reverse transcribed  (Bio-Rad)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    Name:
    C1000 Manager Software
    Description:
    PC software for the C1000 Thermal Cycler allows control of up to 32 thermal cyclers simultaneously
    Catalog Number:
    1844000
    Price:
    None
    Buy from Supplier


    Structured Review

    Bio-Rad reverse transcribed
    C1000 Manager Software
    PC software for the C1000 Thermal Cycler allows control of up to 32 thermal cyclers simultaneously
    https://www.bioz.com/result/reverse transcribed/product/Bio-Rad
    Average 92 stars, based on 35266 article reviews
    Price from $9.99 to $1999.99
    reverse transcribed - by Bioz Stars, 2020-08
    92/100 stars

    Images

    Related Articles

    SYBR Green Assay:

    Article Title: Preclinical Development of siRNA Therapeutics for AL Amyloidosis
    Article Snippet: .. Subsequently, cDNA was synthesized using the iScript™ cDNA Synthesis Kit (Bio-Rad) following the manufacturer’s instructions. qPCR was performed on a BioRad C1000 Thermocycler using Sybr green (BioRad) with primers for AL-009-κ1 LC (forward primer: CACCCTGACGCTGAGCAAA, reverse: TGACTTCGCAGGCGTAGACTT, product size 59 nt), GAPDH, used as a housekeeping gene control (forward primer: CAACGGGAAGCCCATCAC, reverse: GCCTCACCCCATTTGATGTTA, product size 63 nt), and mouse Blimp1, used as a plasma cell specific control (primers: AAAGGACATGGATGGCTTTCG and GTGCCCGGATAGGATAAACCA, product size 80 nt). .. LC primers were designed by Primer Express (Applied Biosystems); GAPDH and Blimp1 primers were designed using Primer Blast (NCBI).

    Article Title: Transcription Factor KLF5 Binds a Cyclin E1 Polymorphic Intronic Enhancer to Confer Increased Bladder Cancer Risk
    Article Snippet: .. qPCR and qRT-PCR were performed using the iQ SYBR Green Supermix (BioRad) and analyzed on a C1000 Thermal Cycler (BioRad) using the BioRad CFX Manager 2.0 software. .. Due to the high GC content within the CCNE1 intronic region, PCR was performed using HotStarTaq DNA Polymerase (Qiagen).

    Amplification:

    Article Title: Quantitative molecular diagnostic assays of grain washes for Claviceps purpurea are correlated with visual determinations of ergot contamination
    Article Snippet: .. Amplification was carried out using a CFX96 real-time system with a C1000 base (Bio-Rad) and reactions were quantified using BioRad CFX manager software (v.3.1). .. The slope of the line resulting from plotting threshold cycle (Cq ) values vs. log10 copy number was used to determine PCR efficiency according to E = 10(-1/slope) , where 2.0 is theoretical [ ].

    RNA Sequencing Assay:

    Article Title: ZMYM2 inhibits NANOG-mediated reprogramming
    Article Snippet: .. Depletion of ribosomal RNA was performed on 2-5 μg of total RNA using the Ribo-Zero rRNA Removal Kit (Illumina) and libraries were produced from 10-100ng of ribosomal-depleted RNA using NextFlex Rapid Directional RNA-seq Kit (5138-07; Bioo Scientific), a Biorad C1000 thermocycler, and standard Illumina primers. .. Libraries were pooled in equimolar quantities and sequenced on the HiSeq4000 platform (Illumina), using V4 chemistry.

    Synthesized:

    Article Title: Preclinical Development of siRNA Therapeutics for AL Amyloidosis
    Article Snippet: .. Subsequently, cDNA was synthesized using the iScript™ cDNA Synthesis Kit (Bio-Rad) following the manufacturer’s instructions. qPCR was performed on a BioRad C1000 Thermocycler using Sybr green (BioRad) with primers for AL-009-κ1 LC (forward primer: CACCCTGACGCTGAGCAAA, reverse: TGACTTCGCAGGCGTAGACTT, product size 59 nt), GAPDH, used as a housekeeping gene control (forward primer: CAACGGGAAGCCCATCAC, reverse: GCCTCACCCCATTTGATGTTA, product size 63 nt), and mouse Blimp1, used as a plasma cell specific control (primers: AAAGGACATGGATGGCTTTCG and GTGCCCGGATAGGATAAACCA, product size 80 nt). .. LC primers were designed by Primer Express (Applied Biosystems); GAPDH and Blimp1 primers were designed using Primer Blast (NCBI).

    Quantitative RT-PCR:

    Article Title: Transcription Factor KLF5 Binds a Cyclin E1 Polymorphic Intronic Enhancer to Confer Increased Bladder Cancer Risk
    Article Snippet: .. qPCR and qRT-PCR were performed using the iQ SYBR Green Supermix (BioRad) and analyzed on a C1000 Thermal Cycler (BioRad) using the BioRad CFX Manager 2.0 software. .. Due to the high GC content within the CCNE1 intronic region, PCR was performed using HotStarTaq DNA Polymerase (Qiagen).

    Real-time Polymerase Chain Reaction:

    Article Title: Preclinical Development of siRNA Therapeutics for AL Amyloidosis
    Article Snippet: .. Subsequently, cDNA was synthesized using the iScript™ cDNA Synthesis Kit (Bio-Rad) following the manufacturer’s instructions. qPCR was performed on a BioRad C1000 Thermocycler using Sybr green (BioRad) with primers for AL-009-κ1 LC (forward primer: CACCCTGACGCTGAGCAAA, reverse: TGACTTCGCAGGCGTAGACTT, product size 59 nt), GAPDH, used as a housekeeping gene control (forward primer: CAACGGGAAGCCCATCAC, reverse: GCCTCACCCCATTTGATGTTA, product size 63 nt), and mouse Blimp1, used as a plasma cell specific control (primers: AAAGGACATGGATGGCTTTCG and GTGCCCGGATAGGATAAACCA, product size 80 nt). .. LC primers were designed by Primer Express (Applied Biosystems); GAPDH and Blimp1 primers were designed using Primer Blast (NCBI).

    Article Title: Transcription Factor KLF5 Binds a Cyclin E1 Polymorphic Intronic Enhancer to Confer Increased Bladder Cancer Risk
    Article Snippet: .. qPCR and qRT-PCR were performed using the iQ SYBR Green Supermix (BioRad) and analyzed on a C1000 Thermal Cycler (BioRad) using the BioRad CFX Manager 2.0 software. .. Due to the high GC content within the CCNE1 intronic region, PCR was performed using HotStarTaq DNA Polymerase (Qiagen).

    Article Title: Yeast heterochromatin regulators Sir2 and Sir3 act directly at euchromatic DNA replication origins
    Article Snippet: .. rDNA copy number determination Quantitative PCR reactions were carried out in sealed 200 ul microplates in a BioRad C1000 Thermocycler, CFX96 Real-Time System. ..

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Comprehensive identification of the full-length transcripts and alternative splicing related to the secondary metabolism pathways in the tea plant (Camellia sinensis)
    Article Snippet: .. The RT-PCR reactions were performed in a BIO-RAD C1000 PCR System, and the PCR amplifications were performed in 20 μl reaction mixtures, which contained 10 μl of Premix Taq (TaKaRa), 1 μl of template cDNA, 1 μl of each primer and 7 µl of sterile double distilled water. .. The PCR products were examined on 2.0% agarose gels.

    Polymerase Chain Reaction:

    Article Title: Comprehensive identification of the full-length transcripts and alternative splicing related to the secondary metabolism pathways in the tea plant (Camellia sinensis)
    Article Snippet: .. The RT-PCR reactions were performed in a BIO-RAD C1000 PCR System, and the PCR amplifications were performed in 20 μl reaction mixtures, which contained 10 μl of Premix Taq (TaKaRa), 1 μl of template cDNA, 1 μl of each primer and 7 µl of sterile double distilled water. .. The PCR products were examined on 2.0% agarose gels.

    Article Title: CD4 is expressed on a heterogeneous subset of hematopoietic progenitors, which persistently harbor CXCR4 and CCR5-tropic HIV proviral genomes in vivo
    Article Snippet: .. PCR assays were performed using a BioRad C1000 thermocycler as described in . .. Amplicons were sequenced directly from the purified gel band.

    Produced:

    Article Title: ZMYM2 inhibits NANOG-mediated reprogramming
    Article Snippet: .. Depletion of ribosomal RNA was performed on 2-5 μg of total RNA using the Ribo-Zero rRNA Removal Kit (Illumina) and libraries were produced from 10-100ng of ribosomal-depleted RNA using NextFlex Rapid Directional RNA-seq Kit (5138-07; Bioo Scientific), a Biorad C1000 thermocycler, and standard Illumina primers. .. Libraries were pooled in equimolar quantities and sequenced on the HiSeq4000 platform (Illumina), using V4 chemistry.

    Software:

    Article Title: Quantitative molecular diagnostic assays of grain washes for Claviceps purpurea are correlated with visual determinations of ergot contamination
    Article Snippet: .. Amplification was carried out using a CFX96 real-time system with a C1000 base (Bio-Rad) and reactions were quantified using BioRad CFX manager software (v.3.1). .. The slope of the line resulting from plotting threshold cycle (Cq ) values vs. log10 copy number was used to determine PCR efficiency according to E = 10(-1/slope) , where 2.0 is theoretical [ ].

    Article Title: Transcription Factor KLF5 Binds a Cyclin E1 Polymorphic Intronic Enhancer to Confer Increased Bladder Cancer Risk
    Article Snippet: .. qPCR and qRT-PCR were performed using the iQ SYBR Green Supermix (BioRad) and analyzed on a C1000 Thermal Cycler (BioRad) using the BioRad CFX Manager 2.0 software. .. Due to the high GC content within the CCNE1 intronic region, PCR was performed using HotStarTaq DNA Polymerase (Qiagen).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    Bio-Rad abi prism 7900ht
    Thermal variability upon amplification of 18s rRNA using 5 ng/µl human genomic DNA. (A) CFX96, (B) xxpress®, (C) <t>ABI</t> Prism <t>7900HT</t> and (D) Rotor-Gene Q.
    Abi Prism 7900ht, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 92/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/abi prism 7900ht/product/Bio-Rad
    Average 92 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    abi prism 7900ht - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    93
    Bio-Rad 7900ht real time pcr system
    Thermal variability upon amplification of 18s rRNA using 5 ng/µl human genomic DNA. (A) CFX96, (B) xxpress®, (C) <t>ABI</t> Prism <t>7900HT</t> and (D) Rotor-Gene Q.
    7900ht Real Time Pcr System, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 93/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/7900ht real time pcr system/product/Bio-Rad
    Average 93 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    7900ht real time pcr system - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    Image Search Results


    Thermal variability upon amplification of 18s rRNA using 5 ng/µl human genomic DNA. (A) CFX96, (B) xxpress®, (C) ABI Prism 7900HT and (D) Rotor-Gene Q.

    Journal: Experimental and Therapeutic Medicine

    Article Title: Amplification efficiency and thermal stability of qPCR instrumentation: Current landscape and future perspectives

    doi: 10.3892/etm.2015.2712

    Figure Lengend Snippet: Thermal variability upon amplification of 18s rRNA using 5 ng/µl human genomic DNA. (A) CFX96, (B) xxpress®, (C) ABI Prism 7900HT and (D) Rotor-Gene Q.

    Article Snippet: Thermal variability was assessed in qPCR by measuring the amplification of 18S rRNA in a selection of wells covering all areas of the sample plate on ABI Prism 7900HT, Bio-Rad CFX96 System, Qiagen Rotor-Gene Q and BJS Biotechnologies xxpress instruments.

    Techniques: Amplification