7900ht fast real time polymerase chain reaction system  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    7900HT Fast Real Time PCR System
    Description:
    The 7900HT Fast Real Time PCR System is a real time quantitative PCR system that combines 96 and 384 well plate compatibility and the TaqMan Low Density Array with fully automated robotic loading and now also offers optional Fast real time PCR capability • Fast PCR option reduces run time to about 35 minutes in a standard 96 well format or about 55 minutes in a 384 well plate• Continuous wavelength detection from 500 660 nm allows the use of multiple fluorophores in a single reaction• Measure gene expression levels detect and quantitate pathogens perform allelic discrimination SNP genotyping assays as well as score the presence of gene sequences• 96 or 384 well plate compatibility including the TaqMan Low Density Array • Optional Enterprise edition software provides data analysis tools that support 21 CFR Part 11 guidelines providing data integrity and security• Hands free plate loading and unloading provides true walkaway automation allowing you to increase your lab s productivity• Proven assay development guidelines save time and moneyHigh ThroughputThe 7900HT System is a high throughput real time PCR system that detects and quantitates nucleic acid sequences An optional Automation Accessory not included combined with 384 well plate capability make the 7900HT system ideally suited to meet the high throughput requirements of today s drug discovery process Key applications include gene expression quantitation and the detection of single nucleotide polymorphisms SNPs using the fluorogenic 5 nuclease assay FlexibilityThe 7900HT system is a versatile research tool that can accommodate any real time PCR need User interchangeable thermal cycling block formats let you select the format that s right for your project using industry standard 96 and 384 well formats as well as a novel 384 well TaqMan Low Density Array and a new Fast 96 well block that reduces run times from 2 hours to about 30 minutes An easy automation upgrade path lets you add features to meet throughput demands A Fast PCR option reduces run times from 2 hours to about 30 minutes Powerful SoftwareUsing two automation software tools Plate Utility and Automation Controller most of the gene expression and SNP genotyping workflow is fully automated for high throughput applications and requires minimal user intervention You can now process 5 000 x 384 well plates 384 markers which equates to 1 92 million genotypes Using Relative Quantification RQ Manager you can also process 200 x 384 well plates 96 detectors with quadruplicate data points⁄multiplexed endogenous control which equates to 153 600 data points Fully integrated into one complete Enterprise system SNP Manager and RQ Manager eliminate data analysis bottlenecks in high throughput SNP and gene expression research by allowing significantly more plates to be analyzed simultaneously This reduces hands on analysis time and simplifies the data analysis workflow For Research Use Only Not for use in diagnostics procedures
    Catalog Number:
    4329001
    Price:
    None
    Applications:
    Fast Real-Time PCR|Genotyping & Genomic Profiling|PCR & Real-Time PCR|Real Time PCR (qPCR)|Real Time PCR-Based Gene Expression Profiling|Real-Time PCR Instruments, Software & Calibration|High Resolution Melting (HRM) Analysis|SNP Genotyping|Genotyping Instruments, Software & Calibration|Gene Expression Analysis & Genotyping
    Category:
    Instruments and Equipment
    Buy from Supplier


    Structured Review

    Thermo Fisher 7900ht fast real time polymerase chain reaction system
    The 7900HT Fast Real Time PCR System is a real time quantitative PCR system that combines 96 and 384 well plate compatibility and the TaqMan Low Density Array with fully automated robotic loading and now also offers optional Fast real time PCR capability • Fast PCR option reduces run time to about 35 minutes in a standard 96 well format or about 55 minutes in a 384 well plate• Continuous wavelength detection from 500 660 nm allows the use of multiple fluorophores in a single reaction• Measure gene expression levels detect and quantitate pathogens perform allelic discrimination SNP genotyping assays as well as score the presence of gene sequences• 96 or 384 well plate compatibility including the TaqMan Low Density Array • Optional Enterprise edition software provides data analysis tools that support 21 CFR Part 11 guidelines providing data integrity and security• Hands free plate loading and unloading provides true walkaway automation allowing you to increase your lab s productivity• Proven assay development guidelines save time and moneyHigh ThroughputThe 7900HT System is a high throughput real time PCR system that detects and quantitates nucleic acid sequences An optional Automation Accessory not included combined with 384 well plate capability make the 7900HT system ideally suited to meet the high throughput requirements of today s drug discovery process Key applications include gene expression quantitation and the detection of single nucleotide polymorphisms SNPs using the fluorogenic 5 nuclease assay FlexibilityThe 7900HT system is a versatile research tool that can accommodate any real time PCR need User interchangeable thermal cycling block formats let you select the format that s right for your project using industry standard 96 and 384 well formats as well as a novel 384 well TaqMan Low Density Array and a new Fast 96 well block that reduces run times from 2 hours to about 30 minutes An easy automation upgrade path lets you add features to meet throughput demands A Fast PCR option reduces run times from 2 hours to about 30 minutes Powerful SoftwareUsing two automation software tools Plate Utility and Automation Controller most of the gene expression and SNP genotyping workflow is fully automated for high throughput applications and requires minimal user intervention You can now process 5 000 x 384 well plates 384 markers which equates to 1 92 million genotypes Using Relative Quantification RQ Manager you can also process 200 x 384 well plates 96 detectors with quadruplicate data points⁄multiplexed endogenous control which equates to 153 600 data points Fully integrated into one complete Enterprise system SNP Manager and RQ Manager eliminate data analysis bottlenecks in high throughput SNP and gene expression research by allowing significantly more plates to be analyzed simultaneously This reduces hands on analysis time and simplifies the data analysis workflow For Research Use Only Not for use in diagnostics procedures
    https://www.bioz.com/result/7900ht fast real time polymerase chain reaction system/product/Thermo Fisher
    Average 99 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    7900ht fast real time polymerase chain reaction system - by Bioz Stars, 2021-01
    99/100 stars

    Related Products / Commonly Used Together

    polymerase chain reaction
    taqman universal master mix

    Images

    Related Articles

    Real-time Polymerase Chain Reaction:

    Article Title: Differential Expression of Granulopoiesis Related Genes in Neutrophil Subsets Distinguished by Membrane Expression of CD177
    Article Snippet: .. Quantitative RT-PCR (q-PCR) RNA was extracted from isolated neutrophils. cDNA was synthesized from 1.0 µg of total RNA. mRNA expression of CD177, MPO, PR3, lipocalin-2, defensin α1, defensin α3, defensin α4, bactericidal/permeability-increasing protein (BPI), cathepsin G and β-actin, was measured in triplicate by the Taqman real-time PCR system (ABI Prism 7900HT Sequence Detection System, Applied Biosystems, Foster City, CA) with specific Taqman primers/probes (Applied Biosystems). .. Amplification was performed using standard conditions and the amount of target transcript was presented as relative expression (2−ΔCT ) or fold induction (2−ΔΔCT ) in comparison to unstimulated controls after being normalized to the expression of β-actin as an endogenous reference.

    Article Title: Next-generation sequencing identified SPATC1L as a possible candidate gene for both early-onset and age-related hearing loss
    Article Snippet: .. Total RNA (1 μg) was reverse transcribed using Transcriptor First Strand cDNA Synthesis kit (Roche). qRT-PCR was performed using standard PCR conditions in a 7900HT fast real-time PCR System (Applied Biosystems) with Power SYBR Green PCR Master Mix (Thermo Fisher Scientific). .. Gene-specific primers were designed with Primer3Web software ( http://bioinfo.ut.ee/primer3/ ) (Myc_For: 5′ AGCAGAAACTCATCTCAGAAG 3′; SPATC1L_human_cells_Rev: 5′ CGTGAACCTTCCGAAATCTG 3′).

    Article Title: Cooperative TRAIL production mediates IFNα/Smac mimetic-induced cell death in TNFα-resistant solid cancer cells
    Article Snippet: .. TNFα and TRAIL mRNA levels were assessed by Taqman Gene Expression Assay purchased from Life Technologies (TNFα: Hs01113624_g1, TRAIL: Hs00921974_m1) and the levels of 28S rRNA by SYBR®Green qPCR assay from Applied Biosystems (Darmstadt, Germany) according to the manufacturer's instructions using the 7900HT fast real-time PCR system from Applied Biosystems (Darmstadt, Germany); 28S rRNA forward primer: TTGAAAATCCGGGGGAGAG; reverse primer: ACATTGTTCCAACATGCCAG. .. The relative expression of the target gene transcript and reference gene transcript was calculated as ΔΔCt.

    Article Title: microRNA-21 Governs TORC1 Activation in Renal Cancer Cell Proliferation and Invasion
    Article Snippet: .. One µg of RNA was used to synthesize cDNA using RT2 miRNA first strand kit according to the manufacturer’s instructions. qRT-PCR was performed using a real-time PCR machine (7900HT, Applied Biosystems). ..

    Article Title: Serum RARRES2 Is a Prognostic Marker in Patients With Adrenocortical Carcinoma
    Article Snippet: .. TaqMan real-time quantitative polymerase chain reaction was performed on 7900HT fast real-time PCR systems (Applied Biosystems). .. The reaction was prepared by mixing cDNA, TaqMan 2× universal PCR master mix and TaqMan gene expression assays (Applied Biosystems).

    Article Title: MiR-31 regulates the cisplatin resistance by targeting Src in gallbladder cancer
    Article Snippet: .. To measure the level of miR-31, quantitative real-time PCR (qRT-PCR) was performed on an ABI 7900HT fast real-time PCR system (Applied Biosystems, FosterCity, CA, USA) according to TaqMan Small RNA Assays protocol. ..

    Article Title: Isoflavones enhance interleukin-17 gene expression via retinoic acid receptor-related orphan receptors α and γ
    Article Snippet: .. We measured Il17a and β-actin mRNA levels using TaqMan® Gene Expression Assays (Applied Biosystems, Foster City, CA, USA). cDNA prepared from the total RNA of the EL4 cells was subjected to real-time quantitative PCR on a 7900HT Fast Real Time PCR system (Applied Biosystems). .. The following probes were designed by Applied Biosystems: for Il17a , 5′-FAM d(CTTCATCTGTGTCTCTGATGCTGTT) NFQ-3′; and for β-actin, 5′-FAM d(ACTGAGCTGCGTTTTACACCCTTTC) NFQ-3′.

    Synthesized:

    Article Title: Differential Expression of Granulopoiesis Related Genes in Neutrophil Subsets Distinguished by Membrane Expression of CD177
    Article Snippet: .. Quantitative RT-PCR (q-PCR) RNA was extracted from isolated neutrophils. cDNA was synthesized from 1.0 µg of total RNA. mRNA expression of CD177, MPO, PR3, lipocalin-2, defensin α1, defensin α3, defensin α4, bactericidal/permeability-increasing protein (BPI), cathepsin G and β-actin, was measured in triplicate by the Taqman real-time PCR system (ABI Prism 7900HT Sequence Detection System, Applied Biosystems, Foster City, CA) with specific Taqman primers/probes (Applied Biosystems). .. Amplification was performed using standard conditions and the amount of target transcript was presented as relative expression (2−ΔCT ) or fold induction (2−ΔΔCT ) in comparison to unstimulated controls after being normalized to the expression of β-actin as an endogenous reference.

    Isolation:

    Article Title: Differential Expression of Granulopoiesis Related Genes in Neutrophil Subsets Distinguished by Membrane Expression of CD177
    Article Snippet: .. Quantitative RT-PCR (q-PCR) RNA was extracted from isolated neutrophils. cDNA was synthesized from 1.0 µg of total RNA. mRNA expression of CD177, MPO, PR3, lipocalin-2, defensin α1, defensin α3, defensin α4, bactericidal/permeability-increasing protein (BPI), cathepsin G and β-actin, was measured in triplicate by the Taqman real-time PCR system (ABI Prism 7900HT Sequence Detection System, Applied Biosystems, Foster City, CA) with specific Taqman primers/probes (Applied Biosystems). .. Amplification was performed using standard conditions and the amount of target transcript was presented as relative expression (2−ΔCT ) or fold induction (2−ΔΔCT ) in comparison to unstimulated controls after being normalized to the expression of β-actin as an endogenous reference.

    Quantitative RT-PCR:

    Article Title: Differential Expression of Granulopoiesis Related Genes in Neutrophil Subsets Distinguished by Membrane Expression of CD177
    Article Snippet: .. Quantitative RT-PCR (q-PCR) RNA was extracted from isolated neutrophils. cDNA was synthesized from 1.0 µg of total RNA. mRNA expression of CD177, MPO, PR3, lipocalin-2, defensin α1, defensin α3, defensin α4, bactericidal/permeability-increasing protein (BPI), cathepsin G and β-actin, was measured in triplicate by the Taqman real-time PCR system (ABI Prism 7900HT Sequence Detection System, Applied Biosystems, Foster City, CA) with specific Taqman primers/probes (Applied Biosystems). .. Amplification was performed using standard conditions and the amount of target transcript was presented as relative expression (2−ΔCT ) or fold induction (2−ΔΔCT ) in comparison to unstimulated controls after being normalized to the expression of β-actin as an endogenous reference.

    Article Title: Next-generation sequencing identified SPATC1L as a possible candidate gene for both early-onset and age-related hearing loss
    Article Snippet: .. Total RNA (1 μg) was reverse transcribed using Transcriptor First Strand cDNA Synthesis kit (Roche). qRT-PCR was performed using standard PCR conditions in a 7900HT fast real-time PCR System (Applied Biosystems) with Power SYBR Green PCR Master Mix (Thermo Fisher Scientific). .. Gene-specific primers were designed with Primer3Web software ( http://bioinfo.ut.ee/primer3/ ) (Myc_For: 5′ AGCAGAAACTCATCTCAGAAG 3′; SPATC1L_human_cells_Rev: 5′ CGTGAACCTTCCGAAATCTG 3′).

    Article Title: microRNA-21 Governs TORC1 Activation in Renal Cancer Cell Proliferation and Invasion
    Article Snippet: .. One µg of RNA was used to synthesize cDNA using RT2 miRNA first strand kit according to the manufacturer’s instructions. qRT-PCR was performed using a real-time PCR machine (7900HT, Applied Biosystems). ..

    Article Title: MiR-31 regulates the cisplatin resistance by targeting Src in gallbladder cancer
    Article Snippet: .. To measure the level of miR-31, quantitative real-time PCR (qRT-PCR) was performed on an ABI 7900HT fast real-time PCR system (Applied Biosystems, FosterCity, CA, USA) according to TaqMan Small RNA Assays protocol. ..

    SYBR Green Assay:

    Article Title: Next-generation sequencing identified SPATC1L as a possible candidate gene for both early-onset and age-related hearing loss
    Article Snippet: .. Total RNA (1 μg) was reverse transcribed using Transcriptor First Strand cDNA Synthesis kit (Roche). qRT-PCR was performed using standard PCR conditions in a 7900HT fast real-time PCR System (Applied Biosystems) with Power SYBR Green PCR Master Mix (Thermo Fisher Scientific). .. Gene-specific primers were designed with Primer3Web software ( http://bioinfo.ut.ee/primer3/ ) (Myc_For: 5′ AGCAGAAACTCATCTCAGAAG 3′; SPATC1L_human_cells_Rev: 5′ CGTGAACCTTCCGAAATCTG 3′).

    Article Title: The Epithelial-Mesenchymal Transition (EMT) Regulatory Factor SLUG (SNAI2) Is a Downstream Target of SPARC and AKT in Promoting Melanoma Cell Invasion
    Article Snippet: .. Quantitative PCR was performed on 25 ng cDNA samples, in sealed 384-well microtiter plates using the SYBR Green™ PCR Master Mix (Applied Biosystems) with the 7900HT Fast Real-Time PCR System (Applied Biosystems). ..

    Article Title: Cooperative TRAIL production mediates IFNα/Smac mimetic-induced cell death in TNFα-resistant solid cancer cells
    Article Snippet: .. TNFα and TRAIL mRNA levels were assessed by Taqman Gene Expression Assay purchased from Life Technologies (TNFα: Hs01113624_g1, TRAIL: Hs00921974_m1) and the levels of 28S rRNA by SYBR®Green qPCR assay from Applied Biosystems (Darmstadt, Germany) according to the manufacturer's instructions using the 7900HT fast real-time PCR system from Applied Biosystems (Darmstadt, Germany); 28S rRNA forward primer: TTGAAAATCCGGGGGAGAG; reverse primer: ACATTGTTCCAACATGCCAG. .. The relative expression of the target gene transcript and reference gene transcript was calculated as ΔΔCt.

    Sequencing:

    Article Title: Differential Expression of Granulopoiesis Related Genes in Neutrophil Subsets Distinguished by Membrane Expression of CD177
    Article Snippet: .. Quantitative RT-PCR (q-PCR) RNA was extracted from isolated neutrophils. cDNA was synthesized from 1.0 µg of total RNA. mRNA expression of CD177, MPO, PR3, lipocalin-2, defensin α1, defensin α3, defensin α4, bactericidal/permeability-increasing protein (BPI), cathepsin G and β-actin, was measured in triplicate by the Taqman real-time PCR system (ABI Prism 7900HT Sequence Detection System, Applied Biosystems, Foster City, CA) with specific Taqman primers/probes (Applied Biosystems). .. Amplification was performed using standard conditions and the amount of target transcript was presented as relative expression (2−ΔCT ) or fold induction (2−ΔΔCT ) in comparison to unstimulated controls after being normalized to the expression of β-actin as an endogenous reference.

    Expressing:

    Article Title: Differential Expression of Granulopoiesis Related Genes in Neutrophil Subsets Distinguished by Membrane Expression of CD177
    Article Snippet: .. Quantitative RT-PCR (q-PCR) RNA was extracted from isolated neutrophils. cDNA was synthesized from 1.0 µg of total RNA. mRNA expression of CD177, MPO, PR3, lipocalin-2, defensin α1, defensin α3, defensin α4, bactericidal/permeability-increasing protein (BPI), cathepsin G and β-actin, was measured in triplicate by the Taqman real-time PCR system (ABI Prism 7900HT Sequence Detection System, Applied Biosystems, Foster City, CA) with specific Taqman primers/probes (Applied Biosystems). .. Amplification was performed using standard conditions and the amount of target transcript was presented as relative expression (2−ΔCT ) or fold induction (2−ΔΔCT ) in comparison to unstimulated controls after being normalized to the expression of β-actin as an endogenous reference.

    Article Title: Cooperative TRAIL production mediates IFNα/Smac mimetic-induced cell death in TNFα-resistant solid cancer cells
    Article Snippet: .. TNFα and TRAIL mRNA levels were assessed by Taqman Gene Expression Assay purchased from Life Technologies (TNFα: Hs01113624_g1, TRAIL: Hs00921974_m1) and the levels of 28S rRNA by SYBR®Green qPCR assay from Applied Biosystems (Darmstadt, Germany) according to the manufacturer's instructions using the 7900HT fast real-time PCR system from Applied Biosystems (Darmstadt, Germany); 28S rRNA forward primer: TTGAAAATCCGGGGGAGAG; reverse primer: ACATTGTTCCAACATGCCAG. .. The relative expression of the target gene transcript and reference gene transcript was calculated as ΔΔCt.

    Article Title: Isoflavones enhance interleukin-17 gene expression via retinoic acid receptor-related orphan receptors α and γ
    Article Snippet: .. We measured Il17a and β-actin mRNA levels using TaqMan® Gene Expression Assays (Applied Biosystems, Foster City, CA, USA). cDNA prepared from the total RNA of the EL4 cells was subjected to real-time quantitative PCR on a 7900HT Fast Real Time PCR system (Applied Biosystems). .. The following probes were designed by Applied Biosystems: for Il17a , 5′-FAM d(CTTCATCTGTGTCTCTGATGCTGTT) NFQ-3′; and for β-actin, 5′-FAM d(ACTGAGCTGCGTTTTACACCCTTTC) NFQ-3′.

    Polymerase Chain Reaction:

    Article Title: Next-generation sequencing identified SPATC1L as a possible candidate gene for both early-onset and age-related hearing loss
    Article Snippet: .. Total RNA (1 μg) was reverse transcribed using Transcriptor First Strand cDNA Synthesis kit (Roche). qRT-PCR was performed using standard PCR conditions in a 7900HT fast real-time PCR System (Applied Biosystems) with Power SYBR Green PCR Master Mix (Thermo Fisher Scientific). .. Gene-specific primers were designed with Primer3Web software ( http://bioinfo.ut.ee/primer3/ ) (Myc_For: 5′ AGCAGAAACTCATCTCAGAAG 3′; SPATC1L_human_cells_Rev: 5′ CGTGAACCTTCCGAAATCTG 3′).

    Article Title: The Epithelial-Mesenchymal Transition (EMT) Regulatory Factor SLUG (SNAI2) Is a Downstream Target of SPARC and AKT in Promoting Melanoma Cell Invasion
    Article Snippet: .. Quantitative PCR was performed on 25 ng cDNA samples, in sealed 384-well microtiter plates using the SYBR Green™ PCR Master Mix (Applied Biosystems) with the 7900HT Fast Real-Time PCR System (Applied Biosystems). ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher relative rt qpcr
    Nitazoxanide reduces virus shedding and viral load. (A and B) <t>FCV</t> viral shedding in cat's mouth and nose test paper on 0 dpi, measured by <t>RT-qPCR.</t> (C and D) At 14 dpi, one cat was euthanized in each group, the trachea, lung, spleen, liver and kidney were collected, and shedding of FCV from the different tissues was measured. (E) Cats’ tracheas and lungs were sectioned (400-fold) and the sections were treated with cat anti-FCV primary antibody and HRP-labeled rabbit anti-cat secondary antibody, followed by color development. Brown areas indicated by black arrows are FCV-positive. (F) Image-Pro Plus 6.0 was used to analysis optical density in two selected slices (400-fold); n = 4 cats/group; -1 dpi, 10 mg/kg NTZ; 3 dpi, 10 mg/kg NTZ; Control, 500 μL PBS (to simulate 10 mg/kg NTZ orally); NS p > 0.1234; ∗ p
    Relative Rt Qpcr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/relative rt qpcr/product/Thermo Fisher
    Average 99 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    relative rt qpcr - by Bioz Stars, 2021-01
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher real time quantitative pcr
    miR-24 negatively regulates <t>menin.</t> A: Real-time <t>PCR</t> evaluation of miR-24 expression in CCA and H69 cell lines demonstrates increased levels in CCA lines compared to H69 cells. B: Luciferase luminescence shows decreased menin expression with miR-24 mimic treatment. C: Left panel: miRNA-sequence data demonstrate increased expression of miR-24 in human CCA tumors compared with matched normal tissue. Right panel: Statistical significance of increased miR-24 expression is validated with an unpaired t -test. Data are expressed as means ± SEM ( A–C ). n = 3 ( A and B ); n = 9 ( C ). ∗ P
    Real Time Quantitative Pcr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 3795 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/real time quantitative pcr/product/Thermo Fisher
    Average 99 stars, based on 3795 article reviews
    Price from $9.99 to $1999.99
    real time quantitative pcr - by Bioz Stars, 2021-01
    99/100 stars
      Buy from Supplier

    Image Search Results


    Nitazoxanide reduces virus shedding and viral load. (A and B) FCV viral shedding in cat's mouth and nose test paper on 0 dpi, measured by RT-qPCR. (C and D) At 14 dpi, one cat was euthanized in each group, the trachea, lung, spleen, liver and kidney were collected, and shedding of FCV from the different tissues was measured. (E) Cats’ tracheas and lungs were sectioned (400-fold) and the sections were treated with cat anti-FCV primary antibody and HRP-labeled rabbit anti-cat secondary antibody, followed by color development. Brown areas indicated by black arrows are FCV-positive. (F) Image-Pro Plus 6.0 was used to analysis optical density in two selected slices (400-fold); n = 4 cats/group; -1 dpi, 10 mg/kg NTZ; 3 dpi, 10 mg/kg NTZ; Control, 500 μL PBS (to simulate 10 mg/kg NTZ orally); NS p > 0.1234; ∗ p

    Journal: Antiviral Research

    Article Title: Nitazoxanide Protects Cats from Feline Calicivirus Infection and Acts Synergistically with Mizoribine in vitro

    doi: 10.1016/j.antiviral.2020.104827

    Figure Lengend Snippet: Nitazoxanide reduces virus shedding and viral load. (A and B) FCV viral shedding in cat's mouth and nose test paper on 0 dpi, measured by RT-qPCR. (C and D) At 14 dpi, one cat was euthanized in each group, the trachea, lung, spleen, liver and kidney were collected, and shedding of FCV from the different tissues was measured. (E) Cats’ tracheas and lungs were sectioned (400-fold) and the sections were treated with cat anti-FCV primary antibody and HRP-labeled rabbit anti-cat secondary antibody, followed by color development. Brown areas indicated by black arrows are FCV-positive. (F) Image-Pro Plus 6.0 was used to analysis optical density in two selected slices (400-fold); n = 4 cats/group; -1 dpi, 10 mg/kg NTZ; 3 dpi, 10 mg/kg NTZ; Control, 500 μL PBS (to simulate 10 mg/kg NTZ orally); NS p > 0.1234; ∗ p

    Article Snippet: Relative RT-qPCR was used to evaluate FCV gene expression.

    Techniques: Quantitative RT-PCR, Labeling

    Evaluation of antiviral effects of nitazoxanide and mizoribine against FCV.(A and E) Solutions of MZR (100 mM) and NTZ (100 mM) in DMSO were diluted with MEM to provide test solutions of different concentration. The solutions were mixed with virus (100 × TCID 50 ); the fluorescence was measured and the optical density was determined statistically. The mock group contained 0.4% DMSO. (B and F) The TCID 50 of FCV was measured after incubation with different concentrations of MZR and NTZ for 28 h. (C and G) Relative RT-qPCR was used to measure the expression of FCV RNA. (D and H) EC 50 curves for MZR and NTZ. Unless otherwise stated, all experiments were simulated with 0.4% DMSO and 100 × TCID 50 FCV, and all were repeated three times. * p

    Journal: Antiviral Research

    Article Title: Nitazoxanide Protects Cats from Feline Calicivirus Infection and Acts Synergistically with Mizoribine in vitro

    doi: 10.1016/j.antiviral.2020.104827

    Figure Lengend Snippet: Evaluation of antiviral effects of nitazoxanide and mizoribine against FCV.(A and E) Solutions of MZR (100 mM) and NTZ (100 mM) in DMSO were diluted with MEM to provide test solutions of different concentration. The solutions were mixed with virus (100 × TCID 50 ); the fluorescence was measured and the optical density was determined statistically. The mock group contained 0.4% DMSO. (B and F) The TCID 50 of FCV was measured after incubation with different concentrations of MZR and NTZ for 28 h. (C and G) Relative RT-qPCR was used to measure the expression of FCV RNA. (D and H) EC 50 curves for MZR and NTZ. Unless otherwise stated, all experiments were simulated with 0.4% DMSO and 100 × TCID 50 FCV, and all were repeated three times. * p

    Article Snippet: Relative RT-qPCR was used to evaluate FCV gene expression.

    Techniques: Concentration Assay, Fluorescence, Incubation, Quantitative RT-PCR, Expressing

    Evaluation of antiviral effects of nitazoxanide and mizoribine against other FCV strains and their effects in combination. (A) Once the antiviral activity of NTZ and MZR against the FCV CH-JL2 strain had been established, CH-JL1, CH-JL3, CH-JL4 and CH-SH strains (diluted to 100 × TCID 50 ) were treated with NTZ (20 μM) or MZR (40 μM). TCID 50 values were measured after 28 h. (B) Relative RT-qPCR was used to assess changes in gene levels of different FCV strains. (C and D) Virus TCID 50 values were calculated to determine the combined effect of different concentrations of NTZ (0–2.5 μM) and MZR (0–20 μM) on FCV. The ZIP model in SynergyFinder was used to analyze the combined effects of the drugs and plot the results. The synergy score for the ZIP model was expressed as the average of all δ scores in the dose-response landscape, and the red portion of the graph indicates synergy. All experiments were repeated three times. ∗ p

    Journal: Antiviral Research

    Article Title: Nitazoxanide Protects Cats from Feline Calicivirus Infection and Acts Synergistically with Mizoribine in vitro

    doi: 10.1016/j.antiviral.2020.104827

    Figure Lengend Snippet: Evaluation of antiviral effects of nitazoxanide and mizoribine against other FCV strains and their effects in combination. (A) Once the antiviral activity of NTZ and MZR against the FCV CH-JL2 strain had been established, CH-JL1, CH-JL3, CH-JL4 and CH-SH strains (diluted to 100 × TCID 50 ) were treated with NTZ (20 μM) or MZR (40 μM). TCID 50 values were measured after 28 h. (B) Relative RT-qPCR was used to assess changes in gene levels of different FCV strains. (C and D) Virus TCID 50 values were calculated to determine the combined effect of different concentrations of NTZ (0–2.5 μM) and MZR (0–20 μM) on FCV. The ZIP model in SynergyFinder was used to analyze the combined effects of the drugs and plot the results. The synergy score for the ZIP model was expressed as the average of all δ scores in the dose-response landscape, and the red portion of the graph indicates synergy. All experiments were repeated three times. ∗ p

    Article Snippet: Relative RT-qPCR was used to evaluate FCV gene expression.

    Techniques: Activity Assay, Quantitative RT-PCR

    The antiviral effect of the compound combination. a and c The compounds were diluted to the indicated concentrations and used in combination to treat FCV infection. The results of the RT-qPCR were statistically analysed by the methods described above, and the effects of the drug combination were evaluated using SynergyFinder. b and d The interaction scores for different concentrations of compounds were calculated using the ZIP model. The synergy score for the ZIP model was expressed as the average of all δ scores for the dose-response landscape, and the red portion of the graph indicates synergy. All experiments were repeated three times

    Journal: BMC Veterinary Research

    Article Title: Antiviral effect of copper chloride on feline calicivirus and synergy with ribavirin in vitro

    doi: 10.1186/s12917-020-02441-0

    Figure Lengend Snippet: The antiviral effect of the compound combination. a and c The compounds were diluted to the indicated concentrations and used in combination to treat FCV infection. The results of the RT-qPCR were statistically analysed by the methods described above, and the effects of the drug combination were evaluated using SynergyFinder. b and d The interaction scores for different concentrations of compounds were calculated using the ZIP model. The synergy score for the ZIP model was expressed as the average of all δ scores for the dose-response landscape, and the red portion of the graph indicates synergy. All experiments were repeated three times

    Article Snippet: Relative RT-qPCR was used to evaluate FCV gene expression.

    Techniques: Infection, Quantitative RT-PCR

    miR-24 negatively regulates menin. A: Real-time PCR evaluation of miR-24 expression in CCA and H69 cell lines demonstrates increased levels in CCA lines compared to H69 cells. B: Luciferase luminescence shows decreased menin expression with miR-24 mimic treatment. C: Left panel: miRNA-sequence data demonstrate increased expression of miR-24 in human CCA tumors compared with matched normal tissue. Right panel: Statistical significance of increased miR-24 expression is validated with an unpaired t -test. Data are expressed as means ± SEM ( A–C ). n = 3 ( A and B ); n = 9 ( C ). ∗ P

    Journal: The American Journal of Pathology

    Article Title: miR-24 Inhibition Increases Menin Expression and Decreases Cholangiocarcinoma Proliferation

    doi: 10.1016/j.ajpath.2016.10.021

    Figure Lengend Snippet: miR-24 negatively regulates menin. A: Real-time PCR evaluation of miR-24 expression in CCA and H69 cell lines demonstrates increased levels in CCA lines compared to H69 cells. B: Luciferase luminescence shows decreased menin expression with miR-24 mimic treatment. C: Left panel: miRNA-sequence data demonstrate increased expression of miR-24 in human CCA tumors compared with matched normal tissue. Right panel: Statistical significance of increased miR-24 expression is validated with an unpaired t -test. Data are expressed as means ± SEM ( A–C ). n = 3 ( A and B ); n = 9 ( C ). ∗ P

    Article Snippet: Transfection efficacy was assessed by measuring menin expression by real-time quantitative PCR and flow cytometry., Cell proliferation was measured by Ki-67 real-time PCR expression, migration via wound healing, invasion via Boyden chamber, and angiogenesis via VEGF-A, VEGF-C, VEGFR-2, VEGFR-3, ANG-1, ANG-2, TIE-1, and TIE-2 real-time PCR expression.

    Techniques: Real-time Polymerase Chain Reaction, Expressing, Luciferase, Sequencing

    Increased menin expression decreases proliferation. Mz-ChA-1 cells overexpressing menin with pCMV6-MEN1 vector exhibit a decrease in Ki-67 proliferative marker expression. A – C: Increased menin expression in pCMV6-MEN1 Mz-ChA-1 cells by real-time PCR ( A ) and flow cytometry ( B ) decreased Ki-67 proliferative marker expression by real-time PCR ( C ). D: Decreased cell migration as measured by wound healing assay. E: Decreased cell invasion as measured by Boyden chamber assay in pCMV6-MEN1 Mz-ChA-1 cells. Data are expressed as means ± SEM performed in triplicate ( A–E ). ∗ P

    Journal: The American Journal of Pathology

    Article Title: miR-24 Inhibition Increases Menin Expression and Decreases Cholangiocarcinoma Proliferation

    doi: 10.1016/j.ajpath.2016.10.021

    Figure Lengend Snippet: Increased menin expression decreases proliferation. Mz-ChA-1 cells overexpressing menin with pCMV6-MEN1 vector exhibit a decrease in Ki-67 proliferative marker expression. A – C: Increased menin expression in pCMV6-MEN1 Mz-ChA-1 cells by real-time PCR ( A ) and flow cytometry ( B ) decreased Ki-67 proliferative marker expression by real-time PCR ( C ). D: Decreased cell migration as measured by wound healing assay. E: Decreased cell invasion as measured by Boyden chamber assay in pCMV6-MEN1 Mz-ChA-1 cells. Data are expressed as means ± SEM performed in triplicate ( A–E ). ∗ P

    Article Snippet: Transfection efficacy was assessed by measuring menin expression by real-time quantitative PCR and flow cytometry., Cell proliferation was measured by Ki-67 real-time PCR expression, migration via wound healing, invasion via Boyden chamber, and angiogenesis via VEGF-A, VEGF-C, VEGFR-2, VEGFR-3, ANG-1, ANG-2, TIE-1, and TIE-2 real-time PCR expression.

    Techniques: Expressing, Plasmid Preparation, Marker, Real-time Polymerase Chain Reaction, Flow Cytometry, Migration, Wound Healing Assay, Boyden Chamber Assay

    Menin expression negatively regulates angiogenesis. A: By real-time PCR, Mz-ChA-1 MEN1 knockout cells increased expression of angiogenic factors compared to Mz-ChA-1 control cells. B: By real-time PCR, pCMV6-MEN1 Mz-ChA-1 cells decreased expression of angiogenic factors compared to Mz-ChA-1 control cells. Data are expressed as means ± SEM performed in triplicate ( A and B ). ∗ P

    Journal: The American Journal of Pathology

    Article Title: miR-24 Inhibition Increases Menin Expression and Decreases Cholangiocarcinoma Proliferation

    doi: 10.1016/j.ajpath.2016.10.021

    Figure Lengend Snippet: Menin expression negatively regulates angiogenesis. A: By real-time PCR, Mz-ChA-1 MEN1 knockout cells increased expression of angiogenic factors compared to Mz-ChA-1 control cells. B: By real-time PCR, pCMV6-MEN1 Mz-ChA-1 cells decreased expression of angiogenic factors compared to Mz-ChA-1 control cells. Data are expressed as means ± SEM performed in triplicate ( A and B ). ∗ P

    Article Snippet: Transfection efficacy was assessed by measuring menin expression by real-time quantitative PCR and flow cytometry., Cell proliferation was measured by Ki-67 real-time PCR expression, migration via wound healing, invasion via Boyden chamber, and angiogenesis via VEGF-A, VEGF-C, VEGFR-2, VEGFR-3, ANG-1, ANG-2, TIE-1, and TIE-2 real-time PCR expression.

    Techniques: Expressing, Real-time Polymerase Chain Reaction, Knock-Out

    Menin is down-regulated in CCA. A and B: By real-time PCR and immunoblots, menin expression is decreased in CCA cell lines compared to H69. Significance is shown versus H69 cells. C: Flow cytometry analysis demonstrated a decrease in menin protein expression in Mz-ChA-1 cells compared to H69 cells. D: By real-time PCR, menin expression decreased in advanced-stage human CCA tissue biopsy specimens compared with normal control. Data are expressed as means ± SEM performed in triplicate ( A – D ). n = 3 independent samples ( A and B ). ∗ P

    Journal: The American Journal of Pathology

    Article Title: miR-24 Inhibition Increases Menin Expression and Decreases Cholangiocarcinoma Proliferation

    doi: 10.1016/j.ajpath.2016.10.021

    Figure Lengend Snippet: Menin is down-regulated in CCA. A and B: By real-time PCR and immunoblots, menin expression is decreased in CCA cell lines compared to H69. Significance is shown versus H69 cells. C: Flow cytometry analysis demonstrated a decrease in menin protein expression in Mz-ChA-1 cells compared to H69 cells. D: By real-time PCR, menin expression decreased in advanced-stage human CCA tissue biopsy specimens compared with normal control. Data are expressed as means ± SEM performed in triplicate ( A – D ). n = 3 independent samples ( A and B ). ∗ P

    Article Snippet: Transfection efficacy was assessed by measuring menin expression by real-time quantitative PCR and flow cytometry., Cell proliferation was measured by Ki-67 real-time PCR expression, migration via wound healing, invasion via Boyden chamber, and angiogenesis via VEGF-A, VEGF-C, VEGFR-2, VEGFR-3, ANG-1, ANG-2, TIE-1, and TIE-2 real-time PCR expression.

    Techniques: Real-time Polymerase Chain Reaction, Western Blot, Expressing, Flow Cytometry

    miR-24 drives proliferation. A: Real-time PCR confirmed knockdown of miR-24 in Mz-ChA-1 cells by hairpin inhibitor. miR-24 knockdown increased menin expression via fluorescence-activated cell sorting ( B ) and decreased expression of angiogenic factors via real-time PCR ( C ). Data are expressed as means ± SEM performed in triplicate unless otherwise stated ( A – C ). ∗ P

    Journal: The American Journal of Pathology

    Article Title: miR-24 Inhibition Increases Menin Expression and Decreases Cholangiocarcinoma Proliferation

    doi: 10.1016/j.ajpath.2016.10.021

    Figure Lengend Snippet: miR-24 drives proliferation. A: Real-time PCR confirmed knockdown of miR-24 in Mz-ChA-1 cells by hairpin inhibitor. miR-24 knockdown increased menin expression via fluorescence-activated cell sorting ( B ) and decreased expression of angiogenic factors via real-time PCR ( C ). Data are expressed as means ± SEM performed in triplicate unless otherwise stated ( A – C ). ∗ P

    Article Snippet: Transfection efficacy was assessed by measuring menin expression by real-time quantitative PCR and flow cytometry., Cell proliferation was measured by Ki-67 real-time PCR expression, migration via wound healing, invasion via Boyden chamber, and angiogenesis via VEGF-A, VEGF-C, VEGFR-2, VEGFR-3, ANG-1, ANG-2, TIE-1, and TIE-2 real-time PCR expression.

    Techniques: Real-time Polymerase Chain Reaction, Expressing, Fluorescence, FACS

    Gene expression of NOS relative to ß-actin in beewolf eggs at different times after oviposition and in freshly hatched larvae. Two trials were conducted, one with 19 and one with 24 eggs per time point. Mean ratios of NOS-mRNA to ß-Actin-mRNA are shown (with standard deviations), as determined by Q-RT-PCR. Source data file: Fig S4 Source data - NOS gene expression.xlsx

    Journal: bioRxiv

    Article Title: Nitric oxide radicals are emitted by wasp eggs to kill mold fungi

    doi: 10.1101/495085

    Figure Lengend Snippet: Gene expression of NOS relative to ß-actin in beewolf eggs at different times after oviposition and in freshly hatched larvae. Two trials were conducted, one with 19 and one with 24 eggs per time point. Mean ratios of NOS-mRNA to ß-Actin-mRNA are shown (with standard deviations), as determined by Q-RT-PCR. Source data file: Fig S4 Source data - NOS gene expression.xlsx

    Article Snippet: We used reverse transcription and real time quantitative PCR to quantify the NOS mRNA in beewolf eggs at different times after oviposition.

    Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction