hek293 cells  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher hek293 cells
    The impact of SNP rs2273626 in the seed sequence of miR-4707 on miRNA production and targeting. (A) The figure shows the predicted hairpin structure of miR-4707 containing rs2273626, which was associated with VCDR and cup area. The mature miRNA sequences (3p and 5p) are shown in red and the position of variants is depicted by an arrow. To examine the effect of rs2273626 on the miR-4707 expression level, <t>HEK293</t> cells were transfected with GFP-miRNA transcripts containing either the minor allele T or the major allele G. The levels of mature miRNA relative to GFP transcript levels were calculated. (B) Luciferase reporter assays indicating miR-4707-3p–mediated repression of CARD10. HEK293 cells were cotransfected with CARD10 3′UTR luciferase reporter vector and GFP-miRNA transcripts containing either the minor allele T or the major allele G. This experiment indicates a significant difference (P = 0.04) between the relative luciferase activity of the CARD10 3′UTR construct in the presence of miR-4707-3p containing the major allele and the minor allele. Our results suggest that rs2273626 diminishes the regulatory interaction between miR-4707-3p and CARD10, resulting in increased CARD10 levels. All experiments were performed in triplicates and repeated at least three times. Error bars represent standard deviation (SD). NS, nonsignificant.
    Hek293 Cells, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 17835 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hek293 cells/product/Thermo Fisher
    Average 99 stars, based on 17835 article reviews
    Price from $9.99 to $1999.99
    hek293 cells - by Bioz Stars, 2020-04
    99/100 stars

    Images

    1) Product Images from "A Genome-Wide Scan for MicroRNA-Related Genetic Variants Associated With Primary Open-Angle Glaucoma"

    Article Title: A Genome-Wide Scan for MicroRNA-Related Genetic Variants Associated With Primary Open-Angle Glaucoma

    Journal: Investigative Ophthalmology & Visual Science

    doi: 10.1167/iovs.17-22410

    The impact of SNP rs2273626 in the seed sequence of miR-4707 on miRNA production and targeting. (A) The figure shows the predicted hairpin structure of miR-4707 containing rs2273626, which was associated with VCDR and cup area. The mature miRNA sequences (3p and 5p) are shown in red and the position of variants is depicted by an arrow. To examine the effect of rs2273626 on the miR-4707 expression level, HEK293 cells were transfected with GFP-miRNA transcripts containing either the minor allele T or the major allele G. The levels of mature miRNA relative to GFP transcript levels were calculated. (B) Luciferase reporter assays indicating miR-4707-3p–mediated repression of CARD10. HEK293 cells were cotransfected with CARD10 3′UTR luciferase reporter vector and GFP-miRNA transcripts containing either the minor allele T or the major allele G. This experiment indicates a significant difference (P = 0.04) between the relative luciferase activity of the CARD10 3′UTR construct in the presence of miR-4707-3p containing the major allele and the minor allele. Our results suggest that rs2273626 diminishes the regulatory interaction between miR-4707-3p and CARD10, resulting in increased CARD10 levels. All experiments were performed in triplicates and repeated at least three times. Error bars represent standard deviation (SD). NS, nonsignificant.
    Figure Legend Snippet: The impact of SNP rs2273626 in the seed sequence of miR-4707 on miRNA production and targeting. (A) The figure shows the predicted hairpin structure of miR-4707 containing rs2273626, which was associated with VCDR and cup area. The mature miRNA sequences (3p and 5p) are shown in red and the position of variants is depicted by an arrow. To examine the effect of rs2273626 on the miR-4707 expression level, HEK293 cells were transfected with GFP-miRNA transcripts containing either the minor allele T or the major allele G. The levels of mature miRNA relative to GFP transcript levels were calculated. (B) Luciferase reporter assays indicating miR-4707-3p–mediated repression of CARD10. HEK293 cells were cotransfected with CARD10 3′UTR luciferase reporter vector and GFP-miRNA transcripts containing either the minor allele T or the major allele G. This experiment indicates a significant difference (P = 0.04) between the relative luciferase activity of the CARD10 3′UTR construct in the presence of miR-4707-3p containing the major allele and the minor allele. Our results suggest that rs2273626 diminishes the regulatory interaction between miR-4707-3p and CARD10, resulting in increased CARD10 levels. All experiments were performed in triplicates and repeated at least three times. Error bars represent standard deviation (SD). NS, nonsignificant.

    Techniques Used: Sequencing, Expressing, Transfection, Luciferase, Plasmid Preparation, Activity Assay, Construct, Standard Deviation

    2) Product Images from "Triglycerides Promote Lipid Homeostasis during Hypoxic Stress by Balancing Fatty Acid Saturation"

    Article Title: Triglycerides Promote Lipid Homeostasis during Hypoxic Stress by Balancing Fatty Acid Saturation

    Journal: Cell Reports

    doi: 10.1016/j.celrep.2018.08.015

    13 C-Oleate Tracing Reveals a Critical Buffering Role for TG-Resident Unsaturated FAs (A) Effect of SCDi on total TG abundances as measured by LC-MS. (B) Effect of oleate pre-loading with or without DGAT shRNA on subsequent A498 cell survival (by Annexin-PI) during serum limitation and SCD inhibition. (C) Schematic of the experimental workflow. DGAT2 knockout cells were serum-starved for 24 hr and then loaded for 24 hr with 10 μM [U 13 C]-oleate (C18:1) ± DGAT1 inhibitor (T863, 2 μM). The medium was then replaced and the tracer removed, and cells were subjected to a 48-hr washout. (D) TG labeling patterns after 24-hr loading with [U 13 C]-oleate with or without DGATi, where numbers of mono-unsaturated FA (MUFA) and FA carbons are indicated. 1×, 2×, and 3× indicate whether TGs have one, two, or three oleates (includes [ 13 C 18 ]-20:1) conjugated to their glycerol backbones. (E) BODIPY and DAPI staining directly after [U 13 C]-oleate loading with or without DGATi. (F) Labeling patterns as assessed by incorporation of the 13 C label in 18:1 and 20:1 FAs in TG, DG, PC, and PE species. (G) Model of the metabolic mechanism by which TGs alleviate the saturation of certain lipid classes (e.g., PCs) under conditions of unsaturated lipid deprivation by releasing stored oleate. Data are means of triplicate wells confirmed in independent experiments (A, B, and D) or means of three independent experiments each conducted in triplicate (F); error bars represent SD. Statistical significance by t test or ANOVA, as appropriate. ∗ p
    Figure Legend Snippet: 13 C-Oleate Tracing Reveals a Critical Buffering Role for TG-Resident Unsaturated FAs (A) Effect of SCDi on total TG abundances as measured by LC-MS. (B) Effect of oleate pre-loading with or without DGAT shRNA on subsequent A498 cell survival (by Annexin-PI) during serum limitation and SCD inhibition. (C) Schematic of the experimental workflow. DGAT2 knockout cells were serum-starved for 24 hr and then loaded for 24 hr with 10 μM [U 13 C]-oleate (C18:1) ± DGAT1 inhibitor (T863, 2 μM). The medium was then replaced and the tracer removed, and cells were subjected to a 48-hr washout. (D) TG labeling patterns after 24-hr loading with [U 13 C]-oleate with or without DGATi, where numbers of mono-unsaturated FA (MUFA) and FA carbons are indicated. 1×, 2×, and 3× indicate whether TGs have one, two, or three oleates (includes [ 13 C 18 ]-20:1) conjugated to their glycerol backbones. (E) BODIPY and DAPI staining directly after [U 13 C]-oleate loading with or without DGATi. (F) Labeling patterns as assessed by incorporation of the 13 C label in 18:1 and 20:1 FAs in TG, DG, PC, and PE species. (G) Model of the metabolic mechanism by which TGs alleviate the saturation of certain lipid classes (e.g., PCs) under conditions of unsaturated lipid deprivation by releasing stored oleate. Data are means of triplicate wells confirmed in independent experiments (A, B, and D) or means of three independent experiments each conducted in triplicate (F); error bars represent SD. Statistical significance by t test or ANOVA, as appropriate. ∗ p

    Techniques Used: Liquid Chromatography with Mass Spectroscopy, shRNA, Inhibition, Knock-Out, Labeling, Staining

    DGAT Loss Reduces Tumor Growth and Alters Lipid Composition In Vivo (A) Diagram of fatty acid and lipid synthesis and the influence of O 2 and exogenous lipid. (B) Growth curves for A498 xenograft tumors with induced (doxycycline chow) and un-induced (control chow) DGAT1 and DGAT2 shRNAs (hereafter called DGAT shRNA). (C) Tumor weights after necropsy. (D) Immunohistochemistry for cleaved caspase-3 and Ki67 in xenograft tumors collected on day 5 of treatment, with accompanying quantification. (E) Total TG abundance derived from summing individual TG species abundance after liquid chromatography-mass spectrometry (LC-MS) quantification. (F) TG species binned according to the number of fully saturated FA chains present and the abundance of each category summed and displayed as a ratio of doxycycline-treated versus control groups. All results are means of n = 10 tumors (2 tumors per mouse) per arm; error bars represent ± SD (B, D, and F) or ± SEM (C). Statistical significance by t test or ANOVA, as appropriate; ∗ p
    Figure Legend Snippet: DGAT Loss Reduces Tumor Growth and Alters Lipid Composition In Vivo (A) Diagram of fatty acid and lipid synthesis and the influence of O 2 and exogenous lipid. (B) Growth curves for A498 xenograft tumors with induced (doxycycline chow) and un-induced (control chow) DGAT1 and DGAT2 shRNAs (hereafter called DGAT shRNA). (C) Tumor weights after necropsy. (D) Immunohistochemistry for cleaved caspase-3 and Ki67 in xenograft tumors collected on day 5 of treatment, with accompanying quantification. (E) Total TG abundance derived from summing individual TG species abundance after liquid chromatography-mass spectrometry (LC-MS) quantification. (F) TG species binned according to the number of fully saturated FA chains present and the abundance of each category summed and displayed as a ratio of doxycycline-treated versus control groups. All results are means of n = 10 tumors (2 tumors per mouse) per arm; error bars represent ± SD (B, D, and F) or ± SEM (C). Statistical significance by t test or ANOVA, as appropriate; ∗ p

    Techniques Used: In Vivo, shRNA, Immunohistochemistry, Derivative Assay, Liquid Chromatography, Mass Spectrometry, Liquid Chromatography with Mass Spectroscopy

    TGs Promote Cell Viability in Low O 2 and Serum by Absorbing FA Saturation (A) Viability of A498 cells expressing inducible shRNA against DGAT1 and DGAT2 mRNAs ( DGAT shRNA), assessed after 72 hr under the indicated conditions (hypoxia = 0.5% O 2 ; serum deprivation = low serum, 0.5% fetal bovine serum [FBS]) by Annexin-propidium iodide (PI) flow cytometry assay. (B) Viability of cells expressing inducible DGAT shRNAs after 72 hr under the indicated conditions (SCDi, 1 μM CAY10566) by Annexin-PI assay using flow cytometry. (C) Volcano plot showing fold change and significance of alterations in the lipidome of A498 cells cultured in low (0.5%) versus high (5%) serum. Lipids with ≥ 1.5 fold change and p ≤ 0.05 are displayed in color to denote lipid class. (D) Changes in FA composition or saturation of TGs, calculated by aggregating TG abundances for species containing 0, 1, or 2+ SFA chains separately. Values are normalized to control conditions (5% serum). (E) Lipid class-specific saturation indices (defined by (palmitate + stearate) / oleate) for A498 cells cultured under hypoxic (0.5% O 2 ) versus normoxic conditions (both in low serum). (F) As (E) but with pharmacological SCD inhibition (1 μM CAY10566) instead of hypoxia. (G) Effect of serum deprivation and DGAT shRNA on total TG abundances. (H) Changes in FA makeup of TGs following DGAT knockdown; values were calculated by aggregating TG abundances for species containing 0, 1, or 2+ SFA chains separately. Values were normalized to the control condition (vehicle [Veh] treatment). (I) TG saturation indices for the indicated conditions. Values are relative to normoxic untreated cells. (J) As (G) but with pharmacological SCD inhibition (1 μM CAY10566). Values are relative to the untreated vehicle control. Data are means of 3 (A, B, and D–J) or 5 (C) replicate wells and were confirmed in independent experiments; error bars represent SD. Statistical significance by t test or ANOVA, as appropriate. ∗∗ p
    Figure Legend Snippet: TGs Promote Cell Viability in Low O 2 and Serum by Absorbing FA Saturation (A) Viability of A498 cells expressing inducible shRNA against DGAT1 and DGAT2 mRNAs ( DGAT shRNA), assessed after 72 hr under the indicated conditions (hypoxia = 0.5% O 2 ; serum deprivation = low serum, 0.5% fetal bovine serum [FBS]) by Annexin-propidium iodide (PI) flow cytometry assay. (B) Viability of cells expressing inducible DGAT shRNAs after 72 hr under the indicated conditions (SCDi, 1 μM CAY10566) by Annexin-PI assay using flow cytometry. (C) Volcano plot showing fold change and significance of alterations in the lipidome of A498 cells cultured in low (0.5%) versus high (5%) serum. Lipids with ≥ 1.5 fold change and p ≤ 0.05 are displayed in color to denote lipid class. (D) Changes in FA composition or saturation of TGs, calculated by aggregating TG abundances for species containing 0, 1, or 2+ SFA chains separately. Values are normalized to control conditions (5% serum). (E) Lipid class-specific saturation indices (defined by (palmitate + stearate) / oleate) for A498 cells cultured under hypoxic (0.5% O 2 ) versus normoxic conditions (both in low serum). (F) As (E) but with pharmacological SCD inhibition (1 μM CAY10566) instead of hypoxia. (G) Effect of serum deprivation and DGAT shRNA on total TG abundances. (H) Changes in FA makeup of TGs following DGAT knockdown; values were calculated by aggregating TG abundances for species containing 0, 1, or 2+ SFA chains separately. Values were normalized to the control condition (vehicle [Veh] treatment). (I) TG saturation indices for the indicated conditions. Values are relative to normoxic untreated cells. (J) As (G) but with pharmacological SCD inhibition (1 μM CAY10566). Values are relative to the untreated vehicle control. Data are means of 3 (A, B, and D–J) or 5 (C) replicate wells and were confirmed in independent experiments; error bars represent SD. Statistical significance by t test or ANOVA, as appropriate. ∗∗ p

    Techniques Used: Expressing, shRNA, Flow Cytometry, Cytometry, Cell Culture, Inhibition

    3) Product Images from "Dimerization confers increased stability to nucleases in 5′ halves from glycine and glutamic acid tRNAs"

    Article Title: Dimerization confers increased stability to nucleases in 5′ halves from glycine and glutamic acid tRNAs

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gky495

    The dimerization capacity of tRNA Gly GCC 5′ halves correlates with their intracellular stability. Biotinylated RNA oligonucleotides (100 nM) with the sequence of tRNA Gly 5′ halves (WT), the 9GG/AA and 25U/C mutants, or a scrambled version of WT where different bases were shuffled in order to disrupt folding and dimer interactions (SCR) were transfected in MCF-7 cells with cationic lipids. After incubation for 30 min at 37°C, cells were washed, and immediately fixed ( t 0) or incubated for further 6 h (t6) before fixing. Cells were then incubated with streptavidin conjugated to APC, and subjected to fluorescence microscopy ( A ). A minimum of 45 random fields was analyzed and the total APC fluoresce was normalized to the cell area covered in each field ( B ). This experiment was repeated three times, in order to obtain the percentage of APC fluorescence per cell area between t = 6 hs and t = 0 ( C ). Intracellular levels of the transfected RNAs were also analyzed by SL-RT-qPCR, using miR-21-5p as a reference, and subtracting the ΔCq values between transfected and non-transfected cells ( D ). Measurements of transfected RNAs in the extracellular space after successive washing of the cells were also perform in order to address whether the decreased levels of SCR were due to degradation or preferential secretion ( E ). In all cases, statistical analysis corresponds to one-way ANOVA with Tukey post-hoc test. Significance was studied between specified conditions (A, B) or versus WT (C). *** P
    Figure Legend Snippet: The dimerization capacity of tRNA Gly GCC 5′ halves correlates with their intracellular stability. Biotinylated RNA oligonucleotides (100 nM) with the sequence of tRNA Gly 5′ halves (WT), the 9GG/AA and 25U/C mutants, or a scrambled version of WT where different bases were shuffled in order to disrupt folding and dimer interactions (SCR) were transfected in MCF-7 cells with cationic lipids. After incubation for 30 min at 37°C, cells were washed, and immediately fixed ( t 0) or incubated for further 6 h (t6) before fixing. Cells were then incubated with streptavidin conjugated to APC, and subjected to fluorescence microscopy ( A ). A minimum of 45 random fields was analyzed and the total APC fluoresce was normalized to the cell area covered in each field ( B ). This experiment was repeated three times, in order to obtain the percentage of APC fluorescence per cell area between t = 6 hs and t = 0 ( C ). Intracellular levels of the transfected RNAs were also analyzed by SL-RT-qPCR, using miR-21-5p as a reference, and subtracting the ΔCq values between transfected and non-transfected cells ( D ). Measurements of transfected RNAs in the extracellular space after successive washing of the cells were also perform in order to address whether the decreased levels of SCR were due to degradation or preferential secretion ( E ). In all cases, statistical analysis corresponds to one-way ANOVA with Tukey post-hoc test. Significance was studied between specified conditions (A, B) or versus WT (C). *** P

    Techniques Used: Sequencing, Transfection, Incubation, Fluorescence, Microscopy, Quantitative RT-PCR

    4) Product Images from "Diphenyl diselenide protects neuronal cells against oxidative stress and mitochondrial dysfunction: Involvement of the glutathione-dependent antioxidant system"

    Article Title: Diphenyl diselenide protects neuronal cells against oxidative stress and mitochondrial dysfunction: Involvement of the glutathione-dependent antioxidant system

    Journal: Redox Biology

    doi: 10.1016/j.redox.2018.09.014

    (PhSe) 2 prevents the mitochondrial dysfunction induced by tert-BuOOH (A) Representative respirometry assay of intact HT22 cells pre-incubated with 2 μM (PhSe) 2 for 48 h followed the exposure or not with tert-BuOOH (40 μM) for additional 4 h. After OCR stabilization, the following electron transport system (ETS) modulators were added: Oligomycin (1.25 μM) to measure uncoupled respiration; sequential additions (0.5 μM) of FCCP to achieve maximum respiration; and antimycin A (2.5 μM) to determine residual oxygen consumption rates. OCR records and mitochondrial reserve capacity of HT22 cells exposed or not with tert-BuOOH (40 μM) for 2 h (B) and 4 h (C) were evaluated in DMEM-5% FBS in the following conditions: basal respiration; after inhibition of ATP synthase with oligomycin (uncoupled respiration – Uncoup.); upon titration with FCCP (maximum respiration – Max); and after inhibition of the respiratory complex III with antimycin A (residual respiration – Rox). Data are represented as mean ± SEM (n = 4) * p
    Figure Legend Snippet: (PhSe) 2 prevents the mitochondrial dysfunction induced by tert-BuOOH (A) Representative respirometry assay of intact HT22 cells pre-incubated with 2 μM (PhSe) 2 for 48 h followed the exposure or not with tert-BuOOH (40 μM) for additional 4 h. After OCR stabilization, the following electron transport system (ETS) modulators were added: Oligomycin (1.25 μM) to measure uncoupled respiration; sequential additions (0.5 μM) of FCCP to achieve maximum respiration; and antimycin A (2.5 μM) to determine residual oxygen consumption rates. OCR records and mitochondrial reserve capacity of HT22 cells exposed or not with tert-BuOOH (40 μM) for 2 h (B) and 4 h (C) were evaluated in DMEM-5% FBS in the following conditions: basal respiration; after inhibition of ATP synthase with oligomycin (uncoupled respiration – Uncoup.); upon titration with FCCP (maximum respiration – Max); and after inhibition of the respiratory complex III with antimycin A (residual respiration – Rox). Data are represented as mean ± SEM (n = 4) * p

    Techniques Used: Incubation, Inhibition, Titration

    5) Product Images from "Effects of Betaine on LPS-Stimulated Activation of Microglial M1/M2 Phenotypes by Suppressing TLR4/NF-κB Pathways in N9 Cells"

    Article Title: Effects of Betaine on LPS-Stimulated Activation of Microglial M1/M2 Phenotypes by Suppressing TLR4/NF-κB Pathways in N9 Cells

    Journal: Molecules

    doi: 10.3390/molecules24020367

    Betaine promoted microglial polarisation to the M2 phenotype in LPS-induced N9 microglial cells. Cells were treated with betaine (1 mM) or MIDO (10 μM) for 1 h and then incubated with or without LPS (1 μg/mL) for 24 h. ( A , B ) Cells were counterstained with anti-iNOS (M1 marker, red) and anti-CD206 (M2 marker, green) antibodies. Nuclei were stained with DAPI (blue), and fluorescence was observed by confocal microscopy. ( C ) Representative images of the fluorescence intensity of iNOS and CD206 with or without LPS treatment. ( D , E ) Expression of iNOS, Arg-1, and CD206 proteins was analysed by western blot analysis. MIDO was used as a positive control. Data are presented as the means ± SEM of three independent experiments. The control group included untreated cells. Untreated cells served as a control group. # p
    Figure Legend Snippet: Betaine promoted microglial polarisation to the M2 phenotype in LPS-induced N9 microglial cells. Cells were treated with betaine (1 mM) or MIDO (10 μM) for 1 h and then incubated with or without LPS (1 μg/mL) for 24 h. ( A , B ) Cells were counterstained with anti-iNOS (M1 marker, red) and anti-CD206 (M2 marker, green) antibodies. Nuclei were stained with DAPI (blue), and fluorescence was observed by confocal microscopy. ( C ) Representative images of the fluorescence intensity of iNOS and CD206 with or without LPS treatment. ( D , E ) Expression of iNOS, Arg-1, and CD206 proteins was analysed by western blot analysis. MIDO was used as a positive control. Data are presented as the means ± SEM of three independent experiments. The control group included untreated cells. Untreated cells served as a control group. # p

    Techniques Used: Incubation, Marker, Staining, Fluorescence, Confocal Microscopy, Expressing, Western Blot, Positive Control

    Effects of betaine on LPS-induced TLR4/NF-κΒ signal transduction in N9 microglia cells. Cells were treated with betaine (1 mM) or MIDO (10 μM) for 1 h and then incubated with or without LPS (1 μg/mL) for 24 h. ( A ) Determination of TLR4/Myd88 protein levels by western blot analysis. ( B – D ) Determination of IKK-β, P-IKK-β, IκΒ-α, P-IκΒ-α, NF-κΒ, and p-NF-κΒ protein levels by western blot analysis. MIDO was used as a positive control. Data are presented as the means ± SEM of three independent experiments. The control group included untreated cells. Untreated cells served as a control group. # p
    Figure Legend Snippet: Effects of betaine on LPS-induced TLR4/NF-κΒ signal transduction in N9 microglia cells. Cells were treated with betaine (1 mM) or MIDO (10 μM) for 1 h and then incubated with or without LPS (1 μg/mL) for 24 h. ( A ) Determination of TLR4/Myd88 protein levels by western blot analysis. ( B – D ) Determination of IKK-β, P-IKK-β, IκΒ-α, P-IκΒ-α, NF-κΒ, and p-NF-κΒ protein levels by western blot analysis. MIDO was used as a positive control. Data are presented as the means ± SEM of three independent experiments. The control group included untreated cells. Untreated cells served as a control group. # p

    Techniques Used: Transduction, Incubation, Western Blot, Positive Control

    Effects of betaine on LPS-induced inflammatory cytokine and NO release in N9 microglial cells. Cells were treated with betaine or MIDO (10 μM) for 1 h and then incubated with or without LPS (1 μg/mL) for 24 h. ( A ) NO concentration in the supernatants was measured by NO one-step detection kit. ( B – E ) Levels of TNF-α, IL-6, IL-1β, and IL-10 in the supernatants were determined by ELISA. MIDO was used as a positive control. Data are presented as the means ± SEM of three independent experiments. The control group included untreated cells. Untreated cells served as a control group. # p
    Figure Legend Snippet: Effects of betaine on LPS-induced inflammatory cytokine and NO release in N9 microglial cells. Cells were treated with betaine or MIDO (10 μM) for 1 h and then incubated with or without LPS (1 μg/mL) for 24 h. ( A ) NO concentration in the supernatants was measured by NO one-step detection kit. ( B – E ) Levels of TNF-α, IL-6, IL-1β, and IL-10 in the supernatants were determined by ELISA. MIDO was used as a positive control. Data are presented as the means ± SEM of three independent experiments. The control group included untreated cells. Untreated cells served as a control group. # p

    Techniques Used: Incubation, Concentration Assay, Enzyme-linked Immunosorbent Assay, Positive Control

    Effects of betaine on LPS-induced protein expression of CD16/32 and CD206 in N9 microglial cells. N9 microglial cells was treated with betaine (1 mM) or MIDO (10 μM) for 1 h and then incubated with or without LPS (1 μg/mL) for 24 h. ( A , C ) CD16/32 (M1) and CD206 (M2) protein expression levels were determined by flow cytometry. ( B , D ) The expression levels of CD16/32 and CD206 with or without LPS treatment were compared. Control is set as 1. ( E ) Quantitative positive cells of an overlay of “control” with each of the treatments. MIDO was used as a positive control. Data are presented as the means ± SEM of three independent experiments. The control group included untreated cells. Untreated cells served as a control group. # p
    Figure Legend Snippet: Effects of betaine on LPS-induced protein expression of CD16/32 and CD206 in N9 microglial cells. N9 microglial cells was treated with betaine (1 mM) or MIDO (10 μM) for 1 h and then incubated with or without LPS (1 μg/mL) for 24 h. ( A , C ) CD16/32 (M1) and CD206 (M2) protein expression levels were determined by flow cytometry. ( B , D ) The expression levels of CD16/32 and CD206 with or without LPS treatment were compared. Control is set as 1. ( E ) Quantitative positive cells of an overlay of “control” with each of the treatments. MIDO was used as a positive control. Data are presented as the means ± SEM of three independent experiments. The control group included untreated cells. Untreated cells served as a control group. # p

    Techniques Used: Expressing, Incubation, Flow Cytometry, Cytometry, Positive Control

    Effects of betaine on the viability and morphological changes of N9 microglial cells with or without LPS stimulation. ( A ) Effects of betaine alone on cell viability. ( B ) Effects of lipopolysaccharide (LPS) alone on cell viability. ( C ) Effects of betaine with or without LPS stimulation on cell viability. Cells were treated with betaine or MIDO (10 μM) for 1 h and then stimulated with LPS (1 μg/mL) for 24 h. ( D ) Effects of betaine with or without LPS stimulation on morphological changes. MIDO was used as a positive control. Data are presented as the means ± SEM of three independent experiments. Untreated cells served as a control group. * p
    Figure Legend Snippet: Effects of betaine on the viability and morphological changes of N9 microglial cells with or without LPS stimulation. ( A ) Effects of betaine alone on cell viability. ( B ) Effects of lipopolysaccharide (LPS) alone on cell viability. ( C ) Effects of betaine with or without LPS stimulation on cell viability. Cells were treated with betaine or MIDO (10 μM) for 1 h and then stimulated with LPS (1 μg/mL) for 24 h. ( D ) Effects of betaine with or without LPS stimulation on morphological changes. MIDO was used as a positive control. Data are presented as the means ± SEM of three independent experiments. Untreated cells served as a control group. * p

    Techniques Used: Positive Control

    6) Product Images from "Conformational signatures in β-arrestin2 reveal natural biased agonism at a G-protein-coupled receptor"

    Article Title: Conformational signatures in β-arrestin2 reveal natural biased agonism at a G-protein-coupled receptor

    Journal: Communications Biology

    doi: 10.1038/s42003-018-0134-3

    Internalization of Galr2. a Schematic representation of the internalization assay. Only the SmBiT-High-affinity:Galr2 remained in the cell surface after ligand stimulation can bind to LgBit to produce the luminescent signal. b HEK293 cells transiently transfected with 0.5 ng/well of Galr2 containing the SmBiT-High-affinity tag at the N termini. Before ligand stimulation, cells were pretreated with 30 μM Cmpd101 (a GRK2/3 inhibitor) for 30 min, 25 μM PitStop 2 (a Clathrin inhibitor) for 15 min, and 80 μM Dynasore (a Dynamin inhibitor) for 40 min. Cells were then treated with different concentrations of Galanin, Spexin, and Fmoc-dA4-dQ14 for 30 min. Remaining cell surface receptors were determined by measuring the luminescent signal produced by the binding between LgBiT and the Galr2-SmBiT-High affinity. Each data point represents mean ± s. e. m. of two independent experiments performed in triplicate
    Figure Legend Snippet: Internalization of Galr2. a Schematic representation of the internalization assay. Only the SmBiT-High-affinity:Galr2 remained in the cell surface after ligand stimulation can bind to LgBit to produce the luminescent signal. b HEK293 cells transiently transfected with 0.5 ng/well of Galr2 containing the SmBiT-High-affinity tag at the N termini. Before ligand stimulation, cells were pretreated with 30 μM Cmpd101 (a GRK2/3 inhibitor) for 30 min, 25 μM PitStop 2 (a Clathrin inhibitor) for 15 min, and 80 μM Dynasore (a Dynamin inhibitor) for 40 min. Cells were then treated with different concentrations of Galanin, Spexin, and Fmoc-dA4-dQ14 for 30 min. Remaining cell surface receptors were determined by measuring the luminescent signal produced by the binding between LgBiT and the Galr2-SmBiT-High affinity. Each data point represents mean ± s. e. m. of two independent experiments performed in triplicate

    Techniques Used: Transfection, Produced, Binding Assay

    7) Product Images from "Haemophilus parasuis Infection Disrupts Adherens Junctions and Initializes EMT Dependent on Canonical Wnt/β-Catenin Signaling Pathway"

    Article Title: Haemophilus parasuis Infection Disrupts Adherens Junctions and Initializes EMT Dependent on Canonical Wnt/β-Catenin Signaling Pathway

    Journal: Frontiers in Cellular and Infection Microbiology

    doi: 10.3389/fcimb.2018.00324

    The high-virulence H. parasuis infection activated the Wnt/β-catenin signaling pathway in PK-15 and NPTr cells. (A,B) PK-15 cells (A) and NPTr cells (B) transfected with TOPflash or FOPflash were stimulated or unstimulated with H. parasuis strains (10 6 , 10 7 , or 10 8 CFU/mL) or LiCl (20 mM) for 24 h. Cells were lysed and TCF transcriptional activity was determined by TOPflash/FOPflash ratio after normalization with Renilla. Representative results of three independent experiments are shown as the mean +/− SD ( n = 3). ** p
    Figure Legend Snippet: The high-virulence H. parasuis infection activated the Wnt/β-catenin signaling pathway in PK-15 and NPTr cells. (A,B) PK-15 cells (A) and NPTr cells (B) transfected with TOPflash or FOPflash were stimulated or unstimulated with H. parasuis strains (10 6 , 10 7 , or 10 8 CFU/mL) or LiCl (20 mM) for 24 h. Cells were lysed and TCF transcriptional activity was determined by TOPflash/FOPflash ratio after normalization with Renilla. Representative results of three independent experiments are shown as the mean +/− SD ( n = 3). ** p

    Techniques Used: Infection, Transfection, Activity Assay

    8) Product Images from "Generating inner ear organoids containing putative cochlear hair cells from human pluripotent stem cells"

    Article Title: Generating inner ear organoids containing putative cochlear hair cells from human pluripotent stem cells

    Journal: Cell Death & Disease

    doi: 10.1038/s41419-018-0967-1

    Generating otic organoids. a Schematic overview of the 90-day protocol used to generate otic organoids containing putative cochlear/vestibular hair cells and sensory neurons. GMEM Eagle’s Minimal Essential Medium, KOSR knockout serum replacement, NEAA nonessential amino-acids, SP sodium pyruvate, P/S penicillin/streptomycin, BME 2-mercaptoethanol, RI Y-27632, BMP BMP4, SB SB-431542, LDN LDN-193189, FGF FGF2. b , c Representative examples of 3D otic vesicles (indicated by white arrows) obtained between days 16 and 36 from hESC (H9) ( b ) and from hiPSC (SB-Ad3) ( c ). Pictures shown are representative of at least four independent experiments ( n = 4). Scale bars represent 50 μm
    Figure Legend Snippet: Generating otic organoids. a Schematic overview of the 90-day protocol used to generate otic organoids containing putative cochlear/vestibular hair cells and sensory neurons. GMEM Eagle’s Minimal Essential Medium, KOSR knockout serum replacement, NEAA nonessential amino-acids, SP sodium pyruvate, P/S penicillin/streptomycin, BME 2-mercaptoethanol, RI Y-27632, BMP BMP4, SB SB-431542, LDN LDN-193189, FGF FGF2. b , c Representative examples of 3D otic vesicles (indicated by white arrows) obtained between days 16 and 36 from hESC (H9) ( b ) and from hiPSC (SB-Ad3) ( c ). Pictures shown are representative of at least four independent experiments ( n = 4). Scale bars represent 50 μm

    Techniques Used: Knock-Out

    9) Product Images from "In renal cell carcinoma the PTEN splice variant PTEN-Δ shows similar function as the tumor suppressor PTEN itself"

    Article Title: In renal cell carcinoma the PTEN splice variant PTEN-Δ shows similar function as the tumor suppressor PTEN itself

    Journal: Cell Communication and Signaling : CCS

    doi: 10.1186/s12964-018-0247-9

    Influence of PTEN-Δ and PTEN on the functional behavior of renal tumor cells. a Migration of PTEN-Δ or PTEN transfected 786-O and A498 cells was determined in a Boyden chamber using ECM compounds as chemotaxins (FN: Fibronectin, VN: Vitronectin, LM: Laminin, CI: Collagen I and CIV: Collagen IV). Differences are shown in percentage of control cells (pcDNA3 transfected cells). b Cell adhesion of PTEN-Δ or PTEN transfected 786-O and A498 cells on immobilized ECM compounds were determined. BSA was used as control (Data not shown). Differences are shown in percentage of control cells (pcDNA3 transfected cells). c Apoptosis values of PTEN-Δ or PTEN transfected 786-O and A498 cells were quantified by determination of cytoplasmic histone-associated DNA fragments (Cell death detection assay, Roche). Differences are shown in percentage of control cells (pcDNA3 transfected cells). Significance was calculated by Student‘s T-test, * p
    Figure Legend Snippet: Influence of PTEN-Δ and PTEN on the functional behavior of renal tumor cells. a Migration of PTEN-Δ or PTEN transfected 786-O and A498 cells was determined in a Boyden chamber using ECM compounds as chemotaxins (FN: Fibronectin, VN: Vitronectin, LM: Laminin, CI: Collagen I and CIV: Collagen IV). Differences are shown in percentage of control cells (pcDNA3 transfected cells). b Cell adhesion of PTEN-Δ or PTEN transfected 786-O and A498 cells on immobilized ECM compounds were determined. BSA was used as control (Data not shown). Differences are shown in percentage of control cells (pcDNA3 transfected cells). c Apoptosis values of PTEN-Δ or PTEN transfected 786-O and A498 cells were quantified by determination of cytoplasmic histone-associated DNA fragments (Cell death detection assay, Roche). Differences are shown in percentage of control cells (pcDNA3 transfected cells). Significance was calculated by Student‘s T-test, * p

    Techniques Used: Functional Assay, Migration, Transfection, Detection Assay

    10) Product Images from "Early myeloid-derived suppressor cells (HLA-DR−/lowCD33+CD16−) expanded by granulocyte colony-stimulating factor prevent acute graft-versus-host disease (GVHD) in humanized mouse and might contribute to lower GVHD in patients post allo-HSCT"

    Article Title: Early myeloid-derived suppressor cells (HLA-DR−/lowCD33+CD16−) expanded by granulocyte colony-stimulating factor prevent acute graft-versus-host disease (GVHD) in humanized mouse and might contribute to lower GVHD in patients post allo-HSCT

    Journal: Journal of Hematology & Oncology

    doi: 10.1186/s13045-019-0710-0

    HLA-DR −/low CD33 + CD16 −  myeloid cells expanded in PB and PBSC after G-CSF administration and exerted a strong immunosuppressive effect on T cell proliferation.  a ,  b  The frequency and cell number of different kind of MDSCs and HLA-DR −/low CD33 + CD16 −  population in ten donors (H-PB, G-PB, G-PBSC) were analyzed by flow cytometry.  c  Gate strategies of HLA-DR −/low CD33 + CD16 − : FSC, forward scatter; SSC, side scatter.  d  The proportion of HLA-DR −/low CD33 + CD16 −  in the CD45 +  fraction from the ten healthy donor’s HPB, GPB, and GPBSC (medians of the different groups were 4.6%, 6.5%, and 15.5% of total CD45+cells, Mann-Whitney  t  test).  e  May-Grünwald-Giemsa cytospin preparations show morphological features of HLA-DR −/low CD33 + CD16 − .  f  T cell proliferation was examined using CFSE dilution. HLA-DR −/low CD33 + CD16 −  and CD3 +  T cells from the same donor G-PBSC were co-cultured at different ratios for 4 days with anti-CD3/CD28 beads. T cell proliferation was evaluated using CFSE labeling. Unstimulating T cells were negative control. The picture shows the representative results.  g  The percentage of T cells in suppression was shown in different groups. Data was compared using unpaired  t  test (ns, not significant)
    Figure Legend Snippet: HLA-DR −/low CD33 + CD16 − myeloid cells expanded in PB and PBSC after G-CSF administration and exerted a strong immunosuppressive effect on T cell proliferation. a , b The frequency and cell number of different kind of MDSCs and HLA-DR −/low CD33 + CD16 − population in ten donors (H-PB, G-PB, G-PBSC) were analyzed by flow cytometry. c Gate strategies of HLA-DR −/low CD33 + CD16 − : FSC, forward scatter; SSC, side scatter. d The proportion of HLA-DR −/low CD33 + CD16 − in the CD45 + fraction from the ten healthy donor’s HPB, GPB, and GPBSC (medians of the different groups were 4.6%, 6.5%, and 15.5% of total CD45+cells, Mann-Whitney t test). e May-Grünwald-Giemsa cytospin preparations show morphological features of HLA-DR −/low CD33 + CD16 − . f T cell proliferation was examined using CFSE dilution. HLA-DR −/low CD33 + CD16 − and CD3 + T cells from the same donor G-PBSC were co-cultured at different ratios for 4 days with anti-CD3/CD28 beads. T cell proliferation was evaluated using CFSE labeling. Unstimulating T cells were negative control. The picture shows the representative results. g The percentage of T cells in suppression was shown in different groups. Data was compared using unpaired t test (ns, not significant)

    Techniques Used: Flow Cytometry, Cytometry, MANN-WHITNEY, Cell Culture, Labeling, Negative Control

    The percentage of IL-10 +  and TGF-β +  cells increased in HLA-DR −/low CD33 + CD16 −  cells in GPBSC and HLA-DR −/low CD33 + CD16 −  cells suppressed T cell proliferation in a TGF-β-dependent manner.  a ,  b  IL-10 and TGF-β were analyzed by cytometry in HPB and GPBSC from eight healthy donors. IL-10 +  and TGF-β +  cells were gated on HLA-DR −/low CD33 + CD16 − cells.  c  HLA-DR −/low CD33 + CD16 −  cells sorted from GPBSC and co-cultured with autologous CD3 +  T cells, with or without anti-IL-10 antibody or anti-TGF-β antibody in culture system in the presence of anti-CD3/CD28 beads. The ratio of HLA-DR −/low CD33 + CD16 −  to CD3 +  T cells was 1:1. Co-cultured for 4 days, T cell proliferation was evaluated using CFSE labeling. Unstimulated T cells were used as a negative control. Stimulated T cells were used as a positive control.  d  The percentage of T cell suppression was shown in a different group. Data were compared using Student’s unpaired  t  test (ns, not significant; * p  ≤ 0.05).  d  Percentages of T cell suppression in different groups. Data were compared using Student’s unpaired  t  test (ns, not significant; * p  ≤ 0.05)
    Figure Legend Snippet: The percentage of IL-10 + and TGF-β + cells increased in HLA-DR −/low CD33 + CD16 − cells in GPBSC and HLA-DR −/low CD33 + CD16 − cells suppressed T cell proliferation in a TGF-β-dependent manner. a , b IL-10 and TGF-β were analyzed by cytometry in HPB and GPBSC from eight healthy donors. IL-10 + and TGF-β + cells were gated on HLA-DR −/low CD33 + CD16 − cells. c HLA-DR −/low CD33 + CD16 − cells sorted from GPBSC and co-cultured with autologous CD3 + T cells, with or without anti-IL-10 antibody or anti-TGF-β antibody in culture system in the presence of anti-CD3/CD28 beads. The ratio of HLA-DR −/low CD33 + CD16 − to CD3 + T cells was 1:1. Co-cultured for 4 days, T cell proliferation was evaluated using CFSE labeling. Unstimulated T cells were used as a negative control. Stimulated T cells were used as a positive control. d The percentage of T cell suppression was shown in a different group. Data were compared using Student’s unpaired t test (ns, not significant; * p  ≤ 0.05). d Percentages of T cell suppression in different groups. Data were compared using Student’s unpaired t test (ns, not significant; * p  ≤ 0.05)

    Techniques Used: Cytometry, Cell Culture, Labeling, Negative Control, Positive Control

    HLA-DR −/low CD33 + CD16 −  cells could affect the balance of Th subsets induce Treg generation . a  Treg (CD4 + CD25 + Foxp3 + ) generation was detected through flow cytometry. CD3 +  T cells were co-cultured with or without HLA-DR −/low CD33 +  CD16 −  cells for 4 days.  b  The percentage of Treg in CD4 +  T cell, group HLA-DR −/low CD33 + CD16 −  vs. control,  p  = 0.0048.  c  Flow cytometry analysis of Th1 (CD4 + IFN-γ + ), Th2 (CD4 + IL-4 + ), Th17 (CD4 + IL-17a + ). CD3 +  T cells were co-cultured with or without HLA-DR −/low CD33 + CD16 −  cells sorted from GPBSC in the presence of CD3/CD28 for 4 days. Red for CD4+ cell fraction and blue for CD4-negative part.  d  Th2/Th1 ratio fold change compared with the control group,  p  = 0.0159.  e  Th2/(Th1+Th17) ratio fold change compared with the control group,  p  = 0.0095
    Figure Legend Snippet: HLA-DR −/low CD33 + CD16 − cells could affect the balance of Th subsets induce Treg generation . a Treg (CD4 + CD25 + Foxp3 + ) generation was detected through flow cytometry. CD3 + T cells were co-cultured with or without HLA-DR −/low CD33 + CD16 − cells for 4 days. b The percentage of Treg in CD4 + T cell, group HLA-DR −/low CD33 + CD16 − vs. control, p  = 0.0048. c Flow cytometry analysis of Th1 (CD4 + IFN-γ + ), Th2 (CD4 + IL-4 + ), Th17 (CD4 + IL-17a + ). CD3 + T cells were co-cultured with or without HLA-DR −/low CD33 + CD16 − cells sorted from GPBSC in the presence of CD3/CD28 for 4 days. Red for CD4+ cell fraction and blue for CD4-negative part. d Th2/Th1 ratio fold change compared with the control group, p  = 0.0159. e Th2/(Th1+Th17) ratio fold change compared with the control group, p  = 0.0095

    Techniques Used: Flow Cytometry, Cytometry, Cell Culture

    11) Product Images from "Human B Cells Engage the NCK/PI3K/RAC1 Axis to Internalize Large Particles via the IgM-BCR"

    Article Title: Human B Cells Engage the NCK/PI3K/RAC1 Axis to Internalize Large Particles via the IgM-BCR

    Journal: Frontiers in Immunology

    doi: 10.3389/fimmu.2019.00415

    NCK facilitates IgM-BCR-mediated activation of RAC1 subsequent large particle binding. (A,B) Proportion of internalization within S. typhimurium + primary human B cells (A) and Ramos B cells (B) after treatment with a RAC1 inhibitor ( n = 5). (C) Schematic illustration of the Cerulean3-CRIB-Venus-RAC1 FRET sensor. Inactive GDP-bound RAC1 results in a large distance between the two fluorescent proteins without a FRET signal. Active GTP-bound RAC1 binds the CDC42/RAC1-interactive binding (CRIB) motif of PAK1, which brings the two fluorescent proteins into close proximity resulting in high FRET efficiency. (D) Time-lapse Venus/Cerulean3 ratio images of the RAC1 DORA biosensor showing spatiotemporal RAC1 activation upon stimulation with anti-IgM-coated S. typhimurium expressing dsRed (magenta). Bar, 5 μm. The boxed region at the upper panel is enlarged at the middle panels. Lower panels show RAC1 biosensor FRET ratio images with dashed lines marking S. typhimurium localization. Time indicated in minutes. Calibration bar shows RAC1 activation (red) relative to basal RAC1 activity (blue). (E,F) Representative activation ratio (E) and quantification (F) of the RAC1 biosensor in time. The activation ratio was assessed at the membrane as compared to the cytoplasm in close proximity to the particle contact area before, during and after S. typhimurium internalization ( n = 3 independent experiments). (G,H) Immunoblot and quantification of GTP-bound RAC1 precipitated from whole cell extracts of wild type and NCK KO Ramos B cells that were unstimulated (−) or stimulated with anti-IgM-coated S. typhimurium for 5, 10, 20, and 30 min. Total Rac1 levels from whole cell extracts were determined to control precipitation input (representative of n = 2 independent experiments). Bars depict mean values and error bars are SEM. Each data point represents the mean of an individual experiment with duplicate measurements. * P
    Figure Legend Snippet: NCK facilitates IgM-BCR-mediated activation of RAC1 subsequent large particle binding. (A,B) Proportion of internalization within S. typhimurium + primary human B cells (A) and Ramos B cells (B) after treatment with a RAC1 inhibitor ( n = 5). (C) Schematic illustration of the Cerulean3-CRIB-Venus-RAC1 FRET sensor. Inactive GDP-bound RAC1 results in a large distance between the two fluorescent proteins without a FRET signal. Active GTP-bound RAC1 binds the CDC42/RAC1-interactive binding (CRIB) motif of PAK1, which brings the two fluorescent proteins into close proximity resulting in high FRET efficiency. (D) Time-lapse Venus/Cerulean3 ratio images of the RAC1 DORA biosensor showing spatiotemporal RAC1 activation upon stimulation with anti-IgM-coated S. typhimurium expressing dsRed (magenta). Bar, 5 μm. The boxed region at the upper panel is enlarged at the middle panels. Lower panels show RAC1 biosensor FRET ratio images with dashed lines marking S. typhimurium localization. Time indicated in minutes. Calibration bar shows RAC1 activation (red) relative to basal RAC1 activity (blue). (E,F) Representative activation ratio (E) and quantification (F) of the RAC1 biosensor in time. The activation ratio was assessed at the membrane as compared to the cytoplasm in close proximity to the particle contact area before, during and after S. typhimurium internalization ( n = 3 independent experiments). (G,H) Immunoblot and quantification of GTP-bound RAC1 precipitated from whole cell extracts of wild type and NCK KO Ramos B cells that were unstimulated (−) or stimulated with anti-IgM-coated S. typhimurium for 5, 10, 20, and 30 min. Total Rac1 levels from whole cell extracts were determined to control precipitation input (representative of n = 2 independent experiments). Bars depict mean values and error bars are SEM. Each data point represents the mean of an individual experiment with duplicate measurements. * P

    Techniques Used: Activation Assay, Binding Assay, Expressing, Activity Assay

    IgM - BCR-mediated signaling through SYK and PI3K facilitate large particle internalization. (A–C) Proportion of internalization within S. typhimurium + primary human B cells after treatment with inhibitors of LYN [ (A) ; n = 4], SYK [ (B) ; n = 6] or PI3K [ (C) ; n = 7]. (D) Heatmap of the mean proportion of internalization within S. typhimurium + or 3μm polystyrene bead + primary human B cells and Ramos B cells after treatment with inhibitors of LYN, SYK, PI3K, BTK, or AKT. Heatmap colors indicate effect on internalization. (E) Immunoblot of whole cell extracts from Ramos B cells that were unstimulated (−) or stimulated (+) with S. typhimurium after incubation with inhibitors of SYK (Piceatannol) or PI3K (LY294002). The blots were probed with specific antibodies for pAKT at S473 and AKT. (F,G) Proportion of internalization within S. typhimurium + primary human B cells after treatment with inhibitors of AKT [ (F) ; n = 4 and 9] or BTK [ (G) ; n = 8 and 5]. (H) Representative images of Ramos B cells expressing GFP-tagged HLA-DOβ having internalized S. typhimurium. S. typhimurium -containing phagosomes localize to the HLA-DOβ-containing MHC class II-antigen loading compartments. Bar, 7μm. (I) Representative plots (top) and quantification (bottom) of the proportion of proliferated CD4 + T cells after co-culture with S. typhimurium- primed autologous primary human B cells that were treated with inhibitors ( n = 7). All data points represent the mean of an individual experiment with duplicate measurements. Error bars indicate SEM. * P
    Figure Legend Snippet: IgM - BCR-mediated signaling through SYK and PI3K facilitate large particle internalization. (A–C) Proportion of internalization within S. typhimurium + primary human B cells after treatment with inhibitors of LYN [ (A) ; n = 4], SYK [ (B) ; n = 6] or PI3K [ (C) ; n = 7]. (D) Heatmap of the mean proportion of internalization within S. typhimurium + or 3μm polystyrene bead + primary human B cells and Ramos B cells after treatment with inhibitors of LYN, SYK, PI3K, BTK, or AKT. Heatmap colors indicate effect on internalization. (E) Immunoblot of whole cell extracts from Ramos B cells that were unstimulated (−) or stimulated (+) with S. typhimurium after incubation with inhibitors of SYK (Piceatannol) or PI3K (LY294002). The blots were probed with specific antibodies for pAKT at S473 and AKT. (F,G) Proportion of internalization within S. typhimurium + primary human B cells after treatment with inhibitors of AKT [ (F) ; n = 4 and 9] or BTK [ (G) ; n = 8 and 5]. (H) Representative images of Ramos B cells expressing GFP-tagged HLA-DOβ having internalized S. typhimurium. S. typhimurium -containing phagosomes localize to the HLA-DOβ-containing MHC class II-antigen loading compartments. Bar, 7μm. (I) Representative plots (top) and quantification (bottom) of the proportion of proliferated CD4 + T cells after co-culture with S. typhimurium- primed autologous primary human B cells that were treated with inhibitors ( n = 7). All data points represent the mean of an individual experiment with duplicate measurements. Error bars indicate SEM. * P

    Techniques Used: Incubation, Expressing, Co-Culture Assay

    The adaptor protein NCK is required for PI3K activity to facilitate IgM-BCR-induced internalization of large particles. (A) Representative histogram of CD19 expression in wild type and CD19 KO Ramos B cells. (B) Immunoblot of whole cell extracts from wild type and NCK KO Ramos B cells probed with NCK- or cofilin-specific (loading control) antibodies. (C) Representative histogram of surface IgM expression in wild type, CD19 KO and NCK KO Ramos B cells. (D,E) Proportion of internalization within S. typhimurium + CD19 KO (D) and NCK KO (E) Ramos B cells compared with wild type ( n = 4). (F,G) Representative histograms (F) and quantification [ (G) ; left] of the proportion of internalization within S. typhimurium + wild type, CD19 KO and NCK KO Ramos B cells in time ( n = 3). The area under the curve was obtained to quantify internalization in time [ (G) ; right]. (H–J) Proportion of internalization within S. typhimurium + wild type (H) , CD19 KO (I) and NCK KO (J) Ramos B cells after treatment with a PI3K inhibitor ( n = 4). (K) Immunoblot of whole cell extracts from wild type, CD19 KO and NCK KO Ramos B cells that were unstimulated (−) or stimulated (+) with S. typhimurium . The blots were probed with specific antibodies against pAKT at S473 and AKT. (L,M) Proportion of internalization within S. typhimurium + (L) , 3μm polystyrene bead + (N) and soluble anti-IgM + (M) wild type, CD19 KO and NCK KO Ramos B cells ( n = 2). Each data point represents the mean of an individual experiment with duplicate measurements. Error bars indicate SEM. * P
    Figure Legend Snippet: The adaptor protein NCK is required for PI3K activity to facilitate IgM-BCR-induced internalization of large particles. (A) Representative histogram of CD19 expression in wild type and CD19 KO Ramos B cells. (B) Immunoblot of whole cell extracts from wild type and NCK KO Ramos B cells probed with NCK- or cofilin-specific (loading control) antibodies. (C) Representative histogram of surface IgM expression in wild type, CD19 KO and NCK KO Ramos B cells. (D,E) Proportion of internalization within S. typhimurium + CD19 KO (D) and NCK KO (E) Ramos B cells compared with wild type ( n = 4). (F,G) Representative histograms (F) and quantification [ (G) ; left] of the proportion of internalization within S. typhimurium + wild type, CD19 KO and NCK KO Ramos B cells in time ( n = 3). The area under the curve was obtained to quantify internalization in time [ (G) ; right]. (H–J) Proportion of internalization within S. typhimurium + wild type (H) , CD19 KO (I) and NCK KO (J) Ramos B cells after treatment with a PI3K inhibitor ( n = 4). (K) Immunoblot of whole cell extracts from wild type, CD19 KO and NCK KO Ramos B cells that were unstimulated (−) or stimulated (+) with S. typhimurium . The blots were probed with specific antibodies against pAKT at S473 and AKT. (L,M) Proportion of internalization within S. typhimurium + (L) , 3μm polystyrene bead + (N) and soluble anti-IgM + (M) wild type, CD19 KO and NCK KO Ramos B cells ( n = 2). Each data point represents the mean of an individual experiment with duplicate measurements. Error bars indicate SEM. * P

    Techniques Used: Activity Assay, Expressing

    IgM - BCR-mediated large particle internalization is an actin-dependent process. (A–C) Proportion of internalization within S. typhimurium + (A,B) or polystyrene bead + (C) primary human B cells [ (A) ; n = 9], and Ramos B cells [ (B) ; n = 16, (C) ; n = 5] after treatment with cytochalisin (B) . (D) Representative confocal still-images at different time points imaging internalization of anti-IgM-coated polystyrene beads by Ramos B cells expressing Lifeact-GFP. Arrowhead, clusters of actin driving internalization. Bar, 10 μm. The boxed region at the upper panels is enlarged at the lower panels. Each data point represents the mean of an individual experiment with duplicate measurements. ** P
    Figure Legend Snippet: IgM - BCR-mediated large particle internalization is an actin-dependent process. (A–C) Proportion of internalization within S. typhimurium + (A,B) or polystyrene bead + (C) primary human B cells [ (A) ; n = 9], and Ramos B cells [ (B) ; n = 16, (C) ; n = 5] after treatment with cytochalisin (B) . (D) Representative confocal still-images at different time points imaging internalization of anti-IgM-coated polystyrene beads by Ramos B cells expressing Lifeact-GFP. Arrowhead, clusters of actin driving internalization. Bar, 10 μm. The boxed region at the upper panels is enlarged at the lower panels. Each data point represents the mean of an individual experiment with duplicate measurements. ** P

    Techniques Used: Imaging, Expressing

    IgM - BCR stimulation specifically promotes large particle internalization. (A) Proportion of primary human B cells interacting with control or anti-IgM-coated S. typhimurium ( n = 9). (B) Schematics of a B cell: S. typhimurium interaction. Internalization was assessed using a high-throughput quantitative image analysis approach for S. typhimurium located in the same focal plane as the human B cell only. (C) To discriminate between bound and internalized S. typhimurium , analysis masks were generated to determine the center of both the B cell and S. typhimurium . Internalization was defined as the distance between the two centroids (left) after correction for the B cell radius as a measure for the cell size (middle). Internalization was plotted against the event count (right). The red/blue shadings behind the plot indicate the portion of cells that bound (blue) or internalized (red) large particles. Events that had a calculated value similar to or > 2 were defined as being internalized. (D) Representative images of primary human B cells containing bound (left) or internalized (right) S. typhimurium . Bar, 7 μm. (E) Proportion of internalization of control or anti-IgM-coated S. typhimurium within Salmonella + primary human B cells ( n = 9). (F) Representative plots (left) and images (right) of S. typhimurium opsonized with antibodies (IgG) or together with complement (C3d) derived from human serum. Bar, 7 μm. (G–H) Proportion of primary human B cells that interacted with (G) and internalized (H) serum-opsonized S. typhimurium ( n = 9). Bars depict mean values and error bars are SEM. *** P
    Figure Legend Snippet: IgM - BCR stimulation specifically promotes large particle internalization. (A) Proportion of primary human B cells interacting with control or anti-IgM-coated S. typhimurium ( n = 9). (B) Schematics of a B cell: S. typhimurium interaction. Internalization was assessed using a high-throughput quantitative image analysis approach for S. typhimurium located in the same focal plane as the human B cell only. (C) To discriminate between bound and internalized S. typhimurium , analysis masks were generated to determine the center of both the B cell and S. typhimurium . Internalization was defined as the distance between the two centroids (left) after correction for the B cell radius as a measure for the cell size (middle). Internalization was plotted against the event count (right). The red/blue shadings behind the plot indicate the portion of cells that bound (blue) or internalized (red) large particles. Events that had a calculated value similar to or > 2 were defined as being internalized. (D) Representative images of primary human B cells containing bound (left) or internalized (right) S. typhimurium . Bar, 7 μm. (E) Proportion of internalization of control or anti-IgM-coated S. typhimurium within Salmonella + primary human B cells ( n = 9). (F) Representative plots (left) and images (right) of S. typhimurium opsonized with antibodies (IgG) or together with complement (C3d) derived from human serum. Bar, 7 μm. (G–H) Proportion of primary human B cells that interacted with (G) and internalized (H) serum-opsonized S. typhimurium ( n = 9). Bars depict mean values and error bars are SEM. *** P

    Techniques Used: High Throughput Screening Assay, Generated, Derivative Assay

    12) Product Images from "Myc-induced nuclear antigen constrains a latent intestinal epithelial cell-intrinsic anthelmintic pathway"

    Article Title: Myc-induced nuclear antigen constrains a latent intestinal epithelial cell-intrinsic anthelmintic pathway

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0211244

    Th2 and Th1 response to TM in Mina KO mice. Shown are the percentage and absolute number of (A) CD4 + IL4 + cells and (B) CD4 + IFNγ + cells and (C) the level of secreted IL4 and IFNγ from mesenteric lymph node cells of Mina KO and WT littermate control mice infected 21 days earlier with 150 embryonated TM eggs. Data are mean ± SD (A: WT n = 8, KO n = 10 each, B: WT and KO: n = 15 and 14 each respectively, C: WT and KO n = 7 each respectively) from 2 independent experiments). Statistical significance was computed by the two-tailed Student’s t-test.
    Figure Legend Snippet: Th2 and Th1 response to TM in Mina KO mice. Shown are the percentage and absolute number of (A) CD4 + IL4 + cells and (B) CD4 + IFNγ + cells and (C) the level of secreted IL4 and IFNγ from mesenteric lymph node cells of Mina KO and WT littermate control mice infected 21 days earlier with 150 embryonated TM eggs. Data are mean ± SD (A: WT n = 8, KO n = 10 each, B: WT and KO: n = 15 and 14 each respectively, C: WT and KO n = 7 each respectively) from 2 independent experiments). Statistical significance was computed by the two-tailed Student’s t-test.

    Techniques Used: Mouse Assay, Infection, Two Tailed Test

    13) Product Images from "MiR-590 Inhibits Endothelial Cell Apoptosis by Inactivating the TLR4/NF-κB Pathway in Atherosclerosis"

    Article Title: MiR-590 Inhibits Endothelial Cell Apoptosis by Inactivating the TLR4/NF-κB Pathway in Atherosclerosis

    Journal: Yonsei Medical Journal

    doi: 10.3349/ymj.2019.60.3.298

    The effects of miR-590 on atherosclerotic lesion in HFD-induced apoE −/− mice. ApoE −/− mice were fed on a HFD for 12 weeks and injected with miR-590 or miR-control via tail vein once every 4 weeks after starting HFD. (A) qRT -PCR analysis of miR-590 expression in the aorta derived from apoE −/− mice fed on a HFD or wild-type C57BL/6 J controls fed on a normal diet. U6 was used as the normalization. (B) qRT-PCR analysis of miR-590 expression in HFD-fed apoE −/− mice injected with miR-590 or miR-control. U6 was used as the normalization. (C) Western blot analysis of the protein levels of Pecam-1, α-SMA and Vimentin in apoE −/− mice fed on a HFD or wild-type C57BL/6 J controls fed on a normal diet. (D) Western blot analysis of the protein levels of Pecam-1, α-SMA and Vimentin HFD-fed apoE −/− mice injected with miR-590 or miR-control. (E) Atherosclerotic plaque formation in the resected aortic sinuses was assessed by Evans blue staining. (F) The atherosclerotic lesion in aortic sinuses was examined by hematoxylin and eosin staining (×40). * p
    Figure Legend Snippet: The effects of miR-590 on atherosclerotic lesion in HFD-induced apoE −/− mice. ApoE −/− mice were fed on a HFD for 12 weeks and injected with miR-590 or miR-control via tail vein once every 4 weeks after starting HFD. (A) qRT -PCR analysis of miR-590 expression in the aorta derived from apoE −/− mice fed on a HFD or wild-type C57BL/6 J controls fed on a normal diet. U6 was used as the normalization. (B) qRT-PCR analysis of miR-590 expression in HFD-fed apoE −/− mice injected with miR-590 or miR-control. U6 was used as the normalization. (C) Western blot analysis of the protein levels of Pecam-1, α-SMA and Vimentin in apoE −/− mice fed on a HFD or wild-type C57BL/6 J controls fed on a normal diet. (D) Western blot analysis of the protein levels of Pecam-1, α-SMA and Vimentin HFD-fed apoE −/− mice injected with miR-590 or miR-control. (E) Atherosclerotic plaque formation in the resected aortic sinuses was assessed by Evans blue staining. (F) The atherosclerotic lesion in aortic sinuses was examined by hematoxylin and eosin staining (×40). * p

    Techniques Used: Mouse Assay, Injection, Quantitative RT-PCR, Expressing, Derivative Assay, Western Blot, Staining

    The effects of miR-590 on the proliferation and apoptosis in ox-LDL-treated HAECs. (A) qRT-PCR analysis of miR-590 expression in HAECs following ox-LDL challenge. U6 was used as the normalization. (B) qRT-PCR analysis of miR-590 expression in HAECs transfected with miR-590, anti-miR-590, or matched controls, followed by ox-LDL treatment. U6 was used as the normalization. (C) MTT assay was performed to evaluate cell proliferation at 24, 48, and 72 h in HAECs transfected with miR-590, anti-miR-590, or matched controls, followed by ox-LDL stimulation. (D) Flow cytometry analysis was conducted to determine the percentage of HAEC apoptosis after transfection with miR-590, anti-miR-590, or matched controls, followed by ox-LDL administration. (E) Western blot was employed to detect the expression levels of Cleaved PARP and Cleaved-Caspase-3 in HAECs transfected with miR-590, anti-miR-590, or matched controls, followed by ox-LDL stimulation. * p
    Figure Legend Snippet: The effects of miR-590 on the proliferation and apoptosis in ox-LDL-treated HAECs. (A) qRT-PCR analysis of miR-590 expression in HAECs following ox-LDL challenge. U6 was used as the normalization. (B) qRT-PCR analysis of miR-590 expression in HAECs transfected with miR-590, anti-miR-590, or matched controls, followed by ox-LDL treatment. U6 was used as the normalization. (C) MTT assay was performed to evaluate cell proliferation at 24, 48, and 72 h in HAECs transfected with miR-590, anti-miR-590, or matched controls, followed by ox-LDL stimulation. (D) Flow cytometry analysis was conducted to determine the percentage of HAEC apoptosis after transfection with miR-590, anti-miR-590, or matched controls, followed by ox-LDL administration. (E) Western blot was employed to detect the expression levels of Cleaved PARP and Cleaved-Caspase-3 in HAECs transfected with miR-590, anti-miR-590, or matched controls, followed by ox-LDL stimulation. * p

    Techniques Used: Quantitative RT-PCR, Expressing, Transfection, MTT Assay, Flow Cytometry, Cytometry, Western Blot

    MiR-590 directly targets TLR4 in ox-LDL-treated HAECs. (A) Bioinformatics analysis of the predicted interaction of miR-590 in the 3′UTR of TLR4. (B) Luciferase activity was determined by luciferase reporter assay in HAECs cells co-transfected with TLR4-WT or TLR4-MUT and miR-590, anti-miR-590, or respective controls. (C) Western blot (left) was performed to detect the cellular protein level of TLR4 in HAECs with or without ox-LDL treatment, while TLR4 protein level on cell surface was evaluated by flow cytometry (right). (D) The cellular protein level of TLR4 in ox-LDL-treated HAECs transfected with miR-590, anti-miR-590, or matched controls was detected by Western blot (left), while TLR4 protein level on cell surface was evaluated by flow cytometry (right). * p
    Figure Legend Snippet: MiR-590 directly targets TLR4 in ox-LDL-treated HAECs. (A) Bioinformatics analysis of the predicted interaction of miR-590 in the 3′UTR of TLR4. (B) Luciferase activity was determined by luciferase reporter assay in HAECs cells co-transfected with TLR4-WT or TLR4-MUT and miR-590, anti-miR-590, or respective controls. (C) Western blot (left) was performed to detect the cellular protein level of TLR4 in HAECs with or without ox-LDL treatment, while TLR4 protein level on cell surface was evaluated by flow cytometry (right). (D) The cellular protein level of TLR4 in ox-LDL-treated HAECs transfected with miR-590, anti-miR-590, or matched controls was detected by Western blot (left), while TLR4 protein level on cell surface was evaluated by flow cytometry (right). * p

    Techniques Used: Luciferase, Activity Assay, Reporter Assay, Transfection, Western Blot, Flow Cytometry, Cytometry

    Anti-miR-590 reverses TLR4 knockdown-mediated promotion of cell proliferation and suppression of apoptosis in ox-LDL-treated HAECs. HAECs were transfected with si-TLR4, si-con, or cotransfected with si-TLR4 and anti-miR-590 or anti-miR-con, following ox-LDL stimulation. (A) Western blot analysis of TLR4 protein level in the treated HAECs. (B) Cell proliferation at 24, 48, and 72 h in the treated HAECs was evaluated by MTT assay. (C) Flow cytometry analysis was performed to detect the apoptotic rates in the treated HAECs. (D) Western blot was applied to analyze the protein levels of Cleaved PARP and Cleaved Caspase-3 in the treated HAECs. * p
    Figure Legend Snippet: Anti-miR-590 reverses TLR4 knockdown-mediated promotion of cell proliferation and suppression of apoptosis in ox-LDL-treated HAECs. HAECs were transfected with si-TLR4, si-con, or cotransfected with si-TLR4 and anti-miR-590 or anti-miR-con, following ox-LDL stimulation. (A) Western blot analysis of TLR4 protein level in the treated HAECs. (B) Cell proliferation at 24, 48, and 72 h in the treated HAECs was evaluated by MTT assay. (C) Flow cytometry analysis was performed to detect the apoptotic rates in the treated HAECs. (D) Western blot was applied to analyze the protein levels of Cleaved PARP and Cleaved Caspase-3 in the treated HAECs. * p

    Techniques Used: Transfection, Western Blot, MTT Assay, Flow Cytometry, Cytometry

    The effects of miR-590 on the TLR4/NF-κB pathway in ox-LDL-treated HAECs. (A) Western blot analysis of TLR4, p-IκBα, IκBα, p-p65, and p65 in HAECs after transfection with miR-590, miR-con, miR-590+TLR4, or miR-590+pcDNA, following ox-LDL challenge. (B) Quantification analysis of the protein level of TLR4, p-IκBα/IκBα ratio and p-p65/p65 ratio in the treated HAECs. * p
    Figure Legend Snippet: The effects of miR-590 on the TLR4/NF-κB pathway in ox-LDL-treated HAECs. (A) Western blot analysis of TLR4, p-IκBα, IκBα, p-p65, and p65 in HAECs after transfection with miR-590, miR-con, miR-590+TLR4, or miR-590+pcDNA, following ox-LDL challenge. (B) Quantification analysis of the protein level of TLR4, p-IκBα/IκBα ratio and p-p65/p65 ratio in the treated HAECs. * p

    Techniques Used: Western Blot, Transfection

    14) Product Images from "Human antibodies targeting Zika virus NS1 provide protection against disease in a mouse model"

    Article Title: Human antibodies targeting Zika virus NS1 provide protection against disease in a mouse model

    Journal: Nature Communications

    doi: 10.1038/s41467-018-07008-0

    Human ZIKV specific-antibodies bind to both MR766 and PRVABC59 NS1 proteins. a Vero cells were infected with the indicated viruses at an MOI of 1 for 24 h. The cells were fixed with 0.5% paraformaldehyde and blocked with 5% non-fat milk. MAbs AA12, FC12, EB9, and GB5 were used at a concentration of 5 μg per mL and an anti-human antibody conjugated to Alexa Fluor 488 was used as a secondary antibody. The murine pan-flavivirus mAb 4G2 was used as a positive control and an anti-mouse antibody conjugated to Alexa Fluor 488 was used as a secondary antibody. Cells stained with mAb 4G2 were fixed and permeabilized using 80% acetone. b , c ELISA assays were performed using recombinant NS1 protein from either MR766 or PRVABC59 viruses to assess the binding activity of mAbs AA12, FC12, EB9, and GB5. ELISAs were performed in duplicates. Data plotted represent mean values and the standard error of the mean (SEM); a non-linear regression line was generated using GraphPad Prism 5. Scale = 100 µm
    Figure Legend Snippet: Human ZIKV specific-antibodies bind to both MR766 and PRVABC59 NS1 proteins. a Vero cells were infected with the indicated viruses at an MOI of 1 for 24 h. The cells were fixed with 0.5% paraformaldehyde and blocked with 5% non-fat milk. MAbs AA12, FC12, EB9, and GB5 were used at a concentration of 5 μg per mL and an anti-human antibody conjugated to Alexa Fluor 488 was used as a secondary antibody. The murine pan-flavivirus mAb 4G2 was used as a positive control and an anti-mouse antibody conjugated to Alexa Fluor 488 was used as a secondary antibody. Cells stained with mAb 4G2 were fixed and permeabilized using 80% acetone. b , c ELISA assays were performed using recombinant NS1 protein from either MR766 or PRVABC59 viruses to assess the binding activity of mAbs AA12, FC12, EB9, and GB5. ELISAs were performed in duplicates. Data plotted represent mean values and the standard error of the mean (SEM); a non-linear regression line was generated using GraphPad Prism 5. Scale = 100 µm

    Techniques Used: Infection, Concentration Assay, Positive Control, Staining, Enzyme-linked Immunosorbent Assay, Recombinant, Binding Assay, Activity Assay, Generated

    NS1-specific antibodies do not cause antibody-dependent enhancement (ADE) of infection in vitro. To examine whether enhancement of flavivirus infection in vitro is observed, ZIKV NS1-specific mAbs or pooled serum from a DENV positive donor were incubated with a PRVABC59 or b DENV-3 viruses and added to FcγR bearing K562 cells. All mAbs were tested at a starting concentration of 100 ng per mL and were serially diluted four-fold. DENV positive control sera was diluted five-fold initially and serially diluted four-fold. The assay was run in duplicate and fold induction was measured as number of infected cells as measured by flow cytometry divided by infected cells with no antibody or serum added. Sera were obtained through a screening of blood donations in Puerto Rico as described previously in Bardina et al. 14 . Plotted values represent mean value and standard deviation
    Figure Legend Snippet: NS1-specific antibodies do not cause antibody-dependent enhancement (ADE) of infection in vitro. To examine whether enhancement of flavivirus infection in vitro is observed, ZIKV NS1-specific mAbs or pooled serum from a DENV positive donor were incubated with a PRVABC59 or b DENV-3 viruses and added to FcγR bearing K562 cells. All mAbs were tested at a starting concentration of 100 ng per mL and were serially diluted four-fold. DENV positive control sera was diluted five-fold initially and serially diluted four-fold. The assay was run in duplicate and fold induction was measured as number of infected cells as measured by flow cytometry divided by infected cells with no antibody or serum added. Sera were obtained through a screening of blood donations in Puerto Rico as described previously in Bardina et al. 14 . Plotted values represent mean value and standard deviation

    Techniques Used: Infection, In Vitro, Incubation, Concentration Assay, Positive Control, Flow Cytometry, Cytometry, Standard Deviation

    15) Product Images from "The TFAP2C-Regulated OCT4 Naive Enhancer Is Involved in Human Germline Formation"

    Article Title: The TFAP2C-Regulated OCT4 Naive Enhancer Is Involved in Human Germline Formation

    Journal: Cell reports

    doi: 10.1016/j.celrep.2018.12.011

    Transcription Factor Motifs Enriched in Open Chromatin of Human Germline Cells (A) Heatmap of ATAC-seq signals in embryonic somatic tissues, hESCs, iMeLCs, hPGCLCs, and hPGCs over germline cell-specific open chromatin regions (defined as enriched in hPGCLCs, hPGCs, or both) and corresponding transcription factor motifs enriched for those regions. (B) Heatmap of gene expression levels in hESCs, iMeLCs, hPGCLCs, and hPGCs for transcription factor family members with motifs identified as being enriched in germline cell-specific open chromatin. F, female; M, male. See also Figure S2 .
    Figure Legend Snippet: Transcription Factor Motifs Enriched in Open Chromatin of Human Germline Cells (A) Heatmap of ATAC-seq signals in embryonic somatic tissues, hESCs, iMeLCs, hPGCLCs, and hPGCs over germline cell-specific open chromatin regions (defined as enriched in hPGCLCs, hPGCs, or both) and corresponding transcription factor motifs enriched for those regions. (B) Heatmap of gene expression levels in hESCs, iMeLCs, hPGCLCs, and hPGCs for transcription factor family members with motifs identified as being enriched in germline cell-specific open chromatin. F, female; M, male. See also Figure S2 .

    Techniques Used: Expressing

    The OCT4 NE Is Involved in hPGCLC Formation (A) Flow cytometry of aggregates at day 4 of differentiation from H1 hESC line genetically modified to express GFP from the OCT4 locus (OCT4-GFP). hPGCLCs (ITGA6/EPCAM double-positive cells) are also positive for GFP. In contrast, non-hPGCLCs are GFP negative. Most OCT4-GFP-positive cells are positive for ITGA6/EPCAM. Three biological replicates were performed. (B) Summary of OCT4-GFP-positive cells during aggregate differentiation from days 1 to 4. The GFP-positive gate was set according to the GFP gate from (A). Two biological replicates were performed. (C) Screenshot of ATAC-seq and TFAP2C ChIP-seq signals showing three enhancers at the POU5F1 locus (encoding OCT4). Shaded boxes highlight the naive enhancer (NE), proximal enhancer (PE), and distal enhancer (DE) at the POU5F1 locus. DE deletion and NE deletion indicate genomic regions that were deleted by CRISPR/Cas9-mediated genome editing. Primers for ChIP-qPCR (P1–2, P3–4, P5–6) of NE and control regions are shown. (D) ChIP-qPCR using anti-TFAP2C antibodies in day 4 aggregates from the UCLA1 line. IgG was used as a ChIP control. Two biological replicates for ChIP and two technical replicates for qPCR were performed. Primer (P) locations at the POU5F1 locus are shown in (C). Error bars represent SEM. (E) Flow cytometry of control and OCT4 NE deletion day 4 aggregates from the UCLA1 hESCs. hPGCLCs correspond to the ITGA6/EPCAM double-positive cells (n = 3 biological replicates). (F) Quantification of hPGCLC percentages from (E). t test was applied. Error bars represent SEM. (G) Expression of germ cell genes in ITGA6/EPCAM double-positive hPGCLCs from control and OCT4 NE deletion samples at day 4 of aggregate differentiation from UCLA1 hESCs (n = 2 biological replicates). Error bars represent SEM. (H) Immunofluorescence of OCT4 (green) and TFAP2C (red) in control and OCT4 NE deletion aggregates at day 4 of differentiation from UCLA1 hESCs (n = 2 biological replicates). hPGCLCs correspond to OCT4/TFAP2C double-positive cells. Scale bars, 15 μm. See also Figure S5 .
    Figure Legend Snippet: The OCT4 NE Is Involved in hPGCLC Formation (A) Flow cytometry of aggregates at day 4 of differentiation from H1 hESC line genetically modified to express GFP from the OCT4 locus (OCT4-GFP). hPGCLCs (ITGA6/EPCAM double-positive cells) are also positive for GFP. In contrast, non-hPGCLCs are GFP negative. Most OCT4-GFP-positive cells are positive for ITGA6/EPCAM. Three biological replicates were performed. (B) Summary of OCT4-GFP-positive cells during aggregate differentiation from days 1 to 4. The GFP-positive gate was set according to the GFP gate from (A). Two biological replicates were performed. (C) Screenshot of ATAC-seq and TFAP2C ChIP-seq signals showing three enhancers at the POU5F1 locus (encoding OCT4). Shaded boxes highlight the naive enhancer (NE), proximal enhancer (PE), and distal enhancer (DE) at the POU5F1 locus. DE deletion and NE deletion indicate genomic regions that were deleted by CRISPR/Cas9-mediated genome editing. Primers for ChIP-qPCR (P1–2, P3–4, P5–6) of NE and control regions are shown. (D) ChIP-qPCR using anti-TFAP2C antibodies in day 4 aggregates from the UCLA1 line. IgG was used as a ChIP control. Two biological replicates for ChIP and two technical replicates for qPCR were performed. Primer (P) locations at the POU5F1 locus are shown in (C). Error bars represent SEM. (E) Flow cytometry of control and OCT4 NE deletion day 4 aggregates from the UCLA1 hESCs. hPGCLCs correspond to the ITGA6/EPCAM double-positive cells (n = 3 biological replicates). (F) Quantification of hPGCLC percentages from (E). t test was applied. Error bars represent SEM. (G) Expression of germ cell genes in ITGA6/EPCAM double-positive hPGCLCs from control and OCT4 NE deletion samples at day 4 of aggregate differentiation from UCLA1 hESCs (n = 2 biological replicates). Error bars represent SEM. (H) Immunofluorescence of OCT4 (green) and TFAP2C (red) in control and OCT4 NE deletion aggregates at day 4 of differentiation from UCLA1 hESCs (n = 2 biological replicates). hPGCLCs correspond to OCT4/TFAP2C double-positive cells. Scale bars, 15 μm. See also Figure S5 .

    Techniques Used: Flow Cytometry, Cytometry, Genetically Modified, Chromatin Immunoprecipitation, CRISPR, Real-time Polymerase Chain Reaction, Expressing, Immunofluorescence

    Identifying Unique Regions of Open Chromatin in Human Germline Cells (A) Morphology of male (UCLA2) and female (UCLA1) primed hESCs, and iMeLCs used for ATAC-seq. Scale bars, 100 μm. (B) Male (UCLA2) and female (UCLA1) hPGCLCs were isolated as ITGA6/EPCAM double-positive cells at day 4 of aggregate differentiation. 82d and 89d hPGCs were isolated as TNAP/cKIT double-positive cells from a pair of embryonic testes and ovaries, respectively. (C–F) Screenshot of the ATAC-seq signal over PRDM1 (C), SOX17 (D), DDX4 (E), and DAZL (F) for male and female primed hESCs, iMeLCs, hPGCLCs, hPGCs, and embryonic somatic cells (soma.). Red dotted boxes highlight ATAC-seq peaks in hPGCLCs and/or hPGCs, but not in primed hESCs, iMeLCs, or embryonic somatic tissues. F, female; M, male. See also Figure S1 .
    Figure Legend Snippet: Identifying Unique Regions of Open Chromatin in Human Germline Cells (A) Morphology of male (UCLA2) and female (UCLA1) primed hESCs, and iMeLCs used for ATAC-seq. Scale bars, 100 μm. (B) Male (UCLA2) and female (UCLA1) hPGCLCs were isolated as ITGA6/EPCAM double-positive cells at day 4 of aggregate differentiation. 82d and 89d hPGCs were isolated as TNAP/cKIT double-positive cells from a pair of embryonic testes and ovaries, respectively. (C–F) Screenshot of the ATAC-seq signal over PRDM1 (C), SOX17 (D), DDX4 (E), and DAZL (F) for male and female primed hESCs, iMeLCs, hPGCLCs, hPGCs, and embryonic somatic cells (soma.). Red dotted boxes highlight ATAC-seq peaks in hPGCLCs and/or hPGCs, but not in primed hESCs, iMeLCs, or embryonic somatic tissues. F, female; M, male. See also Figure S1 .

    Techniques Used: Isolation

    Reacquisition of Ground-State Naive Pluripotency in Human Germline Cells (A) Principal component analysis (PCA) of transcriptomes of ground state naive hESCs cultured in 5i/L/FA media, primed hESCs, iMeLCs, hPGCLCs, and hPGCs. Gene expression analysis was based on the RNA-seq data from Pastor et al. (2016) (5i/L/FA ground-state naive hESCs) and Chen et al. (2017) (primed hESCs, iMeLCs, hPGCLCs, and hPGCs). (B) Heatmap showing the expression of pluripotency genes in 5i/L/FA ground-state naive hESCs, primed hESCs, hPGCLCs, and hPGCs. The five hPGCs samples are 89d female, 103d female, 89d female, 89d female, and 59d male from left to right. F, female; M, male. (C) Venn diagram showing the overlap of germline cell-specific ATAC-seq regions with naive-specific and primed-specific regions identified by Pastor et al. (2018) . Metaplot of the ATAC-seq signals in 5i/L/FA ground-state naive hESCs, hPGCLCs, and hPGCs and TFAP2C ChIP-seq signals in naive hESCs over regions defined from the Venn diagram. (D) Heatmap showing the ground-state naive hESCs ATAC-seq signals ( Pastor et al., 2018 ) over hPGC-specific, hPGCLC-specific, and hPGC/hPGCLC-shared peaks. See also Figure S3 .
    Figure Legend Snippet: Reacquisition of Ground-State Naive Pluripotency in Human Germline Cells (A) Principal component analysis (PCA) of transcriptomes of ground state naive hESCs cultured in 5i/L/FA media, primed hESCs, iMeLCs, hPGCLCs, and hPGCs. Gene expression analysis was based on the RNA-seq data from Pastor et al. (2016) (5i/L/FA ground-state naive hESCs) and Chen et al. (2017) (primed hESCs, iMeLCs, hPGCLCs, and hPGCs). (B) Heatmap showing the expression of pluripotency genes in 5i/L/FA ground-state naive hESCs, primed hESCs, hPGCLCs, and hPGCs. The five hPGCs samples are 89d female, 103d female, 89d female, 89d female, and 59d male from left to right. F, female; M, male. (C) Venn diagram showing the overlap of germline cell-specific ATAC-seq regions with naive-specific and primed-specific regions identified by Pastor et al. (2018) . Metaplot of the ATAC-seq signals in 5i/L/FA ground-state naive hESCs, hPGCLCs, and hPGCs and TFAP2C ChIP-seq signals in naive hESCs over regions defined from the Venn diagram. (D) Heatmap showing the ground-state naive hESCs ATAC-seq signals ( Pastor et al., 2018 ) over hPGC-specific, hPGCLC-specific, and hPGC/hPGCLC-shared peaks. See also Figure S3 .

    Techniques Used: Cell Culture, Expressing, RNA Sequencing Assay, Chromatin Immunoprecipitation

    TFAP2C Is Required for hPGCLC Specification and Expression of the Naive Transcription Factor KLF4 (A) Flow cytometry showing the induction of hPGCLCs at days 2 and 4 of aggregation differentiation using control and TFAP2C mutant hESCs. (B) Two independent TFAP2C mutant lines made from UCLA1 hESCs were used. hPGCLCs correspond to ITGA6/EPCAM double-positive cells. Three biological replicates were examined. Error bars represent SEM. (C) Expression of KLF4 in OCT4-positive hPGCLCs from day 1 through day 4 of aggregate differentiation in control and TFAP2C mutant UCLA1 hESC lines. The percentages of OCT4 and KLF4 double-positive cells are quantified at each stage and are represented by the orange color in the pie chart. Green, OCT4 single-positive cells; red, KLF4 single-positive cells; blue, DAPI-positive cells but negative for OCT4 and KLF4. Scale bars, 15 μm. The counting of all cell types is shown in Figure S4C . (D and E) Screenshot of the ATAC-seq signal near KLF4 (D). Red dashed box indicates a putative DNA regulatory element, which is closed in primed hESCs and iMeLCs but open in hPGCLCs and hPGCs. This DNA region is termed as the KLF4 element (KE). The germline cell-specific KE region with two AP2-binding sites (indicated by black arrows) is highlighted in (E). (F) ChIP-qPCR of KE using anti-TFAP2C antibodies in day 4 aggregates from UCLA1. Immunoglobulin G (IgG) was used as ChIP control. Two biological replicates for ChIP and two technical replicates for qPCR were performed. Control is a genomic region at the OCT4 locus without AP2-binding site. Error bars represent SEM. See also Figure S4 .
    Figure Legend Snippet: TFAP2C Is Required for hPGCLC Specification and Expression of the Naive Transcription Factor KLF4 (A) Flow cytometry showing the induction of hPGCLCs at days 2 and 4 of aggregation differentiation using control and TFAP2C mutant hESCs. (B) Two independent TFAP2C mutant lines made from UCLA1 hESCs were used. hPGCLCs correspond to ITGA6/EPCAM double-positive cells. Three biological replicates were examined. Error bars represent SEM. (C) Expression of KLF4 in OCT4-positive hPGCLCs from day 1 through day 4 of aggregate differentiation in control and TFAP2C mutant UCLA1 hESC lines. The percentages of OCT4 and KLF4 double-positive cells are quantified at each stage and are represented by the orange color in the pie chart. Green, OCT4 single-positive cells; red, KLF4 single-positive cells; blue, DAPI-positive cells but negative for OCT4 and KLF4. Scale bars, 15 μm. The counting of all cell types is shown in Figure S4C . (D and E) Screenshot of the ATAC-seq signal near KLF4 (D). Red dashed box indicates a putative DNA regulatory element, which is closed in primed hESCs and iMeLCs but open in hPGCLCs and hPGCs. This DNA region is termed as the KLF4 element (KE). The germline cell-specific KE region with two AP2-binding sites (indicated by black arrows) is highlighted in (E). (F) ChIP-qPCR of KE using anti-TFAP2C antibodies in day 4 aggregates from UCLA1. Immunoglobulin G (IgG) was used as ChIP control. Two biological replicates for ChIP and two technical replicates for qPCR were performed. Control is a genomic region at the OCT4 locus without AP2-binding site. Error bars represent SEM. See also Figure S4 .

    Techniques Used: Expressing, Flow Cytometry, Cytometry, Mutagenesis, Binding Assay, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction

    The OCT4 NE Is Involved in hPGCLC Formation (A) Flow cytometry of aggregates at day 4 of differentiation from H1 hESC line genetically modified to express GFP from the OCT4 locus (OCT4-GFP). hPGCLCs (ITGA6/EPCAM double-positive cells) are also positive for GFP. In contrast, non-hPGCLCs are GFP negative. Most OCT4-GFP-positive cells are positive for ITGA6/EPCAM. Three biological replicates were performed. (B) Summary of OCT4-GFP-positive cells during aggregate differentiation from days 1 to 4. The GFP-positive gate was set according to the GFP gate from (A). Two biological replicates were performed. (C) Screenshot of ATAC-seq and TFAP2C ChIP-seq signals showing three enhancers at the POU5F1 locus (encoding OCT4). Shaded boxes highlight the naive enhancer (NE), proximal enhancer (PE), and distal enhancer (DE) at the POU5F1 locus. DE deletion and NE deletion indicate genomic regions that were deleted by CRISPR/Cas9-mediated genome editing. Primers for ChIP-qPCR (P1–2, P3–4, P5–6) of NE and control regions are shown. (D) ChIP-qPCR using anti-TFAP2C antibodies in day 4 aggregates from the UCLA1 line. IgG was used as a ChIP control. Two biological replicates for ChIP and two technical replicates for qPCR were performed. Primer (P) locations at the POU5F1 locus are shown in (C). Error bars represent SEM. (E) Flow cytometry of control and OCT4 NE deletion day 4 aggregates from the UCLA1 hESCs. hPGCLCs correspond to the ITGA6/EPCAM double-positive cells (n = 3 biological replicates). (F) Quantification of hPGCLC percentages from (E). t test was applied. Error bars represent SEM. (G) Expression of germ cell genes in ITGA6/EPCAM double-positive hPGCLCs from control and OCT4 NE deletion samples at day 4 of aggregate differentiation from UCLA1 hESCs (n = 2 biological replicates). Error bars represent SEM. (H) Immunofluorescence of OCT4 (green) and TFAP2C (red) in control and OCT4 NE deletion aggregates at day 4 of differentiation from UCLA1 hESCs (n = 2 biological replicates). hPGCLCs correspond to OCT4/TFAP2C double-positive cells. Scale bars, 15 μm. See also Figure S5 .
    Figure Legend Snippet: The OCT4 NE Is Involved in hPGCLC Formation (A) Flow cytometry of aggregates at day 4 of differentiation from H1 hESC line genetically modified to express GFP from the OCT4 locus (OCT4-GFP). hPGCLCs (ITGA6/EPCAM double-positive cells) are also positive for GFP. In contrast, non-hPGCLCs are GFP negative. Most OCT4-GFP-positive cells are positive for ITGA6/EPCAM. Three biological replicates were performed. (B) Summary of OCT4-GFP-positive cells during aggregate differentiation from days 1 to 4. The GFP-positive gate was set according to the GFP gate from (A). Two biological replicates were performed. (C) Screenshot of ATAC-seq and TFAP2C ChIP-seq signals showing three enhancers at the POU5F1 locus (encoding OCT4). Shaded boxes highlight the naive enhancer (NE), proximal enhancer (PE), and distal enhancer (DE) at the POU5F1 locus. DE deletion and NE deletion indicate genomic regions that were deleted by CRISPR/Cas9-mediated genome editing. Primers for ChIP-qPCR (P1–2, P3–4, P5–6) of NE and control regions are shown. (D) ChIP-qPCR using anti-TFAP2C antibodies in day 4 aggregates from the UCLA1 line. IgG was used as a ChIP control. Two biological replicates for ChIP and two technical replicates for qPCR were performed. Primer (P) locations at the POU5F1 locus are shown in (C). Error bars represent SEM. (E) Flow cytometry of control and OCT4 NE deletion day 4 aggregates from the UCLA1 hESCs. hPGCLCs correspond to the ITGA6/EPCAM double-positive cells (n = 3 biological replicates). (F) Quantification of hPGCLC percentages from (E). t test was applied. Error bars represent SEM. (G) Expression of germ cell genes in ITGA6/EPCAM double-positive hPGCLCs from control and OCT4 NE deletion samples at day 4 of aggregate differentiation from UCLA1 hESCs (n = 2 biological replicates). Error bars represent SEM. (H) Immunofluorescence of OCT4 (green) and TFAP2C (red) in control and OCT4 NE deletion aggregates at day 4 of differentiation from UCLA1 hESCs (n = 2 biological replicates). hPGCLCs correspond to OCT4/TFAP2C double-positive cells. Scale bars, 15 μm. See also Figure S5 .

    Techniques Used: Flow Cytometry, Cytometry, Genetically Modified, Chromatin Immunoprecipitation, CRISPR, Real-time Polymerase Chain Reaction, Expressing, Immunofluorescence

    Reacquisition of Ground-State Naive Pluripotency in Human Germline Cells (A) Principal component analysis (PCA) of transcriptomes of ground state naive hESCs cultured in 5i/L/FA media, primed hESCs, iMeLCs, hPGCLCs, and hPGCs. Gene expression analysis was based on the RNA-seq data from Pastor et al. (2016) (5i/L/FA ground-state naive hESCs) and Chen et al. (2017) (primed hESCs, iMeLCs, hPGCLCs, and hPGCs). (B) Heatmap showing the expression of pluripotency genes in 5i/L/FA ground-state naive hESCs, primed hESCs, hPGCLCs, and hPGCs. The five hPGCs samples are 89d female, 103d female, 89d female, 89d female, and 59d male from left to right. F, female; M, male. (C) Venn diagram showing the overlap of germline cell-specific ATAC-seq regions with naive-specific and primed-specific regions identified by Pastor et al. (2018) . Metaplot of the ATAC-seq signals in 5i/L/FA ground-state naive hESCs, hPGCLCs, and hPGCs and TFAP2C ChIP-seq signals in naive hESCs over regions defined from the Venn diagram. (D) Heatmap showing the ground-state naive hESCs ATAC-seq signals ( Pastor et al., 2018 ) over hPGC-specific, hPGCLC-specific, and hPGC/hPGCLC-shared peaks. See also Figure S3 .
    Figure Legend Snippet: Reacquisition of Ground-State Naive Pluripotency in Human Germline Cells (A) Principal component analysis (PCA) of transcriptomes of ground state naive hESCs cultured in 5i/L/FA media, primed hESCs, iMeLCs, hPGCLCs, and hPGCs. Gene expression analysis was based on the RNA-seq data from Pastor et al. (2016) (5i/L/FA ground-state naive hESCs) and Chen et al. (2017) (primed hESCs, iMeLCs, hPGCLCs, and hPGCs). (B) Heatmap showing the expression of pluripotency genes in 5i/L/FA ground-state naive hESCs, primed hESCs, hPGCLCs, and hPGCs. The five hPGCs samples are 89d female, 103d female, 89d female, 89d female, and 59d male from left to right. F, female; M, male. (C) Venn diagram showing the overlap of germline cell-specific ATAC-seq regions with naive-specific and primed-specific regions identified by Pastor et al. (2018) . Metaplot of the ATAC-seq signals in 5i/L/FA ground-state naive hESCs, hPGCLCs, and hPGCs and TFAP2C ChIP-seq signals in naive hESCs over regions defined from the Venn diagram. (D) Heatmap showing the ground-state naive hESCs ATAC-seq signals ( Pastor et al., 2018 ) over hPGC-specific, hPGCLC-specific, and hPGC/hPGCLC-shared peaks. See also Figure S3 .

    Techniques Used: Cell Culture, Expressing, RNA Sequencing Assay, Chromatin Immunoprecipitation

    TFAP2C Is Required for hPGCLC Specification and Expression of the Naive Transcription Factor KLF4 (A) Flow cytometry showing the induction of hPGCLCs at days 2 and 4 of aggregation differentiation using control and TFAP2C mutant hESCs. (B) Two independent TFAP2C mutant lines made from UCLA1 hESCs were used. hPGCLCs correspond to ITGA6/EPCAM double-positive cells. Three biological replicates were examined. Error bars represent SEM. (C) Expression of KLF4 in OCT4-positive hPGCLCs from day 1 through day 4 of aggregate differentiation in control and TFAP2C mutant UCLA1 hESC lines. The percentages of OCT4 and KLF4 double-positive cells are quantified at each stage and are represented by the orange color in the pie chart. Green, OCT4 single-positive cells; red, KLF4 single-positive cells; blue, DAPI-positive cells but negative for OCT4 and KLF4. Scale bars, 15 μm. The counting of all cell types is shown in Figure S4C . (D and E) Screenshot of the ATAC-seq signal near KLF4 (D). Red dashed box indicates a putative DNA regulatory element, which is closed in primed hESCs and iMeLCs but open in hPGCLCs and hPGCs. This DNA region is termed as the KLF4 element (KE). The germline cell-specific KE region with two AP2-binding sites (indicated by black arrows) is highlighted in (E). (F) ChIP-qPCR of KE using anti-TFAP2C antibodies in day 4 aggregates from UCLA1. Immunoglobulin G (IgG) was used as ChIP control. Two biological replicates for ChIP and two technical replicates for qPCR were performed. Control is a genomic region at the OCT4 locus without AP2-binding site. Error bars represent SEM. See also Figure S4 .
    Figure Legend Snippet: TFAP2C Is Required for hPGCLC Specification and Expression of the Naive Transcription Factor KLF4 (A) Flow cytometry showing the induction of hPGCLCs at days 2 and 4 of aggregation differentiation using control and TFAP2C mutant hESCs. (B) Two independent TFAP2C mutant lines made from UCLA1 hESCs were used. hPGCLCs correspond to ITGA6/EPCAM double-positive cells. Three biological replicates were examined. Error bars represent SEM. (C) Expression of KLF4 in OCT4-positive hPGCLCs from day 1 through day 4 of aggregate differentiation in control and TFAP2C mutant UCLA1 hESC lines. The percentages of OCT4 and KLF4 double-positive cells are quantified at each stage and are represented by the orange color in the pie chart. Green, OCT4 single-positive cells; red, KLF4 single-positive cells; blue, DAPI-positive cells but negative for OCT4 and KLF4. Scale bars, 15 μm. The counting of all cell types is shown in Figure S4C . (D and E) Screenshot of the ATAC-seq signal near KLF4 (D). Red dashed box indicates a putative DNA regulatory element, which is closed in primed hESCs and iMeLCs but open in hPGCLCs and hPGCs. This DNA region is termed as the KLF4 element (KE). The germline cell-specific KE region with two AP2-binding sites (indicated by black arrows) is highlighted in (E). (F) ChIP-qPCR of KE using anti-TFAP2C antibodies in day 4 aggregates from UCLA1. Immunoglobulin G (IgG) was used as ChIP control. Two biological replicates for ChIP and two technical replicates for qPCR were performed. Control is a genomic region at the OCT4 locus without AP2-binding site. Error bars represent SEM. See also Figure S4 .

    Techniques Used: Expressing, Flow Cytometry, Cytometry, Mutagenesis, Binding Assay, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction

    16) Product Images from "RNA sequencing reveals the expression profiles of circRNA and indicates that circDDX17 acts as a tumor suppressor in colorectal cancer"

    Article Title: RNA sequencing reveals the expression profiles of circRNA and indicates that circDDX17 acts as a tumor suppressor in colorectal cancer

    Journal: Journal of Experimental & Clinical Cancer Research : CR

    doi: 10.1186/s13046-018-1006-x

    Silencing of circDDX17 promotes CRC cell proliferation, migration, invasion, and inhibits apoptosis. a Relative expression of circDDX17 in 6 CRC cell lines. b Schematic representation of the sequence around the back-splice junction site of circDDX17 and the siRNAs targeting the junction site (si-circDDX17#1 and si-circDDX17#2) (top). Results of qRT-PCR for circDDX17 and its linear isoform in SW480 and SW620 cells treated with siRNAs. c CCK-8 assay of SW480 and SW620 cells transfected with negative control siRNA (si-NC) or si-circDDX17#1 at the indicated days. d Colony formation assays of SW480 and SW620 cells transfected with si-NC or si-circDDX17#1. e Cell apoptosis assay by flow cytometry of SW480 and SW620 cells transfected with si-NC or si-circDDX17#1. f, g Transwell migration and invasion assays of SW480 and SW620 cells transfected with si-NC or si-circDDX17#1. Data are shown as means ± s.d. of at least three independent experiments. * p
    Figure Legend Snippet: Silencing of circDDX17 promotes CRC cell proliferation, migration, invasion, and inhibits apoptosis. a Relative expression of circDDX17 in 6 CRC cell lines. b Schematic representation of the sequence around the back-splice junction site of circDDX17 and the siRNAs targeting the junction site (si-circDDX17#1 and si-circDDX17#2) (top). Results of qRT-PCR for circDDX17 and its linear isoform in SW480 and SW620 cells treated with siRNAs. c CCK-8 assay of SW480 and SW620 cells transfected with negative control siRNA (si-NC) or si-circDDX17#1 at the indicated days. d Colony formation assays of SW480 and SW620 cells transfected with si-NC or si-circDDX17#1. e Cell apoptosis assay by flow cytometry of SW480 and SW620 cells transfected with si-NC or si-circDDX17#1. f, g Transwell migration and invasion assays of SW480 and SW620 cells transfected with si-NC or si-circDDX17#1. Data are shown as means ± s.d. of at least three independent experiments. * p

    Techniques Used: Migration, Expressing, Sequencing, Quantitative RT-PCR, CCK-8 Assay, Transfection, Negative Control, Apoptosis Assay, Flow Cytometry, Cytometry

    17) Product Images from "Epigenetic and Transcriptome Profiling Identifies a Population of Visceral Adipose-Derived Progenitor Cells with the Potential to Differentiate into an Endocrine Pancreatic Lineage"

    Article Title: Epigenetic and Transcriptome Profiling Identifies a Population of Visceral Adipose-Derived Progenitor Cells with the Potential to Differentiate into an Endocrine Pancreatic Lineage

    Journal: Cell Transplantation

    doi: 10.1177/0963689718808472

    Differentiation and function of AMCs. (A) Visceral adipose-derived AMCs from Pdx1-GFP mice were exposed to various growth and differentiation factors. Panel (A) represents the experimental setup where GFP reporter (Pdx1-GFP) AMCs were plated in (black) 96-well plates and fluorescent intensities recorded as detailed in methods. Note that some (minimal) level of GFP seen in the cells (wells 1 and 2), represented as ‘0’ intensity, diminished when exposed to the GLP1 antagonist (exendin 9-39; wells 3 and 4) or to increase in intensity when exposed to an agonist (wells 5 and 6). All conditions were set up in triplicate. (B) Cultures were stimulated to differentiate in the presence of the small molecules described in Supplementary Table 2 and the intensity of GFP fluorescence was measured at the same time of the day and at regular (24 h) intervals. Data were corrected with respect to the blank (well containing media but no cells) and presented relative to the GFP signal measured on day 1. Values generated for day 1 are therefore presented as ‘0’ fluorescence, while subsequent measurements are presented relative to day 1. AMCs generated from Pdx1-GFP transgenic mice do not show GFP expression as monolayers (C). However, when stimulated to differentiate into an endocrine pancreatic lineage, AMCs formed multiple, small ICAs that express GFP in presence of exendin-4 (D) or FGF2 (E). Bar = 20μm. GFP-expressing ICAs were analyzed using TaqMan-based quantitative PCR for the expression of endocrine pancreatic gene transcripts. Data are presented as fold difference over the detectable Ct value was calculated using the ΔΔCt method (Hardikar A et al. 29 ) (F). Human AMCs were induced to differentiate into endocrine pancreatic lineage using FGF2 and exendin-4 agonist and transplanted in NOD/SCID mice using TheraCyte ™ devices. Human AMC-derived ICAs showed detectable expression of pro-endocrine gene transcripts (G). Box and whisker plot showing the abundance of transcript at day 90 relative to expression in day 0 (undifferentiated) AMCs. The line in the box represents the median and the box represents the upper and lower quartile ( N =4 mice). ICA-containing TheraCytes ™ showed evidence of vascularization (H), showed detectable levels of human insulin (mean ± SD; N =3) in mouse circulation (I) and contained insulin-producing cells after 90 days of in-vivo studies (J); red: insulin, blue: DAPI: nuclei; bar = 20μm. AMC: adipose tissue-derived mesenchymal cell; ICA: islet-like cell aggregate; AMC: Adipose-derived mesenchymal cells; ICAs: Islet-like Cell Aggregates; Pdx1: Pancreatic and duodenal homeobox 1; GLP1: Glucagon-like Peptide 1; GFP: Green Fluoroscence Protein; FGF2: Fibroblast Growth Factor 2; PCR: Polymerase Chain Reaction; Ct: Cycle threshold; NOD/SCID: Non-obese Diabetic/Severe Combined Immunodeficiency; DAPI: 4′,6-diamidino-2-phenylindole; SD: Standard Deviation.
    Figure Legend Snippet: Differentiation and function of AMCs. (A) Visceral adipose-derived AMCs from Pdx1-GFP mice were exposed to various growth and differentiation factors. Panel (A) represents the experimental setup where GFP reporter (Pdx1-GFP) AMCs were plated in (black) 96-well plates and fluorescent intensities recorded as detailed in methods. Note that some (minimal) level of GFP seen in the cells (wells 1 and 2), represented as ‘0’ intensity, diminished when exposed to the GLP1 antagonist (exendin 9-39; wells 3 and 4) or to increase in intensity when exposed to an agonist (wells 5 and 6). All conditions were set up in triplicate. (B) Cultures were stimulated to differentiate in the presence of the small molecules described in Supplementary Table 2 and the intensity of GFP fluorescence was measured at the same time of the day and at regular (24 h) intervals. Data were corrected with respect to the blank (well containing media but no cells) and presented relative to the GFP signal measured on day 1. Values generated for day 1 are therefore presented as ‘0’ fluorescence, while subsequent measurements are presented relative to day 1. AMCs generated from Pdx1-GFP transgenic mice do not show GFP expression as monolayers (C). However, when stimulated to differentiate into an endocrine pancreatic lineage, AMCs formed multiple, small ICAs that express GFP in presence of exendin-4 (D) or FGF2 (E). Bar = 20μm. GFP-expressing ICAs were analyzed using TaqMan-based quantitative PCR for the expression of endocrine pancreatic gene transcripts. Data are presented as fold difference over the detectable Ct value was calculated using the ΔΔCt method (Hardikar A et al. 29 ) (F). Human AMCs were induced to differentiate into endocrine pancreatic lineage using FGF2 and exendin-4 agonist and transplanted in NOD/SCID mice using TheraCyte ™ devices. Human AMC-derived ICAs showed detectable expression of pro-endocrine gene transcripts (G). Box and whisker plot showing the abundance of transcript at day 90 relative to expression in day 0 (undifferentiated) AMCs. The line in the box represents the median and the box represents the upper and lower quartile ( N =4 mice). ICA-containing TheraCytes ™ showed evidence of vascularization (H), showed detectable levels of human insulin (mean ± SD; N =3) in mouse circulation (I) and contained insulin-producing cells after 90 days of in-vivo studies (J); red: insulin, blue: DAPI: nuclei; bar = 20μm. AMC: adipose tissue-derived mesenchymal cell; ICA: islet-like cell aggregate; AMC: Adipose-derived mesenchymal cells; ICAs: Islet-like Cell Aggregates; Pdx1: Pancreatic and duodenal homeobox 1; GLP1: Glucagon-like Peptide 1; GFP: Green Fluoroscence Protein; FGF2: Fibroblast Growth Factor 2; PCR: Polymerase Chain Reaction; Ct: Cycle threshold; NOD/SCID: Non-obese Diabetic/Severe Combined Immunodeficiency; DAPI: 4′,6-diamidino-2-phenylindole; SD: Standard Deviation.

    Techniques Used: Derivative Assay, Mouse Assay, Fluorescence, Generated, Transgenic Assay, Expressing, Real-time Polymerase Chain Reaction, Whisker Assay, In Vivo, Polymerase Chain Reaction, Standard Deviation

    18) Product Images from "Long non-coding RNA Irm enhances myogenic differentiation by interacting with MEF2D"

    Article Title: Long non-coding RNA Irm enhances myogenic differentiation by interacting with MEF2D

    Journal: Cell Death & Disease

    doi: 10.1038/s41419-019-1399-2

    Irm directly binds to MEF2D. a RNA-FISH for detecting Irm and GAPDH in undifferentiated and differentiated C2C12 cells. Red: Irm or GAPDH . Blue: DAPI staining. Scale bar, 50 μm. b Relative abundance of Irm in total and nuclear RNAs of differentiating C2C12 cells, as detected by qRT-PCR. U6 , Xist , and GAPDH were used as endogenous controls. c A schematic representation of RNA pull-down assay. d Western blotting assay for the specific interaction of Irm with MEF2D. e A schematic representation of RNA immunoprecipitation (RIP) assay. f RIP assay showed the association of MEF2D with Irm in vivo, as detected by RT-PCR and qRT-PCR. g Deletion mapping of the MEF2D-binding region(s) in Irm . Top: western blotting for MEF2D in protein samples pulled down by the different truncated Irm constructs. Bottom: diagrams of the full-length and truncated Irms . nt: nucleotide. Data shown represent the mean ± SEM of three independent experiments. n.s., not significant; *** P
    Figure Legend Snippet: Irm directly binds to MEF2D. a RNA-FISH for detecting Irm and GAPDH in undifferentiated and differentiated C2C12 cells. Red: Irm or GAPDH . Blue: DAPI staining. Scale bar, 50 μm. b Relative abundance of Irm in total and nuclear RNAs of differentiating C2C12 cells, as detected by qRT-PCR. U6 , Xist , and GAPDH were used as endogenous controls. c A schematic representation of RNA pull-down assay. d Western blotting assay for the specific interaction of Irm with MEF2D. e A schematic representation of RNA immunoprecipitation (RIP) assay. f RIP assay showed the association of MEF2D with Irm in vivo, as detected by RT-PCR and qRT-PCR. g Deletion mapping of the MEF2D-binding region(s) in Irm . Top: western blotting for MEF2D in protein samples pulled down by the different truncated Irm constructs. Bottom: diagrams of the full-length and truncated Irms . nt: nucleotide. Data shown represent the mean ± SEM of three independent experiments. n.s., not significant; *** P

    Techniques Used: Fluorescence In Situ Hybridization, Staining, Quantitative RT-PCR, Pull Down Assay, Western Blot, Immunoprecipitation, In Vivo, Reverse Transcription Polymerase Chain Reaction, Binding Assay, Construct

    Irm enhances the transcriptional activity of MyoD/MEF2D. a The effect of Irm knockdown on the expression of myogenin and miR-206 depended on MEF2D, which was detected by qRT-PCR. b The effect of Irm knockdown on the differentiation of C2C12 cells depended on MEF2D. Fusion index was calculated. Scale bars, 50 mm. c C2C12 cells were transfected with si-Irm or si-scramble, and the luciferase reporter plasmids were generated by inserting the promoter region of myogenin or miR-206. The luciferase activities were measured 48 h after differentiation. d C2C12 cells were transfected with pc-Irm or pc-Ctrl, and the luciferase reporter plasmids were generated by inserting the promoter region of myogenin or miR-206. The luciferase activities were measured 48 h after differentiation. e Knockdown of Irm impaired the binding ability of MEF2D to myogenin and miR-206 promoters, which was determined by ChIP and qRT-PCR assays. f Knockdown of Irm impaired the binding ability of MyoD to myogenin and miR-206 promoters, which was determined by ChIP and qRT-PCR assays. g Chromatin isolation by RNA purification (ChIRP) assay was performed using even and odd antisense oligos tiling Irm and, a significant amount of genomic DNAs corresponding to myogenin and miR-206 promoters but not in glyceraldehyde 3-phosphate dehydrogenase (GAPDH) locus was retrieved. LacZ ChIRP retrieved no signal. h Model for Irm -regulating myogenesis. Data shown represent the mean ± SEM of three independent experiments. n.s., not significant; * P
    Figure Legend Snippet: Irm enhances the transcriptional activity of MyoD/MEF2D. a The effect of Irm knockdown on the expression of myogenin and miR-206 depended on MEF2D, which was detected by qRT-PCR. b The effect of Irm knockdown on the differentiation of C2C12 cells depended on MEF2D. Fusion index was calculated. Scale bars, 50 mm. c C2C12 cells were transfected with si-Irm or si-scramble, and the luciferase reporter plasmids were generated by inserting the promoter region of myogenin or miR-206. The luciferase activities were measured 48 h after differentiation. d C2C12 cells were transfected with pc-Irm or pc-Ctrl, and the luciferase reporter plasmids were generated by inserting the promoter region of myogenin or miR-206. The luciferase activities were measured 48 h after differentiation. e Knockdown of Irm impaired the binding ability of MEF2D to myogenin and miR-206 promoters, which was determined by ChIP and qRT-PCR assays. f Knockdown of Irm impaired the binding ability of MyoD to myogenin and miR-206 promoters, which was determined by ChIP and qRT-PCR assays. g Chromatin isolation by RNA purification (ChIRP) assay was performed using even and odd antisense oligos tiling Irm and, a significant amount of genomic DNAs corresponding to myogenin and miR-206 promoters but not in glyceraldehyde 3-phosphate dehydrogenase (GAPDH) locus was retrieved. LacZ ChIRP retrieved no signal. h Model for Irm -regulating myogenesis. Data shown represent the mean ± SEM of three independent experiments. n.s., not significant; * P

    Techniques Used: Activity Assay, Expressing, Quantitative RT-PCR, Transfection, Luciferase, Generated, Binding Assay, Chromatin Immunoprecipitation, Isolation, Purification

    Irm is a myogenesis relevant lncRNA. a Left: the representative pictures of C2C12 cells at 0, 1, 3, and 5 days in differentiation medium; right: the protein levels of MyoD and myogenin were detected by western blotting in C2C12 cells at 0, 1, 3, and 5 days in DM. Scale bars, 50 mm. b, c The expression levels of Rian ( b ) and Irm ( c ) were detected by qRT-PCR in C2C12 cells at 0, 1, 3, and 5 days in DM. d The certification of the primary myoblasts freshly isolated from mouse limb muscles. Scale bars, 50 mm. e Left: the representative pictures of the primary myoblasts at 0, 1, 3, and 5 days in DM; right: the protein levels of MyoD and myogenin were detected by western blotting in primary myoblasts at 0, 1, 3, and 5 days in DM. Scale bars, 50 mm. f, g The expression levels of Rian ( f ) and Irm ( g ) were detected by qRT-PCR in primary myoblasts at 0, 1, 3, and 5 days in DM. h, i The mRNA levels of MyoD ( h ) and Irm ( i ) were detected by qRT-PCR during CTX-induced regeneration. j The expression levels of Irm were detected by qRT-PCR in muscles of postnatal mice. Data shown represent the mean ± SEM of three independent experiments. n.s., not significant; * P
    Figure Legend Snippet: Irm is a myogenesis relevant lncRNA. a Left: the representative pictures of C2C12 cells at 0, 1, 3, and 5 days in differentiation medium; right: the protein levels of MyoD and myogenin were detected by western blotting in C2C12 cells at 0, 1, 3, and 5 days in DM. Scale bars, 50 mm. b, c The expression levels of Rian ( b ) and Irm ( c ) were detected by qRT-PCR in C2C12 cells at 0, 1, 3, and 5 days in DM. d The certification of the primary myoblasts freshly isolated from mouse limb muscles. Scale bars, 50 mm. e Left: the representative pictures of the primary myoblasts at 0, 1, 3, and 5 days in DM; right: the protein levels of MyoD and myogenin were detected by western blotting in primary myoblasts at 0, 1, 3, and 5 days in DM. Scale bars, 50 mm. f, g The expression levels of Rian ( f ) and Irm ( g ) were detected by qRT-PCR in primary myoblasts at 0, 1, 3, and 5 days in DM. h, i The mRNA levels of MyoD ( h ) and Irm ( i ) were detected by qRT-PCR during CTX-induced regeneration. j The expression levels of Irm were detected by qRT-PCR in muscles of postnatal mice. Data shown represent the mean ± SEM of three independent experiments. n.s., not significant; * P

    Techniques Used: Western Blot, Expressing, Quantitative RT-PCR, Isolation, Mouse Assay

    Overexpression of Irm enhances myogenic differentiation. a Relative expression levels of Irm in C2C12 cells expressing pcDNA3.1 (pc-Ctrl) or pcDNA3.1- Irm (pc-Irm), as detected by qRT-PCR. b The differentiation of Irm -overexpressed C2C12 cells was detected by staining for MHC at 48 h in DM. Fusion index was calculated. Scale bars, 50 mm. c, d The mRNA levels of myogenin ( c ) and MHC ( d ) were detected by qRT-PCR in Irm -overexpressed C2C12 cells at 0, 1, 3, and 5 days in DM. e, f The protein levels of myogenin ( e ) and MHC ( f ) were detected by western blotting in Irm -overexpressed C2C12 cells at 0, 1, 3, and 5 days in DM. Myogenin protein levels were normalized to the GAPDH protein levels. Data shown represent the mean ± SEM of three independent experiments. * P
    Figure Legend Snippet: Overexpression of Irm enhances myogenic differentiation. a Relative expression levels of Irm in C2C12 cells expressing pcDNA3.1 (pc-Ctrl) or pcDNA3.1- Irm (pc-Irm), as detected by qRT-PCR. b The differentiation of Irm -overexpressed C2C12 cells was detected by staining for MHC at 48 h in DM. Fusion index was calculated. Scale bars, 50 mm. c, d The mRNA levels of myogenin ( c ) and MHC ( d ) were detected by qRT-PCR in Irm -overexpressed C2C12 cells at 0, 1, 3, and 5 days in DM. e, f The protein levels of myogenin ( e ) and MHC ( f ) were detected by western blotting in Irm -overexpressed C2C12 cells at 0, 1, 3, and 5 days in DM. Myogenin protein levels were normalized to the GAPDH protein levels. Data shown represent the mean ± SEM of three independent experiments. * P

    Techniques Used: Over Expression, Expressing, Quantitative RT-PCR, Staining, Western Blot

    Knockdown of Irm inhibits myogenic differentiation. a Relative expression levels of Irm in C2C12 cells expressing si-scramble or si-Irm, as detected by qRT-PCR. b The differentiation of Irm -knockdown C2C12 cells was detected by staining for MHC at 96 h in DM. Fusion index was calculated. Scale bars, 50 mm. c, d The mRNA levels of myogenin ( c ) and MHC ( d ) were detected by qRT-PCR in Irm -knockdown C2C12 cells at 0, 1, 3, and 5 days in DM. e, f The protein levels of myogenin ( e ) and MHC ( f ) were detected by western blotting in Irm -knockdown C2C12 cells at 0, 1, 3, and 5 days in DM. Myogenin protein levels were normalized to GAPDH protein levels. Data shown represent the mean ± SEM of three independent experiments. * P
    Figure Legend Snippet: Knockdown of Irm inhibits myogenic differentiation. a Relative expression levels of Irm in C2C12 cells expressing si-scramble or si-Irm, as detected by qRT-PCR. b The differentiation of Irm -knockdown C2C12 cells was detected by staining for MHC at 96 h in DM. Fusion index was calculated. Scale bars, 50 mm. c, d The mRNA levels of myogenin ( c ) and MHC ( d ) were detected by qRT-PCR in Irm -knockdown C2C12 cells at 0, 1, 3, and 5 days in DM. e, f The protein levels of myogenin ( e ) and MHC ( f ) were detected by western blotting in Irm -knockdown C2C12 cells at 0, 1, 3, and 5 days in DM. Myogenin protein levels were normalized to GAPDH protein levels. Data shown represent the mean ± SEM of three independent experiments. * P

    Techniques Used: Expressing, Quantitative RT-PCR, Staining, Western Blot

    19) Product Images from "Generation of TGFBI knockout ABCG2+/ABCB5+ double-positive limbal epithelial stem cells by CRISPR/Cas9-mediated genome editing"

    Article Title: Generation of TGFBI knockout ABCG2+/ABCB5+ double-positive limbal epithelial stem cells by CRISPR/Cas9-mediated genome editing

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0211864

    Evaluation of the sgRNA/Cas9-mediated TGFBI modifications in LESCs. (a) Schematic diagram of the TGFBI partial protein coding region and the locus targeted by the sgRNA/Cas9 complex. The sgRNA-targeting site is presented in red, and the PAM sequence is shown in green and underlined. Amino acid sequence was presented under nucleotide sequence. (b) Targeting efficiency test for the genome editing constructs. Genomic PCR (gPCR) products spanning TGFBI exon 4 were amplified from a heterogeneous population of LESCs that were transfected with or without the TGFBI -targeting sgRNA and Cas9 expression plasmids. Denaturation of these products, followed by rehybridization and treatment with T7E1 nuclease for 1 h at 37°C results in bands of ~280 bp and ~220 bp, indicated with arrows. This is consistent with the predicted cleavage sizes of 284 bp and 227 bp. M, marker. (c) Screening of single clones from LESCs transfected with TGFBI -targeting sgRNA and Cas9 expression plasmids. Single cells were cultured in 96-well plates until colonies were visible, with media changes every 2 days. These were dissociated and moved first to 24-well plates and then to 6-well plates, and gPCR products spanning exon 4 of TGFBI were amplified from individual single cell clones. The gPCR products were denatured, rehybridized, and treated with T7E1 nuclease for 1 h at 37°C, and the products were analyzed on a 2% agarose gel. LESC clone F11 was found to be T7E1 nuclease positive, producing cleavage products of ~280 bp and ~220 bp. Arrows indicate bands resulting from T7E1 nuclease cleavage.
    Figure Legend Snippet: Evaluation of the sgRNA/Cas9-mediated TGFBI modifications in LESCs. (a) Schematic diagram of the TGFBI partial protein coding region and the locus targeted by the sgRNA/Cas9 complex. The sgRNA-targeting site is presented in red, and the PAM sequence is shown in green and underlined. Amino acid sequence was presented under nucleotide sequence. (b) Targeting efficiency test for the genome editing constructs. Genomic PCR (gPCR) products spanning TGFBI exon 4 were amplified from a heterogeneous population of LESCs that were transfected with or without the TGFBI -targeting sgRNA and Cas9 expression plasmids. Denaturation of these products, followed by rehybridization and treatment with T7E1 nuclease for 1 h at 37°C results in bands of ~280 bp and ~220 bp, indicated with arrows. This is consistent with the predicted cleavage sizes of 284 bp and 227 bp. M, marker. (c) Screening of single clones from LESCs transfected with TGFBI -targeting sgRNA and Cas9 expression plasmids. Single cells were cultured in 96-well plates until colonies were visible, with media changes every 2 days. These were dissociated and moved first to 24-well plates and then to 6-well plates, and gPCR products spanning exon 4 of TGFBI were amplified from individual single cell clones. The gPCR products were denatured, rehybridized, and treated with T7E1 nuclease for 1 h at 37°C, and the products were analyzed on a 2% agarose gel. LESC clone F11 was found to be T7E1 nuclease positive, producing cleavage products of ~280 bp and ~220 bp. Arrows indicate bands resulting from T7E1 nuclease cleavage.

    Techniques Used: Sequencing, Construct, Polymerase Chain Reaction, Amplification, Transfection, Expressing, Marker, Clone Assay, Cell Culture, Agarose Gel Electrophoresis

    20) Product Images from "Caspase-11 auto-proteolysis is crucial for noncanonical inflammasome activation"

    Article Title: Caspase-11 auto-proteolysis is crucial for noncanonical inflammasome activation

    Journal: The Journal of Experimental Medicine

    doi: 10.1084/jem.20180589

    Caspase-11 auto-processing at Asp 285 is essential for GSDMD processing, pyroptosis, and IL-1β release. (A–D) BMDMs were treated with 1 µg/ml Pam3CSK4 for 5 h. (A) Immunoblot of caspase-11, GSDMD, and actin in extract (ext) + supernatant (sup) from WT, Casp11 Enz C254A/C254A , and Casp11 Prc D285A/D285A BMDMs at 60 min after LPS electroporation or control. (B) Cell death measured by percent YOYO-1 + cells from live cell images taken every 30 min over a 16-h time course following LPS electroporation of BMDMs from two mice per genotype. (C) LDH, IL-1β, and IL-18 release from BMDMs stimulated with transfected LPS (5 µg/ml plus FuGENE HD), ATP (5 mM), or nigericin (10 µg/ml) after 16 h, 3 h, or 30 min, respectively. (D) LDH, IL-1β, and IL-18 release measured from supernatants of BMDMs infected with indicated strains of bacteria. Data are representative of at least two independent experiments (A and B). Data are presented as mean ± SD ( n = 3) and representative of at least three independent experiments (C and D).
    Figure Legend Snippet: Caspase-11 auto-processing at Asp 285 is essential for GSDMD processing, pyroptosis, and IL-1β release. (A–D) BMDMs were treated with 1 µg/ml Pam3CSK4 for 5 h. (A) Immunoblot of caspase-11, GSDMD, and actin in extract (ext) + supernatant (sup) from WT, Casp11 Enz C254A/C254A , and Casp11 Prc D285A/D285A BMDMs at 60 min after LPS electroporation or control. (B) Cell death measured by percent YOYO-1 + cells from live cell images taken every 30 min over a 16-h time course following LPS electroporation of BMDMs from two mice per genotype. (C) LDH, IL-1β, and IL-18 release from BMDMs stimulated with transfected LPS (5 µg/ml plus FuGENE HD), ATP (5 mM), or nigericin (10 µg/ml) after 16 h, 3 h, or 30 min, respectively. (D) LDH, IL-1β, and IL-18 release measured from supernatants of BMDMs infected with indicated strains of bacteria. Data are representative of at least two independent experiments (A and B). Data are presented as mean ± SD ( n = 3) and representative of at least three independent experiments (C and D).

    Techniques Used: Electroporation, Mouse Assay, Transfection, Infection

    21) Product Images from "Porphyromonas gingivalis in Alzheimer’s disease brains: Evidence for disease causation and treatment with small-molecule inhibitors"

    Article Title: Porphyromonas gingivalis in Alzheimer’s disease brains: Evidence for disease causation and treatment with small-molecule inhibitors

    Journal: Science Advances

    doi: 10.1126/sciadv.aau3333

    COR388 target engagement and dose-dependent effects on brain P. gingivalis , Aβ 1–42 , and TNFα in mice. ( A ) COR553 fluorescent activity probe for Kgp. ( B ) COR553 labeling of Kgp in P. gingivalis W83 strain and no labeling in mutant deficient in Kgp (ΔKgp). ( C ) W83 lysates labeled with COR553. Left lane, before immunodepletion; middle lane, after immunodepletion with anti-Kgp–conjugated beads; right lane, after elution from anti-Kgp–conjugated beads. ( D ) W83 strain titrated and labeled with COR553 to determine the limit of bacterial detection. See Results for details. ( E ) Oral plaque samples from human subjects (CB1-5) with periodontal disease were incubated ex vivo with COR553 probe with or without preincubation with COR388. COR553 probe and CAB102 detected Kgp strongly in three subjects (CB1, CB4, and CB5) and weakly in one subject (CB3). COR388 preincubation blocked COR553 probe binding to Kgp. ( F ) qPCR analysis of plaque samples using hmuY gene–specific primers identified P. gingivalis DNA in samples. ( G ) qPCR analysis of saliva samples. The bar graphs in (F) and (G) show the means and SEMs of three replicates. ( H ) COR388 treatment of W83 culture in defined growth medium reduced growth similarly to a Kgp-deficient strain (ΔKgp) over 43 hours. ( I ) Resistance developed rapidly to moxifloxacin but not COR388 with repeat passaging of bacterial culture. ( J to L ) Efficacy of COR388 at three oral doses of 3, 10, and 30 mg/kg twice daily in treating an established P. gingivalis brain infection in mice. Reduction of brain tissue levels of P. gingivalis (J), Aβ 1–42 (K), and TNFα (L). The bar graphs show the means with SEM error bars. *** P
    Figure Legend Snippet: COR388 target engagement and dose-dependent effects on brain P. gingivalis , Aβ 1–42 , and TNFα in mice. ( A ) COR553 fluorescent activity probe for Kgp. ( B ) COR553 labeling of Kgp in P. gingivalis W83 strain and no labeling in mutant deficient in Kgp (ΔKgp). ( C ) W83 lysates labeled with COR553. Left lane, before immunodepletion; middle lane, after immunodepletion with anti-Kgp–conjugated beads; right lane, after elution from anti-Kgp–conjugated beads. ( D ) W83 strain titrated and labeled with COR553 to determine the limit of bacterial detection. See Results for details. ( E ) Oral plaque samples from human subjects (CB1-5) with periodontal disease were incubated ex vivo with COR553 probe with or without preincubation with COR388. COR553 probe and CAB102 detected Kgp strongly in three subjects (CB1, CB4, and CB5) and weakly in one subject (CB3). COR388 preincubation blocked COR553 probe binding to Kgp. ( F ) qPCR analysis of plaque samples using hmuY gene–specific primers identified P. gingivalis DNA in samples. ( G ) qPCR analysis of saliva samples. The bar graphs in (F) and (G) show the means and SEMs of three replicates. ( H ) COR388 treatment of W83 culture in defined growth medium reduced growth similarly to a Kgp-deficient strain (ΔKgp) over 43 hours. ( I ) Resistance developed rapidly to moxifloxacin but not COR388 with repeat passaging of bacterial culture. ( J to L ) Efficacy of COR388 at three oral doses of 3, 10, and 30 mg/kg twice daily in treating an established P. gingivalis brain infection in mice. Reduction of brain tissue levels of P. gingivalis (J), Aβ 1–42 (K), and TNFα (L). The bar graphs show the means with SEM error bars. *** P

    Techniques Used: Mouse Assay, Activity Assay, Labeling, Mutagenesis, Incubation, Ex Vivo, Binding Assay, Real-time Polymerase Chain Reaction, Passaging, Infection

    Small-molecule gingipain inhibitors protect neuronal cells against P. gingivalis – and gingipain-induced toxicity in vitro and in vivo. ( A ) Differentiated SH-SY5Y neuroblastoma cells demonstrate cell aggregation after exposure to RgpB (10 μg/ml), Kgp (10 μg/ml), or both for 24 hours. The nonselective cysteine protease inhibitor iodoacetamide (IAM) blocks the gingipain-induced cell aggregation. ( B ) AlamarBlue viability assay shows that P. gingivalis ( P.g. ) is toxic to SH-SY5Y cells (MOI of 400) and that the small-molecule Kgp inhibitor COR271 and the RgpB inhibitor COR286 provide dose-dependent protection. The broad-spectrum antibiotics moxifloxacin and doxycycline and the γ-secretase inhibitor semagacestat did not inhibit the cytotoxic effect of P. gingivalis . ( C ) Fluoro-Jade C (FJC) staining (green) in pyramidal neurons of the CA1 region of the mouse hippocampus indicates neurodegeneration after stereotactic injection of gingipains. Counterstain with 4′,6-diamidino-2-phenylindole (DAPI) (blue). Scale bars, 50 μm. ( D ) The total number of FJC-positive cells was determined from serial section through the entire hippocampus. Results demonstrate a significant neuroprotective effect of gingipain inhibitors COR271 + COR286 after acute gingipain exposure in the hippocampus (* P
    Figure Legend Snippet: Small-molecule gingipain inhibitors protect neuronal cells against P. gingivalis – and gingipain-induced toxicity in vitro and in vivo. ( A ) Differentiated SH-SY5Y neuroblastoma cells demonstrate cell aggregation after exposure to RgpB (10 μg/ml), Kgp (10 μg/ml), or both for 24 hours. The nonselective cysteine protease inhibitor iodoacetamide (IAM) blocks the gingipain-induced cell aggregation. ( B ) AlamarBlue viability assay shows that P. gingivalis ( P.g. ) is toxic to SH-SY5Y cells (MOI of 400) and that the small-molecule Kgp inhibitor COR271 and the RgpB inhibitor COR286 provide dose-dependent protection. The broad-spectrum antibiotics moxifloxacin and doxycycline and the γ-secretase inhibitor semagacestat did not inhibit the cytotoxic effect of P. gingivalis . ( C ) Fluoro-Jade C (FJC) staining (green) in pyramidal neurons of the CA1 region of the mouse hippocampus indicates neurodegeneration after stereotactic injection of gingipains. Counterstain with 4′,6-diamidino-2-phenylindole (DAPI) (blue). Scale bars, 50 μm. ( D ) The total number of FJC-positive cells was determined from serial section through the entire hippocampus. Results demonstrate a significant neuroprotective effect of gingipain inhibitors COR271 + COR286 after acute gingipain exposure in the hippocampus (* P

    Techniques Used: In Vitro, In Vivo, Protease Inhibitor, Viability Assay, Staining, Injection

    RgpB colocalizes with neurons and pathology in AD hippocampus. ( A ) IHC using RgpB-specific monoclonal antibody 18E6 (representative images from a 63-year-old AD patient). The hippocampus shows abundant intracellular RgpB in the hilus (1), CA3 pyramidal layer (2), granular cell layer (3), and molecular layer (4). High-magnification images from the indicated areas (1 to 4) exhibit a granular staining pattern consistent with P. gingivalis intracellular infection. Scale bars, 200 μm (overview), 50 μm (1), and 10 μm (2 to 4). ( B ) AD hippocampus stained with 18E6 (AD) compared to gingival tissue (gingiva) from a patient with periodontal disease as well as a non-AD control and mouse IgG1 control (IgG1) in an adjacent hippocampal section. Scale bars, 50 μm. ( C ) Immunofluorescent colabeling with CAB101 reveals granular intraneuronal staining for RgpB (arrows) in MAP2-positive neurons in both the granular cell layer (GCL) and the pyramidal cell layer (CA1). Scale bars, 10 μm. ( D ) Dense extracellular RgpB-positive aggregates (arrowheads) were closely associated with astrocytes [glial fibrillary acidic protein (GFAP)]. There was no observed association of RgpB with microglia (IBA1). Scale bars, 10 μm. ( E ) RgpB was associated with paired helical filament Tau (PHF-Tau; arrows). RgpB-positive neurons negative for PHF-Tau (arrowheads) were also seen. Intracellular Aβ was often colocalized with RgpB (arrows). In some Aβ-positive cells, RgpB could not be detected (arrowheads). Scale bars, 10 μm.
    Figure Legend Snippet: RgpB colocalizes with neurons and pathology in AD hippocampus. ( A ) IHC using RgpB-specific monoclonal antibody 18E6 (representative images from a 63-year-old AD patient). The hippocampus shows abundant intracellular RgpB in the hilus (1), CA3 pyramidal layer (2), granular cell layer (3), and molecular layer (4). High-magnification images from the indicated areas (1 to 4) exhibit a granular staining pattern consistent with P. gingivalis intracellular infection. Scale bars, 200 μm (overview), 50 μm (1), and 10 μm (2 to 4). ( B ) AD hippocampus stained with 18E6 (AD) compared to gingival tissue (gingiva) from a patient with periodontal disease as well as a non-AD control and mouse IgG1 control (IgG1) in an adjacent hippocampal section. Scale bars, 50 μm. ( C ) Immunofluorescent colabeling with CAB101 reveals granular intraneuronal staining for RgpB (arrows) in MAP2-positive neurons in both the granular cell layer (GCL) and the pyramidal cell layer (CA1). Scale bars, 10 μm. ( D ) Dense extracellular RgpB-positive aggregates (arrowheads) were closely associated with astrocytes [glial fibrillary acidic protein (GFAP)]. There was no observed association of RgpB with microglia (IBA1). Scale bars, 10 μm. ( E ) RgpB was associated with paired helical filament Tau (PHF-Tau; arrows). RgpB-positive neurons negative for PHF-Tau (arrowheads) were also seen. Intracellular Aβ was often colocalized with RgpB (arrows). In some Aβ-positive cells, RgpB could not be detected (arrowheads). Scale bars, 10 μm.

    Techniques Used: Immunohistochemistry, Staining, Infection

    Identification of P. gingivalis –specific protein and DNA in cortex from control and AD patients. ( A ) WB with four different strains of P. gingivalis and CAB102 detection of typical molecular weight bands for Kgp in bacterial lysates. ( B ) IP using brain lysates from nondemented controls (C1 to C6; ages 75, 54, 63, 45, 37, and 102 years, respectively) and AD patients (AD1 to AD3; ages 83, 90, and 80 years, respectively) using CAB102 with subsequent WB reveals the ~50-kDa Kgp catalytic subunit (Kgp cat ), along with higher– and lower–molecular weight Kgp species seen in (A). ( C ) qPCR from DNA isolated from the same brain lysates as the protein samples analyzed in (B) shows a positive signal in nondemented control (C1 to C5) and AD (AD1 to AD3) samples. Sample C6 from the 102-year-old nondemented control patient had no detectable qPCR signal in (C) and very faint bands indicating near absence of Kgp (B) (mean with SEM error bars of repeat qPCR runs).
    Figure Legend Snippet: Identification of P. gingivalis –specific protein and DNA in cortex from control and AD patients. ( A ) WB with four different strains of P. gingivalis and CAB102 detection of typical molecular weight bands for Kgp in bacterial lysates. ( B ) IP using brain lysates from nondemented controls (C1 to C6; ages 75, 54, 63, 45, 37, and 102 years, respectively) and AD patients (AD1 to AD3; ages 83, 90, and 80 years, respectively) using CAB102 with subsequent WB reveals the ~50-kDa Kgp catalytic subunit (Kgp cat ), along with higher– and lower–molecular weight Kgp species seen in (A). ( C ) qPCR from DNA isolated from the same brain lysates as the protein samples analyzed in (B) shows a positive signal in nondemented control (C1 to C5) and AD (AD1 to AD3) samples. Sample C6 from the 102-year-old nondemented control patient had no detectable qPCR signal in (C) and very faint bands indicating near absence of Kgp (B) (mean with SEM error bars of repeat qPCR runs).

    Techniques Used: Western Blot, Molecular Weight, Real-time Polymerase Chain Reaction, Isolation

    Detection of P. gingivalis in CSF and oral biofluids from clinical AD subjects. ( A ) Detection and quantitation of P. gingivalis DNA by qPCR in CSF from subjects with probable AD. ( B ) Detection and quantitation of P. gingivalis DNA by qPCR from matching saliva samples. ( C ) Top: PCR products detecting P. gingivalis from CSF in (A) from all subjects run on agarose gel including negative and positive controls containing a synthetic DNA template. Faint or undetectable PCR products from subjects AD1, AD3, and AD5 were below the limit of quantitation for copy number and not of sufficient quantity for sequence analysis. Bottom: qPCR products from CSF from the same subjects for H. pylori. ( D ) Data table includes age and Mini Mental Status Exam (MMSE) score on subjects and sequence identity of PCR products to P. gingivalis hmuY DNA sequence. Sequence data are included in fig. S4. NS, not sequenced.
    Figure Legend Snippet: Detection of P. gingivalis in CSF and oral biofluids from clinical AD subjects. ( A ) Detection and quantitation of P. gingivalis DNA by qPCR in CSF from subjects with probable AD. ( B ) Detection and quantitation of P. gingivalis DNA by qPCR from matching saliva samples. ( C ) Top: PCR products detecting P. gingivalis from CSF in (A) from all subjects run on agarose gel including negative and positive controls containing a synthetic DNA template. Faint or undetectable PCR products from subjects AD1, AD3, and AD5 were below the limit of quantitation for copy number and not of sufficient quantity for sequence analysis. Bottom: qPCR products from CSF from the same subjects for H. pylori. ( D ) Data table includes age and Mini Mental Status Exam (MMSE) score on subjects and sequence identity of PCR products to P. gingivalis hmuY DNA sequence. Sequence data are included in fig. S4. NS, not sequenced.

    Techniques Used: Quantitation Assay, Real-time Polymerase Chain Reaction, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Sequencing

    P. gingivalis invasion of the brain induces an Aβ 1–42 response that is blocked by gingipain inhibition in mice. ( A ) P. gingivalis PCR product in mouse brains after oral infection with P. gingivalis W83, with or without treatment with the Kgp inhibitor COR119, or infection with gingipain knockout strain ΔRgpB or ΔKgp. Lanes 1 to 8 represent individual experimental animals. In the first lane ( P.g. ), P. gingivalis W83 was used as a positive control. ( B ) P. gingivalis W83–infected mice, but not COR119-treated mice or mice infected with gingipain knockouts, had significantly higher Aβ 1–42 levels compared to mock-infected mice (*** P
    Figure Legend Snippet: P. gingivalis invasion of the brain induces an Aβ 1–42 response that is blocked by gingipain inhibition in mice. ( A ) P. gingivalis PCR product in mouse brains after oral infection with P. gingivalis W83, with or without treatment with the Kgp inhibitor COR119, or infection with gingipain knockout strain ΔRgpB or ΔKgp. Lanes 1 to 8 represent individual experimental animals. In the first lane ( P.g. ), P. gingivalis W83 was used as a positive control. ( B ) P. gingivalis W83–infected mice, but not COR119-treated mice or mice infected with gingipain knockouts, had significantly higher Aβ 1–42 levels compared to mock-infected mice (*** P

    Techniques Used: Inhibition, Mouse Assay, Polymerase Chain Reaction, Infection, Knock-Out, Positive Control

    P. gingivalis and gingipains fragment tau. ( A ) WB analysis of total soluble tau in SH-SY5Y cells infected with increasing concentrations of wild-type (WT) P. gingivalis strain W83 ( P.g. ) and P. gingivalis gingipain-deficient mutants either lacking Kgp activity (KgpΔIg-B) or lacking both Kgp and Rgp activity (ΔK/ΔRAB-A) . Uninfected SH-SY5Y cells (No P.g. ) were used as a negative control. Glyceraldehyde-phosphate dehydrogenase (GAPDH) was used as a loading control. Total tau was monitored with the monoclonal antibody Tau-5 at 1, 4, and 8 hours after infection. ( B ) Densitometry analysis of the total tau WB images. ( C ) WB analysis of rtau-441 incubated with purified Kgp and RgpB catalytic domains combined (Gp) at various concentrations for 1 hour at 37°C. The blot was probed with tau monoclonal antibody T46. ( D ) Gingipain cleavage sites in rtau-441 deduced from peptide fragments identified by MS for rtau-441 incubated with 1 or 10 nM gingipains. (a) T46 antibody epitope (red). (b) Tau-5 antibody epitope (red). (c) N-terminal tau fragment. (d) C-terminal tau fragment. (e) Kgp-generated tau fragments containing the VQIVYK sequence. (f) Kgp-generated fragments containing the VQIINK sequence. (g) An RgpB-generated tau fragment. *Cleavage sites identified at 1 nM gingipains.
    Figure Legend Snippet: P. gingivalis and gingipains fragment tau. ( A ) WB analysis of total soluble tau in SH-SY5Y cells infected with increasing concentrations of wild-type (WT) P. gingivalis strain W83 ( P.g. ) and P. gingivalis gingipain-deficient mutants either lacking Kgp activity (KgpΔIg-B) or lacking both Kgp and Rgp activity (ΔK/ΔRAB-A) . Uninfected SH-SY5Y cells (No P.g. ) were used as a negative control. Glyceraldehyde-phosphate dehydrogenase (GAPDH) was used as a loading control. Total tau was monitored with the monoclonal antibody Tau-5 at 1, 4, and 8 hours after infection. ( B ) Densitometry analysis of the total tau WB images. ( C ) WB analysis of rtau-441 incubated with purified Kgp and RgpB catalytic domains combined (Gp) at various concentrations for 1 hour at 37°C. The blot was probed with tau monoclonal antibody T46. ( D ) Gingipain cleavage sites in rtau-441 deduced from peptide fragments identified by MS for rtau-441 incubated with 1 or 10 nM gingipains. (a) T46 antibody epitope (red). (b) Tau-5 antibody epitope (red). (c) N-terminal tau fragment. (d) C-terminal tau fragment. (e) Kgp-generated tau fragments containing the VQIVYK sequence. (f) Kgp-generated fragments containing the VQIINK sequence. (g) An RgpB-generated tau fragment. *Cleavage sites identified at 1 nM gingipains.

    Techniques Used: Western Blot, Infection, Activity Assay, Negative Control, Incubation, Purification, Mass Spectrometry, Generated, Sequencing

    22) Product Images from "Modifying inter-cistronic sequence significantly enhances IRES dependent second gene expression in bicistronic vector: Construction of optimised cassette for gene therapy of familial hypercholesterolemia"

    Article Title: Modifying inter-cistronic sequence significantly enhances IRES dependent second gene expression in bicistronic vector: Construction of optimised cassette for gene therapy of familial hypercholesterolemia

    Journal: Non-coding RNA Research

    doi: 10.1016/j.ncrna.2018.11.005

    Comparative analysis using qRT-PCR with primers, which amplify the hLDLR, and eGFP sequence relative to the endogenous ribosomal protein L19 transcript. The RNA relative expression levels of eGFP are barely detectable from cells transfected with constructs with spacer lengths of 445bp, 372bp, 247bp, and 216bp (constructs 1 to 4). The expression of eGFP is increased significantly at a spacer length of 188bp and peaks when the spacer length is 34bp (construct 8).
    Figure Legend Snippet: Comparative analysis using qRT-PCR with primers, which amplify the hLDLR, and eGFP sequence relative to the endogenous ribosomal protein L19 transcript. The RNA relative expression levels of eGFP are barely detectable from cells transfected with constructs with spacer lengths of 445bp, 372bp, 247bp, and 216bp (constructs 1 to 4). The expression of eGFP is increased significantly at a spacer length of 188bp and peaks when the spacer length is 34bp (construct 8).

    Techniques Used: Quantitative RT-PCR, Sequencing, Expressing, Transfection, Construct

    23) Product Images from "Glycolytic ATP Fuels the Plasma Membrane Calcium Pump Critical for Pancreatic Cancer Cell Survival *"

    Article Title: Glycolytic ATP Fuels the Plasma Membrane Calcium Pump Critical for Pancreatic Cancer Cell Survival *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M113.502948

    Inhibition of glycolysis, but not mitochondrial metabolism, induces cell death in pancreatic cancer cells. PANC1 cells were treated with either the mitochondrial inhibitor, CCCP (1–10 μ m , A ), the glycolytic inhibitor, BrPy (100–1000 μ m , B ), or a combination of both ( A , filled diamond ) for varying times (0.5–6 h). Cell death was determined using PI fluorescence on a Cellomics® ArrayScan® VTI HCS Reader (Imagen Biotech). PI-positive cells (dead) were normalized to Hoechst-positive cells (cell count) to determine % cell death ( n = 5). **, p
    Figure Legend Snippet: Inhibition of glycolysis, but not mitochondrial metabolism, induces cell death in pancreatic cancer cells. PANC1 cells were treated with either the mitochondrial inhibitor, CCCP (1–10 μ m , A ), the glycolytic inhibitor, BrPy (100–1000 μ m , B ), or a combination of both ( A , filled diamond ) for varying times (0.5–6 h). Cell death was determined using PI fluorescence on a Cellomics® ArrayScan® VTI HCS Reader (Imagen Biotech). PI-positive cells (dead) were normalized to Hoechst-positive cells (cell count) to determine % cell death ( n = 5). **, p

    Techniques Used: Inhibition, Fluorescence, Cell Counting

    Glycolytic inhibitors, but not mitochondrial inhibitors, inhibit PMCA activity in PANC1 cells. A–E , representative traces showing the in situ [Ca 2+ ] i clearance assay (PMCA activity) in fura-2-loaded PANC1 cells. CPA (30 μ m ) was applied in zero external Ca 2+ with 1 m m EGTA ( white box ) or 20 m m Ca 2+ ( gray box ) to induce store-operated Ca 2+ influx. Subsequent removal of external Ca 2+ resulted in [Ca 2+ ] i clearance. This influx-clearance phase was repeated using a paired experimental design, and metabolic inhibitors were applied during this second influx-clearance phase. Each inset trace shows expanded time courses comparing the second ( gray trace ) with the first clearance phase ( black trace ) in the presence of each metabolic inhibitor. A , time-matched control (TMC); B , 2 m m IAA; C , 10 μ m OM; D , 500 μ m 3-BrPy; E , 4 μ m CCCP. Linear clearance rate over 60 s during the second clearance phase was normalized to that of the first (% relative clearance). F , normalized linear rate (± S.E.). **, p
    Figure Legend Snippet: Glycolytic inhibitors, but not mitochondrial inhibitors, inhibit PMCA activity in PANC1 cells. A–E , representative traces showing the in situ [Ca 2+ ] i clearance assay (PMCA activity) in fura-2-loaded PANC1 cells. CPA (30 μ m ) was applied in zero external Ca 2+ with 1 m m EGTA ( white box ) or 20 m m Ca 2+ ( gray box ) to induce store-operated Ca 2+ influx. Subsequent removal of external Ca 2+ resulted in [Ca 2+ ] i clearance. This influx-clearance phase was repeated using a paired experimental design, and metabolic inhibitors were applied during this second influx-clearance phase. Each inset trace shows expanded time courses comparing the second ( gray trace ) with the first clearance phase ( black trace ) in the presence of each metabolic inhibitor. A , time-matched control (TMC); B , 2 m m IAA; C , 10 μ m OM; D , 500 μ m 3-BrPy; E , 4 μ m CCCP. Linear clearance rate over 60 s during the second clearance phase was normalized to that of the first (% relative clearance). F , normalized linear rate (± S.E.). **, p

    Techniques Used: Activity Assay, In Situ

    Glycolytic inhibitors, but not mitochondrial inhibitors, inhibit PMCA activity and store-operated Ca 2+ entry in MIA PaCa-2 cells. A–E , representative traces show the in situ [Ca 2+ ] i clearance assay (PMCA activity) in fura-2-loaded MIA PaCa-2 cells. CPA (30 μ m ) was applied in zero external Ca 2+ with 1 m m EGTA ( white box ) or 20 m m Ca 2+ ( gray box ) to induce store-operated Ca 2+ influx. Subsequent removal of external Ca 2+ resulted in [Ca 2+ ] i clearance. This influx-clearance phase was repeated using a paired experimental design, and metabolic inhibitors were applied during this second influx-clearance phase. The inset of each trace shows expanded time courses comparing the second ( gray trace ) with the first clearance phase ( black trace ) in the presence of each metabolic inhibitor. A , TMC; B , 2 m m IAA; C , 10 μ m OM; D, 500 μ m BrPy; E , 4 μ m CCCP. Linear clearance rate over 60 s during the second clearance phase was normalized to that of the first (% relative clearance). F , normalized linear rate (± S.E.). **, p
    Figure Legend Snippet: Glycolytic inhibitors, but not mitochondrial inhibitors, inhibit PMCA activity and store-operated Ca 2+ entry in MIA PaCa-2 cells. A–E , representative traces show the in situ [Ca 2+ ] i clearance assay (PMCA activity) in fura-2-loaded MIA PaCa-2 cells. CPA (30 μ m ) was applied in zero external Ca 2+ with 1 m m EGTA ( white box ) or 20 m m Ca 2+ ( gray box ) to induce store-operated Ca 2+ influx. Subsequent removal of external Ca 2+ resulted in [Ca 2+ ] i clearance. This influx-clearance phase was repeated using a paired experimental design, and metabolic inhibitors were applied during this second influx-clearance phase. The inset of each trace shows expanded time courses comparing the second ( gray trace ) with the first clearance phase ( black trace ) in the presence of each metabolic inhibitor. A , TMC; B , 2 m m IAA; C , 10 μ m OM; D, 500 μ m BrPy; E , 4 μ m CCCP. Linear clearance rate over 60 s during the second clearance phase was normalized to that of the first (% relative clearance). F , normalized linear rate (± S.E.). **, p

    Techniques Used: Activity Assay, In Situ

    Glycolytic inhibitors but not mitochondrial inhibitors induce an irreversible cytosolic Ca 2+ overload in pancreatic cancer cells. Using fura-2 fluorescence imaging, [Ca 2+ ] i concentration was measured in PANC1 or MIA PaCa cells. A–D , representative traces show the effect of various metabolic inhibitors on [Ca 2+ ] i in PANC1 cells. Cells were treated for 30 min with either mitochondrial inhibitors (10 μ m OM ( A ); 4 μ m CCCP ( C )) or glycolytic inhibitors (500 μ m BrPy ( B ); 2 m m IAA ( D )) followed by stimulation with the purinergic agonist, ATP (100 μ m ) to test for cell viability. Similar qualitative results were obtained for MIA PaCa-2 cells. Responses were quantified by measuring the AUC ( E ) for the 30-min treatment with drug and maximum change in [Ca 2+ ] i ( F ). Recovery from metabolic inhibitor treatment was assessed by measuring the % cells that subsequently responded to ATP ( G ). *, p
    Figure Legend Snippet: Glycolytic inhibitors but not mitochondrial inhibitors induce an irreversible cytosolic Ca 2+ overload in pancreatic cancer cells. Using fura-2 fluorescence imaging, [Ca 2+ ] i concentration was measured in PANC1 or MIA PaCa cells. A–D , representative traces show the effect of various metabolic inhibitors on [Ca 2+ ] i in PANC1 cells. Cells were treated for 30 min with either mitochondrial inhibitors (10 μ m OM ( A ); 4 μ m CCCP ( C )) or glycolytic inhibitors (500 μ m BrPy ( B ); 2 m m IAA ( D )) followed by stimulation with the purinergic agonist, ATP (100 μ m ) to test for cell viability. Similar qualitative results were obtained for MIA PaCa-2 cells. Responses were quantified by measuring the AUC ( E ) for the 30-min treatment with drug and maximum change in [Ca 2+ ] i ( F ). Recovery from metabolic inhibitor treatment was assessed by measuring the % cells that subsequently responded to ATP ( G ). *, p

    Techniques Used: Fluorescence, Imaging, Concentration Assay

    Glycolytic inhibitors, but not mitochondrial inhibitors, inhibit PMCA activity in MIA PaCa-2 cells. A–E , representative traces show a modified protocol in situ [Ca 2+ ] i clearance assay (PMCA activity) in fura-2-loaded MIA PaCa-2 cells. Ca 2+ influx was induced before application of test reagents to isolate their effects on clearance. CPA (30 μ m ) was applied in the absence of external Ca 2+ with 1 m m EGTA ( white box ) or 20 m m Ca 2+ ( gray box ) to induce store-operated Ca 2+ influx. 1 m m La 3+ was then applied at the peak of Ca 2+ influx ( striped box ). Subsequent removal of external La 3+ with 1 m m EGTA after 5 min allowed [Ca 2+ ] i clearance. This influx-clearance phase was repeated, and metabolic inhibitors were applied during this second influx-clearance phase. Each inset trace shows expanded time courses comparing the second clearance phase ( gray trace ) with the first ( black trace ) in the presence of each metabolic inhibitor. A , TMC; B , 2 m m IAA; C , 10 μ m OM; D , 500 μ m BrPy; E , 4 μ m CCCP. Linear clearance rate over 60 s during the second clearance phase was normalized to that of the first (% relative clearance). Recovery during the second clearance phase was normalized to the base-line [Ca 2+ ] i before the first influx-clearance phase. F , normalized linear rate (± S.E.). G , recovery (± S.E.). **, p
    Figure Legend Snippet: Glycolytic inhibitors, but not mitochondrial inhibitors, inhibit PMCA activity in MIA PaCa-2 cells. A–E , representative traces show a modified protocol in situ [Ca 2+ ] i clearance assay (PMCA activity) in fura-2-loaded MIA PaCa-2 cells. Ca 2+ influx was induced before application of test reagents to isolate their effects on clearance. CPA (30 μ m ) was applied in the absence of external Ca 2+ with 1 m m EGTA ( white box ) or 20 m m Ca 2+ ( gray box ) to induce store-operated Ca 2+ influx. 1 m m La 3+ was then applied at the peak of Ca 2+ influx ( striped box ). Subsequent removal of external La 3+ with 1 m m EGTA after 5 min allowed [Ca 2+ ] i clearance. This influx-clearance phase was repeated, and metabolic inhibitors were applied during this second influx-clearance phase. Each inset trace shows expanded time courses comparing the second clearance phase ( gray trace ) with the first ( black trace ) in the presence of each metabolic inhibitor. A , TMC; B , 2 m m IAA; C , 10 μ m OM; D , 500 μ m BrPy; E , 4 μ m CCCP. Linear clearance rate over 60 s during the second clearance phase was normalized to that of the first (% relative clearance). Recovery during the second clearance phase was normalized to the base-line [Ca 2+ ] i before the first influx-clearance phase. F , normalized linear rate (± S.E.). G , recovery (± S.E.). **, p

    Techniques Used: Activity Assay, Modification, In Situ

    24) Product Images from "AMD3100-mediated production of interleukin-1 from mesenchymal stem cells is key to chemosensitivity of breast cancer cells"

    Article Title: AMD3100-mediated production of interleukin-1 from mesenchymal stem cells is key to chemosensitivity of breast cancer cells

    Journal: American Journal of Cancer Research

    doi:

    CXCL12-CXCR4 interaction between BCCs and MSCs in BCC proliferation. (A) Western blots were performed with extracts from MSCs and BCCs, stably knockdown (KD) for CXCL12 and CXCR4. Controls included mutant (mut) shRNA and non-transfectants (NT). Membranes were stripped and re-probed with β-actin for normalization. (B) MDA-MB-231 were pre-treated mitomycin C (5 μg/mL) to halt cell growth, and then cultured alone or in combination with MSCs for 7 days and cell proliferation measured to determine the effect of BCCs on MSC growth. (C) MSCs and BCCs, knockdown for CXCL12 or CXCR4 and controls were cultured alone or together for 48 h and then studied for proliferation. The results are presented as mean of 10 replicates in five different experiments, each with MSCs from a different donor (±SD). Dose-response curves were established for AMD3100 on BCC proliferation, in the presence or absence of MSCs in 48 h cultures ( D and E ). The results are presented as mean of ten replicates in five different independent experiments, each with MSCs from a different donor (±SD). Optimal AMD3100 (D and E) dose points were selected and then studied in proliferation responses at various times ( F and G ) and the results are presented as for D and E.* p ≤0.05 vs. BCC alone.
    Figure Legend Snippet: CXCL12-CXCR4 interaction between BCCs and MSCs in BCC proliferation. (A) Western blots were performed with extracts from MSCs and BCCs, stably knockdown (KD) for CXCL12 and CXCR4. Controls included mutant (mut) shRNA and non-transfectants (NT). Membranes were stripped and re-probed with β-actin for normalization. (B) MDA-MB-231 were pre-treated mitomycin C (5 μg/mL) to halt cell growth, and then cultured alone or in combination with MSCs for 7 days and cell proliferation measured to determine the effect of BCCs on MSC growth. (C) MSCs and BCCs, knockdown for CXCL12 or CXCR4 and controls were cultured alone or together for 48 h and then studied for proliferation. The results are presented as mean of 10 replicates in five different experiments, each with MSCs from a different donor (±SD). Dose-response curves were established for AMD3100 on BCC proliferation, in the presence or absence of MSCs in 48 h cultures ( D and E ). The results are presented as mean of ten replicates in five different independent experiments, each with MSCs from a different donor (±SD). Optimal AMD3100 (D and E) dose points were selected and then studied in proliferation responses at various times ( F and G ) and the results are presented as for D and E.* p ≤0.05 vs. BCC alone.

    Techniques Used: Western Blot, Stable Transfection, Mutagenesis, shRNA, Multiple Displacement Amplification, Cell Culture

    Resistance to chemotherapy in non-combinatorial, AMD3100-treated MSC/BCC cocultures. BCCs cultured in the presence or absence of MSCs for 12 days were treated for 48 h with AMD3100, or untreated. Following 48 h, treated and untreated cells were exposed to carboplatin for 72 h to induce cell death. The treated cells did not receive chemotherapy in combination with a second dose of AMD3100 (as illustrated by +/-). At the end of this regiment cell proliferation ( A and B ) and viability ( C and D ) were assessed. The results are presented as the mean of ten replicates in five different experiments, each with MSCs from a different donor (± SD).
    Figure Legend Snippet: Resistance to chemotherapy in non-combinatorial, AMD3100-treated MSC/BCC cocultures. BCCs cultured in the presence or absence of MSCs for 12 days were treated for 48 h with AMD3100, or untreated. Following 48 h, treated and untreated cells were exposed to carboplatin for 72 h to induce cell death. The treated cells did not receive chemotherapy in combination with a second dose of AMD3100 (as illustrated by +/-). At the end of this regiment cell proliferation ( A and B ) and viability ( C and D ) were assessed. The results are presented as the mean of ten replicates in five different experiments, each with MSCs from a different donor (± SD).

    Techniques Used: Cell Culture

    Treatment of co-cultured BCCs-MSCs with carboplatin and AMD3100. BCCs, cultured alone or with MSCs for 12 days, were treated with AMD3100, or untreated. After 48 h, all cultures were exposed to carboplatin, with re-added AMD3100 in cultures that had initial AMD3100. After 72 h, the viable cells were counted ( A and B ), and presented ( C and D ). The results are presented as the mean of ten replicates in five independent experiments, each with MSCs from a different donor (±SD). Whole cell extracts from these experiments were analyzed by immunoblot for caspase-3 ( E ). Membranes were stripped and re-probed with β-actin for normalization. Representative blots are shown for three independent experiments, each performed with MSCs from a different donor. ( F ) Cytokeratin (+) cells were detected in peripheral blood of BC patients by flow cytometry. ( G ) Cytokeratin-positive cells were negatively selected and then cultured alone or in combination with MSCs for 12 days as above. * p ≤0.05 vs. BCCs alone; ** p ≤0.05 vs. BCCs + MSCs.
    Figure Legend Snippet: Treatment of co-cultured BCCs-MSCs with carboplatin and AMD3100. BCCs, cultured alone or with MSCs for 12 days, were treated with AMD3100, or untreated. After 48 h, all cultures were exposed to carboplatin, with re-added AMD3100 in cultures that had initial AMD3100. After 72 h, the viable cells were counted ( A and B ), and presented ( C and D ). The results are presented as the mean of ten replicates in five independent experiments, each with MSCs from a different donor (±SD). Whole cell extracts from these experiments were analyzed by immunoblot for caspase-3 ( E ). Membranes were stripped and re-probed with β-actin for normalization. Representative blots are shown for three independent experiments, each performed with MSCs from a different donor. ( F ) Cytokeratin (+) cells were detected in peripheral blood of BC patients by flow cytometry. ( G ) Cytokeratin-positive cells were negatively selected and then cultured alone or in combination with MSCs for 12 days as above. * p ≤0.05 vs. BCCs alone; ** p ≤0.05 vs. BCCs + MSCs.

    Techniques Used: Cell Culture, Flow Cytometry, Cytometry

    IL-1 in AMD3100-mediated BCC cycling. MSCs were co-cultured with BCCs for 12 days with, or without AMD3100. The MSCs were selected and then added to the inner wells of tran-swell cultures. Naïve BCCs were placed in the outer wells. After 48 h, BCCs were counted and the results presented as the mean of ten replicates in five independent experiments, each performed with MSCs from a different donor (±SD) ( A and B ). The media were analyzed for cytokine production with protein array and the normalized values presented as fold change relative to the internal control ( C ). The studies were repeated with anti-IL-1RI or control IgG ( D ); or with IL-1α/β knockdown MSCs ( E ). The results are presented as for A and B, n=5. * p ≤0.05 vs. no AMD3100; ** p ≤0.05 vs. control IgG.
    Figure Legend Snippet: IL-1 in AMD3100-mediated BCC cycling. MSCs were co-cultured with BCCs for 12 days with, or without AMD3100. The MSCs were selected and then added to the inner wells of tran-swell cultures. Naïve BCCs were placed in the outer wells. After 48 h, BCCs were counted and the results presented as the mean of ten replicates in five independent experiments, each performed with MSCs from a different donor (±SD) ( A and B ). The media were analyzed for cytokine production with protein array and the normalized values presented as fold change relative to the internal control ( C ). The studies were repeated with anti-IL-1RI or control IgG ( D ); or with IL-1α/β knockdown MSCs ( E ). The results are presented as for A and B, n=5. * p ≤0.05 vs. no AMD3100; ** p ≤0.05 vs. control IgG.

    Techniques Used: Cell Culture, Protein Array

    Effect of AMD3100 on BCC proliferation following extended co-culture with MSCs and on cell cycle. MDA-MB-231 ( A ) or T47D ( B ), alone or with MSCs, were treated with AMD3100 for either 2 (D2) or 12 (D12) days. Control cultures were untreated. The results are presented as the mean of ten replicates in five independent experiments, each with MSCs from a different donor (± SD). * p ≤0.05 vs. BCC alone or 12-day cultures with MSCs were treated with AMD3100 for the last 48 h or untreated. At the end of the assay, cells were co-labeled with anti-cytokeratin and propidium iodide and then analyzed by flow cytometry. Results are presented as the mean percent cycling cells (S + G 2 /M phases) ± SD, n=3. Each experiment was performed with MSCs from a different donor ( C ). Representative histogram for MDA-MB-231 co-cultured with MSCs, with or without AMD3100. * p ≤0.05 vs. BCCs alone; ** p ≤0.05 vs. BCCs with MSCs; no AMD3100. The histograms ( D ) represent non-cycling (1) and cycling cells (2, 3). Arrow shows the increased in cycling cells followingAMD3100 treatment.
    Figure Legend Snippet: Effect of AMD3100 on BCC proliferation following extended co-culture with MSCs and on cell cycle. MDA-MB-231 ( A ) or T47D ( B ), alone or with MSCs, were treated with AMD3100 for either 2 (D2) or 12 (D12) days. Control cultures were untreated. The results are presented as the mean of ten replicates in five independent experiments, each with MSCs from a different donor (± SD). * p ≤0.05 vs. BCC alone or 12-day cultures with MSCs were treated with AMD3100 for the last 48 h or untreated. At the end of the assay, cells were co-labeled with anti-cytokeratin and propidium iodide and then analyzed by flow cytometry. Results are presented as the mean percent cycling cells (S + G 2 /M phases) ± SD, n=3. Each experiment was performed with MSCs from a different donor ( C ). Representative histogram for MDA-MB-231 co-cultured with MSCs, with or without AMD3100. * p ≤0.05 vs. BCCs alone; ** p ≤0.05 vs. BCCs with MSCs; no AMD3100. The histograms ( D ) represent non-cycling (1) and cycling cells (2, 3). Arrow shows the increased in cycling cells followingAMD3100 treatment.

    Techniques Used: Co-Culture Assay, Multiple Displacement Amplification, Labeling, Flow Cytometry, Cytometry, Cell Culture

    25) Product Images from "Monocytic microparticles activate endothelial cells in an IL-1?-dependent manner"

    Article Title: Monocytic microparticles activate endothelial cells in an IL-1?-dependent manner

    Journal: Blood

    doi: 10.1182/blood-2011-01-330878

    MPs from LPS-treated THP-1 cells contain IL-1β and inflammasome components. MPs were isolated from THP-1 cells treated with or without LPS. Lysates of MPs and their parental THP-1 cells were subjected to Western blot for (A) IL-1β and ICAM-1, VCAM-1, and E-selectin or (B) NLRP3, caspase-1, and ASC. GAPDH served as a loading control. Western blots are representative of 3 independent experiments. (C) Densitometry from representative MP blots in panel B. Data are mean ± SD; n = 3. * P
    Figure Legend Snippet: MPs from LPS-treated THP-1 cells contain IL-1β and inflammasome components. MPs were isolated from THP-1 cells treated with or without LPS. Lysates of MPs and their parental THP-1 cells were subjected to Western blot for (A) IL-1β and ICAM-1, VCAM-1, and E-selectin or (B) NLRP3, caspase-1, and ASC. GAPDH served as a loading control. Western blots are representative of 3 independent experiments. (C) Densitometry from representative MP blots in panel B. Data are mean ± SD; n = 3. * P

    Techniques Used: Isolation, Western Blot

    IL-1 receptor antagonist inhibits the induction of adhesion molecules on HUVECs by MPs. HUVECs were preincubated with the indicated amounts of the IL-1R antagonist (Kineret) for 30 minutes before a 4-hour incubation with 100 μg/mL of MPs from LPS-treated THP-1 cells in serum-free conditions. Lysates were then subjected to Western blot for (A) ICAM-1, (B) VCAM-1, or (C) E-selectin (representative of 3 experiments). Densitometry measurements of these experiments: Data are mean ± SD; n = 3. * P
    Figure Legend Snippet: IL-1 receptor antagonist inhibits the induction of adhesion molecules on HUVECs by MPs. HUVECs were preincubated with the indicated amounts of the IL-1R antagonist (Kineret) for 30 minutes before a 4-hour incubation with 100 μg/mL of MPs from LPS-treated THP-1 cells in serum-free conditions. Lysates were then subjected to Western blot for (A) ICAM-1, (B) VCAM-1, or (C) E-selectin (representative of 3 experiments). Densitometry measurements of these experiments: Data are mean ± SD; n = 3. * P

    Techniques Used: Incubation, Western Blot

    MPs released by LPS-treated THP-1 cells stimulate intracellular signaling in HUVECs. A total of 100 μg/mL of MPs from LPS-treated (A) or untreated (B) THP-1 cells was incubated in serum-free conditions with HUVECs. Phosphorylation of ERK1/2 and degradation of IκB-α were observed by Western blot at the indicated times. (C) Indicated amounts of MPs from LPS-treated THP-1 cells or 10 ng/mL of TNF-α were incubated in serum-free conditions with HUVECs for the indicated time. Phosphorylation of p65 was detected by Western blot. (D) Subcellular localization of p65 was examined in HUVECs after 1 or 2 hours of stimulation with MPs from untreated or LPS-treated THP-1 cells or 10 ng/mL of TNF-α. HDAC2 served as the nuclear loading control, and GAPDH served as a cytoplasmic loading control. Results are representative of 2 independent experiments.
    Figure Legend Snippet: MPs released by LPS-treated THP-1 cells stimulate intracellular signaling in HUVECs. A total of 100 μg/mL of MPs from LPS-treated (A) or untreated (B) THP-1 cells was incubated in serum-free conditions with HUVECs. Phosphorylation of ERK1/2 and degradation of IκB-α were observed by Western blot at the indicated times. (C) Indicated amounts of MPs from LPS-treated THP-1 cells or 10 ng/mL of TNF-α were incubated in serum-free conditions with HUVECs for the indicated time. Phosphorylation of p65 was detected by Western blot. (D) Subcellular localization of p65 was examined in HUVECs after 1 or 2 hours of stimulation with MPs from untreated or LPS-treated THP-1 cells or 10 ng/mL of TNF-α. HDAC2 served as the nuclear loading control, and GAPDH served as a cytoplasmic loading control. Results are representative of 2 independent experiments.

    Techniques Used: Incubation, Western Blot

    MPs released by LPS-treated THP-1 cells induce the expression of cell adhesion molecules by HUVECs. (A) HUVECs were incubated for 1 or 2 hours in serum-free conditions with MPs from untreated or LPS-treated THP-1 cells or 10 ng/mL TNF-α. ICAM-1 , VCAM-1 , and E-selectin mRNA expression was measured by real-time polymerase chain reaction. (B) HUVECs were incubated for 4 hours in serum-free conditions with MPs derived from LPS-treated or untreated THP-1 cells or 10 ng/mL TNF-α. Expression of VCAM-1, E-selectin, and ICAM-1 by HUVECs was detected by Western blot. (C) HUVECs were incubated for 4 hours in serum-free conditions with MPs from LPS-treated PBMCs or 10 ng/mL TNF-α. VCAM-1 was detected by Western blot. (D) HUVECs were treated with 5 or 10μM of the NF-κB pathway inhibitors MG-132, Bay11–7082, or vehicle control (dimethyl sulfoxide [DMSO]) and then stimulated with MPs from LPS-treated THP-1 cells. VCAM-1 was detected by Western blot. GAPDH served as a loading control. Results are representative of 3 independent experiments.
    Figure Legend Snippet: MPs released by LPS-treated THP-1 cells induce the expression of cell adhesion molecules by HUVECs. (A) HUVECs were incubated for 1 or 2 hours in serum-free conditions with MPs from untreated or LPS-treated THP-1 cells or 10 ng/mL TNF-α. ICAM-1 , VCAM-1 , and E-selectin mRNA expression was measured by real-time polymerase chain reaction. (B) HUVECs were incubated for 4 hours in serum-free conditions with MPs derived from LPS-treated or untreated THP-1 cells or 10 ng/mL TNF-α. Expression of VCAM-1, E-selectin, and ICAM-1 by HUVECs was detected by Western blot. (C) HUVECs were incubated for 4 hours in serum-free conditions with MPs from LPS-treated PBMCs or 10 ng/mL TNF-α. VCAM-1 was detected by Western blot. (D) HUVECs were treated with 5 or 10μM of the NF-κB pathway inhibitors MG-132, Bay11–7082, or vehicle control (dimethyl sulfoxide [DMSO]) and then stimulated with MPs from LPS-treated THP-1 cells. VCAM-1 was detected by Western blot. GAPDH served as a loading control. Results are representative of 3 independent experiments.

    Techniques Used: Expressing, Incubation, Real-time Polymerase Chain Reaction, Derivative Assay, Western Blot

    Assessment of LPS contamination in MPs. (A) HUVECs were incubated in serum-free conditions with the indicated amounts of MPs from LPS-treated THP-1 cells, LPS, or 10 ng/mL of TNF-α. Expression of VCAM-1 was detected by Western blot. (B) HUVECs were incubated with increasing concentrations of polymyxin B and then stimulated in serum-free conditions with MPs from LPS-treated THP-1 cells or in serum-containing media with LPS. VCAM-1 was detected by Western blot. (C) HUVECs were pretreated with the Toll like receptor-4 inhibitor TAK-242 or vehicle control (DMSO) and then stimulated with either 100 μg/mL of MPs derived from LPS-treated THP-1 cells in serum-free conditions or with 10 μg/mL of LPS in serum-containing media. HUVECs incubated with 10 ng/mL of TNF-α or left untreated served as controls. VCAM-1 expression in HUVECs was detected by Western blot. GAPDH served as a loading control. (D) Densitometry of Western blots shown in panel C. Data are mean ± SD; n = 4. * P
    Figure Legend Snippet: Assessment of LPS contamination in MPs. (A) HUVECs were incubated in serum-free conditions with the indicated amounts of MPs from LPS-treated THP-1 cells, LPS, or 10 ng/mL of TNF-α. Expression of VCAM-1 was detected by Western blot. (B) HUVECs were incubated with increasing concentrations of polymyxin B and then stimulated in serum-free conditions with MPs from LPS-treated THP-1 cells or in serum-containing media with LPS. VCAM-1 was detected by Western blot. (C) HUVECs were pretreated with the Toll like receptor-4 inhibitor TAK-242 or vehicle control (DMSO) and then stimulated with either 100 μg/mL of MPs derived from LPS-treated THP-1 cells in serum-free conditions or with 10 μg/mL of LPS in serum-containing media. HUVECs incubated with 10 ng/mL of TNF-α or left untreated served as controls. VCAM-1 expression in HUVECs was detected by Western blot. GAPDH served as a loading control. (D) Densitometry of Western blots shown in panel C. Data are mean ± SD; n = 4. * P

    Techniques Used: Incubation, Expressing, Western Blot, Derivative Assay

    NLRP3 is required for IL-1β expression in MPs from LPS-treated THP-1 cells. (A) NLRP3 protein was detected by Western blot in untreated stable THP-1 cells containing shNLRP3 or empty vector. (B) IL-1β was measured by enzyme-linked immunosorbent assay in MPs from LPS-treated shNLRP3 or empty vector THP-1 cells. (C) HUVECs were treated for 3 or 4 hours with 50 μg/mL of MPs from LPS-treated shNLRP3 or empty vector THP-1 cells or 10 ng/mL of TNF-α for 4 hours. VCAM-1 was detected by Western blot, and the relative level of VCAM-1 expression was shown by densitometry. GAPDH served as a loading control. Data are mean ± SD; n = 4. * P
    Figure Legend Snippet: NLRP3 is required for IL-1β expression in MPs from LPS-treated THP-1 cells. (A) NLRP3 protein was detected by Western blot in untreated stable THP-1 cells containing shNLRP3 or empty vector. (B) IL-1β was measured by enzyme-linked immunosorbent assay in MPs from LPS-treated shNLRP3 or empty vector THP-1 cells. (C) HUVECs were treated for 3 or 4 hours with 50 μg/mL of MPs from LPS-treated shNLRP3 or empty vector THP-1 cells or 10 ng/mL of TNF-α for 4 hours. VCAM-1 was detected by Western blot, and the relative level of VCAM-1 expression was shown by densitometry. GAPDH served as a loading control. Data are mean ± SD; n = 4. * P

    Techniques Used: Expressing, Western Blot, Plasmid Preparation, Enzyme-linked Immunosorbent Assay

    MPs released by LPS-treated THP-1 cells bind to endothelial cells. MPs were isolated from THP-1 cells left untreated or treated with 5 μg/mL LPS for 24 hours. (A) MPs were stained with annexin V with or without calcium and detected by flow cytometry. (B) Annexin V-positive events per milliliter were calculated using a known concentration of flow count beads. (C) MPs from LPS-treated THP-1 cells were labeled with calcein AM and incubated with HUVECs for the indicated times. Fluorescence intensity was measured using a fluorescent plate reader and shown after the subtraction of the background signal of HUVECs alone. (D) Calcein AM-labeled MPs (green) from LPS-treated THP-1 cells were incubated with calcein orange and 4,6 diamidino-2-phenylindole (blue nuclei)-labeled HUVECs for 4 hours and observed in a 1-μm section by confocal microscopy at room temperature using an Olympus Fluoview 1000 with 40× lens. The image was acquired using Olympus Fluoview Version 2.0 viewer and processed using Image J software. Results are representative of at least 3 independent experiments (n = 3 for panels A and B; n = 6 for panel C). * P
    Figure Legend Snippet: MPs released by LPS-treated THP-1 cells bind to endothelial cells. MPs were isolated from THP-1 cells left untreated or treated with 5 μg/mL LPS for 24 hours. (A) MPs were stained with annexin V with or without calcium and detected by flow cytometry. (B) Annexin V-positive events per milliliter were calculated using a known concentration of flow count beads. (C) MPs from LPS-treated THP-1 cells were labeled with calcein AM and incubated with HUVECs for the indicated times. Fluorescence intensity was measured using a fluorescent plate reader and shown after the subtraction of the background signal of HUVECs alone. (D) Calcein AM-labeled MPs (green) from LPS-treated THP-1 cells were incubated with calcein orange and 4,6 diamidino-2-phenylindole (blue nuclei)-labeled HUVECs for 4 hours and observed in a 1-μm section by confocal microscopy at room temperature using an Olympus Fluoview 1000 with 40× lens. The image was acquired using Olympus Fluoview Version 2.0 viewer and processed using Image J software. Results are representative of at least 3 independent experiments (n = 3 for panels A and B; n = 6 for panel C). * P

    Techniques Used: Isolation, Staining, Flow Cytometry, Cytometry, Concentration Assay, Labeling, Incubation, Fluorescence, Confocal Microscopy, Software

    26) Product Images from "Inhibition of poly(ADP-ribose)polymerase-1 and DNA repair by uranium"

    Article Title: Inhibition of poly(ADP-ribose)polymerase-1 and DNA repair by uranium

    Journal: Toxicology and applied pharmacology

    doi: 10.1016/j.taap.2015.11.017

    Inhibition of zinc finger-proteins by UA HEKn cells were treated with the indicated concentrations of UA for 24 h. A B) Total protein was collected and PARP activity assessed via the PAR ELISA as described in “Experimental procedures”. A) PARP activity was stimulated by high concentration of UA alone. B) DNA damage-induced PARP activity (stimulated via the addition of etoposide (80 μM) for 4 h) inhibited by UA C D). Cells were exposed to UA (0–30 μM) for 24 h. PARP-1 was immunoprecipitated from 500 μg of whole cell extract and zinc content of the protein determined via the Zinc Release Assay as described in “Experimental procedures”. C) UA induces loss of zinc from PARP-1 in both HEK293 (black bars) and HEKn (gray bars). D) Zinc assessment of immunoprecipitated XPA (dark gray bars), APTX (light gray bars) and SP1 (white bars) from HEKn cells. Graphs represent normalized means ± SEM of at least 3 independent experiments. **p
    Figure Legend Snippet: Inhibition of zinc finger-proteins by UA HEKn cells were treated with the indicated concentrations of UA for 24 h. A B) Total protein was collected and PARP activity assessed via the PAR ELISA as described in “Experimental procedures”. A) PARP activity was stimulated by high concentration of UA alone. B) DNA damage-induced PARP activity (stimulated via the addition of etoposide (80 μM) for 4 h) inhibited by UA C D). Cells were exposed to UA (0–30 μM) for 24 h. PARP-1 was immunoprecipitated from 500 μg of whole cell extract and zinc content of the protein determined via the Zinc Release Assay as described in “Experimental procedures”. C) UA induces loss of zinc from PARP-1 in both HEK293 (black bars) and HEKn (gray bars). D) Zinc assessment of immunoprecipitated XPA (dark gray bars), APTX (light gray bars) and SP1 (white bars) from HEKn cells. Graphs represent normalized means ± SEM of at least 3 independent experiments. **p

    Techniques Used: Inhibition, Activity Assay, Enzyme-linked Immunosorbent Assay, Concentration Assay, Immunoprecipitation, Release Assay

    Enhanced DNA damage due to UA exposure. (A) HEK293 cells were treated with increasing concentrations of UA (0–100 μM) for 24 h. DNA damage was assessed via indirect immunofluorescence with anti-pH2AX antibodies. Images were collected with an Olympus IX70 equipped with a DP72 digital camera (Olympus America). Fluorescence intensity was quantified using cellSens Dimension 1.9 Count Measure software (Olympus America). *p
    Figure Legend Snippet: Enhanced DNA damage due to UA exposure. (A) HEK293 cells were treated with increasing concentrations of UA (0–100 μM) for 24 h. DNA damage was assessed via indirect immunofluorescence with anti-pH2AX antibodies. Images were collected with an Olympus IX70 equipped with a DP72 digital camera (Olympus America). Fluorescence intensity was quantified using cellSens Dimension 1.9 Count Measure software (Olympus America). *p

    Techniques Used: Immunofluorescence, Fluorescence, Software

    Retention of DNA damage following UA exposure is rescued by zinc. Immunocytochemistry of HEK293 cells was used to illustrate oxidative (A, pH2AX) and direct (B, CPDs) DNA damage. Cells were cultured on chamber slides and treated with UA (10 μM), Zn(2 μM), both or neither for 24 h then DNA damage was induced by exposure to ssUVR (3 kJ/m 2 ). Cells were fixed at 0,1 and 6 h post-ssUVR exposure and stained for the DNA damage markers pH2AX (A) and CPDs (C). Images were collected with an Olympus IX70 equipped with a digital camera and fluorescence intensity was quantified using cellSens Dimension 1.9 Count Measure software (Olympus America) and graphs shown (B, pH2AX and D, CPDs) are mean ± SEM of the intensity per nuclei of at least 10 images from each treatment group from 3 independent experiments. *p
    Figure Legend Snippet: Retention of DNA damage following UA exposure is rescued by zinc. Immunocytochemistry of HEK293 cells was used to illustrate oxidative (A, pH2AX) and direct (B, CPDs) DNA damage. Cells were cultured on chamber slides and treated with UA (10 μM), Zn(2 μM), both or neither for 24 h then DNA damage was induced by exposure to ssUVR (3 kJ/m 2 ). Cells were fixed at 0,1 and 6 h post-ssUVR exposure and stained for the DNA damage markers pH2AX (A) and CPDs (C). Images were collected with an Olympus IX70 equipped with a digital camera and fluorescence intensity was quantified using cellSens Dimension 1.9 Count Measure software (Olympus America) and graphs shown (B, pH2AX and D, CPDs) are mean ± SEM of the intensity per nuclei of at least 10 images from each treatment group from 3 independent experiments. *p

    Techniques Used: Immunocytochemistry, Cell Culture, Staining, Fluorescence, Software

    27) Product Images from "NKp30 isoforms and NKp46 transcripts in metastatic melanoma patients: Unique NKp30 pattern in rare melanoma patients with favorable evolution"

    Article Title: NKp30 isoforms and NKp46 transcripts in metastatic melanoma patients: Unique NKp30 pattern in rare melanoma patients with favorable evolution

    Journal: Oncoimmunology

    doi: 10.1080/2162402X.2016.1154251

    NCR3 genetic variants in Long Survivors and Progressors Melanoma patients. (A–B) Frequencies of NCR3 genetic variants rs986475 (A) and rs15575842 (B) in HV and progressor or LS melanoma patients. (C–F) Analysis of membrane expression of NKp30 according to the presence of the two NCR3 SNP, rs986475 (C) and rs11575842 (E) in progressor (n = 37, black dots) and 13 LS (n = 13, white dots) melanoma patients. Transcript levels (left panels) or ratios (right panels) of NKp30 isoforms according to rs986475 (D) and rs11575842 (F) SNPs in progressor (n = 104) or LS (n = 13) melanoma patients. Non-parametric Mann–Whitney test was used to compare groups.
    Figure Legend Snippet: NCR3 genetic variants in Long Survivors and Progressors Melanoma patients. (A–B) Frequencies of NCR3 genetic variants rs986475 (A) and rs15575842 (B) in HV and progressor or LS melanoma patients. (C–F) Analysis of membrane expression of NKp30 according to the presence of the two NCR3 SNP, rs986475 (C) and rs11575842 (E) in progressor (n = 37, black dots) and 13 LS (n = 13, white dots) melanoma patients. Transcript levels (left panels) or ratios (right panels) of NKp30 isoforms according to rs986475 (D) and rs11575842 (F) SNPs in progressor (n = 104) or LS (n = 13) melanoma patients. Non-parametric Mann–Whitney test was used to compare groups.

    Techniques Used: Expressing, MANN-WHITNEY

    28) Product Images from "A Drosophila dopamine 2-like receptor: Molecular characterization and identification of multiple alternatively spliced variants"

    Article Title: A Drosophila dopamine 2-like receptor: Molecular characterization and identification of multiple alternatively spliced variants

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.202498299

    Alternative splicing of the DD2R gene generates multiple receptor variants. ( A ) The protein-coding exons are depicted as boxes (E1–E9). The size of each intron (number of bases) is shown in parentheses. The portion of the receptor encoded by each exon is illustrated, highlighting the number of amino acids (aa) per exon and the relative position of TMs I–VII (solid gray boxes). ( B ) The complete amino acid sequence of DD2R-606. Double and single underlining marks the sequence that corresponds to exons 6 and 7, respectively. DD2R-506 includes exon 7 but not exon 6 coding sequence. DD2R-461 lacks both exon-6 and -7 coding sequence. ( C ) Variable splicing of exon 6 results in DD2R splice variants DD2R-606, -605, -598, -597, -589, and -581. The carboxyl- and amino-terminal 5 aa of exons 5 and 7, respectively, are shown. Dashes represent amino acids that are absent in the corresponding transcript. Forty-eight amino acids that are shared among DD2R-606, -605, -598, -597, -589, and -581 are depicted by (48 aa). The putative splice sites are illustrated in supporting information, Fig. 5.
    Figure Legend Snippet: Alternative splicing of the DD2R gene generates multiple receptor variants. ( A ) The protein-coding exons are depicted as boxes (E1–E9). The size of each intron (number of bases) is shown in parentheses. The portion of the receptor encoded by each exon is illustrated, highlighting the number of amino acids (aa) per exon and the relative position of TMs I–VII (solid gray boxes). ( B ) The complete amino acid sequence of DD2R-606. Double and single underlining marks the sequence that corresponds to exons 6 and 7, respectively. DD2R-506 includes exon 7 but not exon 6 coding sequence. DD2R-461 lacks both exon-6 and -7 coding sequence. ( C ) Variable splicing of exon 6 results in DD2R splice variants DD2R-606, -605, -598, -597, -589, and -581. The carboxyl- and amino-terminal 5 aa of exons 5 and 7, respectively, are shown. Dashes represent amino acids that are absent in the corresponding transcript. Forty-eight amino acids that are shared among DD2R-606, -605, -598, -597, -589, and -581 are depicted by (48 aa). The putative splice sites are illustrated in supporting information, Fig. 5.

    Techniques Used: Sequencing

    29) Product Images from "A Drosophila dopamine 2-like receptor: Molecular characterization and identification of multiple alternatively spliced variants"

    Article Title: A Drosophila dopamine 2-like receptor: Molecular characterization and identification of multiple alternatively spliced variants

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.202498299

    Alternative splicing of the DD2R gene generates multiple receptor variants. ( A ) The protein-coding exons are depicted as boxes (E1–E9). The size of each intron (number of bases) is shown in parentheses. The portion of the receptor encoded by each exon is illustrated, highlighting the number of amino acids (aa) per exon and the relative position of TMs I–VII (solid gray boxes). ( B ) The complete amino acid sequence of DD2R-606. Double and single underlining marks the sequence that corresponds to exons 6 and 7, respectively. DD2R-506 includes exon 7 but not exon 6 coding sequence. DD2R-461 lacks both exon-6 and -7 coding sequence. ( C ) Variable splicing of exon 6 results in DD2R splice variants DD2R-606, -605, -598, -597, -589, and -581. The carboxyl- and amino-terminal 5 aa of exons 5 and 7, respectively, are shown. Dashes represent amino acids that are absent in the corresponding transcript. Forty-eight amino acids that are shared among DD2R-606, -605, -598, -597, -589, and -581 are depicted by (48 aa). The putative splice sites are illustrated in supporting information, Fig. 5.
    Figure Legend Snippet: Alternative splicing of the DD2R gene generates multiple receptor variants. ( A ) The protein-coding exons are depicted as boxes (E1–E9). The size of each intron (number of bases) is shown in parentheses. The portion of the receptor encoded by each exon is illustrated, highlighting the number of amino acids (aa) per exon and the relative position of TMs I–VII (solid gray boxes). ( B ) The complete amino acid sequence of DD2R-606. Double and single underlining marks the sequence that corresponds to exons 6 and 7, respectively. DD2R-506 includes exon 7 but not exon 6 coding sequence. DD2R-461 lacks both exon-6 and -7 coding sequence. ( C ) Variable splicing of exon 6 results in DD2R splice variants DD2R-606, -605, -598, -597, -589, and -581. The carboxyl- and amino-terminal 5 aa of exons 5 and 7, respectively, are shown. Dashes represent amino acids that are absent in the corresponding transcript. Forty-eight amino acids that are shared among DD2R-606, -605, -598, -597, -589, and -581 are depicted by (48 aa). The putative splice sites are illustrated in supporting information, Fig. 5.

    Techniques Used: Sequencing

    30) Product Images from "Identification of PBX1 Target Genes in Cancer Cells by Global Mapping of PBX1 Binding Sites"

    Article Title: Identification of PBX1 Target Genes in Cancer Cells by Global Mapping of PBX1 Binding Sites

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0036054

    MEOX1 interacts with PBX1 and mediates its growth effect. A. HEK293 cells were transfected with PBX1-V5 and/or MEOX1-FLAG expression vectors. Immunoprecipitation and Western blot were performed using epitope tag-specific antibodies. B. Left panel: OVCAR3 cells were transfected with MEOX1 expression vector or control vector. Western blot was performed to test MEOX1 expression (top). The same cells were transfected with PBX1 siRNA or control siRNA and Western blot was performed to test the down-regulation of PBX1 protein (middle). Detection of GAPDH protein was used as a loading control (bottom). Right panel: Relative cell numbers were measured in OVCAR3 cells transfected with MEOX1 cDNA, PBX1 siRNA, control plasmid (pLPC), and control siRNA (siLuc). Student's t -test was used to determine the significance between the MEOX1 over-expressed group and the control group.
    Figure Legend Snippet: MEOX1 interacts with PBX1 and mediates its growth effect. A. HEK293 cells were transfected with PBX1-V5 and/or MEOX1-FLAG expression vectors. Immunoprecipitation and Western blot were performed using epitope tag-specific antibodies. B. Left panel: OVCAR3 cells were transfected with MEOX1 expression vector or control vector. Western blot was performed to test MEOX1 expression (top). The same cells were transfected with PBX1 siRNA or control siRNA and Western blot was performed to test the down-regulation of PBX1 protein (middle). Detection of GAPDH protein was used as a loading control (bottom). Right panel: Relative cell numbers were measured in OVCAR3 cells transfected with MEOX1 cDNA, PBX1 siRNA, control plasmid (pLPC), and control siRNA (siLuc). Student's t -test was used to determine the significance between the MEOX1 over-expressed group and the control group.

    Techniques Used: Transfection, Expressing, Immunoprecipitation, Western Blot, Plasmid Preparation

    Validation of promoters bound by PBX1 and its cofactors. A. Seven genes were chosen from the PBX1 ChIP target gene list, and occupancy of each promoter by PBX1 was validated by ChIP-qPCR analysis. ChIP was performed using either IgG or anti-PBX1 antibody, and the immunoprecipitated DNA was subjected to qPCR analysis using primers flanking the peak of the PBX1 bound region. B. Transcriptional regulation of these target genes by PBX1 or MEOX1 was assessed using siRNA and RT-qPCR analysis. Expression of all seven target genes are significantly down-regulated by PBX1 siRNA as compared to control siRNA (Student's t -test, p
    Figure Legend Snippet: Validation of promoters bound by PBX1 and its cofactors. A. Seven genes were chosen from the PBX1 ChIP target gene list, and occupancy of each promoter by PBX1 was validated by ChIP-qPCR analysis. ChIP was performed using either IgG or anti-PBX1 antibody, and the immunoprecipitated DNA was subjected to qPCR analysis using primers flanking the peak of the PBX1 bound region. B. Transcriptional regulation of these target genes by PBX1 or MEOX1 was assessed using siRNA and RT-qPCR analysis. Expression of all seven target genes are significantly down-regulated by PBX1 siRNA as compared to control siRNA (Student's t -test, p

    Techniques Used: Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Immunoprecipitation, Quantitative RT-PCR, Expressing

    PBX1 binds to a specific set of genes and controls their transcription in ovarian cancer. A: Venn diagram of PBX1 ChIP-chip target genes and PBX1 transcriptome reveal a set of overlapping genes that are direct target genes of PBX1. The full list of the overlapping genes is shown in Table S5 . Experiments were performed in OVCAR3 cells. B: Gene set enrichment analysis was performed to determine if PBX1 ChIP targets are enriched in the PBX1 transcriptome. Genes down-regulated by PBX1 siRNA are significantly enriched in the PBX1 ChIP target set.
    Figure Legend Snippet: PBX1 binds to a specific set of genes and controls their transcription in ovarian cancer. A: Venn diagram of PBX1 ChIP-chip target genes and PBX1 transcriptome reveal a set of overlapping genes that are direct target genes of PBX1. The full list of the overlapping genes is shown in Table S5 . Experiments were performed in OVCAR3 cells. B: Gene set enrichment analysis was performed to determine if PBX1 ChIP targets are enriched in the PBX1 transcriptome. Genes down-regulated by PBX1 siRNA are significantly enriched in the PBX1 ChIP target set.

    Techniques Used: Chromatin Immunoprecipitation

    31) Product Images from "Camel Milk Triggers Apoptotic Signaling Pathways in Human Hepatoma HepG2 and Breast Cancer MCF7 Cell Lines through Transcriptional Mechanism"

    Article Title: Camel Milk Triggers Apoptotic Signaling Pathways in Human Hepatoma HepG2 and Breast Cancer MCF7 Cell Lines through Transcriptional Mechanism

    Journal: Journal of Biomedicine and Biotechnology

    doi: 10.1155/2012/593195

    Effect of camel milk on apoptotic and oxidative stress markers Caspase-3 (a), DR4 (b), and HO-1 (c) mRNA levels in MCF7 cells. MCF7 cells were treated for 6 h with a various concentrations of camel milk (2.5, 5, 10, and 20 mg/mL). Thereafter, total RNA was isolated using TRIzol reagent and the mRNA levels of Caspase-3, DR4, and HO-1 were quantified using RT-PCR normalized to β -actin housekeeping gene as described Section 2 . Duplicate reactions were performed for each experiment, and the values presented are the means ± SEM ( n = 6) of three independent experiments. + P
    Figure Legend Snippet: Effect of camel milk on apoptotic and oxidative stress markers Caspase-3 (a), DR4 (b), and HO-1 (c) mRNA levels in MCF7 cells. MCF7 cells were treated for 6 h with a various concentrations of camel milk (2.5, 5, 10, and 20 mg/mL). Thereafter, total RNA was isolated using TRIzol reagent and the mRNA levels of Caspase-3, DR4, and HO-1 were quantified using RT-PCR normalized to β -actin housekeeping gene as described Section 2 . Duplicate reactions were performed for each experiment, and the values presented are the means ± SEM ( n = 6) of three independent experiments. + P

    Techniques Used: Isolation, Reverse Transcription Polymerase Chain Reaction

    Effect of camel milk on apoptotic markers Caspase-3 (a), p53 (b), BcL2 (c), and DR4 (d) mRNA levels in HepG2 cells. HepG2 cells were treated for 6 h with a various concentrations of camel milk (2.5, 5, 10, and 20 mg/mL). Thereafter, total RNA was isolated using TRIzol reagent, and the mRNA levels of Caspase-3, p53, BcL2, and DR4 were quantified using RT-PCR normalized to β -actin housekeeping gene as described in Section 2 . Duplicate reactions were performed for each experiment, and the values presented are the means ± SEM ( n = 6) of three independent experiments. + P
    Figure Legend Snippet: Effect of camel milk on apoptotic markers Caspase-3 (a), p53 (b), BcL2 (c), and DR4 (d) mRNA levels in HepG2 cells. HepG2 cells were treated for 6 h with a various concentrations of camel milk (2.5, 5, 10, and 20 mg/mL). Thereafter, total RNA was isolated using TRIzol reagent, and the mRNA levels of Caspase-3, p53, BcL2, and DR4 were quantified using RT-PCR normalized to β -actin housekeeping gene as described in Section 2 . Duplicate reactions were performed for each experiment, and the values presented are the means ± SEM ( n = 6) of three independent experiments. + P

    Techniques Used: Isolation, Reverse Transcription Polymerase Chain Reaction

    Effect of MAPKs inhibitors on camel milk mediated induction of caspase-3 mRNA levels in HepG2 cells. HepG2 cells were pre-treated with for 2 h with JNK inhibitor, SP600125, p38 inhibitor, SB203580, and ERK inhibitor, U0126, before the addition of camel milk (10 mg/mL) for additional 6 h. Thereafter, total RNA was isolated using TRIzol reagent and the mRNA levels of Caspase-3 were quantified using RT-PCR normalized to β -actin housekeeping gene as described Section 2 . Duplicate reactions were performed for each experiment, and the values presented are the means ± SEM ( n = 6) of three independent experiments. + P
    Figure Legend Snippet: Effect of MAPKs inhibitors on camel milk mediated induction of caspase-3 mRNA levels in HepG2 cells. HepG2 cells were pre-treated with for 2 h with JNK inhibitor, SP600125, p38 inhibitor, SB203580, and ERK inhibitor, U0126, before the addition of camel milk (10 mg/mL) for additional 6 h. Thereafter, total RNA was isolated using TRIzol reagent and the mRNA levels of Caspase-3 were quantified using RT-PCR normalized to β -actin housekeeping gene as described Section 2 . Duplicate reactions were performed for each experiment, and the values presented are the means ± SEM ( n = 6) of three independent experiments. + P

    Techniques Used: Isolation, Reverse Transcription Polymerase Chain Reaction

    Effect of camel milk on oxidative stress markers HO-1 (a) and NQO1 (b) mRNA levels, and ROS (c) production in HepG2 cells. (a) and (b) HepG2 cells were treated for 6 h with a various concentrations of camel milk (2.5, 5, 10, and 20 mg/mL). Thereafter, total RNA was isolated using TRIzol reagent and the mRNA levels of HO-1 and NQO1 were quantified using RT-PCR normalized to β -actin housekeeping gene as described Section 2 . Duplicate reactions were performed for each experiment, and the values presented are the means ± SEM ( n = 6) of three independent experiments. + P
    Figure Legend Snippet: Effect of camel milk on oxidative stress markers HO-1 (a) and NQO1 (b) mRNA levels, and ROS (c) production in HepG2 cells. (a) and (b) HepG2 cells were treated for 6 h with a various concentrations of camel milk (2.5, 5, 10, and 20 mg/mL). Thereafter, total RNA was isolated using TRIzol reagent and the mRNA levels of HO-1 and NQO1 were quantified using RT-PCR normalized to β -actin housekeeping gene as described Section 2 . Duplicate reactions were performed for each experiment, and the values presented are the means ± SEM ( n = 6) of three independent experiments. + P

    Techniques Used: Isolation, Reverse Transcription Polymerase Chain Reaction

    Effect of RNA synthesis inhibitor Act-D on the induction Caspase-3 activity by camel milk in HepG2 cells. HepG2 cells were treated with 5 μ g/mL Act-D, a RNA synthesis inhibitor, 30 min before exposure to camel milk (20 mg/mL) for additional 6 h. The amount of Caspase-3 mRNA was quantified using RT-PCR and normalized to β -actin housekeeping gene. Duplicate reactions were performed for each experiment, and the values presented are the means ± SEM ( n = 6) of three inv experiments. + P
    Figure Legend Snippet: Effect of RNA synthesis inhibitor Act-D on the induction Caspase-3 activity by camel milk in HepG2 cells. HepG2 cells were treated with 5 μ g/mL Act-D, a RNA synthesis inhibitor, 30 min before exposure to camel milk (20 mg/mL) for additional 6 h. The amount of Caspase-3 mRNA was quantified using RT-PCR and normalized to β -actin housekeeping gene. Duplicate reactions were performed for each experiment, and the values presented are the means ± SEM ( n = 6) of three inv experiments. + P

    Techniques Used: Activated Clotting Time Assay, Activity Assay, Reverse Transcription Polymerase Chain Reaction

    32) Product Images from "Phosphoinositide 3-Kinase C2? Regulates RhoA and the Actin Cytoskeleton through an Interaction with Dbl"

    Article Title: Phosphoinositide 3-Kinase C2? Regulates RhoA and the Actin Cytoskeleton through an Interaction with Dbl

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0044945

    PI3KC2β protects NIH3T3 cells against anoikis. (A) NIH3T3-V, -C2β-DN and -C2β-WT cells were plated in presence of serum on ultra-low attachment matrix. After 16 h Caspase 3/7 activity was measured as readout for detachment-induced apoptosis (anoikis). Data are mean ± SD of two independent experiments. WT1, −2 and DN1, −2 indicate individual clones. (B) NIH3T3 cells transiently transfected with the wild-type Myc-PI3KC2β, constitutively active form of GFP-fused RhoA protein (CA-RhoA-GFP) or myristylated (Akt-myr) were plated 48 h post-transfection on ultra-low attachment matrix. 16 h later Caspase 3/7 activation was analysed as readout for anoikis. Data are mean ± SD of three independent experiments. Expression level of the transfected proteins and associated signalling was analysed 48 h post-transfection by immunoblotting with indicated antibodies. (C) NIH3T3-C2β-WT cells were transiently transfected with dominant-negative RhoA-GFP (DN-Rho-GFP) or control vector (V). 48 h post-transfection cells were plated on ultra-low attachment matrix and caspase 3/7 activation was measured. Data are mean ± SD of three independent experiments. 48 h post-transfection expression level of the transfected proteins was analysed by western blot with indicated antibodies.
    Figure Legend Snippet: PI3KC2β protects NIH3T3 cells against anoikis. (A) NIH3T3-V, -C2β-DN and -C2β-WT cells were plated in presence of serum on ultra-low attachment matrix. After 16 h Caspase 3/7 activity was measured as readout for detachment-induced apoptosis (anoikis). Data are mean ± SD of two independent experiments. WT1, −2 and DN1, −2 indicate individual clones. (B) NIH3T3 cells transiently transfected with the wild-type Myc-PI3KC2β, constitutively active form of GFP-fused RhoA protein (CA-RhoA-GFP) or myristylated (Akt-myr) were plated 48 h post-transfection on ultra-low attachment matrix. 16 h later Caspase 3/7 activation was analysed as readout for anoikis. Data are mean ± SD of three independent experiments. Expression level of the transfected proteins and associated signalling was analysed 48 h post-transfection by immunoblotting with indicated antibodies. (C) NIH3T3-C2β-WT cells were transiently transfected with dominant-negative RhoA-GFP (DN-Rho-GFP) or control vector (V). 48 h post-transfection cells were plated on ultra-low attachment matrix and caspase 3/7 activation was measured. Data are mean ± SD of three independent experiments. 48 h post-transfection expression level of the transfected proteins was analysed by western blot with indicated antibodies.

    Techniques Used: Activity Assay, Transfection, Activation Assay, Expressing, Dominant Negative Mutation, Plasmid Preparation, Western Blot

    33) Product Images from "Transcriptional Patterns in Peritoneal Tissue of Encapsulating Peritoneal Sclerosis, a Complication of Chronic Peritoneal Dialysis"

    Article Title: Transcriptional Patterns in Peritoneal Tissue of Encapsulating Peritoneal Sclerosis, a Complication of Chronic Peritoneal Dialysis

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0056389

    mRNA expression levels of selected gene products determined through qRT-PCR correlate well with corresponding data from the DNA chip array. Collagen 1 α 1 (Col1a1), Fibronectin 1 (FN1), and thrombospondin 1 (THBS1) were highly upregulated in EPS compared to PD and Uremic groups, while retinol-binding protein 4 (RBP4) was highly downregulated in EPS and PD groups compared to the Uremic group. A. , C. , E. , and G. Normalized mRNA expression levels determined through qRT-PCR of indicated gene products. Individual gene expression levels were calculated using the equation 2 −ΔCT with β-actin (ACTB) as endogenous control. Mean gene expression levels of biological groups were normalized to the Uremic group, defining the relative gene expression in this group as 1.0. B. , D. , F. , and H. Mean raw signal intensity of indicated gene products calculated from DNA array probe signals.
    Figure Legend Snippet: mRNA expression levels of selected gene products determined through qRT-PCR correlate well with corresponding data from the DNA chip array. Collagen 1 α 1 (Col1a1), Fibronectin 1 (FN1), and thrombospondin 1 (THBS1) were highly upregulated in EPS compared to PD and Uremic groups, while retinol-binding protein 4 (RBP4) was highly downregulated in EPS and PD groups compared to the Uremic group. A. , C. , E. , and G. Normalized mRNA expression levels determined through qRT-PCR of indicated gene products. Individual gene expression levels were calculated using the equation 2 −ΔCT with β-actin (ACTB) as endogenous control. Mean gene expression levels of biological groups were normalized to the Uremic group, defining the relative gene expression in this group as 1.0. B. , D. , F. , and H. Mean raw signal intensity of indicated gene products calculated from DNA array probe signals.

    Techniques Used: Expressing, Quantitative RT-PCR, Chromatin Immunoprecipitation, Binding Assay, DNA Array

    34) Product Images from "HSP70 Enhances Immunosuppressive Function of CD4+CD25+FoxP3+ T Regulatory Cells and Cytotoxicity in CD4+CD25− T Cells"

    Article Title: HSP70 Enhances Immunosuppressive Function of CD4+CD25+FoxP3+ T Regulatory Cells and Cytotoxicity in CD4+CD25− T Cells

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0051747

    CD4 + CD25 + treatment with HSP70 inhibits CD4 + CD25 − target T-cell proliferation. CD4 + CD25 + T cells were incubated with IL-2 (200 U/ml), HSP70 (10 µg/ml) or both for 2 h, washed and co-cultured with CFSE-labeled CD4 + CD25 − target T cells (E∶T ratio 1∶10) on 96-well plates coated with anti-CD3 antibodies (OKT3, 1 µg/ml) in serum-free medium. For control CD4 + CD25 − target T cells were culture in the absence of Tregs. After 5 days of incubation, cell proliferation was determined by FACS analysis. ( A ) One representative experiment of CD4 + CD25 − T-cell proliferation under different CD4 + CD25 + stimulation conditions. ( B ) Results of six independent experiments, expressed as mean ± SD. p-values (* p
    Figure Legend Snippet: CD4 + CD25 + treatment with HSP70 inhibits CD4 + CD25 − target T-cell proliferation. CD4 + CD25 + T cells were incubated with IL-2 (200 U/ml), HSP70 (10 µg/ml) or both for 2 h, washed and co-cultured with CFSE-labeled CD4 + CD25 − target T cells (E∶T ratio 1∶10) on 96-well plates coated with anti-CD3 antibodies (OKT3, 1 µg/ml) in serum-free medium. For control CD4 + CD25 − target T cells were culture in the absence of Tregs. After 5 days of incubation, cell proliferation was determined by FACS analysis. ( A ) One representative experiment of CD4 + CD25 − T-cell proliferation under different CD4 + CD25 + stimulation conditions. ( B ) Results of six independent experiments, expressed as mean ± SD. p-values (* p

    Techniques Used: Incubation, Cell Culture, Labeling, FACS

    Uptake of HSP70 by CD4 + CD25 + Tregs and HSP70-dependent expression of Ki-67 and caspase-3. Representative fluorescence microscopy results for isolated Tregs incubated for 2 h ( A ) without or with ( B ) HSP70-FITC. Shown are the immunofluorescence microscopy results for DAPI (blue), FITC (green) and PE (red) staining. Purified CD4 + CD25 + and CD4 + CD25 − T cells were incubated with IL-2 (200 U/ml), HSP70 (10 µg/ml) or both for 2 h, washed and transferred to 96-well plates coated with anti-CD3 antibodies (OKT3, 1 µg/ml) in serum-free medium. After 20 h, Ki-67 and caspase-3 expression was determined by FACS analysis. ( C ) Results of one representative Ki-67-experiment out of six in CD4 + CD25 + T cells under different stimulation conditions. Results of six independent experiments using CD4 + CD25 + cells isolated from six different donors for ( D ) Ki-67 and ( E ) caspase-3, expressed as mean ± SD. p-values (* p
    Figure Legend Snippet: Uptake of HSP70 by CD4 + CD25 + Tregs and HSP70-dependent expression of Ki-67 and caspase-3. Representative fluorescence microscopy results for isolated Tregs incubated for 2 h ( A ) without or with ( B ) HSP70-FITC. Shown are the immunofluorescence microscopy results for DAPI (blue), FITC (green) and PE (red) staining. Purified CD4 + CD25 + and CD4 + CD25 − T cells were incubated with IL-2 (200 U/ml), HSP70 (10 µg/ml) or both for 2 h, washed and transferred to 96-well plates coated with anti-CD3 antibodies (OKT3, 1 µg/ml) in serum-free medium. After 20 h, Ki-67 and caspase-3 expression was determined by FACS analysis. ( C ) Results of one representative Ki-67-experiment out of six in CD4 + CD25 + T cells under different stimulation conditions. Results of six independent experiments using CD4 + CD25 + cells isolated from six different donors for ( D ) Ki-67 and ( E ) caspase-3, expressed as mean ± SD. p-values (* p

    Techniques Used: Expressing, Fluorescence, Microscopy, Isolation, Incubation, Immunofluorescence, Staining, Purification, FACS

    Secretion of cytotoxic effector molecule granzyme B of both CD4 + CD25 + and CD4 + CD25 − T-cell subsets is target-independent enhanced by HSP70. ( A ) Granzyme B mRNA levels in CD4 + CD25 + T cells or independently stimulated CD4 + CD25 − T cells were assessed by real-time PCR after 48 h of stimulation on anti-CD3 (OKT3, 1 µg/ml) coated plates in serum-free medium. Analysis was performed for comparison between the different CD4 + CD25 + and CD4 + CD25 − T-cell subsets. ( B ) Secretion of granzyme B was assessed by ELISA. Data from four independent experiments (mRNA) and two independent experiments (protein levels), expressed as mean ± SD. Comparison between groups was performed using t-tests. Statistically significant differences are indicated with asterisks (* p
    Figure Legend Snippet: Secretion of cytotoxic effector molecule granzyme B of both CD4 + CD25 + and CD4 + CD25 − T-cell subsets is target-independent enhanced by HSP70. ( A ) Granzyme B mRNA levels in CD4 + CD25 + T cells or independently stimulated CD4 + CD25 − T cells were assessed by real-time PCR after 48 h of stimulation on anti-CD3 (OKT3, 1 µg/ml) coated plates in serum-free medium. Analysis was performed for comparison between the different CD4 + CD25 + and CD4 + CD25 − T-cell subsets. ( B ) Secretion of granzyme B was assessed by ELISA. Data from four independent experiments (mRNA) and two independent experiments (protein levels), expressed as mean ± SD. Comparison between groups was performed using t-tests. Statistically significant differences are indicated with asterisks (* p

    Techniques Used: Real-time Polymerase Chain Reaction, Enzyme-linked Immunosorbent Assay

    CD4 + CD25 + -induced inhibition of target T-cell proliferation is cytokine-dependent. CD4 + CD25 + T cells were incubated with IL-2 (200 U/ml), HSP70 (10 µg/ml) or both for 2 h, washed and co-cultured with CFSE-labeled CD4 + CD25 − target T cells (E∶T ratio 1∶10) on 96-well plates coated with anti-CD3 antibodies (OKT3, 1 µg/ml) in serum-free medium. For control CD4 + CD25 − target T cells were culture in the absence of Tregs. After 5 days of incubation, the supernatants were analyzed for ( A ) IL-10, ( B ) TGF-β, ( C ) IFN-γ and ( D ) TNF-α. Results of six independent experiments, expressed as mean ± SD. p-values (* p
    Figure Legend Snippet: CD4 + CD25 + -induced inhibition of target T-cell proliferation is cytokine-dependent. CD4 + CD25 + T cells were incubated with IL-2 (200 U/ml), HSP70 (10 µg/ml) or both for 2 h, washed and co-cultured with CFSE-labeled CD4 + CD25 − target T cells (E∶T ratio 1∶10) on 96-well plates coated with anti-CD3 antibodies (OKT3, 1 µg/ml) in serum-free medium. For control CD4 + CD25 − target T cells were culture in the absence of Tregs. After 5 days of incubation, the supernatants were analyzed for ( A ) IL-10, ( B ) TGF-β, ( C ) IFN-γ and ( D ) TNF-α. Results of six independent experiments, expressed as mean ± SD. p-values (* p

    Techniques Used: Inhibition, Incubation, Cell Culture, Labeling

    HSP70 mediates phosphorylation of AKT, p38, JNK and ERK1/2 in CD4 + CD25 + T cells and suppressive capacity of these cells could be influenced by the respective inhibitors. CD4 + CD25 + Treg cells were incubated alone, with IL-2 (200 U/ml), HSP70 (10 µg/ml) or both for 10 min washed and exposed to anti-CD3 antibodies (OKT3, 1 µg/ml) for 5, 10, 20 and 30 minutes. Phosphorylation for intracellular kinases ( A ) phospo-AKT [p-AKT Ser 473 ], ( B ) phospo-JNK [p-JNK Thr 183 /Tyr 185 ], ( C ) phospo-p38 MAPK [p-p38 MAPK Thr 180 /Tyr 182 ] and ( D ) phospo-ERK1/2 [p-ERK1/2 Thr 202 /Tyr 204 /Thr 185 /Tyr 187 ] was determined by the bead-based multiplex assay (Luminex xMAP technology). Untreated CD4 + CD25 + T cells were adjusted to 1.00 by the use of the Bio-Plex Manager 6.0 software and used to calculate the ratios. Furthermore, CD4 + CD25 + T cells were treated with 5 µM of the following intracellular signal transduction inhibitors: ( E ) Wortmannin, ( F ) JNK or ( G ) SB 203580 for 15 min before incubation alone, with IL-2 (200 U/ml), HSP70 (10 µg/ml) or both for 2 h. Cells were then co-cultured with CD4 + CD25 − T cells (E∶T ratio 1∶5) on 96-well plates coated with anti-CD3 antibodies (OKT3, 1 µg/ml) in serum-free medium for 48 h. Supernatants were analyzed for IFN-γ, TNF-α, IL-10 and TGF-β. Results of four independent experiments, expressed as mean fold increases or decreases in comparison to results obtained for experiments without preactivation of Tregs and without inhibitor treatment (control).
    Figure Legend Snippet: HSP70 mediates phosphorylation of AKT, p38, JNK and ERK1/2 in CD4 + CD25 + T cells and suppressive capacity of these cells could be influenced by the respective inhibitors. CD4 + CD25 + Treg cells were incubated alone, with IL-2 (200 U/ml), HSP70 (10 µg/ml) or both for 10 min washed and exposed to anti-CD3 antibodies (OKT3, 1 µg/ml) for 5, 10, 20 and 30 minutes. Phosphorylation for intracellular kinases ( A ) phospo-AKT [p-AKT Ser 473 ], ( B ) phospo-JNK [p-JNK Thr 183 /Tyr 185 ], ( C ) phospo-p38 MAPK [p-p38 MAPK Thr 180 /Tyr 182 ] and ( D ) phospo-ERK1/2 [p-ERK1/2 Thr 202 /Tyr 204 /Thr 185 /Tyr 187 ] was determined by the bead-based multiplex assay (Luminex xMAP technology). Untreated CD4 + CD25 + T cells were adjusted to 1.00 by the use of the Bio-Plex Manager 6.0 software and used to calculate the ratios. Furthermore, CD4 + CD25 + T cells were treated with 5 µM of the following intracellular signal transduction inhibitors: ( E ) Wortmannin, ( F ) JNK or ( G ) SB 203580 for 15 min before incubation alone, with IL-2 (200 U/ml), HSP70 (10 µg/ml) or both for 2 h. Cells were then co-cultured with CD4 + CD25 − T cells (E∶T ratio 1∶5) on 96-well plates coated with anti-CD3 antibodies (OKT3, 1 µg/ml) in serum-free medium for 48 h. Supernatants were analyzed for IFN-γ, TNF-α, IL-10 and TGF-β. Results of four independent experiments, expressed as mean fold increases or decreases in comparison to results obtained for experiments without preactivation of Tregs and without inhibitor treatment (control).

    Techniques Used: Incubation, Multiplex Assay, Luminex, Software, Transduction, Cell Culture

    Augmentation of cytokine secretion by CD4 + CD25 + and CD4 + CD25 − T cells after HSP70 treatment. CD4 + CD25 + and CD4 + CD25 − T cells were incubated with IL-2 (200 U/ml), HSP70 (10 µg/ml) or both for 2 h, washed and transferred to 96-well plates coated with anti-CD3 antibodies (OKT3, 1 µg/ml) in serum-free medium. After 48 h of incubation, the supernatants were analyzed for ( A ) IL-10, ( B ) TGF-β, ( C ) IFN-γ and ( D ) TNF-α. Results of four independent experiments, expressed as mean ± SD. p-values (* p
    Figure Legend Snippet: Augmentation of cytokine secretion by CD4 + CD25 + and CD4 + CD25 − T cells after HSP70 treatment. CD4 + CD25 + and CD4 + CD25 − T cells were incubated with IL-2 (200 U/ml), HSP70 (10 µg/ml) or both for 2 h, washed and transferred to 96-well plates coated with anti-CD3 antibodies (OKT3, 1 µg/ml) in serum-free medium. After 48 h of incubation, the supernatants were analyzed for ( A ) IL-10, ( B ) TGF-β, ( C ) IFN-γ and ( D ) TNF-α. Results of four independent experiments, expressed as mean ± SD. p-values (* p

    Techniques Used: Incubation

    35) Product Images from "A short protocol using dexamethasone and monophosphoryl lipid A generates tolerogenic dendritic cells that display a potent migratory capacity to lymphoid chemokines"

    Article Title: A short protocol using dexamethasone and monophosphoryl lipid A generates tolerogenic dendritic cells that display a potent migratory capacity to lymphoid chemokines

    Journal: Journal of Translational Medicine

    doi: 10.1186/1479-5876-11-128

    MPLA-tDCs display an anti-inflammatory cytokine secretion profile with major IL-10 production. MPLA-tDCs show a pro-tolerogenic cytokine secretion profile with high anti-inflammatory cytokines production and reduced pro-inflammatory cytokines secretion. On day 5, harvested DCs were washed and then incubated for another 24 hours in AIM-V medium alone or co-cultured with the NIH-3 T3 murine fibroblast cell line transfected with human CD40L at a 1:1 DCs:fibroblasts ratio. Culture supernatants were collected and further analyzed by ELISA for pro- and anti-inflammatory cytokines detection. Untreated immature DCs (iDCs) as well as MPLA-matured DCs (mDCs) were used as controls. ( A ) IL-12, IL-23 and TNFα levels determined for all DC groups upon CD40L stimulation. Levels of these cytokines were undetectable in supernatants of DCs without CD40L stimulation. ( B ) IL-10 and TGFβ1 were detected in supernatants of DCs cultured for 24 hours in AIM-V medium. ( C ) IL-10 and TGFβ1 were also determined in supernatants of DCs co-incubated with fibroblasts expressing CD40L. Data in A , B and C correspond to mean ± SEM of 13 independent experiments (* P
    Figure Legend Snippet: MPLA-tDCs display an anti-inflammatory cytokine secretion profile with major IL-10 production. MPLA-tDCs show a pro-tolerogenic cytokine secretion profile with high anti-inflammatory cytokines production and reduced pro-inflammatory cytokines secretion. On day 5, harvested DCs were washed and then incubated for another 24 hours in AIM-V medium alone or co-cultured with the NIH-3 T3 murine fibroblast cell line transfected with human CD40L at a 1:1 DCs:fibroblasts ratio. Culture supernatants were collected and further analyzed by ELISA for pro- and anti-inflammatory cytokines detection. Untreated immature DCs (iDCs) as well as MPLA-matured DCs (mDCs) were used as controls. ( A ) IL-12, IL-23 and TNFα levels determined for all DC groups upon CD40L stimulation. Levels of these cytokines were undetectable in supernatants of DCs without CD40L stimulation. ( B ) IL-10 and TGFβ1 were detected in supernatants of DCs cultured for 24 hours in AIM-V medium. ( C ) IL-10 and TGFβ1 were also determined in supernatants of DCs co-incubated with fibroblasts expressing CD40L. Data in A , B and C correspond to mean ± SEM of 13 independent experiments (* P

    Techniques Used: Incubation, Cell Culture, Transfection, Enzyme-linked Immunosorbent Assay, Expressing

    36) Product Images from "Different Immunity Elicited by Recombinant H5N1 Hemagglutinin Proteins Containing Pauci-Mannose, High-Mannose, or Complex Type N-Glycans"

    Article Title: Different Immunity Elicited by Recombinant H5N1 Hemagglutinin Proteins Containing Pauci-Mannose, High-Mannose, or Complex Type N-Glycans

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0066719

    T cell responses in splenocytes and T-cell stimulation by antigen-presenting dendritic cells. Splenocytes were added to each well in 96-well plates (5×10 5 cells/well) and stimulated with 1 µg/ml pooled peptides (15-mer overlapping 8 amino acids) spanning the HA 1 of H5HA (A/Viet Nam/1203/2004) to determine (A) IFN-γ- and (B) IL-4-secreting T cells using ELISPOT assays. Bone marrow-derived dendritic cells (DCs) were treated with LPS and recombinant HA proteins and then fixed with paraformaldehyde followed by quenching with glycine. Pre-treated DCs were co-incubated with splenocytes from mice immunized with Sf9-rHA for 2 d. Antigen presentation was determined by measuring (C) IFN-γ- and (D) IL-2-secreting T cells using ELISPOT assays. DCs pretreated with LPS and pulsed with PBS were used as a negative control. Data represent mean ± standard deviation. Results were analyzed using two-tailed Student’s t tests with statistical significance at p
    Figure Legend Snippet: T cell responses in splenocytes and T-cell stimulation by antigen-presenting dendritic cells. Splenocytes were added to each well in 96-well plates (5×10 5 cells/well) and stimulated with 1 µg/ml pooled peptides (15-mer overlapping 8 amino acids) spanning the HA 1 of H5HA (A/Viet Nam/1203/2004) to determine (A) IFN-γ- and (B) IL-4-secreting T cells using ELISPOT assays. Bone marrow-derived dendritic cells (DCs) were treated with LPS and recombinant HA proteins and then fixed with paraformaldehyde followed by quenching with glycine. Pre-treated DCs were co-incubated with splenocytes from mice immunized with Sf9-rHA for 2 d. Antigen presentation was determined by measuring (C) IFN-γ- and (D) IL-2-secreting T cells using ELISPOT assays. DCs pretreated with LPS and pulsed with PBS were used as a negative control. Data represent mean ± standard deviation. Results were analyzed using two-tailed Student’s t tests with statistical significance at p

    Techniques Used: Cell Stimulation, Enzyme-linked Immunospot, Derivative Assay, Recombinant, Incubation, Mouse Assay, Negative Control, Standard Deviation, Two Tailed Test

    37) Product Images from "Platelet activation suppresses HIV-1 infection of T cells"

    Article Title: Platelet activation suppresses HIV-1 infection of T cells

    Journal: Retrovirology

    doi: 10.1186/1742-4690-10-48

    Platelets inhibit HIV-1 spread in T cells and release an anti-HIV-1 activity upon activation. ( A ) PHA stimulated PBMCs were infected with 10 pg of HIV-1 NL4-3 in the presence of untreated platelets (PLT, 1 × 10 8 /mL) or medium alone (control) and p24-antigen content in the supernatants was measured on day one and six post infection. The p24-antigen levels at day one post infection were below detection range. The results of a single representative experiment performed in duplicates are shown, error bars indicate SD. The results were confirmed in an independent experiment. ( B ) Platelets inhibit HIV-1 spread in adjacent T cells in a concentration- and activation status- dependent manner. The indicated amounts of non-resting platelets (PLT, platelets left untreated) or activated platelets (A-PLT, platelets treated with TRAP) were added to C8166-SEAP T cells, the cultures infected with 10 pg of HIV-1 NL4-3 and SEAP-activity measured at day five post infection. The average ± SEM of three experiments performed in triplicates is shown, SEAP-activity measured in the absence of platelets was set as 100%. ( C ) Activation of platelets induces the release of one or more HIV-1 inhibitory factors. The indicator cell line TZM-bl was incubated with supernatants from resting (R-PLT Sup) and activated platelets (A-PLT Sup) or incubated with PBS or PBS containing 10 μM PGE 1 or 100 μM TRAP. Subsequently, the cells were infected with HIV-1 NL4-3 and luciferase activities in the lysates of infected cells were measured. The results ± SD of a single experiment performed in triplicates is shown. Similar results were obtained in a separate experiment.
    Figure Legend Snippet: Platelets inhibit HIV-1 spread in T cells and release an anti-HIV-1 activity upon activation. ( A ) PHA stimulated PBMCs were infected with 10 pg of HIV-1 NL4-3 in the presence of untreated platelets (PLT, 1 × 10 8 /mL) or medium alone (control) and p24-antigen content in the supernatants was measured on day one and six post infection. The p24-antigen levels at day one post infection were below detection range. The results of a single representative experiment performed in duplicates are shown, error bars indicate SD. The results were confirmed in an independent experiment. ( B ) Platelets inhibit HIV-1 spread in adjacent T cells in a concentration- and activation status- dependent manner. The indicated amounts of non-resting platelets (PLT, platelets left untreated) or activated platelets (A-PLT, platelets treated with TRAP) were added to C8166-SEAP T cells, the cultures infected with 10 pg of HIV-1 NL4-3 and SEAP-activity measured at day five post infection. The average ± SEM of three experiments performed in triplicates is shown, SEAP-activity measured in the absence of platelets was set as 100%. ( C ) Activation of platelets induces the release of one or more HIV-1 inhibitory factors. The indicator cell line TZM-bl was incubated with supernatants from resting (R-PLT Sup) and activated platelets (A-PLT Sup) or incubated with PBS or PBS containing 10 μM PGE 1 or 100 μM TRAP. Subsequently, the cells were infected with HIV-1 NL4-3 and luciferase activities in the lysates of infected cells were measured. The results ± SD of a single experiment performed in triplicates is shown. Similar results were obtained in a separate experiment.

    Techniques Used: Activity Assay, Activation Assay, Infection, Concentration Assay, Incubation, Luciferase

    38) Product Images from "Tumor Cell Clone Expressing the Membrane-bound Form of IL-12p35 Subunit Stimulates Antitumor Immune Responses Dominated by CD8+ T Cells"

    Article Title: Tumor Cell Clone Expressing the Membrane-bound Form of IL-12p35 Subunit Stimulates Antitumor Immune Responses Dominated by CD8+ T Cells

    Journal: Immune Network

    doi: 10.4110/in.2013.13.2.63

    The mbIL-12p35 and the mbIL-12p40 molecules on transfected tumor clones are not released. (A) The isolated mouse peritoneal macrophages were stained with specific antibody to CD11b and analyzed by FACS. (B) Cells (5×10 5 cells) of the wild type, mock vector transfected, mbIL-12p35, and mbIL-12p40 transfected clones were cultured for 48 hr in 2 ml normal medium, and then culture supernatants were analyzed for IL-12 by ELISA. As a positive control, culture supernatant from LPS (2µg/ml)-treated mouse peritoneal macrophages was used. ND, not detected.
    Figure Legend Snippet: The mbIL-12p35 and the mbIL-12p40 molecules on transfected tumor clones are not released. (A) The isolated mouse peritoneal macrophages were stained with specific antibody to CD11b and analyzed by FACS. (B) Cells (5×10 5 cells) of the wild type, mock vector transfected, mbIL-12p35, and mbIL-12p40 transfected clones were cultured for 48 hr in 2 ml normal medium, and then culture supernatants were analyzed for IL-12 by ELISA. As a positive control, culture supernatant from LPS (2µg/ml)-treated mouse peritoneal macrophages was used. ND, not detected.

    Techniques Used: Transfection, Clone Assay, Isolation, Staining, FACS, Plasmid Preparation, Cell Culture, Enzyme-linked Immunosorbent Assay, Positive Control

    Expression of mbIL-12p35, mbIL-12p40, and MHC class I molecules on transfected MethA tumor cell clones. (A) The mock vector transfected, mbIL-12p35, and mbIL-12p40 expressing tumor clones were stained with anti-IL-12 antibody and analyzed by FACS, (B) Wild type MethA tumor cells, and mbIL-12p35 and mbIL-12 p40 expressing tumor clones were stained with anti-L d antibody and analyzed by FACS.
    Figure Legend Snippet: Expression of mbIL-12p35, mbIL-12p40, and MHC class I molecules on transfected MethA tumor cell clones. (A) The mock vector transfected, mbIL-12p35, and mbIL-12p40 expressing tumor clones were stained with anti-IL-12 antibody and analyzed by FACS, (B) Wild type MethA tumor cells, and mbIL-12p35 and mbIL-12 p40 expressing tumor clones were stained with anti-L d antibody and analyzed by FACS.

    Techniques Used: Expressing, Transfection, Plasmid Preparation, Clone Assay, Staining, FACS

    The mbIL-12p35 and the mbIL-12p40 expressing tumor clones do not induce TNF-α production on macrophages. Mouse peritoneal macrophages (1×10 6 cells) were co-cultured with MMC-inactivated wild type MethA cells, mock vector transfected, mbIL-12p35, or mbIL-12p40 transfected clones (5×10 5 cells), respectively. After 24 hr, culture supernatants were harvested and measured for TNF-α level by TNF-α specific ELISA. Culture supernatant from LPS (2µg/ml)-treated mouse peritoneal macrophages was used as a positive control. ND, not detected.
    Figure Legend Snippet: The mbIL-12p35 and the mbIL-12p40 expressing tumor clones do not induce TNF-α production on macrophages. Mouse peritoneal macrophages (1×10 6 cells) were co-cultured with MMC-inactivated wild type MethA cells, mock vector transfected, mbIL-12p35, or mbIL-12p40 transfected clones (5×10 5 cells), respectively. After 24 hr, culture supernatants were harvested and measured for TNF-α level by TNF-α specific ELISA. Culture supernatant from LPS (2µg/ml)-treated mouse peritoneal macrophages was used as a positive control. ND, not detected.

    Techniques Used: Expressing, Clone Assay, Cell Culture, Plasmid Preparation, Transfection, Enzyme-linked Immunosorbent Assay, Positive Control

    Survival of T cell subset-depleted mice injected with mbIL-12p35 expressing tumor clone. To deplete CD4 + or CD8 + T cells in vivo , mice were injected with antibodies specific to CD4 (GK1.5, 200µg/time) or CD8 (53-6.72, 200µg/time) intraperitoneally on days -3, 0, 3, 7, respectively. The depletion of CD4 + or CD8 + T cells was confirmed by FACS analysis of peripheral blood cells from the mice (A). CD4 + or CD8 + T cell-depleted mice were injected with 5×10 5 cells of mbIL-12p35 expressing tumor clone subcutaneously, and survival (B) were monitored.
    Figure Legend Snippet: Survival of T cell subset-depleted mice injected with mbIL-12p35 expressing tumor clone. To deplete CD4 + or CD8 + T cells in vivo , mice were injected with antibodies specific to CD4 (GK1.5, 200µg/time) or CD8 (53-6.72, 200µg/time) intraperitoneally on days -3, 0, 3, 7, respectively. The depletion of CD4 + or CD8 + T cells was confirmed by FACS analysis of peripheral blood cells from the mice (A). CD4 + or CD8 + T cell-depleted mice were injected with 5×10 5 cells of mbIL-12p35 expressing tumor clone subcutaneously, and survival (B) were monitored.

    Techniques Used: Mouse Assay, Injection, Expressing, In Vivo, FACS

    39) Product Images from "Reconstitution of dynamic microtubules with Drosophila XMAP215, EB1, and Sentin"

    Article Title: Reconstitution of dynamic microtubules with Drosophila XMAP215, EB1, and Sentin

    Journal: The Journal of Cell Biology

    doi: 10.1083/jcb.201206101

    Sentin functions, at least partially, independent of XMAP215 msps in S2 cells. (A) Immunoblotting to determine knockdown efficiency of Sentin and XMAP215 msps after RNAi. Sentin RNAi was very efficient, whereas ∼35% residual XMAP215 msps was present after RNAi. Tubulin, Aug5 (Dgt5), and the Coomassie staining were used as loading controls. (B) MT growth rate determined by tracing EB1-GFP signals in the kymograph after control ( n = 94), Sentin ( n = 94), XMAP215 msps ( n = 47), and double Sentin/XMAP215 msps RNAi ( n = 49). The error bars represent SEM. (C) The Sentin fragment that lacked the first 230 aa did not restore the normal MT growth rate, although it restored XMAP215 msps -GFP accumulation at the tip. Further truncation of the N terminus of Sentin did not rescue either defect. In this experiment, three independent stable cell lines expressing mRFP- or mCherry-tagged Sentin truncations and XMAP215 msps -GFP were used, and growing MT ends were identified by mRFP/mCherry signals. Plus-end accumulation of XMAP215 msps -GFP was visually determined after kymograph generation (51–121 MTs from two to seven cells). The kymographs and a still cell image of mRFP/mCherry and GFP signals after RNAi knockdown of endogenous Sentin are shown at the top. The XMAP215 msps -GFP accumulation frequency and MT growth rate relative to control RNAi for each cell line (±SEM) have been plotted below. (D, left) A monopolar spindle after double Sentin/Klp61F RNAi. A sum projection image of 11 z sections (separated by 0.5 µm) is shown, and the centrosome and astral MT ends are marked. Chromosomes were clustered in the lower side in this cell (not visible in this image). (right) The distance between a centrosome and each astral MT end was measured after sum projection, and the relative value to control RNAi cells has been plotted. Data have been provided for control ( n = 187), Sentin ( n = 322), XMAP215 msps ( n = 169), and double Sentin/XMAP215 msps RNAi ( n = 174) from 22 or 23 cells (±SEM). Bars: (horizontal) 5 µm; (vertical) 1 min.
    Figure Legend Snippet: Sentin functions, at least partially, independent of XMAP215 msps in S2 cells. (A) Immunoblotting to determine knockdown efficiency of Sentin and XMAP215 msps after RNAi. Sentin RNAi was very efficient, whereas ∼35% residual XMAP215 msps was present after RNAi. Tubulin, Aug5 (Dgt5), and the Coomassie staining were used as loading controls. (B) MT growth rate determined by tracing EB1-GFP signals in the kymograph after control ( n = 94), Sentin ( n = 94), XMAP215 msps ( n = 47), and double Sentin/XMAP215 msps RNAi ( n = 49). The error bars represent SEM. (C) The Sentin fragment that lacked the first 230 aa did not restore the normal MT growth rate, although it restored XMAP215 msps -GFP accumulation at the tip. Further truncation of the N terminus of Sentin did not rescue either defect. In this experiment, three independent stable cell lines expressing mRFP- or mCherry-tagged Sentin truncations and XMAP215 msps -GFP were used, and growing MT ends were identified by mRFP/mCherry signals. Plus-end accumulation of XMAP215 msps -GFP was visually determined after kymograph generation (51–121 MTs from two to seven cells). The kymographs and a still cell image of mRFP/mCherry and GFP signals after RNAi knockdown of endogenous Sentin are shown at the top. The XMAP215 msps -GFP accumulation frequency and MT growth rate relative to control RNAi for each cell line (±SEM) have been plotted below. (D, left) A monopolar spindle after double Sentin/Klp61F RNAi. A sum projection image of 11 z sections (separated by 0.5 µm) is shown, and the centrosome and astral MT ends are marked. Chromosomes were clustered in the lower side in this cell (not visible in this image). (right) The distance between a centrosome and each astral MT end was measured after sum projection, and the relative value to control RNAi cells has been plotted. Data have been provided for control ( n = 187), Sentin ( n = 322), XMAP215 msps ( n = 169), and double Sentin/XMAP215 msps RNAi ( n = 174) from 22 or 23 cells (±SEM). Bars: (horizontal) 5 µm; (vertical) 1 min.

    Techniques Used: Staining, Stable Transfection, Expressing

    40) Product Images from "Up-Regulation and Profibrotic Role of Osteopontin in Human Idiopathic Pulmonary FibrosisRole of Osteopontin in Idiopathic Pulmonary Fibrosis"

    Article Title: Up-Regulation and Profibrotic Role of Osteopontin in Human Idiopathic Pulmonary FibrosisRole of Osteopontin in Idiopathic Pulmonary Fibrosis

    Journal: PLoS Medicine

    doi: 10.1371/journal.pmed.0020251

    Effect of Osteopontin on Fibroblasts and Epithelial Cell Migration Fibroblasts (A) and A549 epithelial cells (B) were placed in the upper compartment of a Boyden-type chamber, and Ham's F-12 medium containing 5% BSA alone or with 10 μg/ml of osteopontin was added to the lower compartment. After 8 h of incubation, the migrating cells were stained, and the absorbance of the stained solution was measured by ELISA. In parallel experiments, osteopontin-stimulated cells were treated with anti-α v β 3 , anti-CD44, and GRGDS. Each bar represents the mean ± SD of three experiments; * p
    Figure Legend Snippet: Effect of Osteopontin on Fibroblasts and Epithelial Cell Migration Fibroblasts (A) and A549 epithelial cells (B) were placed in the upper compartment of a Boyden-type chamber, and Ham's F-12 medium containing 5% BSA alone or with 10 μg/ml of osteopontin was added to the lower compartment. After 8 h of incubation, the migrating cells were stained, and the absorbance of the stained solution was measured by ELISA. In parallel experiments, osteopontin-stimulated cells were treated with anti-α v β 3 , anti-CD44, and GRGDS. Each bar represents the mean ± SD of three experiments; * p

    Techniques Used: Migration, Incubation, Staining, Enzyme-linked Immunosorbent Assay

    Effect of Osteopontin on Fibroblasts and Epithelial Cell Proliferation Human normal lung fibroblasts (A) and A549 epithelial cells (B) were grown in Ham's F-12 medium with 0.1% FBS and stimulated with 2 μg/ml osteopontin. In parallel, osteopontin-stimulated cells were treated with anti-α v β 3 , anti-CD44, and GRGDS. Each bar represents the mean ± SD of three experiments performed in triplicate; * p
    Figure Legend Snippet: Effect of Osteopontin on Fibroblasts and Epithelial Cell Proliferation Human normal lung fibroblasts (A) and A549 epithelial cells (B) were grown in Ham's F-12 medium with 0.1% FBS and stimulated with 2 μg/ml osteopontin. In parallel, osteopontin-stimulated cells were treated with anti-α v β 3 , anti-CD44, and GRGDS. Each bar represents the mean ± SD of three experiments performed in triplicate; * p

    Techniques Used:

    41) Product Images from "Expression of MAGE-A3, NY-ESO-1, LAGE-1 and PRAME in urothelial carcinoma"

    Article Title: Expression of MAGE-A3, NY-ESO-1, LAGE-1 and PRAME in urothelial carcinoma

    Journal: British Journal of Cancer

    doi: 10.1038/bjc.2012.215

    Expression of CT genes and correlation to outcome. Comparison of CT gene expression for all tumours combined ( A ) and stratified for stage ( B ) and grade ( C ). Expression is plotted as: −1x(cross threshold (Ct) CT gene – Ct beta actin). High Ct values indicate high gene expression and vice versa . The colour coding in ( B and C ) is the same as in A . Kaplan–Meier survival estimates of progression-free survival as a function of MAGE-A3 expression ( D ), NY-ESO-1 expression ( E ), LAGE-1 expression ( F ) and PRAME expression ( G ). Only patients with non-muscle-invasive tumours and no prior muscle-invasive tumours were included in the analysis ( n =124).
    Figure Legend Snippet: Expression of CT genes and correlation to outcome. Comparison of CT gene expression for all tumours combined ( A ) and stratified for stage ( B ) and grade ( C ). Expression is plotted as: −1x(cross threshold (Ct) CT gene – Ct beta actin). High Ct values indicate high gene expression and vice versa . The colour coding in ( B and C ) is the same as in A . Kaplan–Meier survival estimates of progression-free survival as a function of MAGE-A3 expression ( D ), NY-ESO-1 expression ( E ), LAGE-1 expression ( F ) and PRAME expression ( G ). Only patients with non-muscle-invasive tumours and no prior muscle-invasive tumours were included in the analysis ( n =124).

    Techniques Used: Expressing

    Methylation status of MAGE-A3 , PRAME , LAGE-1 and NY-ESO-1 promoter regions. Distribution plots of methylation index (beta values) differences between normal samples and tumours. Beta values range from 0 to 1, where 0 indicates no methylation and 1 indicates full methylation. Statistical differences were calculated using the Mann–Whitney test.
    Figure Legend Snippet: Methylation status of MAGE-A3 , PRAME , LAGE-1 and NY-ESO-1 promoter regions. Distribution plots of methylation index (beta values) differences between normal samples and tumours. Beta values range from 0 to 1, where 0 indicates no methylation and 1 indicates full methylation. Statistical differences were calculated using the Mann–Whitney test.

    Techniques Used: Methylation, MANN-WHITNEY

    42) Product Images from "Increased frequency of intestinal CD4+ T cells reactive with mycobacteria in patients with Crohn's disease"

    Article Title: Increased frequency of intestinal CD4+ T cells reactive with mycobacteria in patients with Crohn's disease

    Journal: Scandinavian Journal of Gastroenterology

    doi: 10.3109/00365521.2013.837952

    Cytokine secretion in CD4 T cell clones. Production of IFN-γ, IL-10, IL-17 and IL-4 by CD4 T cell clones ( n = 20) from two different patients after stimulation with and anti-CD3/anti CD28 beads for IL-10 and IL-4, and PMA/Ionomycin for IL-17 and IFN-γ. The cells were stimulated in duplicates for 24 h. The cytokine production in the supernatant was measured in the Bio-Plex™ assay.
    Figure Legend Snippet: Cytokine secretion in CD4 T cell clones. Production of IFN-γ, IL-10, IL-17 and IL-4 by CD4 T cell clones ( n = 20) from two different patients after stimulation with and anti-CD3/anti CD28 beads for IL-10 and IL-4, and PMA/Ionomycin for IL-17 and IFN-γ. The cells were stimulated in duplicates for 24 h. The cytokine production in the supernatant was measured in the Bio-Plex™ assay.

    Techniques Used: Clone Assay, Plex Assay

    Screening of 3972 clones from one CD patient (IBD55). CD4 T cells were isolated from intestinal biopsies and expanded in vitro . The responses to MAP and E. coli was tested in a 3 H thymidine incorporation assay using autologous adherent cells as APC. Each symbol represents one tested well. The line indicates the cut-off of a stimulation index > 10 (response in antigen stimulated well/response in unstimulated wells). The response to the two bacterial antigens was compared using a binominal test ( p = 0.032).
    Figure Legend Snippet: Screening of 3972 clones from one CD patient (IBD55). CD4 T cells were isolated from intestinal biopsies and expanded in vitro . The responses to MAP and E. coli was tested in a 3 H thymidine incorporation assay using autologous adherent cells as APC. Each symbol represents one tested well. The line indicates the cut-off of a stimulation index > 10 (response in antigen stimulated well/response in unstimulated wells). The response to the two bacterial antigens was compared using a binominal test ( p = 0.032).

    Techniques Used: Clone Assay, Isolation, In Vitro, Thymidine Incorporation Assay

    Expression of surface markers in a Th1 clone (left panel) and a Th17/Th1 clone (right panel). The clones were stained with anti-CD4 and then mixed with unstained PBMC to be used as an internal control. The mix was subsequently stained with antibodies against the surface markers β7 integrin, CCR6 and CD161 and analysed by flow cytometry. The negative population of the PBMC for the respective markers were used as an internal control (open histograms) while gating on the CD4+ T cells gave the expression of the various surface markers on the tested clone (grey histograms). Left panels depicts TCC955.M.1 and the right panel TCC958.B.M.1.
    Figure Legend Snippet: Expression of surface markers in a Th1 clone (left panel) and a Th17/Th1 clone (right panel). The clones were stained with anti-CD4 and then mixed with unstained PBMC to be used as an internal control. The mix was subsequently stained with antibodies against the surface markers β7 integrin, CCR6 and CD161 and analysed by flow cytometry. The negative population of the PBMC for the respective markers were used as an internal control (open histograms) while gating on the CD4+ T cells gave the expression of the various surface markers on the tested clone (grey histograms). Left panels depicts TCC955.M.1 and the right panel TCC958.B.M.1.

    Techniques Used: Expressing, Clone Assay, Staining, Flow Cytometry, Cytometry

    43) Product Images from "Loss of miR-10a Activates Lpo and Collaborates with Activated Wnt Signaling in Inducing Intestinal Neoplasia in Female Mice"

    Article Title: Loss of miR-10a Activates Lpo and Collaborates with Activated Wnt Signaling in Inducing Intestinal Neoplasia in Female Mice

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1003913

    Disruption of miR-10a leads to enhanced intestinal tumorigenesis in Apc Min mice. Tumor multiplicity in the small (A) and large intestines (B) of female and male miR-10a +/+ ; Apc Min (WT; n = 22 and n = 19 for each sex) and miR-10a −/− ; Apc Min (KO; n = 15 and n = 16 for each sex) mice; each dot represents data for one mouse. Mean adenoma multiplicities per mouse for each group were: WT = 41.95 and KO = 79.33 for female mice and WT = 50.37 and KO = 55.19 for male mice in the small intestine and WT = 0.82 and KO = 2.40 for female mice and WT = 1.47 and KO = 2.44 for male mice in the large intestine. * p = 0.014, ** p = 0.0042 (two-tailed t -test) (C) Size distribution of polyps in the small intestine of female and male miR-10a +/+ ; Apc Min (WT; filled bars) and miR-10a −/− ; Apc Min (KO; empty bars) mice. Mean tumor diameters were 1.01 and 1.04 mm for males WT and KO respectively and 1.03 and 0.94 for females WT and KO respectively ( p = 0.782 and p = 0.4113, Wilcoxon rank sum test). (D) Left panel shows normal appearing small intestine with characteristic villi and well-ordered distribution of goblet cells together with basal location of epithelial nuclei. Middle panel is a typical example of a low-grade dysplasia in miR-10a +/+ ; Apc Min (WT) mice with accumulation of irregular goblet cells pattern (arrowheads) and some loss of nuclear polarity (indicated by “+”). Right panel shows a typical miR-10a −/− ; Apc Min (KO) high-grade dysplasia with a large area of loss of goblet cells, widespread loss of nuclear polarity, nuclear pleomorphism, and almost complete loss of villus organization (indicated by “*”). Note the transition from lower-grade dysplasia area with highly irregular goblet cell distribution (arrowheads). Scalebar = 100 µM. Whole intestines were paraffin-embedded as “Swiss rolls”, sectioned and stained with hematoxylin and eosin. All animals were in a B6 background and between 110 and 160 days of age.
    Figure Legend Snippet: Disruption of miR-10a leads to enhanced intestinal tumorigenesis in Apc Min mice. Tumor multiplicity in the small (A) and large intestines (B) of female and male miR-10a +/+ ; Apc Min (WT; n = 22 and n = 19 for each sex) and miR-10a −/− ; Apc Min (KO; n = 15 and n = 16 for each sex) mice; each dot represents data for one mouse. Mean adenoma multiplicities per mouse for each group were: WT = 41.95 and KO = 79.33 for female mice and WT = 50.37 and KO = 55.19 for male mice in the small intestine and WT = 0.82 and KO = 2.40 for female mice and WT = 1.47 and KO = 2.44 for male mice in the large intestine. * p = 0.014, ** p = 0.0042 (two-tailed t -test) (C) Size distribution of polyps in the small intestine of female and male miR-10a +/+ ; Apc Min (WT; filled bars) and miR-10a −/− ; Apc Min (KO; empty bars) mice. Mean tumor diameters were 1.01 and 1.04 mm for males WT and KO respectively and 1.03 and 0.94 for females WT and KO respectively ( p = 0.782 and p = 0.4113, Wilcoxon rank sum test). (D) Left panel shows normal appearing small intestine with characteristic villi and well-ordered distribution of goblet cells together with basal location of epithelial nuclei. Middle panel is a typical example of a low-grade dysplasia in miR-10a +/+ ; Apc Min (WT) mice with accumulation of irregular goblet cells pattern (arrowheads) and some loss of nuclear polarity (indicated by “+”). Right panel shows a typical miR-10a −/− ; Apc Min (KO) high-grade dysplasia with a large area of loss of goblet cells, widespread loss of nuclear polarity, nuclear pleomorphism, and almost complete loss of villus organization (indicated by “*”). Note the transition from lower-grade dysplasia area with highly irregular goblet cell distribution (arrowheads). Scalebar = 100 µM. Whole intestines were paraffin-embedded as “Swiss rolls”, sectioned and stained with hematoxylin and eosin. All animals were in a B6 background and between 110 and 160 days of age.

    Techniques Used: Mouse Assay, Two Tailed Test, Staining

    Klf4 is upregulated in miR-10a KO intestines. (A) mRNA levels of Klf4 were measured by qRT-PCR, Actb, Ubc, Hprt and 36b4 were used for normalization. Data are shown as mean ± S.D. of miR-10a KO (n = 16) and WT (n = 13) samples relative to an average of the controls. * p
    Figure Legend Snippet: Klf4 is upregulated in miR-10a KO intestines. (A) mRNA levels of Klf4 were measured by qRT-PCR, Actb, Ubc, Hprt and 36b4 were used for normalization. Data are shown as mean ± S.D. of miR-10a KO (n = 16) and WT (n = 13) samples relative to an average of the controls. * p

    Techniques Used: Quantitative RT-PCR

    Transcription factor KLF4 is regulated by miR-10a and can regulate the LPO promoter in vitro . HCT-116 cells were transfected with a miR-10a duplex or control for 72 h. (A) Relative mRNA levels of KLF4 were measured by qRT-PCR and ACTB was used for normalization. Data are shown as mean ± S.D. of three replicates relative to the control and are representative of three independent experiments. * p
    Figure Legend Snippet: Transcription factor KLF4 is regulated by miR-10a and can regulate the LPO promoter in vitro . HCT-116 cells were transfected with a miR-10a duplex or control for 72 h. (A) Relative mRNA levels of KLF4 were measured by qRT-PCR and ACTB was used for normalization. Data are shown as mean ± S.D. of three replicates relative to the control and are representative of three independent experiments. * p

    Techniques Used: In Vitro, Transfection, Quantitative RT-PCR

    Lpo is transcriptionally upregulated in the intestines of miR-10a deficient female mice. (A) Lpo mRNA is ∼29-fold upregulated in intestines of miR-10a KO compared to WT mice as shown by qRT-PCR. Lpo mRNA levels are normalized to Actb and values ± SD are shown relative to the first WT sample. (B) Western-blot from same tissue samples as in (A) confirming upregulation on protein level. Vinculin was used as loading control. As evident from Lpo and Vinculin control as well as ponceau staining (now shown), sample 4 did not contain any protein for unknown reason. (C) Representative immunohistochemistry staining of Lpo in miR-10a WT and KO intestine. Scale bar 100 µm. (D) Scoring of Lpo expression level estimated by distribution and staining intensity in Lpo stained intestines of WT and miR-10a −/− mice. Scoring is divided into low, medium or high expression. Consistent with qRT-PCR and Western blotting analysis a significant difference ( p ≤0.006, Pearson chi-square test with exact probability) in Lpo expression is observed between the different genotypes.
    Figure Legend Snippet: Lpo is transcriptionally upregulated in the intestines of miR-10a deficient female mice. (A) Lpo mRNA is ∼29-fold upregulated in intestines of miR-10a KO compared to WT mice as shown by qRT-PCR. Lpo mRNA levels are normalized to Actb and values ± SD are shown relative to the first WT sample. (B) Western-blot from same tissue samples as in (A) confirming upregulation on protein level. Vinculin was used as loading control. As evident from Lpo and Vinculin control as well as ponceau staining (now shown), sample 4 did not contain any protein for unknown reason. (C) Representative immunohistochemistry staining of Lpo in miR-10a WT and KO intestine. Scale bar 100 µm. (D) Scoring of Lpo expression level estimated by distribution and staining intensity in Lpo stained intestines of WT and miR-10a −/− mice. Scoring is divided into low, medium or high expression. Consistent with qRT-PCR and Western blotting analysis a significant difference ( p ≤0.006, Pearson chi-square test with exact probability) in Lpo expression is observed between the different genotypes.

    Techniques Used: Mouse Assay, Quantitative RT-PCR, Western Blot, Staining, Immunohistochemistry, Expressing

    Generation of miR-10a KO mice. (A) Schematic representation of the miR-10a WT locus, the targeting construct used for inactivation and the final miR-10a null allele. The targeting construct (TC) harbored a miR-10a inactivated allele, where 70 nucleotides from the pre-miRNA sequence were replaced with a neomycin resistance cassette ( neo ) flanked by loxP sites and long homologous regions for recombination. To obtain the final miR-10a null allele (KO), the neomycin cassette was removed in the mouse germ line by breeding heterozygous mice to transgenic mice harboring the Cre transgene. Arrowheads depict the sites recognized by different primers used in genotyping of mice. (B) Genotyping PCR of mice with all different miR-10a genotypes generated. Primers L_chkinsrtmiR10a.5d and 10a.internal amplified a 273 bp fragment corresponding to the miR-10 WT allele and 361 bp for the floxed miR-10a KO allele, L_chkinsrtmiR10a.5d and R_chkinsrtmiR10a.5 amplified 291 bp from the miR-10a neo allele. The location of all these primers is depicted in (A).
    Figure Legend Snippet: Generation of miR-10a KO mice. (A) Schematic representation of the miR-10a WT locus, the targeting construct used for inactivation and the final miR-10a null allele. The targeting construct (TC) harbored a miR-10a inactivated allele, where 70 nucleotides from the pre-miRNA sequence were replaced with a neomycin resistance cassette ( neo ) flanked by loxP sites and long homologous regions for recombination. To obtain the final miR-10a null allele (KO), the neomycin cassette was removed in the mouse germ line by breeding heterozygous mice to transgenic mice harboring the Cre transgene. Arrowheads depict the sites recognized by different primers used in genotyping of mice. (B) Genotyping PCR of mice with all different miR-10a genotypes generated. Primers L_chkinsrtmiR10a.5d and 10a.internal amplified a 273 bp fragment corresponding to the miR-10 WT allele and 361 bp for the floxed miR-10a KO allele, L_chkinsrtmiR10a.5d and R_chkinsrtmiR10a.5 amplified 291 bp from the miR-10a neo allele. The location of all these primers is depicted in (A).

    Techniques Used: Mouse Assay, Construct, Sequencing, Transgenic Assay, Polymerase Chain Reaction, Generated, Amplification

    44) Product Images from "Production of Bioactive Soluble Interleukin-15 in Complex with Interleukin-15 Receptor Alpha from a Conditionally-Replicating Oncolytic HSV-1"

    Article Title: Production of Bioactive Soluble Interleukin-15 in Complex with Interleukin-15 Receptor Alpha from a Conditionally-Replicating Oncolytic HSV-1

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0081768

    Replication of J100 and J100D in Neuro-2a, but not GL261 or CT-2A cell lines. In these multi-step replication assays, cells are infected at a multiplicity of infection (MOI) of 0.1 to allow multiple rounds of replication. The concentration of cellular-associated virus at each indicated timepoint was determined by limiting dilution plaque assay. Neuro-2a cells are permissive to oHSV replication as demonstrated by the amplification of infectious viral particles above the initial titer at infection. GL261 and CT-2A cells do not support replication of oHSVs. Individual data points represent the mean ± SD of triplicate samples. pfu – plaque forming units; hpi – hours post infection.
    Figure Legend Snippet: Replication of J100 and J100D in Neuro-2a, but not GL261 or CT-2A cell lines. In these multi-step replication assays, cells are infected at a multiplicity of infection (MOI) of 0.1 to allow multiple rounds of replication. The concentration of cellular-associated virus at each indicated timepoint was determined by limiting dilution plaque assay. Neuro-2a cells are permissive to oHSV replication as demonstrated by the amplification of infectious viral particles above the initial titer at infection. GL261 and CT-2A cells do not support replication of oHSVs. Individual data points represent the mean ± SD of triplicate samples. pfu – plaque forming units; hpi – hours post infection.

    Techniques Used: Infection, Concentration Assay, Plaque Assay, Amplification

    45) Product Images from "miR-582-5p Is Upregulated in Patients with Active Tuberculosis and Inhibits Apoptosis of Monocytes by Targeting FOXO1"

    Article Title: miR-582-5p Is Upregulated in Patients with Active Tuberculosis and Inhibits Apoptosis of Monocytes by Targeting FOXO1

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0078381

    FOXO1 is a direct target of miR-582-5p. (A) Alignment between the predicted miR-582-5p target site of FOXO1 3′UTR region and miR-582-5p. (B) Real time RT-PCR and western blot analysis showing FOXO1 mRNA and protein expression levels in THP-1 cells transfected with miR-582-5p mimics or mimics NC, respectively. (C) Co-transfection of miR-582-5p mimics/mimics NC and FOXO1 3′UTR-luciferase reporter vector into HEK-293T cells demonstrated that significant decrease in luciferase activity was only found in reporter vector that contained a wild type sequence (FOXO1-3′UTR-wt), not in vector that contained a mutant sequence (FOXO1-3′UTR-mut) within the miR-582-5p binding site. Values were presented as relative luciferase activity after normalization to Renilla luciferase activity. FOXO1-3′UTR-wt: pMIR-FOXO1-3′UTR-wt vector; FOXO1-3′UTR-mut: pMIR-FOXO1-3′UTR-mut vector. (D) Representative flow cytometric plots showing apoptotic ratio of THP-1 transfected with FOXO1 siRNA or negative controls of siRNA (siRNA NC) (left panel). The apoptotic percentage of THP-1 cells transfected with FOXO1 siRNA were significantly lower than those transfected with negative control siRNA (siRNA NC) ( p
    Figure Legend Snippet: FOXO1 is a direct target of miR-582-5p. (A) Alignment between the predicted miR-582-5p target site of FOXO1 3′UTR region and miR-582-5p. (B) Real time RT-PCR and western blot analysis showing FOXO1 mRNA and protein expression levels in THP-1 cells transfected with miR-582-5p mimics or mimics NC, respectively. (C) Co-transfection of miR-582-5p mimics/mimics NC and FOXO1 3′UTR-luciferase reporter vector into HEK-293T cells demonstrated that significant decrease in luciferase activity was only found in reporter vector that contained a wild type sequence (FOXO1-3′UTR-wt), not in vector that contained a mutant sequence (FOXO1-3′UTR-mut) within the miR-582-5p binding site. Values were presented as relative luciferase activity after normalization to Renilla luciferase activity. FOXO1-3′UTR-wt: pMIR-FOXO1-3′UTR-wt vector; FOXO1-3′UTR-mut: pMIR-FOXO1-3′UTR-mut vector. (D) Representative flow cytometric plots showing apoptotic ratio of THP-1 transfected with FOXO1 siRNA or negative controls of siRNA (siRNA NC) (left panel). The apoptotic percentage of THP-1 cells transfected with FOXO1 siRNA were significantly lower than those transfected with negative control siRNA (siRNA NC) ( p

    Techniques Used: Quantitative RT-PCR, Western Blot, Expressing, Transfection, Cotransfection, Luciferase, Plasmid Preparation, Activity Assay, Sequencing, Mutagenesis, Binding Assay, Flow Cytometry, Negative Control

    46) Product Images from "Mechanisms of cisplatin-induced cell death in malignant mesothelioma cells: Role of inhibitor of apoptosis proteins (IAPs) and caspases"

    Article Title: Mechanisms of cisplatin-induced cell death in malignant mesothelioma cells: Role of inhibitor of apoptosis proteins (IAPs) and caspases

    Journal: International Journal of Oncology

    doi: 10.3892/ijo.2012.1715

    Mechanisms of cisplatin induced cell death in mesothelioma cells. (A) In vitro sensitivity of MM cell lines to cisplatin. Cells were cultured in the presence of cisplatin for 24 h. Cell viability was determined by MTT assay. Data presented are the mean ± SD of five independent experiments each performed in triplicate. (B) Dose-dependent mitochondrial membrane depolarisation. Mitochondrial membrane potential was measured by JC-1 accumulation following cisplatin treatment (lower ratio of red/green indicates loss of potential). Results are the mean ± SD of at least three independent treatments performed in triplicate. FCCP-positive control. (C) Phosphatidylserine (PS) translocation in response to cisplatin. PS translocation to the outer cell membrane was measured by Annexin-V binding and flow cytometry. Cells were treated with a range of cisplatin concentrations (0.1–100 μ g/ml) for 24 h. Results shown are the mean ± SD of two independent experiments performed in triplicate. (D) Loss of membrane integrity in response to cisplatin. Membrane integrity was measured by staining with the cell impermeant dye propidium iodide and flow cytometry. Results shown are the mean ± SD of two independent experiments performed in triplicate.
    Figure Legend Snippet: Mechanisms of cisplatin induced cell death in mesothelioma cells. (A) In vitro sensitivity of MM cell lines to cisplatin. Cells were cultured in the presence of cisplatin for 24 h. Cell viability was determined by MTT assay. Data presented are the mean ± SD of five independent experiments each performed in triplicate. (B) Dose-dependent mitochondrial membrane depolarisation. Mitochondrial membrane potential was measured by JC-1 accumulation following cisplatin treatment (lower ratio of red/green indicates loss of potential). Results are the mean ± SD of at least three independent treatments performed in triplicate. FCCP-positive control. (C) Phosphatidylserine (PS) translocation in response to cisplatin. PS translocation to the outer cell membrane was measured by Annexin-V binding and flow cytometry. Cells were treated with a range of cisplatin concentrations (0.1–100 μ g/ml) for 24 h. Results shown are the mean ± SD of two independent experiments performed in triplicate. (D) Loss of membrane integrity in response to cisplatin. Membrane integrity was measured by staining with the cell impermeant dye propidium iodide and flow cytometry. Results shown are the mean ± SD of two independent experiments performed in triplicate.

    Techniques Used: In Vitro, Cell Culture, MTT Assay, Positive Control, Translocation Assay, Binding Assay, Flow Cytometry, Cytometry, Staining

    47) Product Images from "New Role of JAK2/STAT3 Signaling in Endothelial Cell Oxidative Stress Injury and Protective Effect of Melatonin"

    Article Title: New Role of JAK2/STAT3 Signaling in Endothelial Cell Oxidative Stress Injury and Protective Effect of Melatonin

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0057941

    The effects of JAK2 siRNA on the levels of p-JAK2 and p-STAT3 and the expression of Bcl2, Caspase3, Bax and Cytochrome c in H 2 O 2 -injured HUVECs (treated for 4 h). Representative images of the Western blots are shown. The results are expressed as the mean ± SEM, n = 6, **P
    Figure Legend Snippet: The effects of JAK2 siRNA on the levels of p-JAK2 and p-STAT3 and the expression of Bcl2, Caspase3, Bax and Cytochrome c in H 2 O 2 -injured HUVECs (treated for 4 h). Representative images of the Western blots are shown. The results are expressed as the mean ± SEM, n = 6, **P

    Techniques Used: Expressing, Western Blot

    The effects of JAK2 siRNA on the viability, morphology and apoptotic rate of H 2 O 2 -injured HUVECs (treated for 4 h). (A) The viability of the HUVECs was assessed by performing an MTT assay, and the viability was expressed as an OD value. (B) The cell morphology was observed using inverted/phase-contrast microscopy, and images were obtained. Significant cell shrinkage and a decrease in the cellular attachment rate was observed in the H 2 O 2 group, whereas the pretreatment with JAK2 siRNA reduced H 2 O 2 -induced cell shrinkage and decreased the cellular attachment rate. (C) The apoptosis of the HUVECs was assessed by a TUNEL assay and was expressed as the apoptotic index. TUNEL staining was performed to stain the nuclei of the apoptotic cells (green), and DAPI was used to stain all of the nuclei (blue). The apoptotic index was expressed as the number of positively stained apoptotic cells/the total number of cells counted ×100%. The results are expressed as the mean ± SEM, n = 6, **P
    Figure Legend Snippet: The effects of JAK2 siRNA on the viability, morphology and apoptotic rate of H 2 O 2 -injured HUVECs (treated for 4 h). (A) The viability of the HUVECs was assessed by performing an MTT assay, and the viability was expressed as an OD value. (B) The cell morphology was observed using inverted/phase-contrast microscopy, and images were obtained. Significant cell shrinkage and a decrease in the cellular attachment rate was observed in the H 2 O 2 group, whereas the pretreatment with JAK2 siRNA reduced H 2 O 2 -induced cell shrinkage and decreased the cellular attachment rate. (C) The apoptosis of the HUVECs was assessed by a TUNEL assay and was expressed as the apoptotic index. TUNEL staining was performed to stain the nuclei of the apoptotic cells (green), and DAPI was used to stain all of the nuclei (blue). The apoptotic index was expressed as the number of positively stained apoptotic cells/the total number of cells counted ×100%. The results are expressed as the mean ± SEM, n = 6, **P

    Techniques Used: MTT Assay, Microscopy, Cell Attachment Assay, TUNEL Assay, Staining

    48) Product Images from "The Quiescin Sulfhydryl Oxidase (hQSOX1b) Tunes the Expression of Resistin-Like Molecule Alpha (RELM-? or mFIZZ1) in a Wheat Germ Cell-Free Extract"

    Article Title: The Quiescin Sulfhydryl Oxidase (hQSOX1b) Tunes the Expression of Resistin-Like Molecule Alpha (RELM-? or mFIZZ1) in a Wheat Germ Cell-Free Extract

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0055621

    mFIZZ1′ and mFIZZ1 decreased the IL-13 and IL-5 secretion of splenocytes. Splenocytes were cultured at 200,000 cells/well and activated under Th2 permissive conditions for 4 days. Recombinant mFIZZ1′ and mFIZZ1 expressed with or without hQSOX1b were used at 200 ng/ml. rRa is the bacterial recombinant FIZZ1 (200 ng/ml) from (Peprotech) and PBS is the control. ( A ) Recombinant mFIZZ1′ and mFIZZ1 co-expressed with hQSOX1b significantly decreased the IL-5 secretion compared to the proteins expressed alone. ( B ) Recombinant mFIZZ1′ and mFIZZ1 co-expressed with hQSOX1b decreased the IL-13 secretion compared to the proteins expressed alone. ***P
    Figure Legend Snippet: mFIZZ1′ and mFIZZ1 decreased the IL-13 and IL-5 secretion of splenocytes. Splenocytes were cultured at 200,000 cells/well and activated under Th2 permissive conditions for 4 days. Recombinant mFIZZ1′ and mFIZZ1 expressed with or without hQSOX1b were used at 200 ng/ml. rRa is the bacterial recombinant FIZZ1 (200 ng/ml) from (Peprotech) and PBS is the control. ( A ) Recombinant mFIZZ1′ and mFIZZ1 co-expressed with hQSOX1b significantly decreased the IL-5 secretion compared to the proteins expressed alone. ( B ) Recombinant mFIZZ1′ and mFIZZ1 co-expressed with hQSOX1b decreased the IL-13 secretion compared to the proteins expressed alone. ***P

    Techniques Used: Cell Culture, Recombinant

    49) Product Images from "Antitumor Mechanisms of Amino Acid Hydroxyurea Derivatives in the Metastatic Colon Cancer Model"

    Article Title: Antitumor Mechanisms of Amino Acid Hydroxyurea Derivatives in the Metastatic Colon Cancer Model

    Journal: International Journal of Molecular Sciences

    doi: 10.3390/ijms141223654

    ( A ) The zinc-binding group (ZBG) and the CAP group of HDAC inhibitors; ( B ) Suggested binding mode of N ′-benzyloxyureido derivative BOU (yellow) within the crystal structure 3MAX of HDAC2 complexed with the benzamide LXX (green); ( C ) Alignments of crystal structures of HDAC2 (3MAX, green), HDAC4 (2VQJ, pink) and HDAC8 (2V5X, cyan) complexed with the corresponding inhibitors; ( D ) HDAC enzymes (class I and/or II) activity in SW620 cells treated with BOU and MHCU for 24 and 72 h. Significant changes are marked with an asterisk ( * ).
    Figure Legend Snippet: ( A ) The zinc-binding group (ZBG) and the CAP group of HDAC inhibitors; ( B ) Suggested binding mode of N ′-benzyloxyureido derivative BOU (yellow) within the crystal structure 3MAX of HDAC2 complexed with the benzamide LXX (green); ( C ) Alignments of crystal structures of HDAC2 (3MAX, green), HDAC4 (2VQJ, pink) and HDAC8 (2V5X, cyan) complexed with the corresponding inhibitors; ( D ) HDAC enzymes (class I and/or II) activity in SW620 cells treated with BOU and MHCU for 24 and 72 h. Significant changes are marked with an asterisk ( * ).

    Techniques Used: Binding Assay, Activity Assay

    ( A ) Hydroxyurea (HU) and its derivatives N ′-benzyloxycarbamoyl- d- phenylglycine benzhydrylamide (BOU) and N ′-methyl- N ′-hydroxycarbamoyl- l- phenylalanine benzhydrylamide (MHCU); ( B ) Concentration-dependent antiproliferative effect of BOU and MHCU on the SW620 cell line. Marginal means of survival were estimated as percentages of growth (PG); ( C ) Representative blots of SW620 cells treated with BOU and MHCU, probed with antibodies against human procaspase-3, procaspase-7 and procaspase-9. Treatments are as follows: 1 : control 24 h, 2 : BOU at 1 μM 24 h, 3 : BOU at 50 μM after 24 h, 4 : MHCU at 1 μM after 24 h, 5 : MHCU at 50 μM after 24 h, 6 : control after 72 h, 7 : BOU at 1 μM after 72 h, 8 : BOU at 50 μM after 72 h, 9 : MHCU at 1 μM after 72 h, 10 : MHCU at 50 μM after 72 h.
    Figure Legend Snippet: ( A ) Hydroxyurea (HU) and its derivatives N ′-benzyloxycarbamoyl- d- phenylglycine benzhydrylamide (BOU) and N ′-methyl- N ′-hydroxycarbamoyl- l- phenylalanine benzhydrylamide (MHCU); ( B ) Concentration-dependent antiproliferative effect of BOU and MHCU on the SW620 cell line. Marginal means of survival were estimated as percentages of growth (PG); ( C ) Representative blots of SW620 cells treated with BOU and MHCU, probed with antibodies against human procaspase-3, procaspase-7 and procaspase-9. Treatments are as follows: 1 : control 24 h, 2 : BOU at 1 μM 24 h, 3 : BOU at 50 μM after 24 h, 4 : MHCU at 1 μM after 24 h, 5 : MHCU at 50 μM after 24 h, 6 : control after 72 h, 7 : BOU at 1 μM after 72 h, 8 : BOU at 50 μM after 72 h, 9 : MHCU at 1 μM after 72 h, 10 : MHCU at 50 μM after 72 h.

    Techniques Used: Concentration Assay

    50) Product Images from "Enhanced Biofilm Formation by Escherichia coli LPS Mutants Defective in Hep Biosynthesis"

    Article Title: Enhanced Biofilm Formation by Escherichia coli LPS Mutants Defective in Hep Biosynthesis

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0051241

    Loss of outer membrane integrity in strain RN102. Bacterial samples were collected from 48-hour-cultured biofilms for TEM analysis. TEM images of the bacterial cells and the cell appendages are shown for strains: (A) BW25113, (B) RN102, (C) BW25113/pNTR-SD, (D) RN102/pNTR-SD, and (E) RN102/pNT3( hldE ). The outer membranes are indicated by arrows. Representative electron-microphotographs of each strain are shown. A 500-nm-long bar is shown in the lower left corner of each eclectron-micrograph. (F) Western blot analysis of supernatants from BW25113 and RN102. Supernatants were harvested by centrifugation from bacterial liquid culture grown for 48 hours under static conditions. Results of Western blot using anti-Crp, anti-DsbA, anti-OmpC, and anti-OmpA antisera are shown. (G) Supernatants from bacterial liquid cultures of BW25113 or RN102 grown for 48 hours under static conditions were serially diluted with TE. The diluted samples were used as template DNA for PCR using E. coli atoS gene-specific primer pairs. Lanes: 1, without dilution; 2, 10 −1 dilution; 3, 10 −2 dilution; 4, 10 −3 dilution; 5, 10 −4 dilution; 6, 10 −5 dilution; 7, 10 −6 dilution.
    Figure Legend Snippet: Loss of outer membrane integrity in strain RN102. Bacterial samples were collected from 48-hour-cultured biofilms for TEM analysis. TEM images of the bacterial cells and the cell appendages are shown for strains: (A) BW25113, (B) RN102, (C) BW25113/pNTR-SD, (D) RN102/pNTR-SD, and (E) RN102/pNT3( hldE ). The outer membranes are indicated by arrows. Representative electron-microphotographs of each strain are shown. A 500-nm-long bar is shown in the lower left corner of each eclectron-micrograph. (F) Western blot analysis of supernatants from BW25113 and RN102. Supernatants were harvested by centrifugation from bacterial liquid culture grown for 48 hours under static conditions. Results of Western blot using anti-Crp, anti-DsbA, anti-OmpC, and anti-OmpA antisera are shown. (G) Supernatants from bacterial liquid cultures of BW25113 or RN102 grown for 48 hours under static conditions were serially diluted with TE. The diluted samples were used as template DNA for PCR using E. coli atoS gene-specific primer pairs. Lanes: 1, without dilution; 2, 10 −1 dilution; 3, 10 −2 dilution; 4, 10 −3 dilution; 5, 10 −4 dilution; 6, 10 −5 dilution; 7, 10 −6 dilution.

    Techniques Used: Cell Culture, Transmission Electron Microscopy, Western Blot, Centrifugation, Polymerase Chain Reaction

    Contribution of eDNA to biofilm structure formed by RN102. (A–E) CLSM images of biofilms formed by strains: (A) BW25113 (B) RN102, (C) BW25113/pNTR-SD, (D) RN102/pNTR-SD, and (D) RN102/pNT3( hldE ). Images of biofilms stained with acrydine orange are shown as digital CLSM images. In each strain, a section which has the largest sum of signals in the defined area (127.3 μm by 127.3 μm) among all X–Y sections is shown in the upper row (X–Y). The overview of biofilms in the same area of each X–Y section is shown as 3D image in the lower row (3D). The volume of each 3D image (μm 3 ) in the area of the X–Y planes was quantified and the mean ± SD obtained from 3 different areas chosen at random are denoted in the upper-right corners. The data shown are representative microphotographs of two independent experiments. (F) Quantification of eDNA from BW25113 and RN102 strains. The bars represent the ratio of extracellular DNA to intracellular DNA (eDNA/iDNA). Results are shown as the mean ± SD from 3 independent experiments. * P
    Figure Legend Snippet: Contribution of eDNA to biofilm structure formed by RN102. (A–E) CLSM images of biofilms formed by strains: (A) BW25113 (B) RN102, (C) BW25113/pNTR-SD, (D) RN102/pNTR-SD, and (D) RN102/pNT3( hldE ). Images of biofilms stained with acrydine orange are shown as digital CLSM images. In each strain, a section which has the largest sum of signals in the defined area (127.3 μm by 127.3 μm) among all X–Y sections is shown in the upper row (X–Y). The overview of biofilms in the same area of each X–Y section is shown as 3D image in the lower row (3D). The volume of each 3D image (μm 3 ) in the area of the X–Y planes was quantified and the mean ± SD obtained from 3 different areas chosen at random are denoted in the upper-right corners. The data shown are representative microphotographs of two independent experiments. (F) Quantification of eDNA from BW25113 and RN102 strains. The bars represent the ratio of extracellular DNA to intracellular DNA (eDNA/iDNA). Results are shown as the mean ± SD from 3 independent experiments. * P

    Techniques Used: Confocal Laser Scanning Microscopy, Staining

    Biofilm formation and growth of a series of LPS mutants. (A) Biofilm formation by a series of core OS LPS mutants when compared to the parental strain, BW25113. The mean ± SD of results from 3 independent experiments are shown. Statistical analysis was performed using ANOVA. * P
    Figure Legend Snippet: Biofilm formation and growth of a series of LPS mutants. (A) Biofilm formation by a series of core OS LPS mutants when compared to the parental strain, BW25113. The mean ± SD of results from 3 independent experiments are shown. Statistical analysis was performed using ANOVA. * P

    Techniques Used:

    Loss of flagella in RN102. Fourty eight-hour-cultured biofilms were collected and analyzed by TEM, and by Western blot for FliC. (A–E) TEM images of the bacterial cells and the cell appendages are shown for strains (A) BW25113, (B) RN102, (C) BW25113/pNTR-SD, (D) RN102/pNTR-SD, and (E) RN102/pNT3( hldE ). Flagella found in figures (A), (C), and (E) are shown by arrowheads. Representative electron-microphotographs of each strain are shown. A 1-μm-long bar is shown in the lower left corner. (F) Supernatants were collected from 48-hour bacterial cultures. Result of Western blot using anti-FliC antiserum is shown. Lanes; 1, BW25113; 2, RN102; 3, BW25113/pNTR-SD; 4, RN102/pNTR-SD; 5, RN102/pNT3( hldE ); 6, RN110.
    Figure Legend Snippet: Loss of flagella in RN102. Fourty eight-hour-cultured biofilms were collected and analyzed by TEM, and by Western blot for FliC. (A–E) TEM images of the bacterial cells and the cell appendages are shown for strains (A) BW25113, (B) RN102, (C) BW25113/pNTR-SD, (D) RN102/pNTR-SD, and (E) RN102/pNT3( hldE ). Flagella found in figures (A), (C), and (E) are shown by arrowheads. Representative electron-microphotographs of each strain are shown. A 1-μm-long bar is shown in the lower left corner. (F) Supernatants were collected from 48-hour bacterial cultures. Result of Western blot using anti-FliC antiserum is shown. Lanes; 1, BW25113; 2, RN102; 3, BW25113/pNTR-SD; 4, RN102/pNTR-SD; 5, RN102/pNT3( hldE ); 6, RN110.

    Techniques Used: Cell Culture, Transmission Electron Microscopy, Western Blot

    51) Product Images from "Mechanisms Underlying the Antiproliferative and Prodifferentiative Effects of Psoralen on Adult Neural Stem Cells via DNA Microarray"

    Article Title: Mechanisms Underlying the Antiproliferative and Prodifferentiative Effects of Psoralen on Adult Neural Stem Cells via DNA Microarray

    Journal: Evidence-based Complementary and Alternative Medicine : eCAM

    doi: 10.1155/2013/452948

    Effects of Psoralen on neurosphere formation of neural stem cells in vitro. Single NSCs at a density of 500 cells/well were cultured in normal growth medium (NGM) containing DMEM/F12 supplemented with hrFGF for 7 days to form various size of neurospheres (a). The neurospheres expressed NSC marker nestin (b). Single NSCs were exposed to NGM, DMSO (0.1%), and 10, 50, 100 nM Psoralen dissolved in DMSO (0.1%), respectively. Psoralen caused a significant decrease in frequency of neurosphere formation (c). Scale bars: 100 μ m. Results were expressed as mean ± S.D. of six independent experiments. * P
    Figure Legend Snippet: Effects of Psoralen on neurosphere formation of neural stem cells in vitro. Single NSCs at a density of 500 cells/well were cultured in normal growth medium (NGM) containing DMEM/F12 supplemented with hrFGF for 7 days to form various size of neurospheres (a). The neurospheres expressed NSC marker nestin (b). Single NSCs were exposed to NGM, DMSO (0.1%), and 10, 50, 100 nM Psoralen dissolved in DMSO (0.1%), respectively. Psoralen caused a significant decrease in frequency of neurosphere formation (c). Scale bars: 100 μ m. Results were expressed as mean ± S.D. of six independent experiments. * P

    Techniques Used: In Vitro, Cell Culture, Marker

    52) Product Images from "Silybin-Mediated Inhibition of Notch Signaling Exerts Antitumor Activity in Human Hepatocellular Carcinoma Cells"

    Article Title: Silybin-Mediated Inhibition of Notch Signaling Exerts Antitumor Activity in Human Hepatocellular Carcinoma Cells

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0083699

    Effects of combined SIL treatment and Notch1 siRNA transfection on cell viability and Notch1 signaling in HCC cells. A. Viability is expressed as OD values. B. Representative Western blot results are shown. The results are expressed as the means ± SEM, n = 6. aa P
    Figure Legend Snippet: Effects of combined SIL treatment and Notch1 siRNA transfection on cell viability and Notch1 signaling in HCC cells. A. Viability is expressed as OD values. B. Representative Western blot results are shown. The results are expressed as the means ± SEM, n = 6. aa P

    Techniques Used: Transfection, Western Blot

    53) Product Images from "Shp1 regulates T cell homeostasis by limiting IL-4 signals"

    Article Title: Shp1 regulates T cell homeostasis by limiting IL-4 signals

    Journal: The Journal of Experimental Medicine

    doi: 10.1084/jem.20122239

    T cells skew to Th2 in the absence of Shp1. (A) Naive (CD44 lo ) CD4 + T cells were isolated, stimulated for 3 d with α-CD3/CD28, and then restimulated with PMA/Ionomycin 4 d later. Cells were harvested and stained 6 h after restimulation. (B) Cells were stimulated and analyzed as in A. Percentages of cells staining positive for IFN γ or IL-4. Data are representative of three independent experiments and are displayed as ± standard error; n = 4. (C) Concentration of IgE and IgG2a in sera from the indicated unmanipulated age-matched mice. Horizontal bars represent sample means; n = 8. (D) T cells were stimulated with the indicated concentrations of IL-4 for 30 min and then fixed and stained for p-Stat6. Histograms are gated on CD44 lo T cells. (E) T cells were stimulated with 10 ng/ml IL-4 for 30 min and were then washed three times with media. Cells were harvested at the indicated times and analyzed as in D . Data are representative of three independent experiments. Statistical analyses of data in B and C were performed by Student’s t test; ns, P ≥ 0.05; *, P
    Figure Legend Snippet: T cells skew to Th2 in the absence of Shp1. (A) Naive (CD44 lo ) CD4 + T cells were isolated, stimulated for 3 d with α-CD3/CD28, and then restimulated with PMA/Ionomycin 4 d later. Cells were harvested and stained 6 h after restimulation. (B) Cells were stimulated and analyzed as in A. Percentages of cells staining positive for IFN γ or IL-4. Data are representative of three independent experiments and are displayed as ± standard error; n = 4. (C) Concentration of IgE and IgG2a in sera from the indicated unmanipulated age-matched mice. Horizontal bars represent sample means; n = 8. (D) T cells were stimulated with the indicated concentrations of IL-4 for 30 min and then fixed and stained for p-Stat6. Histograms are gated on CD44 lo T cells. (E) T cells were stimulated with 10 ng/ml IL-4 for 30 min and were then washed three times with media. Cells were harvested at the indicated times and analyzed as in D . Data are representative of three independent experiments. Statistical analyses of data in B and C were performed by Student’s t test; ns, P ≥ 0.05; *, P

    Techniques Used: Isolation, Staining, Concentration Assay, Mouse Assay

    54) Product Images from "Loss of Multi-Epitope Specificity in Memory CD4+ T Cell Responses to B. Pertussis with Age"

    Article Title: Loss of Multi-Epitope Specificity in Memory CD4+ T Cell Responses to B. Pertussis with Age

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0083583

    Prn- and Ptx-epitope multispecificity in individual participants. Fresh PBMC were stimulated with 1 µM peptide for 7 days and [ 3 H]thymidine incorporation was assed in the last 18 hours. Stimulation Index (S.I. = geomean CPM peptide/geomean CPM medium) of participants (n = 91) was calculated. (A) Prn- and Ptx-epitope responses with S.I.≥2 are indicated in blue for each individual participant. Participants and peptides were clustered on the number of positive responses, only participants responding to at least one of the peptides in our peptide panel are shown. The shades of blue indicate the magnitude (S.I. value) of the response (B) The combination of the clinical parameters age at blood donation and months after diagnosis in relation to responsiveness (Responsive = response with S.I. > 2) to the tested (B) Prn- (n = 4) and (C) Ptx-peptides (n = 3) are depicted for (ex-)pertussis patients (n = 62). The degree of Prn- and Ptx- epitope responsiveness (0, 1, 2, 3 or 4 epitopes) per patient are indicated in shades of gray. The numbers in the quadrant insert indicate the percentage and ratio of epitope responsiveness (red) versus no epitope responsiveness (black) in the corresponding study populations. The odds ratio (OR) gives an indication whether differences in the number of responses between recently infected and not recently infected persons depends on age.
    Figure Legend Snippet: Prn- and Ptx-epitope multispecificity in individual participants. Fresh PBMC were stimulated with 1 µM peptide for 7 days and [ 3 H]thymidine incorporation was assed in the last 18 hours. Stimulation Index (S.I. = geomean CPM peptide/geomean CPM medium) of participants (n = 91) was calculated. (A) Prn- and Ptx-epitope responses with S.I.≥2 are indicated in blue for each individual participant. Participants and peptides were clustered on the number of positive responses, only participants responding to at least one of the peptides in our peptide panel are shown. The shades of blue indicate the magnitude (S.I. value) of the response (B) The combination of the clinical parameters age at blood donation and months after diagnosis in relation to responsiveness (Responsive = response with S.I. > 2) to the tested (B) Prn- (n = 4) and (C) Ptx-peptides (n = 3) are depicted for (ex-)pertussis patients (n = 62). The degree of Prn- and Ptx- epitope responsiveness (0, 1, 2, 3 or 4 epitopes) per patient are indicated in shades of gray. The numbers in the quadrant insert indicate the percentage and ratio of epitope responsiveness (red) versus no epitope responsiveness (black) in the corresponding study populations. The odds ratio (OR) gives an indication whether differences in the number of responses between recently infected and not recently infected persons depends on age.

    Techniques Used: Infection

    55) Product Images from "Cyclin D1 affects epithelial-mesenchymal transition in epithelial ovarian cancer stem cell-like cells"

    Article Title: Cyclin D1 affects epithelial-mesenchymal transition in epithelial ovarian cancer stem cell-like cells

    Journal: OncoTargets and therapy

    doi: 10.2147/OTT.S44177

    Cell viability, apoptosis induced by cyclin D1 silence. Notes: ( A ) At 0, 24, and 48 hours, cell viability was not significantly different between cyclin D1-siRNA and NT siRNA transfected cells, but a marked decrease of cell viability was observed at 72 hours post-transfection (Z = −2.241, P = 0.025). ( B and C ) At 30 hours after siRNA transfection, viable apoptosis was significantly increased in cyclin D1 siRNA-transfected cells compared with NT siRNA group (Z = −2.650, P = 0.008). Abbreviation: NT-siRNA, nontargeting small interfering RNA.
    Figure Legend Snippet: Cell viability, apoptosis induced by cyclin D1 silence. Notes: ( A ) At 0, 24, and 48 hours, cell viability was not significantly different between cyclin D1-siRNA and NT siRNA transfected cells, but a marked decrease of cell viability was observed at 72 hours post-transfection (Z = −2.241, P = 0.025). ( B and C ) At 30 hours after siRNA transfection, viable apoptosis was significantly increased in cyclin D1 siRNA-transfected cells compared with NT siRNA group (Z = −2.650, P = 0.008). Abbreviation: NT-siRNA, nontargeting small interfering RNA.

    Techniques Used: Transfection, Small Interfering RNA

    The expression pattern of cyclin D1, N-cadherin, vimentin in parental cells and spheroids, and transfection efficacy of cyclin D1 siRNA. Notes: ( A and B ) The average value of cyclin D1 was higher in spheroids than that in parental cells with a significant difference ( t = −3.351, P = 0.007). The value of N-cadherin was not statistically different between spheroids and parental cells ( t = −1.322, P = 0.221). The average value of vimentin was also higher in spheroids than that in parental cells, with a significant difference ( t = −2.471, P = 0.033). ( C ) Cyclin D1 mRNA was downregulated nearly 59% after siRNA transfection. ( D ) Cyclin D1 protein was down-regulated nearly 51% after siRNA transfection. Abbreviations: P1, parental cell sample 1; P2, parental cell sample 2; P1, spheroids sample 1; S2, spheroids sample 2; NT-siRNA, nontargeting small interfering RNA.
    Figure Legend Snippet: The expression pattern of cyclin D1, N-cadherin, vimentin in parental cells and spheroids, and transfection efficacy of cyclin D1 siRNA. Notes: ( A and B ) The average value of cyclin D1 was higher in spheroids than that in parental cells with a significant difference ( t = −3.351, P = 0.007). The value of N-cadherin was not statistically different between spheroids and parental cells ( t = −1.322, P = 0.221). The average value of vimentin was also higher in spheroids than that in parental cells, with a significant difference ( t = −2.471, P = 0.033). ( C ) Cyclin D1 mRNA was downregulated nearly 59% after siRNA transfection. ( D ) Cyclin D1 protein was down-regulated nearly 51% after siRNA transfection. Abbreviations: P1, parental cell sample 1; P2, parental cell sample 2; P1, spheroids sample 1; S2, spheroids sample 2; NT-siRNA, nontargeting small interfering RNA.

    Techniques Used: Expressing, Transfection, Small Interfering RNA

    Cell migration and n-cadherin, vimentin expression induced by cyclin D1 silence. Notes: ( A and B ) Wound width of cyclin D1 siRNA-transfected cells was significantly decreased compared to that of control ( t = −3.125, P = 0.004); ( C and D ) Knockdown of cyclin D1 resulted in significantly decreased expression of vimentin protein in spheroid-differentiated cells ( t = 3.748, P = 0.002). N-cadherin expression was not significantly different (Z = −1.083, P = 0.279). Abbreviation: NT-siRNA, nontargeting small interfering RNA.
    Figure Legend Snippet: Cell migration and n-cadherin, vimentin expression induced by cyclin D1 silence. Notes: ( A and B ) Wound width of cyclin D1 siRNA-transfected cells was significantly decreased compared to that of control ( t = −3.125, P = 0.004); ( C and D ) Knockdown of cyclin D1 resulted in significantly decreased expression of vimentin protein in spheroid-differentiated cells ( t = 3.748, P = 0.002). N-cadherin expression was not significantly different (Z = −1.083, P = 0.279). Abbreviation: NT-siRNA, nontargeting small interfering RNA.

    Techniques Used: Migration, Expressing, Transfection, Small Interfering RNA

    56) Product Images from "Cyclin D1 affects epithelial-mesenchymal transition in epithelial ovarian cancer stem cell-like cells"

    Article Title: Cyclin D1 affects epithelial-mesenchymal transition in epithelial ovarian cancer stem cell-like cells

    Journal: OncoTargets and therapy

    doi: 10.2147/OTT.S44177

    Cell viability, apoptosis induced by cyclin D1 silence. Notes: ( A ) At 0, 24, and 48 hours, cell viability was not significantly different between cyclin D1-siRNA and NT siRNA transfected cells, but a marked decrease of cell viability was observed at 72 hours post-transfection (Z = −2.241, P = 0.025). ( B and C ) At 30 hours after siRNA transfection, viable apoptosis was significantly increased in cyclin D1 siRNA-transfected cells compared with NT siRNA group (Z = −2.650, P = 0.008). Abbreviation: NT-siRNA, nontargeting small interfering RNA.
    Figure Legend Snippet: Cell viability, apoptosis induced by cyclin D1 silence. Notes: ( A ) At 0, 24, and 48 hours, cell viability was not significantly different between cyclin D1-siRNA and NT siRNA transfected cells, but a marked decrease of cell viability was observed at 72 hours post-transfection (Z = −2.241, P = 0.025). ( B and C ) At 30 hours after siRNA transfection, viable apoptosis was significantly increased in cyclin D1 siRNA-transfected cells compared with NT siRNA group (Z = −2.650, P = 0.008). Abbreviation: NT-siRNA, nontargeting small interfering RNA.

    Techniques Used: Transfection, Small Interfering RNA

    The expression pattern of cyclin D1, N-cadherin, vimentin in parental cells and spheroids, and transfection efficacy of cyclin D1 siRNA. Notes: ( A and B ) The average value of cyclin D1 was higher in spheroids than that in parental cells with a significant difference ( t = −3.351, P = 0.007). The value of N-cadherin was not statistically different between spheroids and parental cells ( t = −1.322, P = 0.221). The average value of vimentin was also higher in spheroids than that in parental cells, with a significant difference ( t = −2.471, P = 0.033). ( C ) Cyclin D1 mRNA was downregulated nearly 59% after siRNA transfection. ( D ) Cyclin D1 protein was down-regulated nearly 51% after siRNA transfection. Abbreviations: P1, parental cell sample 1; P2, parental cell sample 2; P1, spheroids sample 1; S2, spheroids sample 2; NT-siRNA, nontargeting small interfering RNA.
    Figure Legend Snippet: The expression pattern of cyclin D1, N-cadherin, vimentin in parental cells and spheroids, and transfection efficacy of cyclin D1 siRNA. Notes: ( A and B ) The average value of cyclin D1 was higher in spheroids than that in parental cells with a significant difference ( t = −3.351, P = 0.007). The value of N-cadherin was not statistically different between spheroids and parental cells ( t = −1.322, P = 0.221). The average value of vimentin was also higher in spheroids than that in parental cells, with a significant difference ( t = −2.471, P = 0.033). ( C ) Cyclin D1 mRNA was downregulated nearly 59% after siRNA transfection. ( D ) Cyclin D1 protein was down-regulated nearly 51% after siRNA transfection. Abbreviations: P1, parental cell sample 1; P2, parental cell sample 2; P1, spheroids sample 1; S2, spheroids sample 2; NT-siRNA, nontargeting small interfering RNA.

    Techniques Used: Expressing, Transfection, Small Interfering RNA

    Cell migration and n-cadherin, vimentin expression induced by cyclin D1 silence. Notes: ( A and B ) Wound width of cyclin D1 siRNA-transfected cells was significantly decreased compared to that of control ( t = −3.125, P = 0.004); ( C and D ) Knockdown of cyclin D1 resulted in significantly decreased expression of vimentin protein in spheroid-differentiated cells ( t = 3.748, P = 0.002). N-cadherin expression was not significantly different (Z = −1.083, P = 0.279). Abbreviation: NT-siRNA, nontargeting small interfering RNA.
    Figure Legend Snippet: Cell migration and n-cadherin, vimentin expression induced by cyclin D1 silence. Notes: ( A and B ) Wound width of cyclin D1 siRNA-transfected cells was significantly decreased compared to that of control ( t = −3.125, P = 0.004); ( C and D ) Knockdown of cyclin D1 resulted in significantly decreased expression of vimentin protein in spheroid-differentiated cells ( t = 3.748, P = 0.002). N-cadherin expression was not significantly different (Z = −1.083, P = 0.279). Abbreviation: NT-siRNA, nontargeting small interfering RNA.

    Techniques Used: Migration, Expressing, Transfection, Small Interfering RNA

    57) Product Images from "Type III secretion system expression in oxygen-limited Pseudomonas aeruginosa cultures is stimulated by isocitrate lyase activity"

    Article Title: Type III secretion system expression in oxygen-limited Pseudomonas aeruginosa cultures is stimulated by isocitrate lyase activity

    Journal: Open Biology

    doi: 10.1098/rsob.120131

    Biofilm formation in TCA and glyoxylate cycle mutants under anaerobic conditions. Anaerobic biofilm formation in ( a ) PAO1 and the indicated TCA and glyoxylate cycle mutants, and ( b ) PAO1 and an aceA mutant carrying a plasmid-encoded aceA gene (pJC10) or the empty plasmid (pUCP20). * p
    Figure Legend Snippet: Biofilm formation in TCA and glyoxylate cycle mutants under anaerobic conditions. Anaerobic biofilm formation in ( a ) PAO1 and the indicated TCA and glyoxylate cycle mutants, and ( b ) PAO1 and an aceA mutant carrying a plasmid-encoded aceA gene (pJC10) or the empty plasmid (pUCP20). * p

    Techniques Used: Mutagenesis, Plasmid Preparation

    58) Product Images from "Adoptive Transfer With In Vitro Expanded Human Regulatory T Cells Protects Against Porcine Islet Xenograft Rejection via Interleukin-10 in Humanized Mice"

    Article Title: Adoptive Transfer With In Vitro Expanded Human Regulatory T Cells Protects Against Porcine Islet Xenograft Rejection via Interleukin-10 in Humanized Mice

    Journal: Diabetes

    doi: 10.2337/db11-1306

    Ex vivo expanded human CD4 + CD25 + CD127 lo cells retain Treg-suppressive characteristics. A: Representative FACS analysis of Treg phenotype. Gates were set on CD4 + and CD4 + CD25 + cells, respectively. FoxP3 and other marker expression was shown as the percentage of CD4 + CD25 + cells coexpressing individual Treg markers examined. Data represent one of four independent experiments with Treg from four individual donors. B: In vitro suppression assay of unexpanded and expanded human Treg. CFSE-labeled CD25 + cell-depleted human PBMC were stimulated with irradiated xenogeneic pig PBMC in the presence or absence of serial dilutions of unexpanded and expanded autologous Treg for 5 days prior to measurement of xenoreactive PBMC proliferation by CFSE dilution. Data are presented as mean ± SD of three independent experiments.
    Figure Legend Snippet: Ex vivo expanded human CD4 + CD25 + CD127 lo cells retain Treg-suppressive characteristics. A: Representative FACS analysis of Treg phenotype. Gates were set on CD4 + and CD4 + CD25 + cells, respectively. FoxP3 and other marker expression was shown as the percentage of CD4 + CD25 + cells coexpressing individual Treg markers examined. Data represent one of four independent experiments with Treg from four individual donors. B: In vitro suppression assay of unexpanded and expanded human Treg. CFSE-labeled CD25 + cell-depleted human PBMC were stimulated with irradiated xenogeneic pig PBMC in the presence or absence of serial dilutions of unexpanded and expanded autologous Treg for 5 days prior to measurement of xenoreactive PBMC proliferation by CFSE dilution. Data are presented as mean ± SD of three independent experiments.

    Techniques Used: Ex Vivo, FACS, Marker, Expressing, In Vitro, Suppression Assay, Labeling, Irradiation

    59) Product Images from "PPE38 of Mycobacterium marinum Triggers the Cross-Talk of Multiple Pathways Involved in the Host Response, As Revealed by Subcellular Quantitative Proteomics"

    Article Title: PPE38 of Mycobacterium marinum Triggers the Cross-Talk of Multiple Pathways Involved in the Host Response, As Revealed by Subcellular Quantitative Proteomics

    Journal: Journal of Proteome Research

    doi: 10.1021/pr301017e

    PPE38 induced IL-6 production by TLR2. IL-6 production in PMA-differentiated THP-1 macrophages was stimulated with WT and 05B1 (MOI = 10) in the presence of anti-TLR2 or isotype (IgG2a,κ) control Ab (10 μg/mL). Results are mean ± SD of three different experiments.
    Figure Legend Snippet: PPE38 induced IL-6 production by TLR2. IL-6 production in PMA-differentiated THP-1 macrophages was stimulated with WT and 05B1 (MOI = 10) in the presence of anti-TLR2 or isotype (IgG2a,κ) control Ab (10 μg/mL). Results are mean ± SD of three different experiments.

    Techniques Used:

    60) Product Images from "The lysine demethylase, KDM4B, is a key molecule in androgen receptor signalling and turnover"

    Article Title: The lysine demethylase, KDM4B, is a key molecule in androgen receptor signalling and turnover

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkt106

    KDM4B is a putative AR activity regulator. ( A ) LNCaP cells grown in SDM were transiently transfected with a pool of three independent siRNA sequences targeting KDM4B in SDM for 24 h before DHT (100 nM) stimulation for a further 72 h. Non-silencing (N/S), AR and PSA siRNAs were also included as controls. PSA ELISA (R D systems DuoSet) and ( B ) QRT-PCR was performed to detect PSA mRNA levels. ( C ) LNCaP cells grown in SDM were transiently transfected with individual siRNA oligos targeting KDM4B in SDM 24 h before DHT (100 nM) stimulation followed by RNA extraction and QRT-PCR for PSA mRNA expression (* P
    Figure Legend Snippet: KDM4B is a putative AR activity regulator. ( A ) LNCaP cells grown in SDM were transiently transfected with a pool of three independent siRNA sequences targeting KDM4B in SDM for 24 h before DHT (100 nM) stimulation for a further 72 h. Non-silencing (N/S), AR and PSA siRNAs were also included as controls. PSA ELISA (R D systems DuoSet) and ( B ) QRT-PCR was performed to detect PSA mRNA levels. ( C ) LNCaP cells grown in SDM were transiently transfected with individual siRNA oligos targeting KDM4B in SDM 24 h before DHT (100 nM) stimulation followed by RNA extraction and QRT-PCR for PSA mRNA expression (* P

    Techniques Used: Activity Assay, Transfection, Enzyme-linked Immunosorbent Assay, Quantitative RT-PCR, RNA Extraction, Expressing

    61) Product Images from "Combining RNA interference and kinase inhibitors against cell signalling components involved in cancer"

    Article Title: Combining RNA interference and kinase inhibitors against cell signalling components involved in cancer

    Journal: BMC Cancer

    doi: 10.1186/1471-2407-5-125

    Kinase inhibitors block activation at multiple points in EGFR/AP-1 pathway . Inhibitors decrease the response of the AP-1- bla ME180 CellSensor when stimulated with EGF. β-lactamase was measured using Invitrogen's LiveBLAzer™ assay (Panel A). Percent inhibition is determined in comparison to untreated sample and represents the mean of (± SEM) eight independent data points (n = 8). Photomicrographs of cells were obtained under fluorescent microscopy (Panel B).
    Figure Legend Snippet: Kinase inhibitors block activation at multiple points in EGFR/AP-1 pathway . Inhibitors decrease the response of the AP-1- bla ME180 CellSensor when stimulated with EGF. β-lactamase was measured using Invitrogen's LiveBLAzer™ assay (Panel A). Percent inhibition is determined in comparison to untreated sample and represents the mean of (± SEM) eight independent data points (n = 8). Photomicrographs of cells were obtained under fluorescent microscopy (Panel B).

    Techniques Used: Blocking Assay, Activation Assay, Inhibition, Microscopy

    Knockdown by RNAi qualifies EGFR involvement in ME180 AP-1 CellSensor pathway . AP-1- bla ME180 cells transfected with RNAi targeting EGFR were analyzed by RT-qPCR (Panel A). EGFR mRNA expression is knocked down ~80% as compared to a non-specific control (Med GC). Results are represented as a ratio using cyclophilin as a control. Cells RNAi treated with oligos specific for EGFR show a reduced level of EGFR protein on the cell surface including a loss of autophosphorylation (Panels B and C). RFU represent measurement of the Alexa fluor 488 and 594 labelled secondary antibodies used for detection of the phospho and pan EGFR antibodies and represent the mean of (± SEM) eight independent data points (n = 8). RNAi treated AP-1- bla ME180 cells also exhibit a knockdown of AP-1 activation when EGF stimulated and analyzed at different timepoints (Panel D). Normalized response represents the amount of AP-1 gene activation present when compared with a non-specific control (Med GC), and represent the mean of (± SEM) eight independent data points (n = 8).
    Figure Legend Snippet: Knockdown by RNAi qualifies EGFR involvement in ME180 AP-1 CellSensor pathway . AP-1- bla ME180 cells transfected with RNAi targeting EGFR were analyzed by RT-qPCR (Panel A). EGFR mRNA expression is knocked down ~80% as compared to a non-specific control (Med GC). Results are represented as a ratio using cyclophilin as a control. Cells RNAi treated with oligos specific for EGFR show a reduced level of EGFR protein on the cell surface including a loss of autophosphorylation (Panels B and C). RFU represent measurement of the Alexa fluor 488 and 594 labelled secondary antibodies used for detection of the phospho and pan EGFR antibodies and represent the mean of (± SEM) eight independent data points (n = 8). RNAi treated AP-1- bla ME180 cells also exhibit a knockdown of AP-1 activation when EGF stimulated and analyzed at different timepoints (Panel D). Normalized response represents the amount of AP-1 gene activation present when compared with a non-specific control (Med GC), and represent the mean of (± SEM) eight independent data points (n = 8).

    Techniques Used: Transfection, Quantitative RT-PCR, Expressing, Activation Assay

    EGF mediated activation in ME180AP-1 CellSensor . EGF effectively stimulated the EGFR/AP-1 pathway in ME180 cervical cancer cells. Cells expressing β-lactamase were detected using a fluorescent plate reader (Panel A) or under fluorescent microscopy (Panel B). β-lactamase was measured using Invitrogen's LiveBLAzer™ FRET B/G assay. Ratios represent the mean of (± SEM) eight independent data points (n = 8).
    Figure Legend Snippet: EGF mediated activation in ME180AP-1 CellSensor . EGF effectively stimulated the EGFR/AP-1 pathway in ME180 cervical cancer cells. Cells expressing β-lactamase were detected using a fluorescent plate reader (Panel A) or under fluorescent microscopy (Panel B). β-lactamase was measured using Invitrogen's LiveBLAzer™ FRET B/G assay. Ratios represent the mean of (± SEM) eight independent data points (n = 8).

    Techniques Used: Activation Assay, Expressing, Microscopy

    62) Product Images from "Adherens junction protein nectin-4 (PVRL4) is the epithelial receptor for measles virus"

    Article Title: Adherens junction protein nectin-4 (PVRL4) is the epithelial receptor for measles virus

    Journal: Nature

    doi: 10.1038/nature10639

    V domain of nectin-4 supports strong binding to MV H a and b, MV infection competition assays in H358 cells. For (a), N4VCC-Fc (grey bars) with all three immunoglobulin domains, and N4V-Fc (black bars) with only the V domain were used. As control soluble immunoglobulin superfamily protein CTLA4-Fc (cytotoxic T lymphocyte antigen 4, also named CD152) was used (white bars). For (b), antibodies N4.40, recognizing one of the C domains, or N4.61 recognizing the V domain, were used. All assays were done in triplicate (n=3); mean and standard deviation of the number of observed syncytia per well are indicated on the vertical axis. Concentration of the undiluted protein solution is indicated on the horizontal axis. For dimeric N4VCC-Fc 10 μg/ml are 71 nM; no, no protein added. c and d, non-reducing gel electrophoresis analysis of binding of soluble H and purified virus particles to different soluble receptors. Molecular weight markers are indicated. N4VCC-Fc and N4V-Fc are dimeric proteins of 140 kDa and 90 kDa respectively 8 . The 260 kDa observed for N4VCC-Fc probably corresponds to association of two dimers through C domain dependent homophilic interactions. For (d), CTLA4-Fc loaded at the same concentration did not cross-react with soluble H (right top panel), but was detected by protein A-HRP with the same efficiency (right bottom panel). e, surface plasmon resonance analyses of H binding to SLAM. Multiple cycles of association and dissociation were performed using receptor concentrations ranging from 50 to 800 nM (color coding on top). Horizonal axis: time in seconds; vertical axis, absorbance units. f, surface plasmon resonance analyses of H binding to nectin-4.
    Figure Legend Snippet: V domain of nectin-4 supports strong binding to MV H a and b, MV infection competition assays in H358 cells. For (a), N4VCC-Fc (grey bars) with all three immunoglobulin domains, and N4V-Fc (black bars) with only the V domain were used. As control soluble immunoglobulin superfamily protein CTLA4-Fc (cytotoxic T lymphocyte antigen 4, also named CD152) was used (white bars). For (b), antibodies N4.40, recognizing one of the C domains, or N4.61 recognizing the V domain, were used. All assays were done in triplicate (n=3); mean and standard deviation of the number of observed syncytia per well are indicated on the vertical axis. Concentration of the undiluted protein solution is indicated on the horizontal axis. For dimeric N4VCC-Fc 10 μg/ml are 71 nM; no, no protein added. c and d, non-reducing gel electrophoresis analysis of binding of soluble H and purified virus particles to different soluble receptors. Molecular weight markers are indicated. N4VCC-Fc and N4V-Fc are dimeric proteins of 140 kDa and 90 kDa respectively 8 . The 260 kDa observed for N4VCC-Fc probably corresponds to association of two dimers through C domain dependent homophilic interactions. For (d), CTLA4-Fc loaded at the same concentration did not cross-react with soluble H (right top panel), but was detected by protein A-HRP with the same efficiency (right bottom panel). e, surface plasmon resonance analyses of H binding to SLAM. Multiple cycles of association and dissociation were performed using receptor concentrations ranging from 50 to 800 nM (color coding on top). Horizonal axis: time in seconds; vertical axis, absorbance units. f, surface plasmon resonance analyses of H binding to nectin-4.

    Techniques Used: Binding Assay, Infection, Standard Deviation, Concentration Assay, Nucleic Acid Electrophoresis, Purification, Molecular Weight, SPR Assay

    Identification of nectin-4 as candidate MV receptor a, Nectin-4 mediates MV entry. CHO-K1 cells were not transfected (mock), or transfected with the expression plasmids nectin-4 or MST1R. Top row: after transfection cells were infected with a MV expressing GFP. Bottom row: expression of nectin-4 and MST1R (interrupted black lines), as documented by FACS analysis. Dark grey lines: isotype controls; light grey shadings: unstained controls. b, FACS analysis of nectin-4 expression levels in different cells. Cell lines H358, H441 and HT1376, top row, are permissive for MV infection. Cell lines H23, H522, T24, and SCaBER are non-permissive. Antibody LS-C37483 was used. c, siRNA-mediated knock-down of nectin-4 expression in H358 cells (left panels). Control (top row) or nectin-4 specific 4_1 siRNA (bottom row) were transfected. After transfections cells were infected with a MV expressing GFP. FACS analysis (right panels) indicated more than 90% reduction of nectin-4 expression on the cell surface.
    Figure Legend Snippet: Identification of nectin-4 as candidate MV receptor a, Nectin-4 mediates MV entry. CHO-K1 cells were not transfected (mock), or transfected with the expression plasmids nectin-4 or MST1R. Top row: after transfection cells were infected with a MV expressing GFP. Bottom row: expression of nectin-4 and MST1R (interrupted black lines), as documented by FACS analysis. Dark grey lines: isotype controls; light grey shadings: unstained controls. b, FACS analysis of nectin-4 expression levels in different cells. Cell lines H358, H441 and HT1376, top row, are permissive for MV infection. Cell lines H23, H522, T24, and SCaBER are non-permissive. Antibody LS-C37483 was used. c, siRNA-mediated knock-down of nectin-4 expression in H358 cells (left panels). Control (top row) or nectin-4 specific 4_1 siRNA (bottom row) were transfected. After transfections cells were infected with a MV expressing GFP. FACS analysis (right panels) indicated more than 90% reduction of nectin-4 expression on the cell surface.

    Techniques Used: Transfection, Expressing, Infection, FACS

    63) Product Images from "BMP8B Increases Brown Adipose Tissue Thermogenesis through Both Central and Peripheral Actions"

    Article Title: BMP8B Increases Brown Adipose Tissue Thermogenesis through Both Central and Peripheral Actions

    Journal: Cell

    doi: 10.1016/j.cell.2012.02.066

    Regulation of the BMP8B Promoter, Related to Figure 1 (A) Luciferase activity in HEK293 cells driven from 3 kb of the BMP8B promoter following co-transfection with plasmids overexpressing the indicated TR isoforms. n = 3 experiments carried out in triplicate. (B) Schematic diagram of 3 kb of the murine BMP8B promoter indicating location and sequences of the 2 identified candidate PPREs. ∗ p
    Figure Legend Snippet: Regulation of the BMP8B Promoter, Related to Figure 1 (A) Luciferase activity in HEK293 cells driven from 3 kb of the BMP8B promoter following co-transfection with plasmids overexpressing the indicated TR isoforms. n = 3 experiments carried out in triplicate. (B) Schematic diagram of 3 kb of the murine BMP8B promoter indicating location and sequences of the 2 identified candidate PPREs. ∗ p

    Techniques Used: Luciferase, Activity Assay, Cotransfection

    64) Product Images from "Protective Role of Toll-like Receptor 4 in Experimental Gonococcal Infection of Female Mice"

    Article Title: Protective Role of Toll-like Receptor 4 in Experimental Gonococcal Infection of Female Mice

    Journal: Mucosal immunology

    doi: 10.1038/mi.2011.38

    TLR4 mutant mice upregulate inflammatory cytokines and chemokines in response to gonococcal infection Mice were infected as described in the text, and vaginal washes were obtained over time for assay of IL-1β, TNF-α, MIP-2 and KC by custom multiplex assay. Shown above are data pooled from three independent experiments. Each data point represents an individual mouse; n=10–12 for BALB/c, n=11–13 for BALB/c- Lps d . The horizontal line represents the median value for each time point. Statistics were calculated using a Mann-Whitney U-test, with p values as follows: *, p
    Figure Legend Snippet: TLR4 mutant mice upregulate inflammatory cytokines and chemokines in response to gonococcal infection Mice were infected as described in the text, and vaginal washes were obtained over time for assay of IL-1β, TNF-α, MIP-2 and KC by custom multiplex assay. Shown above are data pooled from three independent experiments. Each data point represents an individual mouse; n=10–12 for BALB/c, n=11–13 for BALB/c- Lps d . The horizontal line represents the median value for each time point. Statistics were calculated using a Mann-Whitney U-test, with p values as follows: *, p

    Techniques Used: Mutagenesis, Mouse Assay, Infection, Multiplex Assay, MANN-WHITNEY

    65) Product Images from "Protective Role of Toll-like Receptor 4 in Experimental Gonococcal Infection of Female Mice"

    Article Title: Protective Role of Toll-like Receptor 4 in Experimental Gonococcal Infection of Female Mice

    Journal: Mucosal immunology

    doi: 10.1038/mi.2011.38

    Cells derived from TLR4 mutant mice are hyporesponsive to stimulation with N. gonorrhoeae ( a ) BMDM or ( b ) splenic mononuclear cells were derived from BALB/c and BALB/c- Lps d mice as described in the text, and treated with the indicated agents. Supernatant was collected at 24 hours for ( a ) and at the indicated time points for ( b ), and assayed for TNF-α or IL-6 by ELISA. Pam2Cys, lipopeptide Pam 2 -Cys-Ser-Lys 4 ; GC lys, N. gonorrhoeae FA1090 crude lysates. Significance was calculated using an unpaired t-test, with p values as follows: **, p
    Figure Legend Snippet: Cells derived from TLR4 mutant mice are hyporesponsive to stimulation with N. gonorrhoeae ( a ) BMDM or ( b ) splenic mononuclear cells were derived from BALB/c and BALB/c- Lps d mice as described in the text, and treated with the indicated agents. Supernatant was collected at 24 hours for ( a ) and at the indicated time points for ( b ), and assayed for TNF-α or IL-6 by ELISA. Pam2Cys, lipopeptide Pam 2 -Cys-Ser-Lys 4 ; GC lys, N. gonorrhoeae FA1090 crude lysates. Significance was calculated using an unpaired t-test, with p values as follows: **, p

    Techniques Used: Derivative Assay, Mutagenesis, Mouse Assay, Enzyme-linked Immunosorbent Assay

    66) Product Images from "The shrimp IKK-NF-?B signaling pathway regulates antimicrobial peptide expression and may be subverted by white spot syndrome virus to facilitate viral gene expression"

    Article Title: The shrimp IKK-NF-?B signaling pathway regulates antimicrobial peptide expression and may be subverted by white spot syndrome virus to facilitate viral gene expression

    Journal: Cellular & Molecular Immunology

    doi: 10.1038/cmi.2013.30

    ( a ) The overexpression of LvIKKβ but not LvIKKε activated Drosophila and shrimp AMP gene promoters in Drosophila S2 cells. Drosophila S2 cells were transfected with 0.05 µg of protein expression vector (LvIKKβ, LvIKKε1 or LvIKKε2), 0.05 µg luciferase reporter plasmid (pGL3-Basic, pGL3-PEN453, pGL3-PEN309, pGL3-PEN4, pGL3-Drs, or pGL3-AttA) and 0.005 µg pRL-TK Renilla luciferase plasmid (as an internal control; Promega, USA). ( b ) LvIKKβ and LvIKKε activated NF-κB luciferase reporter in the HEK 293T cells. HEK 293T cells were cotransfected with the pCMV empty vector (70 ng), pCMV-LvIKKε2 (70 ng), pCMV-LvIKKε1 (70 ng) or pCMV-LvIKKβ (70 ng) together with the NF-κB luciferase reporter vector (30 ng) and the internal control Renilla expression vector (3 ng). pCMV empty vector and the pTAL luciferase reporter vector (Clontech, USA) were used as negative controls (blue bars). At 36 h after transfection, the cells were harvested and analyzed using the Dual Luciferase kit (Promega). The bars indicate the mean±s.d. of luciferase activity ( n =3). Statistical significance was calculated by the Student's t -test (not statistical significant # P > 0.05; statistical significant * P
    Figure Legend Snippet: ( a ) The overexpression of LvIKKβ but not LvIKKε activated Drosophila and shrimp AMP gene promoters in Drosophila S2 cells. Drosophila S2 cells were transfected with 0.05 µg of protein expression vector (LvIKKβ, LvIKKε1 or LvIKKε2), 0.05 µg luciferase reporter plasmid (pGL3-Basic, pGL3-PEN453, pGL3-PEN309, pGL3-PEN4, pGL3-Drs, or pGL3-AttA) and 0.005 µg pRL-TK Renilla luciferase plasmid (as an internal control; Promega, USA). ( b ) LvIKKβ and LvIKKε activated NF-κB luciferase reporter in the HEK 293T cells. HEK 293T cells were cotransfected with the pCMV empty vector (70 ng), pCMV-LvIKKε2 (70 ng), pCMV-LvIKKε1 (70 ng) or pCMV-LvIKKβ (70 ng) together with the NF-κB luciferase reporter vector (30 ng) and the internal control Renilla expression vector (3 ng). pCMV empty vector and the pTAL luciferase reporter vector (Clontech, USA) were used as negative controls (blue bars). At 36 h after transfection, the cells were harvested and analyzed using the Dual Luciferase kit (Promega). The bars indicate the mean±s.d. of luciferase activity ( n =3). Statistical significance was calculated by the Student's t -test (not statistical significant # P > 0.05; statistical significant * P

    Techniques Used: Over Expression, Transfection, Expressing, Plasmid Preparation, Luciferase, Activity Assay

    67) Product Images from "Virus-Like Particles Containing the Tetrameric Ectodomain of Influenza Matrix Protein 2 and Flagellin Induce Heterosubtypic Protection in Mice"

    Article Title: Virus-Like Particles Containing the Tetrameric Ectodomain of Influenza Matrix Protein 2 and Flagellin Induce Heterosubtypic Protection in Mice

    Journal: BioMed Research International

    doi: 10.1155/2013/686549

    Cellular immune responses. Cellular immune responses were assessed with cells from spleens and lungs of immunized mice. Cells from spleens ((a), (c)) and lungs ((b), (d)) were stimulated with M2e peptides and M2e VLPs for 40 hours, and cytokine-secreting cell colonies were determined by ELISPOT assay. Each group has 3 mice. The asterisk (∗) indicates a significant difference between G2 and G1, G3 and G1, G4 and G1, and G5 and G1. The “+” indicates a significant difference between G3 and G2, G4 and G2, and G5 and G2.
    Figure Legend Snippet: Cellular immune responses. Cellular immune responses were assessed with cells from spleens and lungs of immunized mice. Cells from spleens ((a), (c)) and lungs ((b), (d)) were stimulated with M2e peptides and M2e VLPs for 40 hours, and cytokine-secreting cell colonies were determined by ELISPOT assay. Each group has 3 mice. The asterisk (∗) indicates a significant difference between G2 and G1, G3 and G1, G4 and G1, and G5 and G1. The “+” indicates a significant difference between G3 and G2, G4 and G2, and G5 and G2.

    Techniques Used: Mouse Assay, Enzyme-linked Immunospot

    68) Product Images from "Modulation of Vascular Cell Function by Bim Expression"

    Article Title: Modulation of Vascular Cell Function by Bim Expression

    Journal: International Journal of Cell Biology

    doi: 10.1155/2013/297537

    Bim −/− endothelial cells and pericytes were more adherent. The adhesion of retinal wild-type (■) and Bim −/− (○) endothelial cells (panel (a)) and pericytes (panel (b)) to fibronectin, vitronectin, collagen type I, or collagen IV was determined as described in Section 5 . Please note that Bim −/− vascular cells had increased adherence. These experiments were repeated twice with similar results.
    Figure Legend Snippet: Bim −/− endothelial cells and pericytes were more adherent. The adhesion of retinal wild-type (■) and Bim −/− (○) endothelial cells (panel (a)) and pericytes (panel (b)) to fibronectin, vitronectin, collagen type I, or collagen IV was determined as described in Section 5 . Please note that Bim −/− vascular cells had increased adherence. These experiments were repeated twice with similar results.

    Techniques Used:

    Wild-type and Bim −/− retinal vascular cells had similar integrin expression. Expression of various integrins was determined in wild-type and Bim −/− endothelial cells (panel (a)) and pericytes (panel (b)) using FACScan analysis as described in Section 5 . The shaded graphs show staining in the presence of control IgG. These experiments were repeated twice with similar results.
    Figure Legend Snippet: Wild-type and Bim −/− retinal vascular cells had similar integrin expression. Expression of various integrins was determined in wild-type and Bim −/− endothelial cells (panel (a)) and pericytes (panel (b)) using FACScan analysis as described in Section 5 . The shaded graphs show staining in the presence of control IgG. These experiments were repeated twice with similar results.

    Techniques Used: Expressing, Staining

    Modulation of proliferation in Bim −/− cells. Wild-type and Bim −/− retinal endothelial cells (panel (a)) and pericytes (panel (b)) were incubated with 10 nM staurosporine for 24 hours. Apoptosis was determined using a Caspase-Glo 3/7 assay. Wild-type and Bim −/− retinal endothelial cells (panel (c)) and pericytes (panel (d)) were monitored for their growth rate over a two-week time frame for wild-type (○) and Bim −/− (□) cells. These experiments were repeated twice with similar results (*** P
    Figure Legend Snippet: Modulation of proliferation in Bim −/− cells. Wild-type and Bim −/− retinal endothelial cells (panel (a)) and pericytes (panel (b)) were incubated with 10 nM staurosporine for 24 hours. Apoptosis was determined using a Caspase-Glo 3/7 assay. Wild-type and Bim −/− retinal endothelial cells (panel (c)) and pericytes (panel (d)) were monitored for their growth rate over a two-week time frame for wild-type (○) and Bim −/− (□) cells. These experiments were repeated twice with similar results (*** P

    Techniques Used: Incubation, Caspase-Glo Assay

    A summary of the modulation of VEGF expression, proliferation, migration, adhesion, and ECM expression in Bim deficient endothelial cells and pericytes.
    Figure Legend Snippet: A summary of the modulation of VEGF expression, proliferation, migration, adhesion, and ECM expression in Bim deficient endothelial cells and pericytes.

    Techniques Used: Expressing, Migration

    Decreased eNOS and increased VEGF expressions in Bim −/− vascular cells. In panels (a) and (b), an immunoassay was used to determine VEGF levels (pg/mL) in retinal endothelial cells (a) and pericytes (b) from wild-type and Bim −/− mice. Protein lysates (20 μ g) from wild-type and Bim −/− retinal endothelial cells were analyzed by Western blot analysis for the expression of phospho-eNOS, eNOS, HSP90, phospho-Akt, and Akt (panel (c)). β -Actin expression was assessed as a loading control (panel (c)). In panel (d), the intracellular NO production was determined as analyzed by DAF-FM fluorescence for retinal endothelial cells. Please note that the increased VEGF expression was independent of eNOS expression in Bim −/− endothelial cells (*** P
    Figure Legend Snippet: Decreased eNOS and increased VEGF expressions in Bim −/− vascular cells. In panels (a) and (b), an immunoassay was used to determine VEGF levels (pg/mL) in retinal endothelial cells (a) and pericytes (b) from wild-type and Bim −/− mice. Protein lysates (20 μ g) from wild-type and Bim −/− retinal endothelial cells were analyzed by Western blot analysis for the expression of phospho-eNOS, eNOS, HSP90, phospho-Akt, and Akt (panel (c)). β -Actin expression was assessed as a loading control (panel (c)). In panel (d), the intracellular NO production was determined as analyzed by DAF-FM fluorescence for retinal endothelial cells. Please note that the increased VEGF expression was independent of eNOS expression in Bim −/− endothelial cells (*** P

    Techniques Used: Mouse Assay, Western Blot, Expressing, Fluorescence

    Bim −/− pericytes diminished capillary morphogenesis of retinal endothelial cells. Wild-type (WT) and Bim −/− retinal endothelial cells (REC) were plated alone or with wild-type or Bim −/− pericytes (PC) in Matrigel and photographed in digital format (panel (a)). The quantitative assessment of the data is shown in panels (b) and (c). In panel (d), wild-type retinal endothelial cells were plated alone or with Bim −/− pericytes in the presence or absence of sFlt1 or IgG control (10 μ g/mL) and photographed. Panel (e) is the quantitative assessment of the data in panel (d). The data are the mean number of branch points per field (×40) ± SD. These experiments were repeated at least twice with similar results (*** P
    Figure Legend Snippet: Bim −/− pericytes diminished capillary morphogenesis of retinal endothelial cells. Wild-type (WT) and Bim −/− retinal endothelial cells (REC) were plated alone or with wild-type or Bim −/− pericytes (PC) in Matrigel and photographed in digital format (panel (a)). The quantitative assessment of the data is shown in panels (b) and (c). In panel (d), wild-type retinal endothelial cells were plated alone or with Bim −/− pericytes in the presence or absence of sFlt1 or IgG control (10 μ g/mL) and photographed. Panel (e) is the quantitative assessment of the data in panel (d). The data are the mean number of branch points per field (×40) ± SD. These experiments were repeated at least twice with similar results (*** P

    Techniques Used:

    Bim −/− retinal endothelial cells and pericytes demonstrate increased migration. Cell migration was determined by the scratch wounding of retinal endothelial cells (panel (a)) or pericytes (panel (b)) monolayers, and wound closure was monitored using a phase microscope in digital format at low magnification (×40). A representative experiment is shown here. Please note that wild-type vascular cells migrate slower than Bim −/− cells. The quantitative assessment of the data is shown in panels (c) and (d). Transwell assays were performed with wild-type and Bim −/− retinal endothelial cells (panel (e)) and pericytes (panel (f)). These experiments were repeated twice with similar results (*** P
    Figure Legend Snippet: Bim −/− retinal endothelial cells and pericytes demonstrate increased migration. Cell migration was determined by the scratch wounding of retinal endothelial cells (panel (a)) or pericytes (panel (b)) monolayers, and wound closure was monitored using a phase microscope in digital format at low magnification (×40). A representative experiment is shown here. Please note that wild-type vascular cells migrate slower than Bim −/− cells. The quantitative assessment of the data is shown in panels (c) and (d). Transwell assays were performed with wild-type and Bim −/− retinal endothelial cells (panel (e)) and pericytes (panel (f)). These experiments were repeated twice with similar results (*** P

    Techniques Used: Migration, Microscopy

    Wild-type and Bim −/− cells morphology. Wild-type and Bim −/− retinal endothelial cells (panel (a)) and pericytes (panel (b)) were cultured on gelatin or uncoated plates, respectively. Cells were photographed using a phase microscope in digital format at low magnification (×40). In panel (c), retinal endothelial cells prepared from wild-type and Bim −/− mice were examined for the expression of PECAM-1 and VE-cadherin FACScan analysis. In panel (d), retinal pericytes from wild-type and Bim −/− mice were examined for the expression of NG2 and PDGFR- β by FACScan analysis. The shaded areas show staining in the presence of control IgG.
    Figure Legend Snippet: Wild-type and Bim −/− cells morphology. Wild-type and Bim −/− retinal endothelial cells (panel (a)) and pericytes (panel (b)) were cultured on gelatin or uncoated plates, respectively. Cells were photographed using a phase microscope in digital format at low magnification (×40). In panel (c), retinal endothelial cells prepared from wild-type and Bim −/− mice were examined for the expression of PECAM-1 and VE-cadherin FACScan analysis. In panel (d), retinal pericytes from wild-type and Bim −/− mice were examined for the expression of NG2 and PDGFR- β by FACScan analysis. The shaded areas show staining in the presence of control IgG.

    Techniques Used: Cell Culture, Microscopy, Mouse Assay, Expressing, Staining

    Altered expression of ECM proteins in Bim −/− retinal cells. Wild-type and Bim −/− retinal endothelial cells (panel (a)) and pericytes (panel (b)) were grown for 2 days in serum-free medium. The medium was harvested, clarified, and Western-blotted for extracellular matrix proteins as noted. The expression of β -actin from total cell lysates was used as a loading control. These experiments were repeated twice with similar results.
    Figure Legend Snippet: Altered expression of ECM proteins in Bim −/− retinal cells. Wild-type and Bim −/− retinal endothelial cells (panel (a)) and pericytes (panel (b)) were grown for 2 days in serum-free medium. The medium was harvested, clarified, and Western-blotted for extracellular matrix proteins as noted. The expression of β -actin from total cell lysates was used as a loading control. These experiments were repeated twice with similar results.

    Techniques Used: Expressing, Western Blot

    69) Product Images from "Systematic Exploration of Natural and Synthetic Flavonoids for the Inhibition of Staphylococcus aureus Biofilms"

    Article Title: Systematic Exploration of Natural and Synthetic Flavonoids for the Inhibition of Staphylococcus aureus Biofilms

    Journal: International Journal of Molecular Sciences

    doi: 10.3390/ijms141019434

    Anti-biofilm effects of the flavonoids collection when added prior-to ( a ) or post-biofilm formation ( b ). Strains 1 and 2 are S. aureus ATCC 25923 and Newman clinical strains, respectively. Highly active flavonoids are those present in both shadowed areas. Primary screening results are presented in Table S1.
    Figure Legend Snippet: Anti-biofilm effects of the flavonoids collection when added prior-to ( a ) or post-biofilm formation ( b ). Strains 1 and 2 are S. aureus ATCC 25923 and Newman clinical strains, respectively. Highly active flavonoids are those present in both shadowed areas. Primary screening results are presented in Table S1.

    Techniques Used:

    Summary of the anti-biofilm screening and selection criteria applied to the collection in this study. Highly and moderately active flavonoids are listed in Tables S2 and S3, respectively.
    Figure Legend Snippet: Summary of the anti-biofilm screening and selection criteria applied to the collection in this study. Highly and moderately active flavonoids are listed in Tables S2 and S3, respectively.

    Techniques Used: Selection

    The four most active anti-biofilm flavonoids identified in this contribution.
    Figure Legend Snippet: The four most active anti-biofilm flavonoids identified in this contribution.

    Techniques Used:

    Key structural features present in the anti-biofilm chalcones and flavones (moderately and highly active ones).
    Figure Legend Snippet: Key structural features present in the anti-biofilm chalcones and flavones (moderately and highly active ones).

    Techniques Used:

    70) Product Images from "The Orally Available, Synthetic Ether Lipid Edelfosine Inhibits T Cell Proliferation and Induces a Type I Interferon Response"

    Article Title: The Orally Available, Synthetic Ether Lipid Edelfosine Inhibits T Cell Proliferation and Induces a Type I Interferon Response

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0091970

    Human T cell proliferation was affected by edelfosine. (A) Reduced PBMC proliferation upon addition of edelfosine on cell seeding was independent of the addition of PHA. Notably, PHA-activated cells appeared to be susceptible to edelfosine at 10-fold lower concentrations. (B) The inhibitory effect of edelfosine was observed if the drug was added to already activated, proliferating T cells, i.e. two days after cell seeding and PHA addition. Here, a significant reduction of proliferation in unstimulated cells was only detectable with 33.3 µg/ml edelfosine. (C) Preincubation of PBMCs with at least 3.3 µg/ml edelfosine interfered with the cells' capacity to proliferate upon PHA stimulation. No effect was detected in preconditioned, but unstimulated cells (experiments A, B, C: sample size n = 3 donors, each approach was seeded in triplicates and means for each donor are represented by symbols •, ▪, ▴). (D) 1 µg/ml edelfosine or higher concentrations profoundly diminished proliferation in MBP (83–99) -specific TCLs. One representative TCL of two is shown. Cells were incubated in quadruplicates. • stimulated, ▪ unstimulated (E) PBMCs of one donor were cultured without addition of a stimulus. Proliferation was detectable after seven days. The presence of anti-HLA-DR- and anti-MHC class I-blocking antibodies or 3.3 µg/ml edelfosine inhibited cellular proliferation (• untreated, ▪ blocking antibodies added, ▴ 3.3 µg/ml edelfosine-treated). Bars represent mean values ± SEM, *P
    Figure Legend Snippet: Human T cell proliferation was affected by edelfosine. (A) Reduced PBMC proliferation upon addition of edelfosine on cell seeding was independent of the addition of PHA. Notably, PHA-activated cells appeared to be susceptible to edelfosine at 10-fold lower concentrations. (B) The inhibitory effect of edelfosine was observed if the drug was added to already activated, proliferating T cells, i.e. two days after cell seeding and PHA addition. Here, a significant reduction of proliferation in unstimulated cells was only detectable with 33.3 µg/ml edelfosine. (C) Preincubation of PBMCs with at least 3.3 µg/ml edelfosine interfered with the cells' capacity to proliferate upon PHA stimulation. No effect was detected in preconditioned, but unstimulated cells (experiments A, B, C: sample size n = 3 donors, each approach was seeded in triplicates and means for each donor are represented by symbols •, ▪, ▴). (D) 1 µg/ml edelfosine or higher concentrations profoundly diminished proliferation in MBP (83–99) -specific TCLs. One representative TCL of two is shown. Cells were incubated in quadruplicates. • stimulated, ▪ unstimulated (E) PBMCs of one donor were cultured without addition of a stimulus. Proliferation was detectable after seven days. The presence of anti-HLA-DR- and anti-MHC class I-blocking antibodies or 3.3 µg/ml edelfosine inhibited cellular proliferation (• untreated, ▪ blocking antibodies added, ▴ 3.3 µg/ml edelfosine-treated). Bars represent mean values ± SEM, *P

    Techniques Used: Incubation, Cell Culture, Blocking Assay

    71) Product Images from "Competitive HIF Prolyl Hydroxylase Inhibitors Show Protection against Oxidative Stress by a Mechanism Partially Dependent on Glycolysis"

    Article Title: Competitive HIF Prolyl Hydroxylase Inhibitors Show Protection against Oxidative Stress by a Mechanism Partially Dependent on Glycolysis

    Journal: ISRN Neuroscience

    doi: 10.1155/2013/598587

    FG41, DFO, CpdA, and JNJ induce HIF-1 α upregulation and nuclear translocation in SH-SY5Y cells. (a) Immunocytochemical detection of HIF-1 α in SH-SY5Y cells after 3 hours of treatment with FG41 or CpdA (both at 25 μ M). The top panel shows HIF-1 α immunoreactivity alone and the lower panel shows HIF-1 α merged with Hoechst. Purple nuclei in the merged image indicate nuclear localization of HIF-1 α . (b) Cellomics ArrayScan quantification of the total nuclear level of HIF-1 α induced after 3 or 24 hours of FG41 or DFO treatment (both at 25 μ M). The levels are represented as percentage of control (untreated). (c) Cellomics ArrayScan quantification of the ratio of nuclear to cytosolic located HIF-1 α (percentage of untreated control) after FG41 or DFO treatment as in (b). (d) Nuclear HIF-1 α after treatment with CpdA or JNJ (both 25 μ M). (e) Nuclear/cytosolic ratio of HIF-1 α after treatment with CpdA or JNJ as in (e). Asterisks indicate levels significantly different from control in a t -test.
    Figure Legend Snippet: FG41, DFO, CpdA, and JNJ induce HIF-1 α upregulation and nuclear translocation in SH-SY5Y cells. (a) Immunocytochemical detection of HIF-1 α in SH-SY5Y cells after 3 hours of treatment with FG41 or CpdA (both at 25 μ M). The top panel shows HIF-1 α immunoreactivity alone and the lower panel shows HIF-1 α merged with Hoechst. Purple nuclei in the merged image indicate nuclear localization of HIF-1 α . (b) Cellomics ArrayScan quantification of the total nuclear level of HIF-1 α induced after 3 or 24 hours of FG41 or DFO treatment (both at 25 μ M). The levels are represented as percentage of control (untreated). (c) Cellomics ArrayScan quantification of the ratio of nuclear to cytosolic located HIF-1 α (percentage of untreated control) after FG41 or DFO treatment as in (b). (d) Nuclear HIF-1 α after treatment with CpdA or JNJ (both 25 μ M). (e) Nuclear/cytosolic ratio of HIF-1 α after treatment with CpdA or JNJ as in (e). Asterisks indicate levels significantly different from control in a t -test.

    Techniques Used: Translocation Assay

    HIF-1 α stabilization and nuclear translocation in differentiated SHSH-5Y cells. The cells were treated with 10 or 25 μ M FG41 for 3 hours, then fixed, and Hoechst-stained. The upper panel shows HIF-1 α immunoreactivity alone and the lower panel shows the images merged with the Hoechst-staining.
    Figure Legend Snippet: HIF-1 α stabilization and nuclear translocation in differentiated SHSH-5Y cells. The cells were treated with 10 or 25 μ M FG41 for 3 hours, then fixed, and Hoechst-stained. The upper panel shows HIF-1 α immunoreactivity alone and the lower panel shows the images merged with the Hoechst-staining.

    Techniques Used: Translocation Assay, Staining

    Cellomics images showing the algorithm used for quantification of nuclear and cytoplasmic levels of HIF-1 α . Raw images without the applied algorithm used to define cells are shown in the top panel and images showing the algorithm are shown in the lower panel. Circ is defined by the outline of the Hoechst-staining and thus represents the nuclear region. Ring is defined as a certain radius surrounding the Circ region and thus represents the cytoplasmic region of the cell. The Hoechst fluorescence and the HIF-1 α fluorescence are recorded in two different channels.
    Figure Legend Snippet: Cellomics images showing the algorithm used for quantification of nuclear and cytoplasmic levels of HIF-1 α . Raw images without the applied algorithm used to define cells are shown in the top panel and images showing the algorithm are shown in the lower panel. Circ is defined by the outline of the Hoechst-staining and thus represents the nuclear region. Ring is defined as a certain radius surrounding the Circ region and thus represents the cytoplasmic region of the cell. The Hoechst fluorescence and the HIF-1 α fluorescence are recorded in two different channels.

    Techniques Used: Staining, Fluorescence

    FG41 induces stabilization and nuclear translocation of HIF-1 α and dopamine release in PC12 cells. (a) Immunocytochemical detection of HIF-1 α in PC12 cells after 3 hours treatment with FG41 (25 and 50 μ M). (b) Cellomics ArrayScan quantification of the nuclear to cytoplasmatic ratio of HIF-1 α after 6 or 24 hours of treatment with FG41 or Cpd (both used at 25 μ M). (d) DA release from PC12-cells induced by 6 or 24 hours of treatment with FG41 or CpdA (25 μ M).
    Figure Legend Snippet: FG41 induces stabilization and nuclear translocation of HIF-1 α and dopamine release in PC12 cells. (a) Immunocytochemical detection of HIF-1 α in PC12 cells after 3 hours treatment with FG41 (25 and 50 μ M). (b) Cellomics ArrayScan quantification of the nuclear to cytoplasmatic ratio of HIF-1 α after 6 or 24 hours of treatment with FG41 or Cpd (both used at 25 μ M). (d) DA release from PC12-cells induced by 6 or 24 hours of treatment with FG41 or CpdA (25 μ M).

    Techniques Used: Translocation Assay

    72) Product Images from "Accurate sequential detection of primary tumor and metastatic lymphatics using a temperature-induced phase transition nanoparticulate system"

    Article Title: Accurate sequential detection of primary tumor and metastatic lymphatics using a temperature-induced phase transition nanoparticulate system

    Journal: International Journal of Nanomedicine

    doi: 10.2147/IJN.S63720

    Characteristics of DTX/FPR-675 Pluronic NPs. Notes: ( A ) Size changes and ( B ) zeta potential of DTX/FPR-675 Pluronic NPs prepared with different soybean oil/Tween 80 weight ratios. ( C ) Size distribution and morphology and ( D ) in vitro release behavior of DTX/FPR-675 Pluronic NPs. Data are presented as the mean ± standard deviation (n=4). Abbreviations: DTX, docetaxel; NPs, nanoparticles; FPR-675, Flamma™ fluorescence molecular imaging dye; w, weight.
    Figure Legend Snippet: Characteristics of DTX/FPR-675 Pluronic NPs. Notes: ( A ) Size changes and ( B ) zeta potential of DTX/FPR-675 Pluronic NPs prepared with different soybean oil/Tween 80 weight ratios. ( C ) Size distribution and morphology and ( D ) in vitro release behavior of DTX/FPR-675 Pluronic NPs. Data are presented as the mean ± standard deviation (n=4). Abbreviations: DTX, docetaxel; NPs, nanoparticles; FPR-675, Flamma™ fluorescence molecular imaging dye; w, weight.

    Techniques Used: In Vitro, Standard Deviation, Fluorescence, Imaging

    Schematic and expected behavior of DTX/FPR-675 Pluronic NPs. Notes: ( A ) Schematic of DTX/FPR-675 Pluronic NPs according to temperature-induced phase transition and ( B ) expected behavior of NPs in blood vessels and lymphatic vessels. Abbreviations: DTX, docetaxel; NPs, nanoparticles; FPR-675, Flamma™ fluorescence molecular imaging dye; NIR, near-infrared; PEO-PPO-PEO, poly(ethylene oxide)-poly (propylene oxide)-poly(ethylene oxide).
    Figure Legend Snippet: Schematic and expected behavior of DTX/FPR-675 Pluronic NPs. Notes: ( A ) Schematic of DTX/FPR-675 Pluronic NPs according to temperature-induced phase transition and ( B ) expected behavior of NPs in blood vessels and lymphatic vessels. Abbreviations: DTX, docetaxel; NPs, nanoparticles; FPR-675, Flamma™ fluorescence molecular imaging dye; NIR, near-infrared; PEO-PPO-PEO, poly(ethylene oxide)-poly (propylene oxide)-poly(ethylene oxide).

    Techniques Used: Sublimation, Fluorescence, Imaging

    In vivo real-time and excised lymph node near-infrared fluorescence imaging of tumor-bearing mice injected with DTX/FPR-675 Pluronic NPs for lymph node imaging. Notes: In vivo whole body near-infrared fluorescence images of mice (n=4) 60 minutes post-injection of ( A ) free FPR-675 (upper) and DTX/FPR-675 Pluronic NPs (lower). Comparison of near-infrared fluorescence intensity in ( B ) an excised superficial cervical (right) and a brachial (left) node and ( C ) near-infrared fluorescence images using DTX/FPR-675 Pluronic NPs. ( D ) Representative ex vivo fluorescence images of dissected lymph nodes (superficial cervical, brachial, and inguinal). Abbreviations: DTX, docetaxel; NPs, nanoparticles; FPR-675, Flamma™ fluorescence molecular imaging dye; IV, intravenous.
    Figure Legend Snippet: In vivo real-time and excised lymph node near-infrared fluorescence imaging of tumor-bearing mice injected with DTX/FPR-675 Pluronic NPs for lymph node imaging. Notes: In vivo whole body near-infrared fluorescence images of mice (n=4) 60 minutes post-injection of ( A ) free FPR-675 (upper) and DTX/FPR-675 Pluronic NPs (lower). Comparison of near-infrared fluorescence intensity in ( B ) an excised superficial cervical (right) and a brachial (left) node and ( C ) near-infrared fluorescence images using DTX/FPR-675 Pluronic NPs. ( D ) Representative ex vivo fluorescence images of dissected lymph nodes (superficial cervical, brachial, and inguinal). Abbreviations: DTX, docetaxel; NPs, nanoparticles; FPR-675, Flamma™ fluorescence molecular imaging dye; IV, intravenous.

    Techniques Used: In Vivo, Fluorescence, Imaging, Mouse Assay, Injection, Ex Vivo

    Cytotoxicity and in vitro cellular uptake of the NPs in various cells. Notes: ( A ) In vitro cytotoxicity at various concentrations of the DTX/FPR-675 Pluronic NPs from 0.1 g/mL to 1,000 g/mL and ( B ) cellular behavior of the DTX/FPR-675 Pluronic NPs using normal cells (BAECs), macrophages (Raw264.7), and tumor (SCC-7) cells. Data are presented as the mean ± standard deviation (n=6). Abbreviations: BAECs, bovine aortic endothelial cells; DTX, docetaxel; NPs, nanoparticles; FPR-675, Flamma™ fluorescence molecular imaging dye; TRITC, tetramethylrhodamine; DAPI, 4’,6-diamidino-2-phenylindole.
    Figure Legend Snippet: Cytotoxicity and in vitro cellular uptake of the NPs in various cells. Notes: ( A ) In vitro cytotoxicity at various concentrations of the DTX/FPR-675 Pluronic NPs from 0.1 g/mL to 1,000 g/mL and ( B ) cellular behavior of the DTX/FPR-675 Pluronic NPs using normal cells (BAECs), macrophages (Raw264.7), and tumor (SCC-7) cells. Data are presented as the mean ± standard deviation (n=6). Abbreviations: BAECs, bovine aortic endothelial cells; DTX, docetaxel; NPs, nanoparticles; FPR-675, Flamma™ fluorescence molecular imaging dye; TRITC, tetramethylrhodamine; DAPI, 4’,6-diamidino-2-phenylindole.

    Techniques Used: In Vitro, Standard Deviation, Fluorescence, Imaging

    In vivo and ex vivo near-infrared fluorescence images of a lymph node with DTX/FPR-675 Pluronic NPs. Notes: ( A ) In vivo real-time near-infrared fluorescence images and ( B ) fluorescence quantification data for a localized lymph node in a mouse (n=4) within 60 minutes of being intradermally injected with DTX/FPR-675 Pluronic NPs (10 μL, 5 mg/mL DTX) in the right forepaw pad. The filter set has Cy5.5 emission (700 nm). ( C ) Fluorescence microscopic images of a dissected brachial lymph node from a non-tumor-bearing mouse (upper) and a tumor-bearing mouse (lower) with DTX/FPR-675 Pluronic NPs 60 minutes post-injection. Abbreviations: DTX, docetaxel; NPs, nanoparticles; FPR-675, Flamma™ fluorescence molecular imaging dye; TRITC, tetramethylrhodamine.
    Figure Legend Snippet: In vivo and ex vivo near-infrared fluorescence images of a lymph node with DTX/FPR-675 Pluronic NPs. Notes: ( A ) In vivo real-time near-infrared fluorescence images and ( B ) fluorescence quantification data for a localized lymph node in a mouse (n=4) within 60 minutes of being intradermally injected with DTX/FPR-675 Pluronic NPs (10 μL, 5 mg/mL DTX) in the right forepaw pad. The filter set has Cy5.5 emission (700 nm). ( C ) Fluorescence microscopic images of a dissected brachial lymph node from a non-tumor-bearing mouse (upper) and a tumor-bearing mouse (lower) with DTX/FPR-675 Pluronic NPs 60 minutes post-injection. Abbreviations: DTX, docetaxel; NPs, nanoparticles; FPR-675, Flamma™ fluorescence molecular imaging dye; TRITC, tetramethylrhodamine.

    Techniques Used: In Vivo, Ex Vivo, Fluorescence, Injection, Imaging

    73) Product Images from "Tip30 controls differentiation of murine mammary luminal progenitor to estrogen receptor-positive luminal cell through regulating FoxA1 expression"

    Article Title: Tip30 controls differentiation of murine mammary luminal progenitor to estrogen receptor-positive luminal cell through regulating FoxA1 expression

    Journal: Cell Death & Disease

    doi: 10.1038/cddis.2014.224

    Tip30 deletion enhanced the mammosphere and colony-forming capacity of mammary cells. ( a ) Freshly isolated mammary cells from mice at 5 months of age were plated in ultra-low attachment plates (5000 cells per well) with serum-free DMEM/F12 medium supplemented with growth factors. After 10 days in culture, mammosphere's number and size were calculated as shown in histograms. Only mammospheres exceeding 60 μ m in diameter were counted. Error bars represent the mean±S.E.M. of three mice per group. ( b ) Freshly isolated mammary cells from mice were plated in Matrigel-coated 48-well plates (2000 cells per well). Colonies were cultured for 9 days and then photographed. The histograms show colony number and size. The results are the mean±S.E.M. of three mice per group
    Figure Legend Snippet: Tip30 deletion enhanced the mammosphere and colony-forming capacity of mammary cells. ( a ) Freshly isolated mammary cells from mice at 5 months of age were plated in ultra-low attachment plates (5000 cells per well) with serum-free DMEM/F12 medium supplemented with growth factors. After 10 days in culture, mammosphere's number and size were calculated as shown in histograms. Only mammospheres exceeding 60 μ m in diameter were counted. Error bars represent the mean±S.E.M. of three mice per group. ( b ) Freshly isolated mammary cells from mice were plated in Matrigel-coated 48-well plates (2000 cells per well). Colonies were cultured for 9 days and then photographed. The histograms show colony number and size. The results are the mean±S.E.M. of three mice per group

    Techniques Used: Isolation, Mouse Assay, Cell Culture

    74) Product Images from "Large Scale RNAi Reveals the Requirement of Nuclear Envelope Breakdown for Nuclear Import of Human Papillomaviruses"

    Article Title: Large Scale RNAi Reveals the Requirement of Nuclear Envelope Breakdown for Nuclear Import of Human Papillomaviruses

    Journal: PLoS Pathogens

    doi: 10.1371/journal.ppat.1004162

    Nuclear import of HPV16 vDNA is blocked in interphase cells. (A) Aphidicolin-treated or untreated HeLa cells were infected with HPV16-GFP. At 16 h p.i., cells were fixed and immunostained with the L1-7 antibody detecting endosomal, conformationally altered virions. Depicted are confocal sections of untreated (left) or aphidicolin-treated (right) cells. (B) As in (A) with quantification of the three-dimensional distance of L1-7 signals to the nuclear border (in µm) ± SD. (C) As in (A) with quantification of the number of discernible L1-7 spots/cell. (D) As in (A) with quantification of the fluorescent intensity (in arbitrary units, AU) of individual L1-7 spots. (E) HeLa H2B-mCherry cells were infected with BrdU-HPV16. Cells were immunostained for BrdU to detect the vDNA after fixation at 24 h p.i.. Depicted are confocal sections of aphidicolin-treated (interphase, right) or untreated (left) cells. Mostly, the vDNA localized intranuclearly as discrete spots in untreated cells (arrowheads) or exclusively perinuclearly in aphidicolin-treated cells. (F) As in (E) with quantification of intranuclear BrdU spots/cell. The number of intranuclear spots is given relative to the total number of cellular spots. (G) As in (E) with quantification of perinuclear BrdU spot/cell as in (F). (H) As in (E) with quantification of the signal intensities of individual perinuclear BrdU spots relative to untreated infected cells. (I) HeLa cells were treated with or without aphidicolin for 16 h prior to infection. 20 h after infection with EdU-HPV16 (green), cells were fixed and immunostained for TGN46 (red) and LAMP1 (light blue). The nucleus was stained by Hoechst (dark blue). Depicted are single confocal sections. The cytosolic EdU-HPV16 signal is depicted after substraction of the EdU-HPV16 signals colocalizing with LAMP1, TGN46 and the nucleus. (J) As (I) with quantification of signal colocalization of EdU-HPV16 with LAMP1 or TGN46. Cytosolic EdU-HPV16 amounts were defined as signals that did not colocalize with LAMP1, TGN46, or the nucleus (see below). (K) As in (I) with quantification of signal colocalization of EdU-HPV16 with the nuclear stain (Hoechst). Statistical significance was determined by a two-tailed, independent t-test; P-values: *
    Figure Legend Snippet: Nuclear import of HPV16 vDNA is blocked in interphase cells. (A) Aphidicolin-treated or untreated HeLa cells were infected with HPV16-GFP. At 16 h p.i., cells were fixed and immunostained with the L1-7 antibody detecting endosomal, conformationally altered virions. Depicted are confocal sections of untreated (left) or aphidicolin-treated (right) cells. (B) As in (A) with quantification of the three-dimensional distance of L1-7 signals to the nuclear border (in µm) ± SD. (C) As in (A) with quantification of the number of discernible L1-7 spots/cell. (D) As in (A) with quantification of the fluorescent intensity (in arbitrary units, AU) of individual L1-7 spots. (E) HeLa H2B-mCherry cells were infected with BrdU-HPV16. Cells were immunostained for BrdU to detect the vDNA after fixation at 24 h p.i.. Depicted are confocal sections of aphidicolin-treated (interphase, right) or untreated (left) cells. Mostly, the vDNA localized intranuclearly as discrete spots in untreated cells (arrowheads) or exclusively perinuclearly in aphidicolin-treated cells. (F) As in (E) with quantification of intranuclear BrdU spots/cell. The number of intranuclear spots is given relative to the total number of cellular spots. (G) As in (E) with quantification of perinuclear BrdU spot/cell as in (F). (H) As in (E) with quantification of the signal intensities of individual perinuclear BrdU spots relative to untreated infected cells. (I) HeLa cells were treated with or without aphidicolin for 16 h prior to infection. 20 h after infection with EdU-HPV16 (green), cells were fixed and immunostained for TGN46 (red) and LAMP1 (light blue). The nucleus was stained by Hoechst (dark blue). Depicted are single confocal sections. The cytosolic EdU-HPV16 signal is depicted after substraction of the EdU-HPV16 signals colocalizing with LAMP1, TGN46 and the nucleus. (J) As (I) with quantification of signal colocalization of EdU-HPV16 with LAMP1 or TGN46. Cytosolic EdU-HPV16 amounts were defined as signals that did not colocalize with LAMP1, TGN46, or the nucleus (see below). (K) As in (I) with quantification of signal colocalization of EdU-HPV16 with the nuclear stain (Hoechst). Statistical significance was determined by a two-tailed, independent t-test; P-values: *

    Techniques Used: Infection, Staining, Two Tailed Test

    vDNA and L2-GFP associate with mitotic chromosomes. (A) HeLa Kyoto cells were infected with EdU-HPV16. Cells were stained for host DNA and EdU to detect the vDNA after fixation at 20 h p.i.. Depicted are host cell chromatin (left), the vDNA (middle), and merge (right) of confocal sections of an aphidicolin-treated cell (G1/S) and untreated mitotic cells. Note that vDNA commenced association with chromosomes upon entry into mitosis. Indicated are the mitotic stages based on chromosomal organization. (B) as in (A). Quantification of vDNA localization to host chromatin ± SD (n = 5). (C) HeLa H2B-mCherry cells were transiently transfected with an L2-GFP expression plasmid. Cells were imaged by video microscopy 32 h post transfection for 24 h in 5 min intervals. Depicted are images of a L2-GFP expressing cell progressing through mitosis (from Video S9 ). (D) Timing of L2-GFP chromosomal association relative to metaphase plate formation (n = 88).
    Figure Legend Snippet: vDNA and L2-GFP associate with mitotic chromosomes. (A) HeLa Kyoto cells were infected with EdU-HPV16. Cells were stained for host DNA and EdU to detect the vDNA after fixation at 20 h p.i.. Depicted are host cell chromatin (left), the vDNA (middle), and merge (right) of confocal sections of an aphidicolin-treated cell (G1/S) and untreated mitotic cells. Note that vDNA commenced association with chromosomes upon entry into mitosis. Indicated are the mitotic stages based on chromosomal organization. (B) as in (A). Quantification of vDNA localization to host chromatin ± SD (n = 5). (C) HeLa H2B-mCherry cells were transiently transfected with an L2-GFP expression plasmid. Cells were imaged by video microscopy 32 h post transfection for 24 h in 5 min intervals. Depicted are images of a L2-GFP expressing cell progressing through mitosis (from Video S9 ). (D) Timing of L2-GFP chromosomal association relative to metaphase plate formation (n = 88).

    Techniques Used: Infection, Staining, Transfection, Expressing, Plasmid Preparation, Microscopy

    Cell cycle progression into early mitosis is required for HPV16 entry. (A) Depicted are images from representative time lapses for untreated (first row), aphidicolin-treated (second row), and monastrol-treated (last row) HeLa H2B-mCherry cells infected with HPV16-GFP (30vge/cell, see also Videos S1 – S3 ). Time stamps (hh:mm) indicate the time after virus addition. Mitoses in untreated cells are marked by arrows/arrowheads. Note that monastrol-treated cells failed to separate chromosomes but underwent chromosome condensation, aberrant metaphase plate formation, and decondensation of chromosomes (arrows). (B) as in (A). To relate the timing of mitosis and the onset of GFP expression (i.e. successful HPV16 entry), HeLa H2B-mCherry cells were infected with HPV16 (30 and 300 vge/cell), and cells were imaged by time-lapse microscopy. The end of mitosis was defined by visible chromosome decondensation (i.e. telophase), whereas the onset of GFP expression was defined as 10% signal above background. Given is the relative timing of GFP onset post mitosis ± standard deviation (SD). (C) Schematic depiction of the cell cycle. The effects of the inhibitors on cell cycle transitions are indicated. (D) HeLa (black bars) or HaCaT (gray bars) cells were infected with HPV16 PsV after 16 h of preincubation in the presence of inhibitors or solvent control (unperturbed) at indicated concentrations. The number of infected cells was determined 48 h p.i. by flow cytometry. Depicted are infected cells relative to control in percent ± SD. (E) as in (D). To test the reversibility of the S-phase arrest for infection, cells were treated with aphidicolin, and the drug was washed out at the time of HPV16 infection (0 h p.i.) or 24 h p.i.. (F) as in (D) using PHK cells. (G) HeLa cells were infected with HPV6, HPV16, or HPV18 PsV after 16 h preincubation aphidicolin. The number of infected cells was determined 48 h p.i. by flow cytometry. Depicted are infected cells relative to the DMSO treated control in percent ± SD. (H) HaCat cells were infected with raft-derived HPV16 after 16 h preincubation with aphidicolin. Total RNA was extracted 48 h p.i., and infection was measured by the viral splice transcript E1∧E4 normalized to TBP. Infection is depicted relative to the DMSO treated control in percent ± SD.
    Figure Legend Snippet: Cell cycle progression into early mitosis is required for HPV16 entry. (A) Depicted are images from representative time lapses for untreated (first row), aphidicolin-treated (second row), and monastrol-treated (last row) HeLa H2B-mCherry cells infected with HPV16-GFP (30vge/cell, see also Videos S1 – S3 ). Time stamps (hh:mm) indicate the time after virus addition. Mitoses in untreated cells are marked by arrows/arrowheads. Note that monastrol-treated cells failed to separate chromosomes but underwent chromosome condensation, aberrant metaphase plate formation, and decondensation of chromosomes (arrows). (B) as in (A). To relate the timing of mitosis and the onset of GFP expression (i.e. successful HPV16 entry), HeLa H2B-mCherry cells were infected with HPV16 (30 and 300 vge/cell), and cells were imaged by time-lapse microscopy. The end of mitosis was defined by visible chromosome decondensation (i.e. telophase), whereas the onset of GFP expression was defined as 10% signal above background. Given is the relative timing of GFP onset post mitosis ± standard deviation (SD). (C) Schematic depiction of the cell cycle. The effects of the inhibitors on cell cycle transitions are indicated. (D) HeLa (black bars) or HaCaT (gray bars) cells were infected with HPV16 PsV after 16 h of preincubation in the presence of inhibitors or solvent control (unperturbed) at indicated concentrations. The number of infected cells was determined 48 h p.i. by flow cytometry. Depicted are infected cells relative to control in percent ± SD. (E) as in (D). To test the reversibility of the S-phase arrest for infection, cells were treated with aphidicolin, and the drug was washed out at the time of HPV16 infection (0 h p.i.) or 24 h p.i.. (F) as in (D) using PHK cells. (G) HeLa cells were infected with HPV6, HPV16, or HPV18 PsV after 16 h preincubation aphidicolin. The number of infected cells was determined 48 h p.i. by flow cytometry. Depicted are infected cells relative to the DMSO treated control in percent ± SD. (H) HaCat cells were infected with raft-derived HPV16 after 16 h preincubation with aphidicolin. Total RNA was extracted 48 h p.i., and infection was measured by the viral splice transcript E1∧E4 normalized to TBP. Infection is depicted relative to the DMSO treated control in percent ± SD.

    Techniques Used: Infection, Expressing, Time-lapse Microscopy, Standard Deviation, Flow Cytometry, Cytometry, Derivative Assay

    Nuclear envelope perforation allows HPV16 entry in interphase cells. (A) Schematic depiction of the experimental setup. Aphidicolin-treated cells were infected (loaded) with HPV16, after which they were superinfected with parvovirus H1. (B) Time-lapse images of HeLa IBB-GFP cells (see Video S5 ). Arrowheads indicate mitotic events, during which the IBB-GFP signal dispersed throughout the cytosol after NEB. Indicated is the time after image acquisition was started. (C) As in (B) of cells treated with aphidicolin. Indicated are the times after image acquisition was started and, in brackets, after aphidicolin was added (see Video S6 ). (D) As in (C) with addition of parvovirus H1. Timestamps indicate the time after H1 addition. Note the translocation of the IBB-GFP signal into the cytosol (arrows, see Video S7 ). (E) Quantification of video microscopy from (D). Depicted is the relative number of cells exhibiting IBB-GFP translocation to the cytosol (NE perforation by H1) ± SD (18 fields of view/experiment) (F) HeLa H2B-mCherry cells were treated with aphidicolin for 16 h, when cells were infected with HPV16 PsV. 12 h post HPV16 infection, cells were superinfected with parvovirus H1, and time-lapse recording was started. Depicted are images from a representative time lapse (see Video S8 ). Time stamps indicate the time after H1 addition. (G) Quantification of video microscopy from (F) with or without H1 addition. Depicted are the numbers of infected cells in percent ± SD (n = 350 cells/experiment). Statistical significance was determined by a one-tailed, independent t-test: P-value **
    Figure Legend Snippet: Nuclear envelope perforation allows HPV16 entry in interphase cells. (A) Schematic depiction of the experimental setup. Aphidicolin-treated cells were infected (loaded) with HPV16, after which they were superinfected with parvovirus H1. (B) Time-lapse images of HeLa IBB-GFP cells (see Video S5 ). Arrowheads indicate mitotic events, during which the IBB-GFP signal dispersed throughout the cytosol after NEB. Indicated is the time after image acquisition was started. (C) As in (B) of cells treated with aphidicolin. Indicated are the times after image acquisition was started and, in brackets, after aphidicolin was added (see Video S6 ). (D) As in (C) with addition of parvovirus H1. Timestamps indicate the time after H1 addition. Note the translocation of the IBB-GFP signal into the cytosol (arrows, see Video S7 ). (E) Quantification of video microscopy from (D). Depicted is the relative number of cells exhibiting IBB-GFP translocation to the cytosol (NE perforation by H1) ± SD (18 fields of view/experiment) (F) HeLa H2B-mCherry cells were treated with aphidicolin for 16 h, when cells were infected with HPV16 PsV. 12 h post HPV16 infection, cells were superinfected with parvovirus H1, and time-lapse recording was started. Depicted are images from a representative time lapse (see Video S8 ). Time stamps indicate the time after H1 addition. (G) Quantification of video microscopy from (F) with or without H1 addition. Depicted are the numbers of infected cells in percent ± SD (n = 350 cells/experiment). Statistical significance was determined by a one-tailed, independent t-test: P-value **

    Techniques Used: Infection, Translocation Assay, Microscopy, One-tailed Test

    75) Product Images from "Small molecule inhibitors of WNT/?-catenin signaling block IL-1?- and TNF?-induced cartilage degradation"

    Article Title: Small molecule inhibitors of WNT/?-catenin signaling block IL-1?- and TNF?-induced cartilage degradation

    Journal: Arthritis Research & Therapy

    doi: 10.1186/ar4273

    Small molecule inhibitors of WNT/β-catenin signaling effectively block TCF/Lef-mediated activity of β-catenin . (A) Small molecules dose-dependently inhibit transcription factor/lymphoid enhancer-binding factor (TCF/LEF) reporter activity in HEK-293t cells, induced by the glycogen synthase kinase 3β (GSK3β) inhibitor 6-bromoindirubin 3'-oxime (BIO) (1.0 µM). Data represent the means of three independent experiments with 95% confidence intervals (CIs). (B) Metabolic activity, measured using a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay in KS483-4C3 cells, was not affected by small molecules at lower concentrations; however, at 1.0 µM (except for CGP049090) and 3.0 µM, metabolic activity was significantly decreased. Data represent the means of three independent experiments with 95% CI. (C) Treatment with 50 mM LiCl induced nuclear translocation of β-catenin. Small molecules by themselves had no effect on cellular localization of β-catenin, whereas PKF118-310 and PKF115-584 blocked LiCl-induced translocation of β-catenin to the nucleus. CGP049090 did not affect nuclear accumulation of β-catenin after LiCl treatment. A representative example of three independent experiments is shown. Scale bar represents 10 µm * P
    Figure Legend Snippet: Small molecule inhibitors of WNT/β-catenin signaling effectively block TCF/Lef-mediated activity of β-catenin . (A) Small molecules dose-dependently inhibit transcription factor/lymphoid enhancer-binding factor (TCF/LEF) reporter activity in HEK-293t cells, induced by the glycogen synthase kinase 3β (GSK3β) inhibitor 6-bromoindirubin 3'-oxime (BIO) (1.0 µM). Data represent the means of three independent experiments with 95% confidence intervals (CIs). (B) Metabolic activity, measured using a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay in KS483-4C3 cells, was not affected by small molecules at lower concentrations; however, at 1.0 µM (except for CGP049090) and 3.0 µM, metabolic activity was significantly decreased. Data represent the means of three independent experiments with 95% CI. (C) Treatment with 50 mM LiCl induced nuclear translocation of β-catenin. Small molecules by themselves had no effect on cellular localization of β-catenin, whereas PKF118-310 and PKF115-584 blocked LiCl-induced translocation of β-catenin to the nucleus. CGP049090 did not affect nuclear accumulation of β-catenin after LiCl treatment. A representative example of three independent experiments is shown. Scale bar represents 10 µm * P

    Techniques Used: Blocking Assay, Activity Assay, Binding Assay, Translocation Assay

    Related Articles

    Clone Assay:

    Article Title: A Genome-Wide Scan for MicroRNA-Related Genetic Variants Associated With Primary Open-Angle Glaucoma
    Article Snippet: The 3′UTR sequences containing putative binding site (wild type and mutated) of the miRNA were amplified and cloned into the pGL3 Luciferase reporter vector (Promega, Madison, WI, USA) downstream of the Luciferase open reading frame. .. HEK293 cells (n = 10,000) were plated into 96-well plates and cotransfected with 1 μg pGL3 containing the 3′UTR with either the major or minor allele, miRNA mimic (mirVana Mimics; Thermo Fischer Scientific, Waltham, MA, USA), and a plasmid expressing the Renilla luciferase that served as transfection control, with Lipofectamine RNAiMAX (Invitrogen).

    Article Title: Triglycerides Promote Lipid Homeostasis during Hypoxic Stress by Balancing Fatty Acid Saturation
    Article Snippet: .. After selection with puromycin and G418, the knockdown of both DGAT1 and DGAT2 transcripts was confirmed by qRT-PCR (Taqman probes; ThermoFisher) DGAT2 knockout cell lines were generated by cloning sgRNA sequences 5′-TGTGCTCTACTTCACTTGGC-3′ and 5′-GTACATGAGGATGGCACTGC-3′ into the lentiviral vector lentiCrisprv2 (Addgene), generating lentivirus in HEK293T cells and transducing ccRCC cell lines with 25μl of un-concentrated supernatant. .. After puromycin selection, single cell clones were generated by limiting dilutions in 96 well plates.

    Luciferase:

    Article Title: A Genome-Wide Scan for MicroRNA-Related Genetic Variants Associated With Primary Open-Angle Glaucoma
    Article Snippet: .. HEK293 cells (n = 10,000) were plated into 96-well plates and cotransfected with 1 μg pGL3 containing the 3′UTR with either the major or minor allele, miRNA mimic (mirVana Mimics; Thermo Fischer Scientific, Waltham, MA, USA), and a plasmid expressing the Renilla luciferase that served as transfection control, with Lipofectamine RNAiMAX (Invitrogen). .. Luciferase activity was measured with the Dual-Glo Luciferase Assay System according to manufacturer's protocol (Promega).

    Article Title: Haemophilus parasuis Infection Disrupts Adherens Junctions and Initializes EMT Dependent on Canonical Wnt/β-Catenin Signaling Pathway
    Article Snippet: .. Plasmid transfection and luciferase assay To assess the activation of Wnt/β-catenin pathway, cells seeded in 96 well plates were transfected with 0.1 μg/well of either TOPflash or FOPflash and 0.1 μg/well of pRL-TK by 0.5 μg/well Lipofectamine 2000 (Invitrogen, USA) following the manufacturer's instructions. .. At 24 h after transfection, cells were treated or untreated with various inhibitors for 2 h before stimulation with H. parasuis or LiCl.

    Reporter Assay:

    Article Title: A Genome-Wide Scan for MicroRNA-Related Genetic Variants Associated With Primary Open-Angle Glaucoma
    Article Snippet: Luciferase Reporter Assays A luciferase reporter assay system was used to examine the interaction between an miRNA and the 3′UTR of its putative target gene. .. HEK293 cells (n = 10,000) were plated into 96-well plates and cotransfected with 1 μg pGL3 containing the 3′UTR with either the major or minor allele, miRNA mimic (mirVana Mimics; Thermo Fischer Scientific, Waltham, MA, USA), and a plasmid expressing the Renilla luciferase that served as transfection control, with Lipofectamine RNAiMAX (Invitrogen).

    Article Title: Haemophilus parasuis Infection Disrupts Adherens Junctions and Initializes EMT Dependent on Canonical Wnt/β-Catenin Signaling Pathway
    Article Snippet: Plasmid transfection and luciferase assay To assess the activation of Wnt/β-catenin pathway, cells seeded in 96 well plates were transfected with 0.1 μg/well of either TOPflash or FOPflash and 0.1 μg/well of pRL-TK by 0.5 μg/well Lipofectamine 2000 (Invitrogen, USA) following the manufacturer's instructions. .. Cells were lysed 24 h after stimulation and the relative firefly and renilla luciferase activity were detected with a dual-luciferase reporter assay system (Promega, USA) following the manufacturer's instructions.

    Synthesized:

    Article Title: SWI/SNF interacts with cleavage and polyadenylation factors and facilitates pre-mRNA 3′ end processing
    Article Snippet: .. Double-stranded RNAs (dsRNAs) complementary to dBRM or GFP were synthesized by in vitro transcription using the MegaScript RNAi kit (Ambion) from gene-specific PCR fragments with incorporated T7 promoters at both ends. .. The sequences of the PCR primers used for dsRNA synthesis are provided as additional text in the .

    Construct:

    Article Title: A Genome-Wide Scan for MicroRNA-Related Genetic Variants Associated With Primary Open-Angle Glaucoma
    Article Snippet: The inserts of all constructs were confirmed by Sanger sequencing. .. HEK293 cells (n = 10,000) were plated into 96-well plates and cotransfected with 1 μg pGL3 containing the 3′UTR with either the major or minor allele, miRNA mimic (mirVana Mimics; Thermo Fischer Scientific, Waltham, MA, USA), and a plasmid expressing the Renilla luciferase that served as transfection control, with Lipofectamine RNAiMAX (Invitrogen).

    Article Title: Conformational signatures in β-arrestin2 reveal natural biased agonism at a G-protein-coupled receptor
    Article Snippet: .. A mixture containing 50 ng β-arrestin2 construct containing the SmBit and 50 ng Galr2 containing the LgBiT at the C termini plus 0.2 μl Lipofectamine 2000 (Invitrogen) was prepared and added to each well. .. At 24 h post transfection, the medium was aspirated and replaced with 100 μl OPTIMEM and incubated at room temperature.

    Electrophoresis:

    Article Title: Serum and Ectopic Endometrium from Women with Endometriosis Modulate Macrophage M1/M2 Polarization via the Smad2/Smad3 Pathway
    Article Snippet: The THP-1 cells were harvested and lysed in 50 μ l lysis buffer (Thermo Fisher Scientific, Waltham, MA, USA). .. Protein samples (30 μ g protein) were solubilized and heated at 70°C in NuPAGE® LDS sample buffer and reducing agent (Invitrogen, Carlsbad, CA, USA) for 10 min. Then, 30 μ l samples were then loaded onto each lane for electrophoresis and then transferred onto nitrocellulose blotting membranes.

    Incubation:

    Article Title: Diphenyl diselenide protects neuronal cells against oxidative stress and mitochondrial dysfunction: Involvement of the glutathione-dependent antioxidant system
    Article Snippet: .. HT22 cells were maintained in DMEM supplemented with 5% (v/v) fetal bovine serum (FBS; Gibco/lnvitrogen), 2 mM glutamine, 100 units/mL penicillin, 100 μg/mL streptomycin, 10 mM Hepes, 24 mM glucose, 44 mM NaHCO3 and incubated at 37 °C in a humidified atmosphere of 5% CO2 . ..

    Article Title: Dimerization confers increased stability to nucleases in 5′ halves from glycine and glutamic acid tRNAs
    Article Snippet: Fluorescence microscopy MCF-7 cells (1 × 104 ) were seeded onto 96-well plates and 24 h later were washed with PBS and transfected with 100 nM biotinylated RNAs (WT, 9GG/AA, 25U/C and SCR) using Lipofectamine 2000 (Invitrogen) following manufacturer's recommendations. .. After 30 min incubation with the lipid/RNA mixture, cells were rinsed three times with PBS to remove non-transfected RNA.

    Article Title: Conformational signatures in β-arrestin2 reveal natural biased agonism at a G-protein-coupled receptor
    Article Snippet: A mixture containing 50 ng β-arrestin2 construct containing the SmBit and 50 ng Galr2 containing the LgBiT at the C termini plus 0.2 μl Lipofectamine 2000 (Invitrogen) was prepared and added to each well. .. At 24 h post transfection, the medium was aspirated and replaced with 100 μl OPTIMEM and incubated at room temperature.

    Article Title: Serum and Ectopic Endometrium from Women with Endometriosis Modulate Macrophage M1/M2 Polarization via the Smad2/Smad3 Pathway
    Article Snippet: The THP-1 cells were harvested and lysed in 50 μ l lysis buffer (Thermo Fisher Scientific, Waltham, MA, USA). .. The membrane was blocked with 5% fat-free milk at 4°C overnight for 1 h, followed by incubation with primary antibody to Smad2 (dilution 1 : 500), Smad3 (dilution 1 : 200), NF-κ Bp50 (dilution 1 : 200), or β -actin (dilution 1 : 5000) at 4°C overnight.

    Article Title: Effects of Betaine on LPS-Stimulated Activation of Microglial M1/M2 Phenotypes by Suppressing TLR4/NF-κB Pathways in N9 Cells
    Article Snippet: .. In brief, N9 microglial cells was cultured in 96-well plates with betaine (1 μM–100 mM) and LPS (10 ng/mL–100 μg/mL) for 24 h. The cells were treated with betaine (0.125, 0.25, 0.5 and 1 mM) for 1 h and then treated with or without LPS (1 μg/mL) for 24 h. CCK-8 solution (10 μL) was added, and the plates were incubated at 37 °C for 3 h. The absorbance was measured at 450 nm using a plate reader (Thermo Scientific). .. For morphological analysis, cells were imaged with a laser scanning confocal microscope (Olympus, Tokyo, Japan) at 40× magnification.

    Article Title: Altered dynamics of scaRNA2 and scaRNA9 in response to stress correlates with disrupted nuclear organization
    Article Snippet: .. For cell treatments, HeLa cells were grown at 37°C in DMEM (Dulbecco's Modification of Eagle's Medium) containing glucose, glutamine and sodium pyruvate supplemented with 10% fetal bovine serum until 70% confluent and then transfected with pcDNA3.1+scaRNA9 for 7 h. The cells were then subjected to the following treatments for 17 h (resulting in 24 h total DNA expression): 3 μg/ml cisplatin, 7.5 μM etoposide, 42°C incubation, 0.2 mM H2 O2 , DMEM without serum or incubation in Optimem reduced serum medium (Invitrogen). .. Northern blotting RNA was harvested using TRI-Reagent (Sigma-Aldrich) following the manufacturer's suggested protocol.

    Amplification:

    Article Title: A Genome-Wide Scan for MicroRNA-Related Genetic Variants Associated With Primary Open-Angle Glaucoma
    Article Snippet: The 3′UTR sequences containing putative binding site (wild type and mutated) of the miRNA were amplified and cloned into the pGL3 Luciferase reporter vector (Promega, Madison, WI, USA) downstream of the Luciferase open reading frame. .. HEK293 cells (n = 10,000) were plated into 96-well plates and cotransfected with 1 μg pGL3 containing the 3′UTR with either the major or minor allele, miRNA mimic (mirVana Mimics; Thermo Fischer Scientific, Waltham, MA, USA), and a plasmid expressing the Renilla luciferase that served as transfection control, with Lipofectamine RNAiMAX (Invitrogen).

    Article Title: Evaluation of glutathione S‐transferase pi 1 expression and gene promoter methylation in Moroccan patients with urothelial bladder cancer, et al. Evaluation of glutathione S‐transferase pi 1 expression and gene promoter methylation in Moroccan patients with urothelial bladder cancer
    Article Snippet: .. For PCR amplification, 2 μl of bisulfite‐converted DNA was added to mixtures containing 1× PCR buffer, 1.5 mM MgCl2 , 200 μM of each dNTP, 200 nM of each primer and 0.25 U Platinum Taq DNA polymerase (Invitrogen), in a final volume of 25 μl. .. PCR reactions were carried out under the following conditions: first denaturation at 95°C for 2 min, 35 cycles of 30 s at 94°C, 30 s at 60°C, 30 s at 72°C and a final extension for 7 min at 72°C.

    Activity Assay:

    Article Title: A Genome-Wide Scan for MicroRNA-Related Genetic Variants Associated With Primary Open-Angle Glaucoma
    Article Snippet: HEK293 cells (n = 10,000) were plated into 96-well plates and cotransfected with 1 μg pGL3 containing the 3′UTR with either the major or minor allele, miRNA mimic (mirVana Mimics; Thermo Fischer Scientific, Waltham, MA, USA), and a plasmid expressing the Renilla luciferase that served as transfection control, with Lipofectamine RNAiMAX (Invitrogen). .. Luciferase activity was measured with the Dual-Glo Luciferase Assay System according to manufacturer's protocol (Promega).

    Article Title: Haemophilus parasuis Infection Disrupts Adherens Junctions and Initializes EMT Dependent on Canonical Wnt/β-Catenin Signaling Pathway
    Article Snippet: Plasmid transfection and luciferase assay To assess the activation of Wnt/β-catenin pathway, cells seeded in 96 well plates were transfected with 0.1 μg/well of either TOPflash or FOPflash and 0.1 μg/well of pRL-TK by 0.5 μg/well Lipofectamine 2000 (Invitrogen, USA) following the manufacturer's instructions. .. Cells were lysed 24 h after stimulation and the relative firefly and renilla luciferase activity were detected with a dual-luciferase reporter assay system (Promega, USA) following the manufacturer's instructions.

    Expressing:

    Article Title: A Genome-Wide Scan for MicroRNA-Related Genetic Variants Associated With Primary Open-Angle Glaucoma
    Article Snippet: .. HEK293 cells (n = 10,000) were plated into 96-well plates and cotransfected with 1 μg pGL3 containing the 3′UTR with either the major or minor allele, miRNA mimic (mirVana Mimics; Thermo Fischer Scientific, Waltham, MA, USA), and a plasmid expressing the Renilla luciferase that served as transfection control, with Lipofectamine RNAiMAX (Invitrogen). .. Luciferase activity was measured with the Dual-Glo Luciferase Assay System according to manufacturer's protocol (Promega).

    Article Title: Triglycerides Promote Lipid Homeostasis during Hypoxic Stress by Balancing Fatty Acid Saturation
    Article Snippet: DGAT mutant and knockdown lines DGAT1 and DGAT2 shRNA (specified as DGAT shRNA unless stated otherwise) was achieved by expressing Dox-inducible shDGAT2_5 (TRCN0000005195) using the Tet-pLKO-puro plasmid and shDGAT1_1 (TRCN0000036151) using the Tet-pLKO-neo. .. After selection with puromycin and G418, the knockdown of both DGAT1 and DGAT2 transcripts was confirmed by qRT-PCR (Taqman probes; ThermoFisher) DGAT2 knockout cell lines were generated by cloning sgRNA sequences 5′-TGTGCTCTACTTCACTTGGC-3′ and 5′-GTACATGAGGATGGCACTGC-3′ into the lentiviral vector lentiCrisprv2 (Addgene), generating lentivirus in HEK293T cells and transducing ccRCC cell lines with 25μl of un-concentrated supernatant.

    Article Title: Altered dynamics of scaRNA2 and scaRNA9 in response to stress correlates with disrupted nuclear organization
    Article Snippet: .. For cell treatments, HeLa cells were grown at 37°C in DMEM (Dulbecco's Modification of Eagle's Medium) containing glucose, glutamine and sodium pyruvate supplemented with 10% fetal bovine serum until 70% confluent and then transfected with pcDNA3.1+scaRNA9 for 7 h. The cells were then subjected to the following treatments for 17 h (resulting in 24 h total DNA expression): 3 μg/ml cisplatin, 7.5 μM etoposide, 42°C incubation, 0.2 mM H2 O2 , DMEM without serum or incubation in Optimem reduced serum medium (Invitrogen). .. Northern blotting RNA was harvested using TRI-Reagent (Sigma-Aldrich) following the manufacturer's suggested protocol.

    BIA-KA:

    Article Title: Serum and Ectopic Endometrium from Women with Endometriosis Modulate Macrophage M1/M2 Polarization via the Smad2/Smad3 Pathway
    Article Snippet: The THP-1 cells were harvested and lysed in 50 μ l lysis buffer (Thermo Fisher Scientific, Waltham, MA, USA). .. The mixture was centrifuged at 14000 rpm for 10 min. Total protein in the supernatant was quantified with a bicinchoninic acid (BCA) kit (Thermo Scientific Pierce, Rockford, IL, USA).

    Modification:

    Article Title: Altered dynamics of scaRNA2 and scaRNA9 in response to stress correlates with disrupted nuclear organization
    Article Snippet: .. For cell treatments, HeLa cells were grown at 37°C in DMEM (Dulbecco's Modification of Eagle's Medium) containing glucose, glutamine and sodium pyruvate supplemented with 10% fetal bovine serum until 70% confluent and then transfected with pcDNA3.1+scaRNA9 for 7 h. The cells were then subjected to the following treatments for 17 h (resulting in 24 h total DNA expression): 3 μg/ml cisplatin, 7.5 μM etoposide, 42°C incubation, 0.2 mM H2 O2 , DMEM without serum or incubation in Optimem reduced serum medium (Invitrogen). .. Northern blotting RNA was harvested using TRI-Reagent (Sigma-Aldrich) following the manufacturer's suggested protocol.

    Article Title: Evaluation of glutathione S‐transferase pi 1 expression and gene promoter methylation in Moroccan patients with urothelial bladder cancer, et al. Evaluation of glutathione S‐transferase pi 1 expression and gene promoter methylation in Moroccan patients with urothelial bladder cancer
    Article Snippet: Modified DNA was then desulfonated using desulfonation buffer and recovered in 10 μl of elution buffer. .. For PCR amplification, 2 μl of bisulfite‐converted DNA was added to mixtures containing 1× PCR buffer, 1.5 mM MgCl2 , 200 μM of each dNTP, 200 nM of each primer and 0.25 U Platinum Taq DNA polymerase (Invitrogen), in a final volume of 25 μl.

    Western Blot:

    Article Title: Serum and Ectopic Endometrium from Women with Endometriosis Modulate Macrophage M1/M2 Polarization via the Smad2/Smad3 Pathway
    Article Snippet: Paragraph title: 2.11. Western Blotting ... The THP-1 cells were harvested and lysed in 50 μ l lysis buffer (Thermo Fisher Scientific, Waltham, MA, USA).

    Transfection:

    Article Title: A Genome-Wide Scan for MicroRNA-Related Genetic Variants Associated With Primary Open-Angle Glaucoma
    Article Snippet: .. HEK293 cells (n = 10,000) were plated into 96-well plates and cotransfected with 1 μg pGL3 containing the 3′UTR with either the major or minor allele, miRNA mimic (mirVana Mimics; Thermo Fischer Scientific, Waltham, MA, USA), and a plasmid expressing the Renilla luciferase that served as transfection control, with Lipofectamine RNAiMAX (Invitrogen). .. Luciferase activity was measured with the Dual-Glo Luciferase Assay System according to manufacturer's protocol (Promega).

    Article Title: Dimerization confers increased stability to nucleases in 5′ halves from glycine and glutamic acid tRNAs
    Article Snippet: .. Fluorescence microscopy MCF-7 cells (1 × 104 ) were seeded onto 96-well plates and 24 h later were washed with PBS and transfected with 100 nM biotinylated RNAs (WT, 9GG/AA, 25U/C and SCR) using Lipofectamine 2000 (Invitrogen) following manufacturer's recommendations. ..

    Article Title: Conformational signatures in β-arrestin2 reveal natural biased agonism at a G-protein-coupled receptor
    Article Snippet: Reversal assay for dissociation kinetics One day before transfection, the cells were seeded in 96-well plates at a density of 2.5 × 104 cells per well. .. A mixture containing 50 ng β-arrestin2 construct containing the SmBit and 50 ng Galr2 containing the LgBiT at the C termini plus 0.2 μl Lipofectamine 2000 (Invitrogen) was prepared and added to each well.

    Article Title: Altered dynamics of scaRNA2 and scaRNA9 in response to stress correlates with disrupted nuclear organization
    Article Snippet: .. For cell treatments, HeLa cells were grown at 37°C in DMEM (Dulbecco's Modification of Eagle's Medium) containing glucose, glutamine and sodium pyruvate supplemented with 10% fetal bovine serum until 70% confluent and then transfected with pcDNA3.1+scaRNA9 for 7 h. The cells were then subjected to the following treatments for 17 h (resulting in 24 h total DNA expression): 3 μg/ml cisplatin, 7.5 μM etoposide, 42°C incubation, 0.2 mM H2 O2 , DMEM without serum or incubation in Optimem reduced serum medium (Invitrogen). .. Northern blotting RNA was harvested using TRI-Reagent (Sigma-Aldrich) following the manufacturer's suggested protocol.

    Article Title: Haemophilus parasuis Infection Disrupts Adherens Junctions and Initializes EMT Dependent on Canonical Wnt/β-Catenin Signaling Pathway
    Article Snippet: .. Plasmid transfection and luciferase assay To assess the activation of Wnt/β-catenin pathway, cells seeded in 96 well plates were transfected with 0.1 μg/well of either TOPflash or FOPflash and 0.1 μg/well of pRL-TK by 0.5 μg/well Lipofectamine 2000 (Invitrogen, USA) following the manufacturer's instructions. .. At 24 h after transfection, cells were treated or untreated with various inhibitors for 2 h before stimulation with H. parasuis or LiCl.

    Cell Culture:

    Article Title: Diphenyl diselenide protects neuronal cells against oxidative stress and mitochondrial dysfunction: Involvement of the glutathione-dependent antioxidant system
    Article Snippet: Paragraph title: Cell culture ... HT22 cells were maintained in DMEM supplemented with 5% (v/v) fetal bovine serum (FBS; Gibco/lnvitrogen), 2 mM glutamine, 100 units/mL penicillin, 100 μg/mL streptomycin, 10 mM Hepes, 24 mM glucose, 44 mM NaHCO3 and incubated at 37 °C in a humidified atmosphere of 5% CO2 .

    Article Title: SWI/SNF interacts with cleavage and polyadenylation factors and facilitates pre-mRNA 3′ end processing
    Article Snippet: Double-stranded RNAs (dsRNAs) complementary to dBRM or GFP were synthesized by in vitro transcription using the MegaScript RNAi kit (Ambion) from gene-specific PCR fragments with incorporated T7 promoters at both ends. .. 3 × 106 S2 cells were cultured in six-well plates overnight, washed with serum-free and antibiotic-free Schneider's medium, and treated with 30 μg of dsRNA per well.

    Article Title: Effects of Betaine on LPS-Stimulated Activation of Microglial M1/M2 Phenotypes by Suppressing TLR4/NF-κB Pathways in N9 Cells
    Article Snippet: .. In brief, N9 microglial cells was cultured in 96-well plates with betaine (1 μM–100 mM) and LPS (10 ng/mL–100 μg/mL) for 24 h. The cells were treated with betaine (0.125, 0.25, 0.5 and 1 mM) for 1 h and then treated with or without LPS (1 μg/mL) for 24 h. CCK-8 solution (10 μL) was added, and the plates were incubated at 37 °C for 3 h. The absorbance was measured at 450 nm using a plate reader (Thermo Scientific). .. For morphological analysis, cells were imaged with a laser scanning confocal microscope (Olympus, Tokyo, Japan) at 40× magnification.

    Labeling:

    Article Title: Clostridium difficile Biofilm: Remodeling Metabolism and Cell Surface to Build a Sparse and Heterogeneously Aggregated Architecture
    Article Snippet: .. Confocal Laser Scanning Microscopy (CLSM) After growth in micro-titer plates, biofilms were anaerobically stained for 2 h by the FilmtracerTM LIVE/DEAD® Biofilm Viability Kit (Thermo Fisher Scientific) at a 1/350 dilution (DNA-dyes SYTO 9 at 9.5 μM and propidium iodide at 57.1 μM, both labeling DNA, but only in damaged-membrane cells for the latter). .. The plate was then placed on the motorized stage of an inverted confocal microscope (TCS SP8 AOBS, Leica Microsystems) at INRA-MIMA2 platform .

    Generated:

    Article Title: Triglycerides Promote Lipid Homeostasis during Hypoxic Stress by Balancing Fatty Acid Saturation
    Article Snippet: .. After selection with puromycin and G418, the knockdown of both DGAT1 and DGAT2 transcripts was confirmed by qRT-PCR (Taqman probes; ThermoFisher) DGAT2 knockout cell lines were generated by cloning sgRNA sequences 5′-TGTGCTCTACTTCACTTGGC-3′ and 5′-GTACATGAGGATGGCACTGC-3′ into the lentiviral vector lentiCrisprv2 (Addgene), generating lentivirus in HEK293T cells and transducing ccRCC cell lines with 25μl of un-concentrated supernatant. .. After puromycin selection, single cell clones were generated by limiting dilutions in 96 well plates.

    Confocal Laser Scanning Microscopy:

    Article Title: Clostridium difficile Biofilm: Remodeling Metabolism and Cell Surface to Build a Sparse and Heterogeneously Aggregated Architecture
    Article Snippet: .. Confocal Laser Scanning Microscopy (CLSM) After growth in micro-titer plates, biofilms were anaerobically stained for 2 h by the FilmtracerTM LIVE/DEAD® Biofilm Viability Kit (Thermo Fisher Scientific) at a 1/350 dilution (DNA-dyes SYTO 9 at 9.5 μM and propidium iodide at 57.1 μM, both labeling DNA, but only in damaged-membrane cells for the latter). .. The plate was then placed on the motorized stage of an inverted confocal microscope (TCS SP8 AOBS, Leica Microsystems) at INRA-MIMA2 platform .

    Polymerase Chain Reaction:

    Article Title: SWI/SNF interacts with cleavage and polyadenylation factors and facilitates pre-mRNA 3′ end processing
    Article Snippet: .. Double-stranded RNAs (dsRNAs) complementary to dBRM or GFP were synthesized by in vitro transcription using the MegaScript RNAi kit (Ambion) from gene-specific PCR fragments with incorporated T7 promoters at both ends. .. The sequences of the PCR primers used for dsRNA synthesis are provided as additional text in the .

    Article Title: Triglycerides Promote Lipid Homeostasis during Hypoxic Stress by Balancing Fatty Acid Saturation
    Article Snippet: After selection with puromycin and G418, the knockdown of both DGAT1 and DGAT2 transcripts was confirmed by qRT-PCR (Taqman probes; ThermoFisher) DGAT2 knockout cell lines were generated by cloning sgRNA sequences 5′-TGTGCTCTACTTCACTTGGC-3′ and 5′-GTACATGAGGATGGCACTGC-3′ into the lentiviral vector lentiCrisprv2 (Addgene), generating lentivirus in HEK293T cells and transducing ccRCC cell lines with 25μl of un-concentrated supernatant. .. PCR of the DGAT2 locus was performed using DA182 (TCCTCTTGTCCCAGGAATCTGC) forward and DA184 CACTCAGGATGAGGCCCTTCAG reverse primers.

    Article Title: Evaluation of glutathione S‐transferase pi 1 expression and gene promoter methylation in Moroccan patients with urothelial bladder cancer, et al. Evaluation of glutathione S‐transferase pi 1 expression and gene promoter methylation in Moroccan patients with urothelial bladder cancer
    Article Snippet: .. For PCR amplification, 2 μl of bisulfite‐converted DNA was added to mixtures containing 1× PCR buffer, 1.5 mM MgCl2 , 200 μM of each dNTP, 200 nM of each primer and 0.25 U Platinum Taq DNA polymerase (Invitrogen), in a final volume of 25 μl. .. PCR reactions were carried out under the following conditions: first denaturation at 95°C for 2 min, 35 cycles of 30 s at 94°C, 30 s at 60°C, 30 s at 72°C and a final extension for 7 min at 72°C.

    Binding Assay:

    Article Title: A Genome-Wide Scan for MicroRNA-Related Genetic Variants Associated With Primary Open-Angle Glaucoma
    Article Snippet: The 3′UTR sequences containing putative binding site (wild type and mutated) of the miRNA were amplified and cloned into the pGL3 Luciferase reporter vector (Promega, Madison, WI, USA) downstream of the Luciferase open reading frame. .. HEK293 cells (n = 10,000) were plated into 96-well plates and cotransfected with 1 μg pGL3 containing the 3′UTR with either the major or minor allele, miRNA mimic (mirVana Mimics; Thermo Fischer Scientific, Waltham, MA, USA), and a plasmid expressing the Renilla luciferase that served as transfection control, with Lipofectamine RNAiMAX (Invitrogen).

    Fluorescence:

    Article Title: Dimerization confers increased stability to nucleases in 5′ halves from glycine and glutamic acid tRNAs
    Article Snippet: .. Fluorescence microscopy MCF-7 cells (1 × 104 ) were seeded onto 96-well plates and 24 h later were washed with PBS and transfected with 100 nM biotinylated RNAs (WT, 9GG/AA, 25U/C and SCR) using Lipofectamine 2000 (Invitrogen) following manufacturer's recommendations. ..

    Methylation:

    Article Title: Evaluation of glutathione S‐transferase pi 1 expression and gene promoter methylation in Moroccan patients with urothelial bladder cancer, et al. Evaluation of glutathione S‐transferase pi 1 expression and gene promoter methylation in Moroccan patients with urothelial bladder cancer
    Article Snippet: Paragraph title: Methylation‐specific PCR ... For PCR amplification, 2 μl of bisulfite‐converted DNA was added to mixtures containing 1× PCR buffer, 1.5 mM MgCl2 , 200 μM of each dNTP, 200 nM of each primer and 0.25 U Platinum Taq DNA polymerase (Invitrogen), in a final volume of 25 μl.

    Mutagenesis:

    Article Title: Triglycerides Promote Lipid Homeostasis during Hypoxic Stress by Balancing Fatty Acid Saturation
    Article Snippet: Paragraph title: DGAT mutant and knockdown lines ... After selection with puromycin and G418, the knockdown of both DGAT1 and DGAT2 transcripts was confirmed by qRT-PCR (Taqman probes; ThermoFisher) DGAT2 knockout cell lines were generated by cloning sgRNA sequences 5′-TGTGCTCTACTTCACTTGGC-3′ and 5′-GTACATGAGGATGGCACTGC-3′ into the lentiviral vector lentiCrisprv2 (Addgene), generating lentivirus in HEK293T cells and transducing ccRCC cell lines with 25μl of un-concentrated supernatant.

    Isolation:

    Article Title: Triglycerides Promote Lipid Homeostasis during Hypoxic Stress by Balancing Fatty Acid Saturation
    Article Snippet: After selection with puromycin and G418, the knockdown of both DGAT1 and DGAT2 transcripts was confirmed by qRT-PCR (Taqman probes; ThermoFisher) DGAT2 knockout cell lines were generated by cloning sgRNA sequences 5′-TGTGCTCTACTTCACTTGGC-3′ and 5′-GTACATGAGGATGGCACTGC-3′ into the lentiviral vector lentiCrisprv2 (Addgene), generating lentivirus in HEK293T cells and transducing ccRCC cell lines with 25μl of un-concentrated supernatant. .. Single-cell clones were expanded and genomic DNA was isolated from a portion of the expanded cell population.

    Microscopy:

    Article Title: Clostridium difficile Biofilm: Remodeling Metabolism and Cell Surface to Build a Sparse and Heterogeneously Aggregated Architecture
    Article Snippet: Confocal Laser Scanning Microscopy (CLSM) After growth in micro-titer plates, biofilms were anaerobically stained for 2 h by the FilmtracerTM LIVE/DEAD® Biofilm Viability Kit (Thermo Fisher Scientific) at a 1/350 dilution (DNA-dyes SYTO 9 at 9.5 μM and propidium iodide at 57.1 μM, both labeling DNA, but only in damaged-membrane cells for the latter). .. The plate was then placed on the motorized stage of an inverted confocal microscope (TCS SP8 AOBS, Leica Microsystems) at INRA-MIMA2 platform .

    Article Title: Dimerization confers increased stability to nucleases in 5′ halves from glycine and glutamic acid tRNAs
    Article Snippet: .. Fluorescence microscopy MCF-7 cells (1 × 104 ) were seeded onto 96-well plates and 24 h later were washed with PBS and transfected with 100 nM biotinylated RNAs (WT, 9GG/AA, 25U/C and SCR) using Lipofectamine 2000 (Invitrogen) following manufacturer's recommendations. ..

    Article Title: Effects of Betaine on LPS-Stimulated Activation of Microglial M1/M2 Phenotypes by Suppressing TLR4/NF-κB Pathways in N9 Cells
    Article Snippet: In brief, N9 microglial cells was cultured in 96-well plates with betaine (1 μM–100 mM) and LPS (10 ng/mL–100 μg/mL) for 24 h. The cells were treated with betaine (0.125, 0.25, 0.5 and 1 mM) for 1 h and then treated with or without LPS (1 μg/mL) for 24 h. CCK-8 solution (10 μL) was added, and the plates were incubated at 37 °C for 3 h. The absorbance was measured at 450 nm using a plate reader (Thermo Scientific). .. For morphological analysis, cells were imaged with a laser scanning confocal microscope (Olympus, Tokyo, Japan) at 40× magnification.

    Sequencing:

    Article Title: A Genome-Wide Scan for MicroRNA-Related Genetic Variants Associated With Primary Open-Angle Glaucoma
    Article Snippet: The inserts of all constructs were confirmed by Sanger sequencing. .. HEK293 cells (n = 10,000) were plated into 96-well plates and cotransfected with 1 μg pGL3 containing the 3′UTR with either the major or minor allele, miRNA mimic (mirVana Mimics; Thermo Fischer Scientific, Waltham, MA, USA), and a plasmid expressing the Renilla luciferase that served as transfection control, with Lipofectamine RNAiMAX (Invitrogen).

    Selection:

    Article Title: Triglycerides Promote Lipid Homeostasis during Hypoxic Stress by Balancing Fatty Acid Saturation
    Article Snippet: .. After selection with puromycin and G418, the knockdown of both DGAT1 and DGAT2 transcripts was confirmed by qRT-PCR (Taqman probes; ThermoFisher) DGAT2 knockout cell lines were generated by cloning sgRNA sequences 5′-TGTGCTCTACTTCACTTGGC-3′ and 5′-GTACATGAGGATGGCACTGC-3′ into the lentiviral vector lentiCrisprv2 (Addgene), generating lentivirus in HEK293T cells and transducing ccRCC cell lines with 25μl of un-concentrated supernatant. .. After puromycin selection, single cell clones were generated by limiting dilutions in 96 well plates.

    Quantitative RT-PCR:

    Article Title: Triglycerides Promote Lipid Homeostasis during Hypoxic Stress by Balancing Fatty Acid Saturation
    Article Snippet: .. After selection with puromycin and G418, the knockdown of both DGAT1 and DGAT2 transcripts was confirmed by qRT-PCR (Taqman probes; ThermoFisher) DGAT2 knockout cell lines were generated by cloning sgRNA sequences 5′-TGTGCTCTACTTCACTTGGC-3′ and 5′-GTACATGAGGATGGCACTGC-3′ into the lentiviral vector lentiCrisprv2 (Addgene), generating lentivirus in HEK293T cells and transducing ccRCC cell lines with 25μl of un-concentrated supernatant. .. After puromycin selection, single cell clones were generated by limiting dilutions in 96 well plates.

    Staining:

    Article Title: Clostridium difficile Biofilm: Remodeling Metabolism and Cell Surface to Build a Sparse and Heterogeneously Aggregated Architecture
    Article Snippet: .. Confocal Laser Scanning Microscopy (CLSM) After growth in micro-titer plates, biofilms were anaerobically stained for 2 h by the FilmtracerTM LIVE/DEAD® Biofilm Viability Kit (Thermo Fisher Scientific) at a 1/350 dilution (DNA-dyes SYTO 9 at 9.5 μM and propidium iodide at 57.1 μM, both labeling DNA, but only in damaged-membrane cells for the latter). .. The plate was then placed on the motorized stage of an inverted confocal microscope (TCS SP8 AOBS, Leica Microsystems) at INRA-MIMA2 platform .

    Article Title: Evaluation of glutathione S‐transferase pi 1 expression and gene promoter methylation in Moroccan patients with urothelial bladder cancer, et al. Evaluation of glutathione S‐transferase pi 1 expression and gene promoter methylation in Moroccan patients with urothelial bladder cancer
    Article Snippet: For PCR amplification, 2 μl of bisulfite‐converted DNA was added to mixtures containing 1× PCR buffer, 1.5 mM MgCl2 , 200 μM of each dNTP, 200 nM of each primer and 0.25 U Platinum Taq DNA polymerase (Invitrogen), in a final volume of 25 μl. .. The PCR products were directly loaded onto a 2% agarose gel, stained with ethidium bromide and visualized under UV illumination.

    Viability Assay:

    Article Title: Effects of Betaine on LPS-Stimulated Activation of Microglial M1/M2 Phenotypes by Suppressing TLR4/NF-κB Pathways in N9 Cells
    Article Snippet: Paragraph title: 4.2. Cell Viability Assay and Morphological Analysis ... In brief, N9 microglial cells was cultured in 96-well plates with betaine (1 μM–100 mM) and LPS (10 ng/mL–100 μg/mL) for 24 h. The cells were treated with betaine (0.125, 0.25, 0.5 and 1 mM) for 1 h and then treated with or without LPS (1 μg/mL) for 24 h. CCK-8 solution (10 μL) was added, and the plates were incubated at 37 °C for 3 h. The absorbance was measured at 450 nm using a plate reader (Thermo Scientific).

    Plasmid Preparation:

    Article Title: A Genome-Wide Scan for MicroRNA-Related Genetic Variants Associated With Primary Open-Angle Glaucoma
    Article Snippet: .. HEK293 cells (n = 10,000) were plated into 96-well plates and cotransfected with 1 μg pGL3 containing the 3′UTR with either the major or minor allele, miRNA mimic (mirVana Mimics; Thermo Fischer Scientific, Waltham, MA, USA), and a plasmid expressing the Renilla luciferase that served as transfection control, with Lipofectamine RNAiMAX (Invitrogen). .. Luciferase activity was measured with the Dual-Glo Luciferase Assay System according to manufacturer's protocol (Promega).

    Article Title: Triglycerides Promote Lipid Homeostasis during Hypoxic Stress by Balancing Fatty Acid Saturation
    Article Snippet: .. After selection with puromycin and G418, the knockdown of both DGAT1 and DGAT2 transcripts was confirmed by qRT-PCR (Taqman probes; ThermoFisher) DGAT2 knockout cell lines were generated by cloning sgRNA sequences 5′-TGTGCTCTACTTCACTTGGC-3′ and 5′-GTACATGAGGATGGCACTGC-3′ into the lentiviral vector lentiCrisprv2 (Addgene), generating lentivirus in HEK293T cells and transducing ccRCC cell lines with 25μl of un-concentrated supernatant. .. After puromycin selection, single cell clones were generated by limiting dilutions in 96 well plates.

    Article Title: Altered dynamics of scaRNA2 and scaRNA9 in response to stress correlates with disrupted nuclear organization
    Article Snippet: For experiments in which cells were transfected with DNA after siRNA treatment, siRNA treatment was for 24 h, followed by DNA transfection and incubation for an additional 24 h. At harvest, therefore, these cells were subjected to 48 h of siRNA treatment and 24 h of plasmid expression. .. For cell treatments, HeLa cells were grown at 37°C in DMEM (Dulbecco's Modification of Eagle's Medium) containing glucose, glutamine and sodium pyruvate supplemented with 10% fetal bovine serum until 70% confluent and then transfected with pcDNA3.1+scaRNA9 for 7 h. The cells were then subjected to the following treatments for 17 h (resulting in 24 h total DNA expression): 3 μg/ml cisplatin, 7.5 μM etoposide, 42°C incubation, 0.2 mM H2 O2 , DMEM without serum or incubation in Optimem reduced serum medium (Invitrogen).

    Article Title: Haemophilus parasuis Infection Disrupts Adherens Junctions and Initializes EMT Dependent on Canonical Wnt/β-Catenin Signaling Pathway
    Article Snippet: .. Plasmid transfection and luciferase assay To assess the activation of Wnt/β-catenin pathway, cells seeded in 96 well plates were transfected with 0.1 μg/well of either TOPflash or FOPflash and 0.1 μg/well of pRL-TK by 0.5 μg/well Lipofectamine 2000 (Invitrogen, USA) following the manufacturer's instructions. .. At 24 h after transfection, cells were treated or untreated with various inhibitors for 2 h before stimulation with H. parasuis or LiCl.

    Negative Control:

    Article Title: Altered dynamics of scaRNA2 and scaRNA9 in response to stress correlates with disrupted nuclear organization
    Article Snippet: Negative control SMN siRNAs were ordered from Integrated DNA Technologies (Coralville, USA). .. For cell treatments, HeLa cells were grown at 37°C in DMEM (Dulbecco's Modification of Eagle's Medium) containing glucose, glutamine and sodium pyruvate supplemented with 10% fetal bovine serum until 70% confluent and then transfected with pcDNA3.1+scaRNA9 for 7 h. The cells were then subjected to the following treatments for 17 h (resulting in 24 h total DNA expression): 3 μg/ml cisplatin, 7.5 μM etoposide, 42°C incubation, 0.2 mM H2 O2 , DMEM without serum or incubation in Optimem reduced serum medium (Invitrogen).

    shRNA:

    Article Title: Triglycerides Promote Lipid Homeostasis during Hypoxic Stress by Balancing Fatty Acid Saturation
    Article Snippet: DGAT mutant and knockdown lines DGAT1 and DGAT2 shRNA (specified as DGAT shRNA unless stated otherwise) was achieved by expressing Dox-inducible shDGAT2_5 (TRCN0000005195) using the Tet-pLKO-puro plasmid and shDGAT1_1 (TRCN0000036151) using the Tet-pLKO-neo. .. After selection with puromycin and G418, the knockdown of both DGAT1 and DGAT2 transcripts was confirmed by qRT-PCR (Taqman probes; ThermoFisher) DGAT2 knockout cell lines were generated by cloning sgRNA sequences 5′-TGTGCTCTACTTCACTTGGC-3′ and 5′-GTACATGAGGATGGCACTGC-3′ into the lentiviral vector lentiCrisprv2 (Addgene), generating lentivirus in HEK293T cells and transducing ccRCC cell lines with 25μl of un-concentrated supernatant.

    Agarose Gel Electrophoresis:

    Article Title: Evaluation of glutathione S‐transferase pi 1 expression and gene promoter methylation in Moroccan patients with urothelial bladder cancer, et al. Evaluation of glutathione S‐transferase pi 1 expression and gene promoter methylation in Moroccan patients with urothelial bladder cancer
    Article Snippet: For PCR amplification, 2 μl of bisulfite‐converted DNA was added to mixtures containing 1× PCR buffer, 1.5 mM MgCl2 , 200 μM of each dNTP, 200 nM of each primer and 0.25 U Platinum Taq DNA polymerase (Invitrogen), in a final volume of 25 μl. .. The PCR products were directly loaded onto a 2% agarose gel, stained with ethidium bromide and visualized under UV illumination.

    In Vitro:

    Article Title: SWI/SNF interacts with cleavage and polyadenylation factors and facilitates pre-mRNA 3′ end processing
    Article Snippet: .. Double-stranded RNAs (dsRNAs) complementary to dBRM or GFP were synthesized by in vitro transcription using the MegaScript RNAi kit (Ambion) from gene-specific PCR fragments with incorporated T7 promoters at both ends. .. The sequences of the PCR primers used for dsRNA synthesis are provided as additional text in the .

    CCK-8 Assay:

    Article Title: Effects of Betaine on LPS-Stimulated Activation of Microglial M1/M2 Phenotypes by Suppressing TLR4/NF-κB Pathways in N9 Cells
    Article Snippet: .. In brief, N9 microglial cells was cultured in 96-well plates with betaine (1 μM–100 mM) and LPS (10 ng/mL–100 μg/mL) for 24 h. The cells were treated with betaine (0.125, 0.25, 0.5 and 1 mM) for 1 h and then treated with or without LPS (1 μg/mL) for 24 h. CCK-8 solution (10 μL) was added, and the plates were incubated at 37 °C for 3 h. The absorbance was measured at 450 nm using a plate reader (Thermo Scientific). .. For morphological analysis, cells were imaged with a laser scanning confocal microscope (Olympus, Tokyo, Japan) at 40× magnification.

    Knock-Out:

    Article Title: Triglycerides Promote Lipid Homeostasis during Hypoxic Stress by Balancing Fatty Acid Saturation
    Article Snippet: .. After selection with puromycin and G418, the knockdown of both DGAT1 and DGAT2 transcripts was confirmed by qRT-PCR (Taqman probes; ThermoFisher) DGAT2 knockout cell lines were generated by cloning sgRNA sequences 5′-TGTGCTCTACTTCACTTGGC-3′ and 5′-GTACATGAGGATGGCACTGC-3′ into the lentiviral vector lentiCrisprv2 (Addgene), generating lentivirus in HEK293T cells and transducing ccRCC cell lines with 25μl of un-concentrated supernatant. .. After puromycin selection, single cell clones were generated by limiting dilutions in 96 well plates.

    DNA Methylation Assay:

    Article Title: Evaluation of glutathione S‐transferase pi 1 expression and gene promoter methylation in Moroccan patients with urothelial bladder cancer, et al. Evaluation of glutathione S‐transferase pi 1 expression and gene promoter methylation in Moroccan patients with urothelial bladder cancer
    Article Snippet: 2.3.2 Methylation‐specific PCR Extracted DNA was converted with sodium bisulfite using EZ DNA Methylation™ Kit (Zymo Research). .. For PCR amplification, 2 μl of bisulfite‐converted DNA was added to mixtures containing 1× PCR buffer, 1.5 mM MgCl2 , 200 μM of each dNTP, 200 nM of each primer and 0.25 U Platinum Taq DNA polymerase (Invitrogen), in a final volume of 25 μl.

    Activation Assay:

    Article Title: Haemophilus parasuis Infection Disrupts Adherens Junctions and Initializes EMT Dependent on Canonical Wnt/β-Catenin Signaling Pathway
    Article Snippet: .. Plasmid transfection and luciferase assay To assess the activation of Wnt/β-catenin pathway, cells seeded in 96 well plates were transfected with 0.1 μg/well of either TOPflash or FOPflash and 0.1 μg/well of pRL-TK by 0.5 μg/well Lipofectamine 2000 (Invitrogen, USA) following the manufacturer's instructions. .. At 24 h after transfection, cells were treated or untreated with various inhibitors for 2 h before stimulation with H. parasuis or LiCl.

    Lysis:

    Article Title: Serum and Ectopic Endometrium from Women with Endometriosis Modulate Macrophage M1/M2 Polarization via the Smad2/Smad3 Pathway
    Article Snippet: .. The THP-1 cells were harvested and lysed in 50 μ l lysis buffer (Thermo Fisher Scientific, Waltham, MA, USA). .. The mixture was centrifuged at 14000 rpm for 10 min. Total protein in the supernatant was quantified with a bicinchoninic acid (BCA) kit (Thermo Scientific Pierce, Rockford, IL, USA).

    Variant Assay:

    Article Title: A Genome-Wide Scan for MicroRNA-Related Genetic Variants Associated With Primary Open-Angle Glaucoma
    Article Snippet: In addition, this experiment was used to determine the impact of candidate variant on the miRNA–target gene interaction. .. HEK293 cells (n = 10,000) were plated into 96-well plates and cotransfected with 1 μg pGL3 containing the 3′UTR with either the major or minor allele, miRNA mimic (mirVana Mimics; Thermo Fischer Scientific, Waltham, MA, USA), and a plasmid expressing the Renilla luciferase that served as transfection control, with Lipofectamine RNAiMAX (Invitrogen).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher biofilms
    Loss of outer membrane integrity in strain RN102. Bacterial samples were collected from 48-hour-cultured <t>biofilms</t> for TEM analysis. TEM images of the bacterial cells and the cell appendages are shown for strains: (A) BW25113, (B) RN102, (C) BW25113/pNTR-SD, (D) RN102/pNTR-SD, and (E) RN102/pNT3( hldE ). The outer membranes are indicated by arrows. Representative electron-microphotographs of each strain are shown. A 500-nm-long bar is shown in the lower left corner of each eclectron-micrograph. (F) Western blot analysis of supernatants from BW25113 and RN102. Supernatants were harvested by centrifugation from bacterial liquid culture grown for 48 hours under static conditions. Results of Western blot using anti-Crp, anti-DsbA, anti-OmpC, and anti-OmpA antisera are shown. (G) Supernatants from bacterial liquid cultures of BW25113 or RN102 grown for 48 hours under static conditions were serially diluted with TE. The diluted samples were used as template DNA for PCR using E. coli atoS gene-specific primer pairs. Lanes: 1, without dilution; 2, 10 −1 dilution; 3, 10 −2 dilution; 4, 10 −3 dilution; 5, 10 −4 dilution; 6, 10 −5 dilution; 7, 10 −6 dilution.
    Biofilms, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 524 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/biofilms/product/Thermo Fisher
    Average 99 stars, based on 524 article reviews
    Price from $9.99 to $1999.99
    biofilms - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    86
    Thermo Fisher streptavidin coated 96 well maxisorp plates
    ), are shown. (B) Peptide A specificity of the MAbs in an ELISA. Biotin-conjugated peptide A was added to <t>streptavidin-coated</t> 96-well plates (200 ng/well). Each MAb (ascites fluid) was diluted 1:1,000 and used as the primary antibody. The y . An ELISA was performed with 1:20,000-diluted ascites fluid in the presence or absence of various concentrations of NaSCN as indicated. The specific binding affinity was calculated based on the values obtained with or without NaSCN. The data shown represent three independent experiments. Error bars represent the standard deviation.
    Streptavidin Coated 96 Well Maxisorp Plates, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/streptavidin coated 96 well maxisorp plates/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    streptavidin coated 96 well maxisorp plates - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    95
    Thermo Fisher viral genomic rna
    ABT-263 induces the premature death of cells <t>transfected</t> with IAV genomic <t>RNA</t> (vRNA) or plasmid DNA (pDNA). ( A ) Fluorescent microscopy images showing that ABT-263 kills vRNA-transfected (160 ng) but not mock-transfected RPE cells at 8 h post transfection. Asymmetric cyanine dye stains the dsDNA of dead cells. Hoechst stains DNA in living cells; ( B ) CTxG plot showing that ABT-263 (3 µM) induces that premature death of RPE cells transfected with increasing concentrations of vRNA. Mean ± SD, n = 3; ( C ) Fluorescent and bright field microscopy of RPE cells showing that ABT-263 kills eGFP-expressing plasmid transfected (300 ng) but not mock-transfected RPE cells at 6 h post transfection; ( D ) CTG graph showing that the viability of ABT-263-treated (3 µM) cells decreases with increasing concentrations of transfected plasmid DNA. Mean ± SD, n = 3.
    Viral Genomic Rna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/viral genomic rna/product/Thermo Fisher
    Average 95 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    viral genomic rna - by Bioz Stars, 2020-04
    95/100 stars
      Buy from Supplier

    98
    Thermo Fisher 96 well pcr plates
    Workflow outlining the major steps of the study. SYBR Green I-stained single sperm cells were isolated by fluorescence-activated cell sorting (FACS) to <t>96-well</t> <t>PCR</t> plates; DNA was amplified and used for next-generation sequencing
    96 Well Pcr Plates, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 98/100, based on 73 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/96 well pcr plates/product/Thermo Fisher
    Average 98 stars, based on 73 article reviews
    Price from $9.99 to $1999.99
    96 well pcr plates - by Bioz Stars, 2020-04
    98/100 stars
      Buy from Supplier

    Image Search Results


    Loss of outer membrane integrity in strain RN102. Bacterial samples were collected from 48-hour-cultured biofilms for TEM analysis. TEM images of the bacterial cells and the cell appendages are shown for strains: (A) BW25113, (B) RN102, (C) BW25113/pNTR-SD, (D) RN102/pNTR-SD, and (E) RN102/pNT3( hldE ). The outer membranes are indicated by arrows. Representative electron-microphotographs of each strain are shown. A 500-nm-long bar is shown in the lower left corner of each eclectron-micrograph. (F) Western blot analysis of supernatants from BW25113 and RN102. Supernatants were harvested by centrifugation from bacterial liquid culture grown for 48 hours under static conditions. Results of Western blot using anti-Crp, anti-DsbA, anti-OmpC, and anti-OmpA antisera are shown. (G) Supernatants from bacterial liquid cultures of BW25113 or RN102 grown for 48 hours under static conditions were serially diluted with TE. The diluted samples were used as template DNA for PCR using E. coli atoS gene-specific primer pairs. Lanes: 1, without dilution; 2, 10 −1 dilution; 3, 10 −2 dilution; 4, 10 −3 dilution; 5, 10 −4 dilution; 6, 10 −5 dilution; 7, 10 −6 dilution.

    Journal: PLoS ONE

    Article Title: Enhanced Biofilm Formation by Escherichia coli LPS Mutants Defective in Hep Biosynthesis

    doi: 10.1371/journal.pone.0051241

    Figure Lengend Snippet: Loss of outer membrane integrity in strain RN102. Bacterial samples were collected from 48-hour-cultured biofilms for TEM analysis. TEM images of the bacterial cells and the cell appendages are shown for strains: (A) BW25113, (B) RN102, (C) BW25113/pNTR-SD, (D) RN102/pNTR-SD, and (E) RN102/pNT3( hldE ). The outer membranes are indicated by arrows. Representative electron-microphotographs of each strain are shown. A 500-nm-long bar is shown in the lower left corner of each eclectron-micrograph. (F) Western blot analysis of supernatants from BW25113 and RN102. Supernatants were harvested by centrifugation from bacterial liquid culture grown for 48 hours under static conditions. Results of Western blot using anti-Crp, anti-DsbA, anti-OmpC, and anti-OmpA antisera are shown. (G) Supernatants from bacterial liquid cultures of BW25113 or RN102 grown for 48 hours under static conditions were serially diluted with TE. The diluted samples were used as template DNA for PCR using E. coli atoS gene-specific primer pairs. Lanes: 1, without dilution; 2, 10 −1 dilution; 3, 10 −2 dilution; 4, 10 −3 dilution; 5, 10 −4 dilution; 6, 10 −5 dilution; 7, 10 −6 dilution.

    Article Snippet: In order to quantify the amount of biofilm on a 96-well plate, all stain associated with the attached biofilms was dissolved with 95% ethanol, then OD595 absorbance was measured using a microplate reader (Multiskan RC, ThermoFisher, Waltham, MA).

    Techniques: Cell Culture, Transmission Electron Microscopy, Western Blot, Centrifugation, Polymerase Chain Reaction

    Contribution of eDNA to biofilm structure formed by RN102. (A–E) CLSM images of biofilms formed by strains: (A) BW25113 (B) RN102, (C) BW25113/pNTR-SD, (D) RN102/pNTR-SD, and (D) RN102/pNT3( hldE ). Images of biofilms stained with acrydine orange are shown as digital CLSM images. In each strain, a section which has the largest sum of signals in the defined area (127.3 μm by 127.3 μm) among all X–Y sections is shown in the upper row (X–Y). The overview of biofilms in the same area of each X–Y section is shown as 3D image in the lower row (3D). The volume of each 3D image (μm 3 ) in the area of the X–Y planes was quantified and the mean ± SD obtained from 3 different areas chosen at random are denoted in the upper-right corners. The data shown are representative microphotographs of two independent experiments. (F) Quantification of eDNA from BW25113 and RN102 strains. The bars represent the ratio of extracellular DNA to intracellular DNA (eDNA/iDNA). Results are shown as the mean ± SD from 3 independent experiments. * P

    Journal: PLoS ONE

    Article Title: Enhanced Biofilm Formation by Escherichia coli LPS Mutants Defective in Hep Biosynthesis

    doi: 10.1371/journal.pone.0051241

    Figure Lengend Snippet: Contribution of eDNA to biofilm structure formed by RN102. (A–E) CLSM images of biofilms formed by strains: (A) BW25113 (B) RN102, (C) BW25113/pNTR-SD, (D) RN102/pNTR-SD, and (D) RN102/pNT3( hldE ). Images of biofilms stained with acrydine orange are shown as digital CLSM images. In each strain, a section which has the largest sum of signals in the defined area (127.3 μm by 127.3 μm) among all X–Y sections is shown in the upper row (X–Y). The overview of biofilms in the same area of each X–Y section is shown as 3D image in the lower row (3D). The volume of each 3D image (μm 3 ) in the area of the X–Y planes was quantified and the mean ± SD obtained from 3 different areas chosen at random are denoted in the upper-right corners. The data shown are representative microphotographs of two independent experiments. (F) Quantification of eDNA from BW25113 and RN102 strains. The bars represent the ratio of extracellular DNA to intracellular DNA (eDNA/iDNA). Results are shown as the mean ± SD from 3 independent experiments. * P

    Article Snippet: In order to quantify the amount of biofilm on a 96-well plate, all stain associated with the attached biofilms was dissolved with 95% ethanol, then OD595 absorbance was measured using a microplate reader (Multiskan RC, ThermoFisher, Waltham, MA).

    Techniques: Confocal Laser Scanning Microscopy, Staining

    Biofilm formation and growth of a series of LPS mutants. (A) Biofilm formation by a series of core OS LPS mutants when compared to the parental strain, BW25113. The mean ± SD of results from 3 independent experiments are shown. Statistical analysis was performed using ANOVA. * P

    Journal: PLoS ONE

    Article Title: Enhanced Biofilm Formation by Escherichia coli LPS Mutants Defective in Hep Biosynthesis

    doi: 10.1371/journal.pone.0051241

    Figure Lengend Snippet: Biofilm formation and growth of a series of LPS mutants. (A) Biofilm formation by a series of core OS LPS mutants when compared to the parental strain, BW25113. The mean ± SD of results from 3 independent experiments are shown. Statistical analysis was performed using ANOVA. * P

    Article Snippet: In order to quantify the amount of biofilm on a 96-well plate, all stain associated with the attached biofilms was dissolved with 95% ethanol, then OD595 absorbance was measured using a microplate reader (Multiskan RC, ThermoFisher, Waltham, MA).

    Techniques:

    Loss of flagella in RN102. Fourty eight-hour-cultured biofilms were collected and analyzed by TEM, and by Western blot for FliC. (A–E) TEM images of the bacterial cells and the cell appendages are shown for strains (A) BW25113, (B) RN102, (C) BW25113/pNTR-SD, (D) RN102/pNTR-SD, and (E) RN102/pNT3( hldE ). Flagella found in figures (A), (C), and (E) are shown by arrowheads. Representative electron-microphotographs of each strain are shown. A 1-μm-long bar is shown in the lower left corner. (F) Supernatants were collected from 48-hour bacterial cultures. Result of Western blot using anti-FliC antiserum is shown. Lanes; 1, BW25113; 2, RN102; 3, BW25113/pNTR-SD; 4, RN102/pNTR-SD; 5, RN102/pNT3( hldE ); 6, RN110.

    Journal: PLoS ONE

    Article Title: Enhanced Biofilm Formation by Escherichia coli LPS Mutants Defective in Hep Biosynthesis

    doi: 10.1371/journal.pone.0051241

    Figure Lengend Snippet: Loss of flagella in RN102. Fourty eight-hour-cultured biofilms were collected and analyzed by TEM, and by Western blot for FliC. (A–E) TEM images of the bacterial cells and the cell appendages are shown for strains (A) BW25113, (B) RN102, (C) BW25113/pNTR-SD, (D) RN102/pNTR-SD, and (E) RN102/pNT3( hldE ). Flagella found in figures (A), (C), and (E) are shown by arrowheads. Representative electron-microphotographs of each strain are shown. A 1-μm-long bar is shown in the lower left corner. (F) Supernatants were collected from 48-hour bacterial cultures. Result of Western blot using anti-FliC antiserum is shown. Lanes; 1, BW25113; 2, RN102; 3, BW25113/pNTR-SD; 4, RN102/pNTR-SD; 5, RN102/pNT3( hldE ); 6, RN110.

    Article Snippet: In order to quantify the amount of biofilm on a 96-well plate, all stain associated with the attached biofilms was dissolved with 95% ethanol, then OD595 absorbance was measured using a microplate reader (Multiskan RC, ThermoFisher, Waltham, MA).

    Techniques: Cell Culture, Transmission Electron Microscopy, Western Blot

    ), are shown. (B) Peptide A specificity of the MAbs in an ELISA. Biotin-conjugated peptide A was added to streptavidin-coated 96-well plates (200 ng/well). Each MAb (ascites fluid) was diluted 1:1,000 and used as the primary antibody. The y . An ELISA was performed with 1:20,000-diluted ascites fluid in the presence or absence of various concentrations of NaSCN as indicated. The specific binding affinity was calculated based on the values obtained with or without NaSCN. The data shown represent three independent experiments. Error bars represent the standard deviation.

    Journal: Journal of Virology

    Article Title: Amino Acid Residue-Specific Neutralization and Nonneutralization of Hepatitis C Virus by Monoclonal Antibodies to the E2 Protein

    doi: 10.1128/JVI.00994-12

    Figure Lengend Snippet: ), are shown. (B) Peptide A specificity of the MAbs in an ELISA. Biotin-conjugated peptide A was added to streptavidin-coated 96-well plates (200 ng/well). Each MAb (ascites fluid) was diluted 1:1,000 and used as the primary antibody. The y . An ELISA was performed with 1:20,000-diluted ascites fluid in the presence or absence of various concentrations of NaSCN as indicated. The specific binding affinity was calculated based on the values obtained with or without NaSCN. The data shown represent three independent experiments. Error bars represent the standard deviation.

    Article Snippet: Biotin-conjugated peptide (200 ng/well) was added to streptavidin-coated 96-well Maxisorp plates (Thermo Fisher Scientific, Rockford, IL), followed by incubation at room temperature for 1 h in Super Block blocking buffer (Thermo Scientific).

    Techniques: Enzyme-linked Immunosorbent Assay, Binding Assay, Standard Deviation

    Use of mutational analysis to identify the residues that are critical for antibody recognition. (A) Biotin-conjugated peptides were chemically synthesized to represent the truncated peptide B, i.e., B short, from the E2 protein of HCV genotype 1a (H77 strain) and its mutations. The B short mutant peptides contained a single alanine substitution at positions 437, 438, 440, 441, and 442, respectively. A hyphen indicates an amino acid residue identical to that of the H77 sequence. (B) Biotin-conjugated B short peptide and its mutants were added to streptavidin-coated 96-well plates at 200 ng/well in an ELISA. Each MAb (ascites fluid) was diluted 1:10 5 dilution, and applied as the primary antibody. The data shown represent at least three independent experiments. The x axis indicates the antibodies used in the assay. The y axis indicates the absorbance at 405 nm, representing specific binding of a given antibody to each individual peptide.

    Journal: Journal of Virology

    Article Title: Amino Acid Residue-Specific Neutralization and Nonneutralization of Hepatitis C Virus by Monoclonal Antibodies to the E2 Protein

    doi: 10.1128/JVI.00994-12

    Figure Lengend Snippet: Use of mutational analysis to identify the residues that are critical for antibody recognition. (A) Biotin-conjugated peptides were chemically synthesized to represent the truncated peptide B, i.e., B short, from the E2 protein of HCV genotype 1a (H77 strain) and its mutations. The B short mutant peptides contained a single alanine substitution at positions 437, 438, 440, 441, and 442, respectively. A hyphen indicates an amino acid residue identical to that of the H77 sequence. (B) Biotin-conjugated B short peptide and its mutants were added to streptavidin-coated 96-well plates at 200 ng/well in an ELISA. Each MAb (ascites fluid) was diluted 1:10 5 dilution, and applied as the primary antibody. The data shown represent at least three independent experiments. The x axis indicates the antibodies used in the assay. The y axis indicates the absorbance at 405 nm, representing specific binding of a given antibody to each individual peptide.

    Article Snippet: Biotin-conjugated peptide (200 ng/well) was added to streptavidin-coated 96-well Maxisorp plates (Thermo Fisher Scientific, Rockford, IL), followed by incubation at room temperature for 1 h in Super Block blocking buffer (Thermo Scientific).

    Techniques: Synthesized, Mutagenesis, Sequencing, Enzyme-linked Immunosorbent Assay, Binding Assay

    ABT-263 induces the premature death of cells transfected with IAV genomic RNA (vRNA) or plasmid DNA (pDNA). ( A ) Fluorescent microscopy images showing that ABT-263 kills vRNA-transfected (160 ng) but not mock-transfected RPE cells at 8 h post transfection. Asymmetric cyanine dye stains the dsDNA of dead cells. Hoechst stains DNA in living cells; ( B ) CTxG plot showing that ABT-263 (3 µM) induces that premature death of RPE cells transfected with increasing concentrations of vRNA. Mean ± SD, n = 3; ( C ) Fluorescent and bright field microscopy of RPE cells showing that ABT-263 kills eGFP-expressing plasmid transfected (300 ng) but not mock-transfected RPE cells at 6 h post transfection; ( D ) CTG graph showing that the viability of ABT-263-treated (3 µM) cells decreases with increasing concentrations of transfected plasmid DNA. Mean ± SD, n = 3.

    Journal: Viruses

    Article Title: Antiviral Properties of Chemical Inhibitors of Cellular Anti-Apoptotic Bcl-2 Proteins

    doi: 10.3390/v9100271

    Figure Lengend Snippet: ABT-263 induces the premature death of cells transfected with IAV genomic RNA (vRNA) or plasmid DNA (pDNA). ( A ) Fluorescent microscopy images showing that ABT-263 kills vRNA-transfected (160 ng) but not mock-transfected RPE cells at 8 h post transfection. Asymmetric cyanine dye stains the dsDNA of dead cells. Hoechst stains DNA in living cells; ( B ) CTxG plot showing that ABT-263 (3 µM) induces that premature death of RPE cells transfected with increasing concentrations of vRNA. Mean ± SD, n = 3; ( C ) Fluorescent and bright field microscopy of RPE cells showing that ABT-263 kills eGFP-expressing plasmid transfected (300 ng) but not mock-transfected RPE cells at 6 h post transfection; ( D ) CTG graph showing that the viability of ABT-263-treated (3 µM) cells decreases with increasing concentrations of transfected plasmid DNA. Mean ± SD, n = 3.

    Article Snippet: Transfections of RPE Cells with vRNA or Plasmid DNA RPE cells were cultured to 80% confluence in 96 well plates and transfected with 160 ng viral genomic RNA using Lipofectamine RNAiMAX (Thermo Fisher Scientific, Waltham, MA, USA) or with 30, 100, or 300 ng of plasmid DNA (pEGFP) using Lipofectamine 3000 (Thermo Fisher Scientific, Waltham, MA, USA).

    Techniques: Transfection, Plasmid Preparation, Microscopy, Expressing, CTG Assay

    Workflow outlining the major steps of the study. SYBR Green I-stained single sperm cells were isolated by fluorescence-activated cell sorting (FACS) to 96-well PCR plates; DNA was amplified and used for next-generation sequencing

    Journal: Journal of Assisted Reproduction and Genetics

    Article Title: Chromosomal scan of single sperm cells by combining fluorescence-activated cell sorting and next-generation sequencing

    doi: 10.1007/s10815-018-1340-0

    Figure Lengend Snippet: Workflow outlining the major steps of the study. SYBR Green I-stained single sperm cells were isolated by fluorescence-activated cell sorting (FACS) to 96-well PCR plates; DNA was amplified and used for next-generation sequencing

    Article Snippet: Single sperms were collected into 96-well PCR plates (Thermo Fisher Scientific, USA) containing 3 μL PBS per well.

    Techniques: SYBR Green Assay, Staining, Isolation, Fluorescence, FACS, Polymerase Chain Reaction, Amplification, Next-Generation Sequencing