), anti-Myc (9B11/71D10, Cell Signaling Technology (CST)), anti-HA (16B12, Biolegend and H6908, Sigma), anti-TRAF2 (sc-136999, Santa Cruz), anti-Rab5 (sc-46692, Santa Cruz), anti-Rab7 (sc-376362, Santa Cruz), anti-Sprouty 2 (sc-100862, Santa Cruz/ab85670, Abcam), anti-EGFR (sc-373746, Santa Cruz), anti-p-Tyr (9411, CST), anti-p-Ser/Thr (ab9344, Abcam and 05-368, Sigma), anti-Ser (sc-81514, Santa Cruz), anti-Thr (sc-5267, Santa Cruz), anti-Ubiquitin (sc-8017, Santa Cruz), anti-β-Actin (AC026, Abclonal), anti-GFP (AE011, Abclonal), anti-glutathione S-transferase (GST) (2622 S, CST), anti-V5 (R960-25, Thermo Fisher and 30801ES10, Yeasen), anti-Mouse/Rabbit IgG-peroxidase secondary antibody (A0545/A9044, Sigma), anti-Mouse IgG (light chain specific)-peroxidase secondary antibody (115-005-174, Jackson), and anti-DYRK1A polyclonal antibody has been previously described [ ].

Western Blot:

Article Title: An autoregulatory negative feedback loop controls thermomorphogenesis in Arabidopsis
Article Snippet: .. Western blots using anti-myc (Cell Signaling Technologies, Danvers, MA) or anti-GFP antibody (Abcam, Cambridge, MA) were used to detect the proteins. ..

Article Title: Mechanism of actin-dependent activation of nucleotidyl cyclase toxins from bacterial human pathogens
Article Snippet: .. Analysis of protein expression in yeast was performed by total protein extraction , followed by SDS-PAGE, Western blotting, and incubation with anti-myc (9B11, CST) or anti-RPS9 serum (polyclonal rabbit antibodies were a generous gift of Prof. S. Rospert). ..

Expressing:

Article Title: Mechanism of actin-dependent activation of nucleotidyl cyclase toxins from bacterial human pathogens
Article Snippet: .. Analysis of protein expression in yeast was performed by total protein extraction , followed by SDS-PAGE, Western blotting, and incubation with anti-myc (9B11, CST) or anti-RPS9 serum (polyclonal rabbit antibodies were a generous gift of Prof. S. Rospert). ..

Protein Extraction:

Article Title: Mechanism of actin-dependent activation of nucleotidyl cyclase toxins from bacterial human pathogens
Article Snippet: .. Analysis of protein expression in yeast was performed by total protein extraction , followed by SDS-PAGE, Western blotting, and incubation with anti-myc (9B11, CST) or anti-RPS9 serum (polyclonal rabbit antibodies were a generous gift of Prof. S. Rospert). ..

SDS Page:

Article Title: Mechanism of actin-dependent activation of nucleotidyl cyclase toxins from bacterial human pathogens
Article Snippet: .. Analysis of protein expression in yeast was performed by total protein extraction , followed by SDS-PAGE, Western blotting, and incubation with anti-myc (9B11, CST) or anti-RPS9 serum (polyclonal rabbit antibodies were a generous gift of Prof. S. Rospert). ..

Incubation:

Article Title: Mechanism of actin-dependent activation of nucleotidyl cyclase toxins from bacterial human pathogens
Article Snippet: .. Analysis of protein expression in yeast was performed by total protein extraction , followed by SDS-PAGE, Western blotting, and incubation with anti-myc (9B11, CST) or anti-RPS9 serum (polyclonal rabbit antibodies were a generous gift of Prof. S. Rospert). ..

Transfection:

Article Title: OGA is associated with deglycosylation of NONO and the KU complex during DNA damage repair
Article Snippet: .. Antibodies used in this study include the following: anti-O-GlcNAc (CTD 110.6, Cell Signaling Technology), anti-PAR (Trevigen), anti-GAPDH (Proteintech), anti-OGA antibody (Proteintech), anti-NONO (Proteintech), anti-Ku70 (Proteintech), anti-Ku80 (Proteintech), anti-FLAG (Sigma), anti-Myc (Cell Signaling Technology), anti-H3 (Proteintech). siRNA sequences were used to target human OGA (5′- GAAATCTATCAGTACCTAGGA−3′ or 5′-TGAATAAATAATTTCAATTTG-3′). siRNAs were transfected into cells using oligofectamine2000 (Invitrogen) according to the manufacturer’s instructions. ..

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    Cell Signaling Technology Inc anti myc antibody
    Anti Myc Antibody, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti myc antibody/product/Cell Signaling Technology Inc
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    anti myc antibody - by Bioz Stars, 2021-09
    97/100 stars
      Buy from Supplier

    Image Search Results