96 well plastic plate  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    96 Well Plate Plastic Non Coated
    Description:

    Catalog Number:
    60180-p101
    Price:
    None
    Buy from Supplier


    Structured Review

    Thermo Fisher 96 well plastic plate

    https://www.bioz.com/result/96 well plastic plate/product/Thermo Fisher
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    96 well plastic plate - by Bioz Stars, 2020-04
    99/100 stars

    Images

    Related Articles

    Enzyme-linked Immunosorbent Assay:

    Article Title: TET3 prevents terminal differentiation of adult NSCs by a non-catalytic action at Snrpn
    Article Snippet: Paragraph title: Immunoblotting and ELISA ... Double strand DNA was denatured at 98 °C during 10 min. DNA solutions were immobilized onto a 96-well plastic plate with Reacti-Bind DNA Coating Solution (Thermo Scientific) and incubated overnight at room temperature.

    Methylation:

    Article Title: TET3 prevents terminal differentiation of adult NSCs by a non-catalytic action at Snrpn
    Article Snippet: Double strand DNA was denatured at 98 °C during 10 min. DNA solutions were immobilized onto a 96-well plastic plate with Reacti-Bind DNA Coating Solution (Thermo Scientific) and incubated overnight at room temperature. .. The amounts of hydroxymethylated and methylated DNA were obtained by comparison to a standard curve of hydroxymethylated and methylated DNA standards (5-hmC, 5-mC, & cytosine DNA standard pack; Diagenode), respectively.

    Blocking Assay:

    Article Title: TET3 prevents terminal differentiation of adult NSCs by a non-catalytic action at Snrpn
    Article Snippet: Double strand DNA was denatured at 98 °C during 10 min. DNA solutions were immobilized onto a 96-well plastic plate with Reacti-Bind DNA Coating Solution (Thermo Scientific) and incubated overnight at room temperature. .. Sample solutions were removed and plates were washed three times with washing buffer (0.1 M PBS containing 0.1% Tween-20) and blocked with blocking buffer (0.1 M PBS containing 5% skimmed milk and 0.1% Tween-20) at room temperature for 1 h. After washing three times with the washing buffer, primary antibodies for 5hmC or 5mC (Supplementary Table ) were added and incubated at room temperature for 2 h. After three more washes, secondary antibodies (HRP-conjugated goat anti-rabbit IgG for 5hmC or anti-mouse for 5mC, 1:2000 each, DAKO) were added and incubated at room temperature for 1 h. After three washes, One-Step Ultra TMB-ELISA (Thermo Scientific) was added to the plate to develop chemiluminescent signals, and incubated at room temperature for 30 min or until the desired color appeared.

    SYBR Green Assay:

    Article Title: A role for human endogenous retrovirus-K (HML-2) in rheumatoid arthritis: investigating mechanisms of pathogenesis
    Article Snippet: Reagents [magnesium chloride (50 mM), reverse transcription buffer, deoxyribonucleoside triphosphates (dNTPs) and sterile nuclease-free water] were added to RNA and incubated at 42°C for 80 min and 95°C for 5 min. cDNA template (2·5 µl) was added to PCR mastermix containing 9 µl of nuclease-free dH2 O, 0·5 µl of each primer (100 nM) (Gag1 forward: GGGGCCATCAGAGTCTAAACC, Gag1 reverse: TGATAGGCTACTTGCGGTTGG) and 12·5 µl absolute SYBR green master mix (Abgene, Epsom, UK). .. Reagents were transferred to a 96-well plastic plate (Abgene) and run on an iCycler (Bio-Rad Laboratories, Hemel Hempstead, UK).

    Incubation:

    Article Title: A role for human endogenous retrovirus-K (HML-2) in rheumatoid arthritis: investigating mechanisms of pathogenesis
    Article Snippet: Reagents [magnesium chloride (50 mM), reverse transcription buffer, deoxyribonucleoside triphosphates (dNTPs) and sterile nuclease-free water] were added to RNA and incubated at 42°C for 80 min and 95°C for 5 min. cDNA template (2·5 µl) was added to PCR mastermix containing 9 µl of nuclease-free dH2 O, 0·5 µl of each primer (100 nM) (Gag1 forward: GGGGCCATCAGAGTCTAAACC, Gag1 reverse: TGATAGGCTACTTGCGGTTGG) and 12·5 µl absolute SYBR green master mix (Abgene, Epsom, UK). .. Reagents were transferred to a 96-well plastic plate (Abgene) and run on an iCycler (Bio-Rad Laboratories, Hemel Hempstead, UK).

    Article Title: TET3 prevents terminal differentiation of adult NSCs by a non-catalytic action at Snrpn
    Article Snippet: .. Double strand DNA was denatured at 98 °C during 10 min. DNA solutions were immobilized onto a 96-well plastic plate with Reacti-Bind DNA Coating Solution (Thermo Scientific) and incubated overnight at room temperature. .. Sample solutions were removed and plates were washed three times with washing buffer (0.1 M PBS containing 0.1% Tween-20) and blocked with blocking buffer (0.1 M PBS containing 5% skimmed milk and 0.1% Tween-20) at room temperature for 1 h. After washing three times with the washing buffer, primary antibodies for 5hmC or 5mC (Supplementary Table ) were added and incubated at room temperature for 2 h. After three more washes, secondary antibodies (HRP-conjugated goat anti-rabbit IgG for 5hmC or anti-mouse for 5mC, 1:2000 each, DAKO) were added and incubated at room temperature for 1 h. After three washes, One-Step Ultra TMB-ELISA (Thermo Scientific) was added to the plate to develop chemiluminescent signals, and incubated at room temperature for 30 min or until the desired color appeared.

    Polymerase Chain Reaction:

    Article Title: A role for human endogenous retrovirus-K (HML-2) in rheumatoid arthritis: investigating mechanisms of pathogenesis
    Article Snippet: Reagents [magnesium chloride (50 mM), reverse transcription buffer, deoxyribonucleoside triphosphates (dNTPs) and sterile nuclease-free water] were added to RNA and incubated at 42°C for 80 min and 95°C for 5 min. cDNA template (2·5 µl) was added to PCR mastermix containing 9 µl of nuclease-free dH2 O, 0·5 µl of each primer (100 nM) (Gag1 forward: GGGGCCATCAGAGTCTAAACC, Gag1 reverse: TGATAGGCTACTTGCGGTTGG) and 12·5 µl absolute SYBR green master mix (Abgene, Epsom, UK). .. Reagents were transferred to a 96-well plastic plate (Abgene) and run on an iCycler (Bio-Rad Laboratories, Hemel Hempstead, UK).

    Real-time Polymerase Chain Reaction:

    Article Title: A role for human endogenous retrovirus-K (HML-2) in rheumatoid arthritis: investigating mechanisms of pathogenesis
    Article Snippet: Paragraph title: Real-time PCR reactions ... Reagents were transferred to a 96-well plastic plate (Abgene) and run on an iCycler (Bio-Rad Laboratories, Hemel Hempstead, UK).

    Software:

    Article Title: TET3 prevents terminal differentiation of adult NSCs by a non-catalytic action at Snrpn
    Article Snippet: Proteins were revealed using Lightning® Plus ECL (Perkin Elmer) and the bands were analyzed by densitometry using ImageJ (NIH) software. .. Double strand DNA was denatured at 98 °C during 10 min. DNA solutions were immobilized onto a 96-well plastic plate with Reacti-Bind DNA Coating Solution (Thermo Scientific) and incubated overnight at room temperature.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher 96 well cell bind plates
    Characterization of an anti–Gremlin 1 mAb. A : Biacore analysis of 16E3-2-1 to recombinant mouse (rm) Gremlin 1. CM5 chip was immobilized with mouse 20 nmol/L mouse Gremlin 1 (R D Systems, Minneapolis, MN) followed by binding of mAb 16E3-2-1 in a range of concentration from 1.6 to 50 nmol/L (series of 1:2 dilution). B : RGA analysis of anti–Gremlin 1 mAb on bone morphogenetic protein (BMP) signaling. HEK293 cells were stably transfected with the BMP reporter BRE-Luc (BMP response element fused to luciferase reporter) construct and BMP4 stimulation induced luciferase activity, which was reduced in cells treated with rmGremlin 1. Treatment with 16E3-2-1 mAb restores BMP-mediated increases in BRE-LUC activity in a dose- dependent manner in cells treated with both BMP4 and rmGremlin. C : Immunofluorescence analysis of pulmonary arterial smooth muscle cells (PASMCs) treated with BMP4 and recombinant human (rh)Gremlin. PASMCS were grown in <t>96-well</t> cell bind plates and treated for 1 hour with 80 ng/mL BMP4, ±1 μg/mL rhGremlin 1 for 1 hour, ±10 μg/mL anti–Gremlin 1 mAb 16E3-2-1. PASMCs were fixed and stained with an anti phospho-smad1/5/8/antibody and Hoechst dye. Phospho-smad1/5/8 nuclear translocation is seen as a pink nucleus. D : Quantification of phospho-smad1/5/8/and DAPI staining in PASMCS using high content screening. Each bar shows means ± SEM of two independent experiments performed in triplicate. Similar results were seen with different PASMC donor cells (data not shown). Statistical significance was determined using Student's t -test. ∗ P
    96 Well Cell Bind Plates, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 143 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/96 well cell bind plates/product/Thermo Fisher
    Average 99 stars, based on 143 article reviews
    Price from $9.99 to $1999.99
    96 well cell bind plates - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    Characterization of an anti–Gremlin 1 mAb. A : Biacore analysis of 16E3-2-1 to recombinant mouse (rm) Gremlin 1. CM5 chip was immobilized with mouse 20 nmol/L mouse Gremlin 1 (R D Systems, Minneapolis, MN) followed by binding of mAb 16E3-2-1 in a range of concentration from 1.6 to 50 nmol/L (series of 1:2 dilution). B : RGA analysis of anti–Gremlin 1 mAb on bone morphogenetic protein (BMP) signaling. HEK293 cells were stably transfected with the BMP reporter BRE-Luc (BMP response element fused to luciferase reporter) construct and BMP4 stimulation induced luciferase activity, which was reduced in cells treated with rmGremlin 1. Treatment with 16E3-2-1 mAb restores BMP-mediated increases in BRE-LUC activity in a dose- dependent manner in cells treated with both BMP4 and rmGremlin. C : Immunofluorescence analysis of pulmonary arterial smooth muscle cells (PASMCs) treated with BMP4 and recombinant human (rh)Gremlin. PASMCS were grown in 96-well cell bind plates and treated for 1 hour with 80 ng/mL BMP4, ±1 μg/mL rhGremlin 1 for 1 hour, ±10 μg/mL anti–Gremlin 1 mAb 16E3-2-1. PASMCs were fixed and stained with an anti phospho-smad1/5/8/antibody and Hoechst dye. Phospho-smad1/5/8 nuclear translocation is seen as a pink nucleus. D : Quantification of phospho-smad1/5/8/and DAPI staining in PASMCS using high content screening. Each bar shows means ± SEM of two independent experiments performed in triplicate. Similar results were seen with different PASMC donor cells (data not shown). Statistical significance was determined using Student's t -test. ∗ P

    Journal: The American Journal of Pathology

    Article Title: Treatment with Anti–Gremlin 1 Antibody Ameliorates Chronic Hypoxia/SU5416–Induced Pulmonary Arterial Hypertension in Mice

    doi: 10.1016/j.ajpath.2013.07.017

    Figure Lengend Snippet: Characterization of an anti–Gremlin 1 mAb. A : Biacore analysis of 16E3-2-1 to recombinant mouse (rm) Gremlin 1. CM5 chip was immobilized with mouse 20 nmol/L mouse Gremlin 1 (R D Systems, Minneapolis, MN) followed by binding of mAb 16E3-2-1 in a range of concentration from 1.6 to 50 nmol/L (series of 1:2 dilution). B : RGA analysis of anti–Gremlin 1 mAb on bone morphogenetic protein (BMP) signaling. HEK293 cells were stably transfected with the BMP reporter BRE-Luc (BMP response element fused to luciferase reporter) construct and BMP4 stimulation induced luciferase activity, which was reduced in cells treated with rmGremlin 1. Treatment with 16E3-2-1 mAb restores BMP-mediated increases in BRE-LUC activity in a dose- dependent manner in cells treated with both BMP4 and rmGremlin. C : Immunofluorescence analysis of pulmonary arterial smooth muscle cells (PASMCs) treated with BMP4 and recombinant human (rh)Gremlin. PASMCS were grown in 96-well cell bind plates and treated for 1 hour with 80 ng/mL BMP4, ±1 μg/mL rhGremlin 1 for 1 hour, ±10 μg/mL anti–Gremlin 1 mAb 16E3-2-1. PASMCs were fixed and stained with an anti phospho-smad1/5/8/antibody and Hoechst dye. Phospho-smad1/5/8 nuclear translocation is seen as a pink nucleus. D : Quantification of phospho-smad1/5/8/and DAPI staining in PASMCS using high content screening. Each bar shows means ± SEM of two independent experiments performed in triplicate. Similar results were seen with different PASMC donor cells (data not shown). Statistical significance was determined using Student's t -test. ∗ P

    Article Snippet: PASMCS were grown in 96-well Cell-Bind plates (Costar; Thermofisher Scientific, Basingstoke, UK) and treated for 1 hour with 80 ng/mL BMP4, ±1 μg/mL rh Gremlin 1 for 1 hour, ±10 μg/mL anti–Gremlin 1 mAb 16E3-2-1.

    Techniques: Recombinant, Chromatin Immunoprecipitation, Binding Assay, Concentration Assay, Stable Transfection, Transfection, Luciferase, Construct, Activity Assay, Immunofluorescence, Staining, Translocation Assay, High Content Screening

    Anti-biofilm activities of AMPs. In 96-well microtiter plates C. albicans was allowed to establish a biofilm for (A,B) 1 h and (C) 24 h before 0–40 μM of (A) protein and (B,C) peptide variants were added. H 2 O 2 (0–40 mM) served as a positive control. Values represent the mean of three replicates. Values represent mean ± SD.

    Journal: Frontiers in Microbiology

    Article Title: The Evolutionary Conserved γ-Core Motif Influences the Anti-Candida Activity of the Penicillium chrysogenum Antifungal Protein PAF

    doi: 10.3389/fmicb.2018.01655

    Figure Lengend Snippet: Anti-biofilm activities of AMPs. In 96-well microtiter plates C. albicans was allowed to establish a biofilm for (A,B) 1 h and (C) 24 h before 0–40 μM of (A) protein and (B,C) peptide variants were added. H 2 O 2 (0–40 mM) served as a positive control. Values represent the mean of three replicates. Values represent mean ± SD.

    Article Snippet: Antifungal Activity Determination The MIC of all protein and peptide variants was determined on C. albicans with broth microdilution assays in 96-well microtiter plates (Nunclon Delta, Thermo Fisher Scientific).

    Techniques: Positive Control

    Spheroids growth using different techniques, a comparison between spheroids that were prepared using the following formats: 96 well plate with agarose; Rounded bottom 96 well plate; 3D petri dish with 35 wells; Hanging drop method. Spheroids were made of 5,000 cells per spheroid. Assembly time was 3 days for all methods except the hanging drop method which was 5 days. Bar = 100 µm.

    Journal: Scientific Reports

    Article Title: Tumor cells and their crosstalk with endothelial cells in 3D spheroids

    doi: 10.1038/s41598-017-10699-y

    Figure Lengend Snippet: Spheroids growth using different techniques, a comparison between spheroids that were prepared using the following formats: 96 well plate with agarose; Rounded bottom 96 well plate; 3D petri dish with 35 wells; Hanging drop method. Spheroids were made of 5,000 cells per spheroid. Assembly time was 3 days for all methods except the hanging drop method which was 5 days. Bar = 100 µm.

    Article Snippet: Spheroids formation using multi-well agarose-coated plates Agarose hydrogel 1.5% (100 µl) was added to each well of a 96-well culture plate (Thermo Fisher Scientific, Denmark), and incubated at 37 °C for 2 hours.

    Techniques: