7500 fast real time pcr system (Thermo Fisher)

Thermo Fisher is a verified supplier

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Name:

7500 Fast Real-Time PCR Systems Spectral Calibration Kit II

Description:

This easy-to-use kit establishes the pure dye spectra and multicomponent values for Cy3, Cy5, and Texas Red dyes on the 7500 Fast Real-Time PCR System. The Applied Biosystems 7500 Real-Time PCR Systems Spectral Calibration Kit II contains three Optical 96-Well Fast Thermocycling Plates preloaded and sealed with Cy3, Cy5, and Texas Red fluorescent dye standards.• 96-well optical reaction plates preloaded with Cy3, Cy5, and Texas Red dyes allow quick and easy calibration of the 7500 Fast Real-Time PCR System• Easy-to-use, preloaded spectral calibration kit allows accurate discrimination of the individual dyes in a reaction mixture when all the dyes are excited simultaneouslySpend Your Time on Research, Not Instrument CalibrationThis kit's easy-to-use, preloaded, 96-well optical reaction plates enable quick and easy calibration of the 7500 Fast Real-Time PCR System. Insert the reaction plates during system installation, and the system collects the dye standard's spectral information. The system's application algorithm then uses the calibration information to ensure accurate data analysis.

Catalog Number:

4362201

Price:

None

Applications:

PCR & Real-Time PCR|Real Time PCR (qPCR)|Real-Time PCR Instruments, Software & Calibration

Conjugate:

Cy3|Cy5|Texas Red

Size:

1 kit

Category:

Standards, Ladders & Controls, Instrument Calibration Kits, Standards & Reagents, Real-Time PCR Instrument Calibration Kits & Reagents

Score:

Buy from Supplier

Name:

Applied Biosystems 7500 Fast Dx Real-Time PCR Instrument

Description:

The Applied Biosystems 7500 Fast Dx Real-Time PCR Instrument with SDS Software is a real-time nucleic acid amplification and five-color fluorescence detection system available for in vitro diagnostic use. The 7500 Fast Dx Real-Time PCR Instrument delivers the performance required for high-quality results in a 96-well format.• 96-well format eases plate setup if automation is not available• Accommodates tube strips, which can be capped immediately after pipetting each sample• Fast mode completes runs in less than forty minutes• Optional standard mode facilitates use of standard length real-time PCR assays without changing thermal cycling parameters• 5-color variable excitation enables multiplex assaysConvenient 96-well FormatThe 7500 Fast Dx Real-Time PCR Instrument minimizes the effort required to perform sample setup while also allowing the use of tube strips.Intuitive Software to Run Pre-optimized ProtocolsThe 7500 Fast Dx instrument's Sequence Detection Software Security, Auditing, and E-Signature module offers the flexibility to develop assays and also run pre-optimized protocols for users operating in a secure environment.Instrument Service and SupportThe 7500 Fast Dx Real-Time PCR Instrument is supported by our AB Assurance Service Plan for Diagnostics, which includes:• Instrument Installation Qualification, Operation Qualification, and Performance Qualification (IQ⁄OQ⁄PQ)• Spectral calibration and software setup• Emergency repair, including parts and labor, and OQ⁄PQ after any major part change• Planned maintenance every 12 monthsEurope: For in vitro Diagnostic Use. The 7500 Fast Dx Real-Time PCR Instrument meets the requirements of the in vitro Diagnostic Medical Devices Directive (98⁄79⁄EC). The CE IVD-registered 7500 Fast Dx Real-Time PCR Instrument is for distribution and use in specific European countries only.USA: For in vitro Diagnostic Use. The 7500 Fast Dx Real-Time PCR instrument is 510(k)-cleared (K082562). The customer is responsible for any validation of assays and compliance with any regulatory requirements that pertain to their procedures and instrument use.

Catalog Number:

4406984

Price:

None

Applications:

PCR & Real-Time PCR|Real Time PCR (qPCR)|Real-Time PCR Instruments, Software & Calibration

Size:

1 system

Category:

Instruments and Equipment, Real-Time PCR Instruments & Accessories, Real-Time PCR Instruments

Score:

Buy from Supplier

Structured Review

Thermo Fisher 7500 fast real time pcr system

Chemical structure and DNA binding properties of PM01183. (A) Structure of PM01183; (B) binding to naked DNA. Drugs were incubated with a 250 bp <t>PCR</t> product at 25°C during 1 h and the electrophoresis was run in 2% agarose-TAE; (C) relative binding affinities for different DNA triplet sequences. PM01183 was incubated with the labelled double-strand oligodeoxynucleotides at 25°C during 1 h; then the melting assay was started in a <t>7500</t> Fast Real-Time PCR System by increasing the temperature up to 95°C in small steps of 1°C·min−1 . Analysis of the 1/C50 parameter (drug affinity for specific DNA sequences) and ΔTm (max) (stability of the drug–DNA complex) were analysed with an in-house developed Visual Basic Application (VBA) running on Microsoft Excel. The values correspond to the mean and standard deviation from at least two independent experiments for each sequence.

7500 fast real time pcr system - by Bioz Stars, 2019-12

99/100 stars

Images

1) Product Images from "PM01183, a new DNA minor groove covalent binder with potent in vitro and in vivo anti-tumour activity"

Article Title: PM01183, a new DNA minor groove covalent binder with potent in vitro and in vivo anti-tumour activity

Journal:

doi: 10.1111/j.1476-5381.2010.00945.x

Chemical structure and DNA binding properties of PM01183. (A) Structure of PM01183; (B) binding to naked DNA. Drugs were incubated with a 250 bp PCR product at 25°C during 1 h and the electrophoresis was run in 2% agarose-TAE; (C) relative binding affinities for different DNA triplet sequences. PM01183 was incubated with the labelled double-strand oligodeoxynucleotides at 25°C during 1 h; then the melting assay was started in a 7500 Fast Real-Time PCR System by increasing the temperature up to 95°C in small steps of 1°C·min−1 . Analysis of the 1/C50 parameter (drug affinity for specific DNA sequences) and ΔTm (max) (stability of the drug–DNA complex) were analysed with an in-house developed Visual Basic Application (VBA) running on Microsoft Excel. The values correspond to the mean and standard deviation from at least two independent experiments for each sequence.

Figure Legend Snippet: Chemical structure and DNA binding properties of PM01183. (A) Structure of PM01183; (B) binding to naked DNA. Drugs were incubated with a 250 bp PCR product at 25°C during 1 h and the electrophoresis was run in 2% agarose-TAE; (C) relative binding affinities for different DNA triplet sequences. PM01183 was incubated with the labelled double-strand oligodeoxynucleotides at 25°C during 1 h; then the melting assay was started in a 7500 Fast Real-Time PCR System by increasing the temperature up to 95°C in small steps of 1°C·min−1 . Analysis of the 1/C50 parameter (drug affinity for specific DNA sequences) and ΔTm (max) (stability of the drug–DNA complex) were analysed with an in-house developed Visual Basic Application (VBA) running on Microsoft Excel. The values correspond to the mean and standard deviation from at least two independent experiments for each sequence.

Techniques Used: Binding Assay, Incubation, Polymerase Chain Reaction, Electrophoresis, Real-time Polymerase Chain Reaction, Standard Deviation, Sequencing

2) Product Images from "RNAseq Transcriptional Profiling following Whip Development in Sugarcane Smut Disease"

Article Title: RNAseq Transcriptional Profiling following Whip Development in Sugarcane Smut Disease

Journal: PLoS ONE

doi: 10.1371/journal.pone.0162237

RT-qPCR validation. Sugarcane unigenes selected for RT-qPCR analysis of 5-DAI and 200-DAI samples: longifolia-like protein ( comp200950_c0_seq1 ); auxin transporter ( comp205699_c0_seq1 ); SAM ( comp194455_c0_seq1 ); invertase ( comp201528_c0_seq1 ); trehalose 6P synthase ( comp204716_c0_seq1 ); aldolase ( comp196354_c1_seq1 ); pyruvate decarboxylase ( comp200606_c0_seq1 ) andperoxidase ( comp187834_c0_seq1 ). The reactions were performed using a one-step GoTaq ® One-Step RT-qPCR System Kit (Promega) using a 7500 Fast Real-Time PCR System (Applied Biosystems). Statistical analysis was performed using REST ® software. “*” indicates genes differentially expressed in the RT-qPCR reactions (p-value

Figure Legend Snippet: RT-qPCR validation. Sugarcane unigenes selected for RT-qPCR analysis of 5-DAI and 200-DAI samples: longifolia-like protein ( comp200950_c0_seq1 ); auxin transporter ( comp205699_c0_seq1 ); SAM ( comp194455_c0_seq1 ); invertase ( comp201528_c0_seq1 ); trehalose 6P synthase ( comp204716_c0_seq1 ); aldolase ( comp196354_c1_seq1 ); pyruvate decarboxylase ( comp200606_c0_seq1 ) andperoxidase ( comp187834_c0_seq1 ). The reactions were performed using a one-step GoTaq ® One-Step RT-qPCR System Kit (Promega) using a 7500 Fast Real-Time PCR System (Applied Biosystems). Statistical analysis was performed using REST ® software. “*” indicates genes differentially expressed in the RT-qPCR reactions (p-value

Techniques Used: Quantitative RT-PCR, Real-time Polymerase Chain Reaction, Software, Significance Assay

3) Product Images from "Complement factor 5 (C5) p.A252T mutation is prevalent in, but not restricted to, sub‐Saharan Africa: implications for the susceptibility to meningococcal disease"

Article Title: Complement factor 5 (C5) p.A252T mutation is prevalent in, but not restricted to, sub‐Saharan Africa: implications for the susceptibility to meningococcal disease

Journal:

doi: 10.1111/cei.12967

C5 p.A252T mutation screening. (a) Cluster plot of 96 DNA samples that underwent C5 p.A252T mutation genotyping by TaqMan assay using the Applied Biosystems 7500 real‐time polymerase chain reaction (RT–PCR) system. Red indicates wild‐type homozygous samples (A252). Green indicates heterozygous samples. Blue indicates mutated homozygous samples (T252). Black indicates the negative controls. Two controls for each genotype were included in all plates. (b) Sanger sequencing of one heterozygous carrier of the C5 p.A252T mutation. All heterozygous samples detected by quantitative PCR were sequenced to confirm the results. [Colour figure can be viewed at ]

Figure Legend Snippet: C5 p.A252T mutation screening. (a) Cluster plot of 96 DNA samples that underwent C5 p.A252T mutation genotyping by TaqMan assay using the Applied Biosystems 7500 real‐time polymerase chain reaction (RT–PCR) system. Red indicates wild‐type homozygous samples (A252). Green indicates heterozygous samples. Blue indicates mutated homozygous samples (T252). Black indicates the negative controls. Two controls for each genotype were included in all plates. (b) Sanger sequencing of one heterozygous carrier of the C5 p.A252T mutation. All heterozygous samples detected by quantitative PCR were sequenced to confirm the results. [Colour figure can be viewed at ]

Techniques Used: Mutagenesis, TaqMan Assay, Real-time Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Sequencing

4) Product Images from "Comprehensive Exploration of Novel Chimeric Transcripts in Clear Cell Renal Cell Carcinomas Using Whole Transcriptome Analysis"

Article Title: Comprehensive Exploration of Novel Chimeric Transcripts in Clear Cell Renal Cell Carcinomas Using Whole Transcriptome Analysis

Journal: Genes, Chromosomes & Cancer

doi: 10.1002/gcc.22211

Levels of mRNA expression for the partner genes involved in chimeric transcripts in 26 paired samples of tumorous tissue (T) and non-cancerous renal cortex tissue (N) in the second cohort. mRNA expression was analyzed using custom TaqMan Gene Expression Assays on the 7500 Fast Real-Time PCR System (Life Technologies) employing the relative standard curve method. The probes and PCR primer sets used are summarized in Supporting Information Table S6. Experiments were performed in triplicate for each sample-primer set, and the mean value for the three experiments was used as the CT value. All CT values were normalized to that of GAPDH in the same sample. Levels of mRNA expression for the MMACHC, PTER, EPC2, ATXN7, FHIT, KIFAP3, CPEB1, MINPP1, TEX264, FAM107A , UPF3A, CDC16, MCCC1, CPSF3 , and ASAP2 genes were significantly reduced in T samples (shaded column) relative to N samples (white column). Bar, standard deviation.

Figure Legend Snippet: Levels of mRNA expression for the partner genes involved in chimeric transcripts in 26 paired samples of tumorous tissue (T) and non-cancerous renal cortex tissue (N) in the second cohort. mRNA expression was analyzed using custom TaqMan Gene Expression Assays on the 7500 Fast Real-Time PCR System (Life Technologies) employing the relative standard curve method. The probes and PCR primer sets used are summarized in Supporting Information Table S6. Experiments were performed in triplicate for each sample-primer set, and the mean value for the three experiments was used as the CT value. All CT values were normalized to that of GAPDH in the same sample. Levels of mRNA expression for the MMACHC, PTER, EPC2, ATXN7, FHIT, KIFAP3, CPEB1, MINPP1, TEX264, FAM107A , UPF3A, CDC16, MCCC1, CPSF3 , and ASAP2 genes were significantly reduced in T samples (shaded column) relative to N samples (white column). Bar, standard deviation.

Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Polymerase Chain Reaction, Standard Deviation

5) Product Images from "Fluorescent Duplex Allele-Specific PCR and Amplicon Melting for Rapid Homogeneous mtDNA Haplogroup H Screening and Sensitive Mixture Detection"

Article Title: Fluorescent Duplex Allele-Specific PCR and Amplicon Melting for Rapid Homogeneous mtDNA Haplogroup H Screening and Sensitive Mixture Detection

Journal: PLoS ONE

doi: 10.1371/journal.pone.0008374

Analytical window of 32-cycle ARMS-DCA for hg H and non-hg H templates. (A, B) Melt-peak data shown originated from an experiment on an ABI PRISM 7700 Sequence Detector. (C, D) Data shown originated from a sensitivity check performed on an Applied Biosystems 7500 Fast Real Time PCR System. Total genomic DNA input amounts are indicated in the panels. For all experiments, 1 pg gDNA equalled approximately 100 mtGE.

Figure Legend Snippet: Analytical window of 32-cycle ARMS-DCA for hg H and non-hg H templates. (A, B) Melt-peak data shown originated from an experiment on an ABI PRISM 7700 Sequence Detector. (C, D) Data shown originated from a sensitivity check performed on an Applied Biosystems 7500 Fast Real Time PCR System. Total genomic DNA input amounts are indicated in the panels. For all experiments, 1 pg gDNA equalled approximately 100 mtGE.

Techniques Used: Sequencing, Real-time Polymerase Chain Reaction

Sensitivity of 7028C/2706G mixture detection depending on the initial amount of template molecules. Data shown originate from two independent 32-cycle ARMS-DCA experiments (800,000–100,000 mtGE and 50,000–6,250 mtGE, n = 1 per mixture ratio/mtDNA input combination) on a 7500 Fast Real Time PCR System. Total template molecule input amounts are given in mtGE, K: ×1000; 1 mtGE equals approximately 10 fg gDNA standard; NTC: no template control.

Figure Legend Snippet: Sensitivity of 7028C/2706G mixture detection depending on the initial amount of template molecules. Data shown originate from two independent 32-cycle ARMS-DCA experiments (800,000–100,000 mtGE and 50,000–6,250 mtGE, n = 1 per mixture ratio/mtDNA input combination) on a 7500 Fast Real Time PCR System. Total template molecule input amounts are given in mtGE, K: ×1000; 1 mtGE equals approximately 10 fg gDNA standard; NTC: no template control.

Techniques Used: Real-time Polymerase Chain Reaction

mtDNA-input dependence of 7028C and 2706G melt ramp heights in pure and admixed hg H and non-hg H samples. The heights of the 7028C and 2706G melt-ramps (Δ F ) were determined from non-normalized melting curves (32-cycle ARMS-DCA; 7500 Fast Real Time PCR System) obtained in two independent 32-cycle ARMS-DCA experiments (800,000–100,000 mtGE and 50,000–6,250 mtGE, singleton data points).

Figure Legend Snippet: mtDNA-input dependence of 7028C and 2706G melt ramp heights in pure and admixed hg H and non-hg H samples. The heights of the 7028C and 2706G melt-ramps (Δ F ) were determined from non-normalized melting curves (32-cycle ARMS-DCA; 7500 Fast Real Time PCR System) obtained in two independent 32-cycle ARMS-DCA experiments (800,000–100,000 mtGE and 50,000–6,250 mtGE, singleton data points).

Techniques Used: Real-time Polymerase Chain Reaction

Influence of the initial copy number and mixture-ratio on the 7028C/2706G melt-ramp height ratio. The ratios of normalized 7028C and 2706G melt-ramp heights (2 independent experiments: 800,000–100,000 mtGE and 50,000–6,250 mtGE, singleton data points, 32-cycle ARMS-DCA; 7500 Fast Real Time PCR System) were visualized as color-coded angles (θ) in degrees.

Figure Legend Snippet: Influence of the initial copy number and mixture-ratio on the 7028C/2706G melt-ramp height ratio. The ratios of normalized 7028C and 2706G melt-ramp heights (2 independent experiments: 800,000–100,000 mtGE and 50,000–6,250 mtGE, singleton data points, 32-cycle ARMS-DCA; 7500 Fast Real Time PCR System) were visualized as color-coded angles (θ) in degrees.

Techniques Used: Real-time Polymerase Chain Reaction

Effects of model inhibitors. Humic acid (A–C) and hematin (D–F) were used as model substances to assess the effects of PCR inhibitors on ARMS-DCA typing of pure and admixed hg H and non-hg-H samples (32-cycle ARMS-DCA, 7500 Fast Real Time PCR System).

Figure Legend Snippet: Effects of model inhibitors. Humic acid (A–C) and hematin (D–F) were used as model substances to assess the effects of PCR inhibitors on ARMS-DCA typing of pure and admixed hg H and non-hg-H samples (32-cycle ARMS-DCA, 7500 Fast Real Time PCR System).

Techniques Used: Polymerase Chain Reaction, Real-time Polymerase Chain Reaction

mtDNA-input dependence of Δ F n and F max , dye translocation, and preferential amplification. (A) The Δ F n and F max data (n = 3, mean ± standard deviation) obtained for an 80% hg H +20% non-hg H mixture originated from two independent 32-cycle ARMS-DCA experiments (800,000 and 600,000 mtGE down to 6,250 and 9,375 mtGE per reaction, respectively, in twofold dilution steps) on a 7500 Fast Real Time PCR System. (B) No template control reactions were used for serially diluting the PCR product (initial template amount in reaction: 800,000 mtGE; 80% hg H +20% non-hg H target-mixture; 32-cycle ARMS-DCA; 7500 Fast Real Time PCR System; data from two independent experiments, n = 5, mean ± standard deviation) to test for amplicon concentration dependent effects on Δ F n 7028C and 2706G. (C) 7028C and 2706G band intensities were determined after polyacrylamide gel-electrophoretic separation of PCR products followed by silver staining (80% hg H +20% non-hg H target-mixture; 32-cycle ARMS-DCA, single experiment, n = 3, mean ± standard deviation).

Figure Legend Snippet: mtDNA-input dependence of Δ F n and F max , dye translocation, and preferential amplification. (A) The Δ F n and F max data (n = 3, mean ± standard deviation) obtained for an 80% hg H +20% non-hg H mixture originated from two independent 32-cycle ARMS-DCA experiments (800,000 and 600,000 mtGE down to 6,250 and 9,375 mtGE per reaction, respectively, in twofold dilution steps) on a 7500 Fast Real Time PCR System. (B) No template control reactions were used for serially diluting the PCR product (initial template amount in reaction: 800,000 mtGE; 80% hg H +20% non-hg H target-mixture; 32-cycle ARMS-DCA; 7500 Fast Real Time PCR System; data from two independent experiments, n = 5, mean ± standard deviation) to test for amplicon concentration dependent effects on Δ F n 7028C and 2706G. (C) 7028C and 2706G band intensities were determined after polyacrylamide gel-electrophoretic separation of PCR products followed by silver staining (80% hg H +20% non-hg H target-mixture; 32-cycle ARMS-DCA, single experiment, n = 3, mean ± standard deviation).

Techniques Used: Translocation Assay, Amplification, Standard Deviation, Real-time Polymerase Chain Reaction, Polymerase Chain Reaction, Concentration Assay, Silver Staining

Mixture ratio resolution and reproducibility of θ values. (A) The ratios of normalized 7028C and 2706G melt-ramp heights (2 independent experiments: 800,000–100,000 mtGE and 50,000–6,250 mtGE, singleton data points, 32-cycle ARMS-DCA; 7500 Fast Real Time PCR System) obtained for pure and admixed hg H and non-hg H templates were transformed into an angle θ and expressed in degrees. Total template molecule input amounts are given in mtGE; K: ×1000. (B) θ values for the selected hg H non-hg H admixtures were obtained with 32-cycle ARMS-DCA (7500 Fast Real Time PCR System; 80% hg H+20% non-hg H: single experiments, n = 3, mean ± standard deviation shown).

Figure Legend Snippet: Mixture ratio resolution and reproducibility of θ values. (A) The ratios of normalized 7028C and 2706G melt-ramp heights (2 independent experiments: 800,000–100,000 mtGE and 50,000–6,250 mtGE, singleton data points, 32-cycle ARMS-DCA; 7500 Fast Real Time PCR System) obtained for pure and admixed hg H and non-hg H templates were transformed into an angle θ and expressed in degrees. Total template molecule input amounts are given in mtGE; K: ×1000. (B) θ values for the selected hg H non-hg H admixtures were obtained with 32-cycle ARMS-DCA (7500 Fast Real Time PCR System; 80% hg H+20% non-hg H: single experiments, n = 3, mean ± standard deviation shown).

Techniques Used: Real-time Polymerase Chain Reaction, Transformation Assay, Standard Deviation

6) Product Images from "Performance Evaluation of the Real-Q Cytomegalovirus (CMV) Quantification Kit Using Two Real-Time PCR Systems for Quantifying CMV DNA in Whole Blood"

Article Title: Performance Evaluation of the Real-Q Cytomegalovirus (CMV) Quantification Kit Using Two Real-Time PCR Systems for Quantifying CMV DNA in Whole Blood

Journal: Annals of Laboratory Medicine

doi: 10.3343/alm.2016.36.6.603

Bland-Altman plot comparing the artus cytomegalovirus (CMV) RG PCR kit and the Real-Q CMV Quantification kit on different real-time PCR platforms: (A) the 7500 Fast Real-time PCR system, (B) the CFX96 real-time PCR detection system. Solid lines are the mean differences between the values; dashed lines are the mean difference plus or minus 1.96 SD (95% confidential interval of mean difference).

Figure Legend Snippet: Bland-Altman plot comparing the artus cytomegalovirus (CMV) RG PCR kit and the Real-Q CMV Quantification kit on different real-time PCR platforms: (A) the 7500 Fast Real-time PCR system, (B) the CFX96 real-time PCR detection system. Solid lines are the mean differences between the values; dashed lines are the mean difference plus or minus 1.96 SD (95% confidential interval of mean difference).

Techniques Used: Polymerase Chain Reaction, Real-time Polymerase Chain Reaction

Linearity of the Real-Q cytomegalovirus (CMV) Quantification kit on different real-time PCR platforms: (A) the 7500 Fast real-time PCR system and (B) the CFX96 real-time PCR detection system.

Figure Legend Snippet: Linearity of the Real-Q cytomegalovirus (CMV) Quantification kit on different real-time PCR platforms: (A) the 7500 Fast real-time PCR system and (B) the CFX96 real-time PCR detection system.

Techniques Used: Real-time Polymerase Chain Reaction

Amplification:

Article Title: Trans-kingdom mimicry underlies ribosome customization by a poxvirus kinase
Article Snippet: 1µl cDNA was used as template and amplification products were resolved on 1% Agarose gels, staining using SYBR safe. .. Real-time PCR was performed was performed using FastStart Universal SYBR Green Master (Rox) on a 96-well plate using 7500 Fast Real-Time PCR System (Applied Biosystems).

Synthesized:

Quantitative RT-PCR:

Article Title: RNAseq Transcriptional Profiling following Whip Development in Sugarcane Smut Disease
Article Snippet: The primers were manually designed and the quality verified using Gene Runner ( http://www.generunner.net/ ) and NetPrimer ( http://www.premierbiosoft.com/netprimer/ ). .. All RT-qPCRs were performed in a 7500 Fast Real-Time PCR System (Applied Biosystems,Waltham, MA) using a GoTaq® One-Step RT-qPCR System Kit (Promega, Madison, WI). .. A reaction mixture containing 50 ng of RNA, 6.5 μL of GoTaq® qPCRMaster Mix, 0.2 μM of each primer, 0.25 μL of GoScript™ RT Mix, and nuclease-free water to a final volume of 12.5 μL was used for the three biological replicates and two technical replicates.

Article Title: Thymic tuft cells promote an IL4-enriched medulla and shape thymocyte development
Article Snippet: Paragraph title: Quantitative RT–PCR ... The resulting cDNA was used as template for quantitative PCR with Taqman Gene Expression Assays on a 7500 Fast Real-Time PCR System (Applied Biosystems).

Article Title: H7N9 Avian Influenza Virus Is Efficiently Transmissible and Induces an Antibody Response in Chickens
Article Snippet: Primer pairs were selected based on specificity determined by dissociation curves. .. The qRT-PCR was carried out using a 7500 Fast Real-Time PCR system (Applied Biosystems, Foster City, CA, USA). .. The PCR conditions were as follows: 1 cycle of 95°C for 5 min, followed by 40 cycles of 95°C for 15 s and 60°C for 34 s. The increase in fluorescence was measured in real time during the extension step.

Article Title: Targeting mitochondrial oxidative phosphorylation eradicates therapy-resistant chronic myeloid leukemic stem cells
Article Snippet: Paragraph title: RT-QPCR ... The PCR was performed using the 7500 Fast Real-Time PCR System (Applied Biosystems) with the following steps: 20 s at 95°C followed by 40 cycles of 3s at 95°, 30 s at 60°C.

Article Title: Trans-kingdom mimicry underlies ribosome customization by a poxvirus kinase
Article Snippet: Paragraph title: PCR and RT-qPCR ... Real-time PCR was performed was performed using FastStart Universal SYBR Green Master (Rox) on a 96-well plate using 7500 Fast Real-Time PCR System (Applied Biosystems).

Article Title: Functional analysis of a chromosomal deletion associated with myelodysplastic syndromes using isogenic human induced pluripotent stem cells
Article Snippet: Paragraph title: Gene expression analysis by qRT-PCR ... Reactions were carried out in triplicate in a 7500 Fast Real-Time PCR System (Applied Bio-systems).

Article Title: Comprehensive Exploration of Novel Chimeric Transcripts in Clear Cell Renal Cell Carcinomas Using Whole Transcriptome Analysis
Article Snippet: Paragraph title: Quantitative RT-PCR Analysis ... cDNA was reverse transcribed from total RNA (500 ng) of the 26 paired T and N samples of the second cohort using random primers and Superscript III RNase H− Reverse Transcriptase (Life Technologies). mRNA expression was analyzed using custom TaqMan Gene Expression Assays and TaqMan Fast Advanced Master Mix (Life Technologies) on a 7500 Fast Real-Time PCR System (Life Technologies) employing the relative standard curve method.

Real-time Polymerase Chain Reaction:

Article Title: Fluorescent Duplex Allele-Specific PCR and Amplicon Melting for Rapid Homogeneous mtDNA Haplogroup H Screening and Sensitive Mixture Detection
Article Snippet: To test the intra- as well as the inter-run T m variability obtained for hg H and non-hg H samples, two independent experiments were performed on two consecutive days comprising 18 replicates for both the mtDNA hg H and the non-hg H standard. .. In 32-cycle ARMS-DCA, using initial total genomic DNA (gDNA) amounts of 10 ng and the 7500 Fast Real-Time PCR System (Applied Biosystems, Foster City, CA), the average melting point temperatures of 7028C (T m = 73.6±0.2°C; mean ± standard deviation; n = 36; pooled data from two independent experiments) and 2706G (T m = 81.4±0.2°C; n = 36; pooled data from two independent experiments) amplicons differed due to a T m -shifting, non-homologous, GC-rich tail , attached to the 5′ end of the 2706 reverse primer ( , ) by 7.8°C from each other, facilitating unambiguous product scoring. .. The intra-run T m variability (18 replicates per run and hg H respectively non-hg H standard sample; ) amounted to less than 1°C for both amplicons, and the average T m values obtained in the two independent experiments differed between 0.0°C (7028C amplicons) and 0.1°C (2706G amplicons) from each other ( ).

Article Title: Performance Evaluation of the Real-Q Cytomegalovirus (CMV) Quantification Kit Using Two Real-Time PCR Systems for Quantifying CMV DNA in Whole Blood
Article Snippet: It targets the CMV glycoprotein B and consists of Taqman reagent, dual hybridization probes, and a primer system. .. In the present study, we assessed the performance of the Real-Q assay for quantifying CMV DNA in WB using two real-time PCR platforms: the 7500 Fast real-time PCR system (7500 Fast; Applied Biosystems, Foster City, CA, USA) and the CFX96 real-time PCR detection system (CFX96; Bio-Rad, Hercules, CA, USA). .. This study was conducted at a tertiary-care hospital in Seoul, Korea, and it was approved by the Institutional Review Board of Samsung Medical Center.

Article Title: Complement factor 5 (C5) p.A252T mutation is prevalent in, but not restricted to, sub‐Saharan Africa: implications for the susceptibility to meningococcal disease
Article Snippet: Two controls for each condition (wild‐type, heterozygous for the mutation and homozygous for the mutation) were used in each assay. .. Plates were loaded onto an Applied Biosystems 7500 fast real‐time PCR system, and the 7500 (version 2.0.5) software was used to run the assay, following the default standard allelic discrimination genotyping assay protocol. .. Briefly, this consisted of an end‐point PCR in which fluorescence was read prior to PCR and after completion of the last PCR cycle.

Article Title: PM01183, a new DNA minor groove covalent binder with potent in vitro and in vivo anti-tumour activity
Article Snippet: Synthetic oligodeoxynucleotides with one strand 5′-end-labelled with the fluorophore 6-carboxyfluorescein and the complementary strand 3′-end-labelled with the quencher tetramethylrhodamine were synthesized at Bonsai Technologies (Madrid, Spain) ( ). .. For the experiments, we followed the methodology previously described ( ; ) using a 7500 Fast Real-Time PCR System (ABI Prism, Applied Biosystems, Foster City, CA, USA). .. Analyses of the raw data obtained for each oligodeoxynucleotide using an in-house developed Visual Basic Application running on Microsoft Excel (Microsoft, Redmond, WA, USA) yielded estimates of both the increase in melting temperature (ΔTm ) brought about by drug binding, relative to the free DNA molecule, and the ligand concentration that produces half the maximal change in melting temperature (C50 ).

Article Title: Functional and genetic evidence that the Mal/TIRAP allele variant 180L has been selected by providing protection against septic shock
Article Snippet: PCRs were set up according to the manufacturer's instructions. .. Thermal cycling was performed on a fast optical 96-well reaction plate on the 7500 Fast Real-Time PCR system (Applied Biosystems) as follows: Initial denaturation and enzyme activation at 95 °C for 10 min, followed by 40 cycles of denaturation at 95 °C for 15 s, and annealing/extension at 60 °C for 1 min. Mal SNP polymorphism was determined by performing an Allelic Discrimination Assay run on the 7500 Fast Real-Time PCR system (Applied Biosystems). .. SNP polymorphism results were verified by using positive controls ( ).

Article Title: Generalized L?vy walks and the role of chemokines in migration of effector CD8+ T cells
Article Snippet: To measure the amount of parasite DNA in the brain, real-time PCR was utilized as previously described . .. PCR was performed using Power SYBRr Green PCR Master Mix and a 7500 Fast Real-Time PCR System (Applied Biosystems, Warrington, UK). .. Single cell suspensions were generated from spleen and lymph node by macerating the tissues through a 70 μm nylon mesh filter (BD Falcon, Bedford, MA).

Article Title: Thymic tuft cells promote an IL4-enriched medulla and shape thymocyte development
Article Snippet: Cells were sorted directly into TRIzol LS (ThermoFisher Scientific) and the aqueous phase was isolated using Phasemaker Tubes (ThermoFisher) and RNA was isolated using the Micro Plus RNeasy kit (Qiagen) and reverse transcribed using the SuperScript IV Vilo Master Mix with ezDNase (ThermoFisher). .. The resulting cDNA was used as template for quantitative PCR with Taqman Gene Expression Assays on a 7500 Fast Real-Time PCR System (Applied Biosystems). .. Transcripts were normalized to Actb (Mm00607939_s1) expression.

Article Title: Microglia-mediated recovery from ALS-relevant motor neuron degeneration in a mouse model of TDP-43 proteinopathy
Article Snippet: Quantitative polymerase chain reaction (qPCR) was performed on the cDNA using SYBR Green PCR Master Mix (Life Technologies) and the following primers for hTDP-43: CCTAATTCTAAGCAAAGCCAAGATG and ACAGCGCCCCACAAACA, for Emp1: GAGACACTGGCCAGAAAAGC and TAAAAGGCAAGGGAATGCAC, for Serping1: ACAGCCCCCTCTGAATTCTT and GGATGCTCTCCAAGTTGCTC, and for Fkbp5: GGCAAACTCTAGGAGGCTTAAA and CTTACAGCTCCCACCAGAATAC. .. The qPCR plate was read using Applied Biosystems 7500 Fast Real Time PCR system. .. Gene expression was measured relative to Actb (β-actin).

Article Title: Targeting mitochondrial oxidative phosphorylation eradicates therapy-resistant chronic myeloid leukemic stem cells
Article Snippet: The following primers were used: MT-CO1 _F CTTTTCACCGTAGGTGGCCT, MT-CO1 _R AGTGGAAGTGGGCTACAACG,MT-CO2 _F CCGTCTGAACTATCCTGCCC, MT-CO2_R GAGGGATCGTTGACCTCGTC, 18S _F GTAACCCGTTGAACCCCATT and18S _R CCATCCAATCGGTAGTAGCG. cDNAs were mixed with the Fast SYBR® Green Master Mix (4385612, Applied Biosystems), 0.25 µM of each primer, and the volume adjusted to 20 µl according to the manufacturer instructions. .. The PCR was performed using the 7500 Fast Real-Time PCR System (Applied Biosystems) with the following steps: 20 s at 95°C followed by 40 cycles of 3s at 95°, 30 s at 60°C. .. The relative quantitation of mRNA was performed by the comparativeΔΔ Ct method using 18S for normalization.

Article Title: Functional analysis of a chromosomal deletion associated with myelodysplastic syndromes using isogenic human induced pluripotent stem cells
Article Snippet: Reverse transcription was performed with Superscript III (Life Technologies) and qPCR was performed with the SsoFast EvaGreen Supermix (Bio-Rad) using primers shown in . .. Reactions were carried out in triplicate in a 7500 Fast Real-Time PCR System (Applied Bio-systems). .. Total RNA integrity was tested using an Agilent 2200 TapeStation (Agilent Technologies, Inc., Santa Clara, CA) and was quantified using a Trinean DropSense96 spectrophotometer (Caliper Life Sciences, Hopkinton, MA).

Article Title: HAUSP deubiquitinated and stabilizes N-Myc in neuroblastoma
Article Snippet: 2 μg total RNA was reverse-transcribed using the ProtoScrpt First Stand cDNA Synthesis Kit (NEB). .. Quantitative PCR was done using a 7500 Fast Real-Time PCR System (Applied Biosystems) with a standard protocol. .. All mouse mRNA expression levels were normalized to β -actin while all human mRNA expression levels were normalized to GAPDH or HPRT.

Article Title: Recognition of DHN-melanin by MelLec, is required for protective immunity to Aspergillus
Article Snippet: Genomic DNA was isolated from whole blood of recipients and donors (before transplantation) using the QIAcube automated system (Qiagen) at the regional centres of the Instituto Português do Sangue e Transplantação (Portugal). .. Genotyping of the nonsynonymous rs2306894 SNP in the CLEC1A gene was performed using KASPar assays (LGC Genomics) according to manufacturer’s instructions in an Applied Biosystems 7500 Fast real–time PCR system (Thermo Fisher). .. Peripheral blood mononuclear cells from healthy genotyped donors were enriched from buffy coats using Histopaque®-1077 (Sigma-Aldrich) and contaminating erythrocytes removed using Red Blood Cell Lysis Buffer (Sigma-Aldrich).

Article Title: Comprehensive Exploration of Novel Chimeric Transcripts in Clear Cell Renal Cell Carcinomas Using Whole Transcriptome Analysis
Article Snippet: The PCR products were then directly sequenced in both directions using the same primers with the BigDye Terminator v3.1 Cycle Sequencing kit and an ABI 3130xl DNA Sequencer (Life Technologies). .. cDNA was reverse transcribed from total RNA (500 ng) of the 26 paired T and N samples of the second cohort using random primers and Superscript III RNase H− Reverse Transcriptase (Life Technologies). mRNA expression was analyzed using custom TaqMan Gene Expression Assays and TaqMan Fast Advanced Master Mix (Life Technologies) on a 7500 Fast Real-Time PCR System (Life Technologies) employing the relative standard curve method. .. Experiments were performed in triplicate for each sample-primer set, and the mean value for the three experiments was used as the CT value.

Article Title: Diet restriction delays accelerated aging and genomic stress in DNA repair deficient mice
Article Snippet: The concentration of RNA was measured by Nanodrop (Thermo Fisher Scientific). .. Gene expression analyses were performed with gene-specific real-time PCR primers (see below) using SYBR Green (Sigma-Aldrich) and Platinum Taq polymerase (Life Technologies) on a Bio-Rad CFX96 thermocycler or with pre-designed TaqMan Gene Expression Assays (given below) with a 7500 Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). .. Relative gene expressions were calculated as previously described .

Article Title: Metformin suppresses gluconeogenesis by inhibiting mitochondrial glycerophosphate dehydrogenase
Article Snippet: RNA was isolated using the Qiagen RNAeasy kit (Qiagen). mRNA was reverse transcribed to cDNA using MuLV reverse transcriptase (New England Bio Labs). .. The abundance of transcripts was assessed by real-time PCR on a 7500 Fast Real-Time PCR System (Applied Biosystems). .. The expression data for the gene of interest and actin were normalized for the efficiency of amplification determined by the standard curve included for each data acquisition.

Quantitation Assay:

Article Title: H7N9 Avian Influenza Virus Is Efficiently Transmissible and Induces an Antibody Response in Chickens
Article Snippet: Real-time quantitation of the mRNA relative to β-action was performed with a SYBR Green I assay (Qiagen, Germany). .. The qRT-PCR was carried out using a 7500 Fast Real-Time PCR system (Applied Biosystems, Foster City, CA, USA).

Luciferase:

Article Title: Trans-kingdom mimicry underlies ribosome customization by a poxvirus kinase
Article Snippet: Real-time PCR was performed was performed using FastStart Universal SYBR Green Master (Rox) on a 96-well plate using 7500 Fast Real-Time PCR System (Applied Biosystems). .. Average Ct values were used to calculate fold change or 2^(−ΔΔCt).

Expressing:

Article Title: RNAseq Transcriptional Profiling following Whip Development in Sugarcane Smut Disease
Article Snippet: Paragraph title: Quantitative PCR (qPCR) Expression Analysis ... All RT-qPCRs were performed in a 7500 Fast Real-Time PCR System (Applied Biosystems,Waltham, MA) using a GoTaq® One-Step RT-qPCR System Kit (Promega, Madison, WI).

Article Title: Generalized L?vy walks and the role of chemokines in migration of effector CD8+ T cells
Article Snippet: For the analysis of gene expression, brain tissue was placed in Trizol (Invitrogen, Carlsbad, CA) and mRNA was extracted as instructed by the manufacturer. .. PCR was performed using Power SYBRr Green PCR Master Mix and a 7500 Fast Real-Time PCR System (Applied Biosystems, Warrington, UK).

Article Title: H7N9 Avian Influenza Virus Is Efficiently Transmissible and Induces an Antibody Response in Chickens
Article Snippet: The qRT-PCR was carried out using a 7500 Fast Real-Time PCR system (Applied Biosystems, Foster City, CA, USA). .. The qRT-PCR was carried out using a 7500 Fast Real-Time PCR system (Applied Biosystems, Foster City, CA, USA).

Article Title: Functional analysis of a chromosomal deletion associated with myelodysplastic syndromes using isogenic human induced pluripotent stem cells
Article Snippet: Paragraph title: Gene expression analysis by qRT-PCR ... Reactions were carried out in triplicate in a 7500 Fast Real-Time PCR System (Applied Bio-systems).

Transplantation Assay:

Western Blot:

Hybridization:

FACS:

Article Title: Thymic tuft cells promote an IL4-enriched medulla and shape thymocyte development
Article Snippet: Single-cell epithelial suspensions were isolated and stained as described above and then sorted using a FACS Aria Fusion (BD Biosciences). .. The resulting cDNA was used as template for quantitative PCR with Taqman Gene Expression Assays on a 7500 Fast Real-Time PCR System (Applied Biosystems).

Gas Chromatography:

Concentration Assay:

Article Title: Microglia-mediated recovery from ALS-relevant motor neuron degeneration in a mouse model of TDP-43 proteinopathy
Article Snippet: Quality and concentration were tested using NanoDrop 2000. .. The qPCR plate was read using Applied Biosystems 7500 Fast Real Time PCR system.

Infection:

Article Title: Recognition of DHN-melanin by MelLec, is required for protective immunity to Aspergillus
Article Snippet: Exclusion criteria included diagnosis of “possible” invasive aspergillosis, infection with invasive moulds other than Aspergillus spp. or history of pre-transplant mould infection. .. Genotyping of the nonsynonymous rs2306894 SNP in the CLEC1A gene was performed using KASPar assays (LGC Genomics) according to manufacturer’s instructions in an Applied Biosystems 7500 Fast real–time PCR system (Thermo Fisher).

Generated:

Article Title: Generalized L?vy walks and the role of chemokines in migration of effector CD8+ T cells
Article Snippet: Purified RNA was treated with DNAse I to eliminate any contamination with genomic DNA (Promega, Madison, WI). cDNA was generated using Superscript II reverse transcriptase (Invitrogen). .. PCR was performed using Power SYBRr Green PCR Master Mix and a 7500 Fast Real-Time PCR System (Applied Biosystems, Warrington, UK).

Polymerase Chain Reaction:

Article Title: RNAseq Transcriptional Profiling following Whip Development in Sugarcane Smut Disease
Article Snippet: All RT-qPCRs were performed in a 7500 Fast Real-Time PCR System (Applied Biosystems,Waltham, MA) using a GoTaq® One-Step RT-qPCR System Kit (Promega, Madison, WI). .. Sugarcane housekeeping genes encoding polyubiquitin [ ] and GAPDH (d-glyceraldehyde-3-phosphate dehydrogenase [ ] were used to normalize the expression signals.

Article Title: Complement factor 5 (C5) p.A252T mutation is prevalent in, but not restricted to, sub‐Saharan Africa: implications for the susceptibility to meningococcal disease
Article Snippet: To obtain a final PCR volume of 10 μl, a working master mix was prepared containing 0·25 μl of TaqMan genotyping assay mix (×40), 5 μl TaqMan UNG Master Mix ×2 (Applied Biosystems, Carlsbad, CA, USA) and 2·75 μl of water for each reaction. .. Plates were loaded onto an Applied Biosystems 7500 fast real‐time PCR system, and the 7500 (version 2.0.5) software was used to run the assay, following the default standard allelic discrimination genotyping assay protocol.

Binding Assay:

Article Title: PM01183, a new DNA minor groove covalent binder with potent in vitro and in vivo anti-tumour activity
Article Snippet: For the experiments, we followed the methodology previously described ( ; ) using a 7500 Fast Real-Time PCR System (ABI Prism, Applied Biosystems, Foster City, CA, USA). .. Analyses of the raw data obtained for each oligodeoxynucleotide using an in-house developed Visual Basic Application running on Microsoft Excel (Microsoft, Redmond, WA, USA) yielded estimates of both the increase in melting temperature (ΔTm ) brought about by drug binding, relative to the free DNA molecule, and the ligand concentration that produces half the maximal change in melting temperature (C50 ).

Genotyping Assay:

Fluorescence:

Article Title: Complement factor 5 (C5) p.A252T mutation is prevalent in, but not restricted to, sub‐Saharan Africa: implications for the susceptibility to meningococcal disease
Article Snippet: Plates were loaded onto an Applied Biosystems 7500 fast real‐time PCR system, and the 7500 (version 2.0.5) software was used to run the assay, following the default standard allelic discrimination genotyping assay protocol. .. Briefly, this consisted of an end‐point PCR in which fluorescence was read prior to PCR and after completion of the last PCR cycle.

Mutagenesis:

Article Title: Complement factor 5 (C5) p.A252T mutation is prevalent in, but not restricted to, sub‐Saharan Africa: implications for the susceptibility to meningococcal disease
Article Snippet: Plates were loaded onto an Applied Biosystems 7500 fast real‐time PCR system, and the 7500 (version 2.0.5) software was used to run the assay, following the default standard allelic discrimination genotyping assay protocol. .. Plates were loaded onto an Applied Biosystems 7500 fast real‐time PCR system, and the 7500 (version 2.0.5) software was used to run the assay, following the default standard allelic discrimination genotyping assay protocol.

Isolation:

Article Title: Functional and genetic evidence that the Mal/TIRAP allele variant 180L has been selected by providing protection against septic shock
Article Snippet: From most populations, blood was drawn and the DNA was extracted by using the isolation kit Puregene (Gentra Sytems). .. Thermal cycling was performed on a fast optical 96-well reaction plate on the 7500 Fast Real-Time PCR system (Applied Biosystems) as follows: Initial denaturation and enzyme activation at 95 °C for 10 min, followed by 40 cycles of denaturation at 95 °C for 15 s, and annealing/extension at 60 °C for 1 min. Mal SNP polymorphism was determined by performing an Allelic Discrimination Assay run on the 7500 Fast Real-Time PCR system (Applied Biosystems).

Article Title: Microglia-mediated recovery from ALS-relevant motor neuron degeneration in a mouse model of TDP-43 proteinopathy
Article Snippet: RNA was isolated using miRNeasy Kit (Qiagen). .. The qPCR plate was read using Applied Biosystems 7500 Fast Real Time PCR system.

Article Title: Trans-kingdom mimicry underlies ribosome customization by a poxvirus kinase
Article Snippet: RNA was isolated using Trizol (Invitrogen, Thermo Fisher Scientific). .. Real-time PCR was performed was performed using FastStart Universal SYBR Green Master (Rox) on a 96-well plate using 7500 Fast Real-Time PCR System (Applied Biosystems).

Article Title: Functional analysis of a chromosomal deletion associated with myelodysplastic syndromes using isogenic human induced pluripotent stem cells
Article Snippet: RNA was isolated with Trizol (Life Technologies). .. Reactions were carried out in triplicate in a 7500 Fast Real-Time PCR System (Applied Bio-systems).

Article Title: HAUSP deubiquitinated and stabilizes N-Myc in neuroblastoma
Article Snippet: Paragraph title: RNA Isolation and Quantitative real-time PCR ... Quantitative PCR was done using a 7500 Fast Real-Time PCR System (Applied Biosystems) with a standard protocol.

Sequencing:

Article Title: Diet restriction delays accelerated aging and genomic stress in DNA repair deficient mice
Article Snippet: Gene expression analyses were performed with gene-specific real-time PCR primers (see below) using SYBR Green (Sigma-Aldrich) and Platinum Taq polymerase (Life Technologies) on a Bio-Rad CFX96 thermocycler or with pre-designed TaqMan Gene Expression Assays (given below) with a 7500 Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). .. For SYBR Green method the following primers were used (Forward primer 5′ to 3′; Reverse primer 5′ to 3′): Gsta1 (CTTCTGACCCCTTTCCCTCT; ATCCATGGGAGGCTTTCTCT), Nqo1 (GGTAGCGGCTCCATGTACTC; GAGTGTGGCCAATGCTGTAA), Nfe2l2 (AGGACATGGAGCAAGTTTGG; TCTGTCAGTGTGGCTTCTGG), Gstt2 (CGAGCAATTCTCCCAGGTGA; TATTCGTGGACTTGGGCACG), Fkbp5 (TGTTCAAGAAGTTCGCAGAGC; CCTTCTTGCTCCCAGCTTT), Srxn1 (TGAGCAGCTCCTCTGATGTG; GCTGAGGTGACAATTGACTATGG), Gsta4 (TCGATGGGATGATGCTGAC; CATCTGCATACATGTCAATCCTG), Gclm (TGGAGCAGCTGTATCAGTGG; CAAAGGCAGTCAAATCTGGTG), Hmox1 (CAGGTGATGCTGACAGAGGA; ATGGCATAAATTCCCACTGC), Gclc (AGATGATAGAACACGGGAGGAG; TGATCCTAAAGCGATTGTTCTTC), Ephx1 (GAGTGGAGGAACTGCACACC; AGCACAGAAGCCAGGATGA), Mgst1 (CTCGGCAGGACAACTTGC; CCATGCTTCCAATCTTGGTC), TubG2 (CAGACCAACCACTGCTACAT; AGGGAATGAAGTTGGCCAGT), Hprt (TGATAGATCCATTCCTATGACTGTAGA; AAGACATTCTTTCCAGTTAAAGTTGAG), Rps9 (ATCCGCCAACGTCACATTA; TCTTCACTCGGCCTGGAC).

Microscopy:

Article Title: Recognition of DHN-melanin by MelLec, is required for protective immunity to Aspergillus
Article Snippet: Genotyping of the nonsynonymous rs2306894 SNP in the CLEC1A gene was performed using KASPar assays (LGC Genomics) according to manufacturer’s instructions in an Applied Biosystems 7500 Fast real–time PCR system (Thermo Fisher). .. Monocytes were isolated by positive selection using magnetically labelled CD14+ MicroBeads (Miltenyi Biotec) on a MiniMACS separator and seeded at 106 cells/mL in 24-well plates for 7 days in RPMI-1640 medium supplemented with 10% (v/v) human serum and 20 ng/mL recombinant human granulocyte macrophage colony-stimulating factor (GM-CSF, Gibco).

Purification:

Reverse Transcription Polymerase Chain Reaction:

Article Title: Metformin suppresses gluconeogenesis by inhibiting mitochondrial glycerophosphate dehydrogenase
Article Snippet: Paragraph title: Real Time Quantative RT-PCR Analysis ... The abundance of transcripts was assessed by real-time PCR on a 7500 Fast Real-Time PCR System (Applied Biosystems).

Selection:

Article Title: Recognition of DHN-melanin by MelLec, is required for protective immunity to Aspergillus
Article Snippet: Genotyping of the nonsynonymous rs2306894 SNP in the CLEC1A gene was performed using KASPar assays (LGC Genomics) according to manufacturer’s instructions in an Applied Biosystems 7500 Fast real–time PCR system (Thermo Fisher). .. Genotyping of the nonsynonymous rs2306894 SNP in the CLEC1A gene was performed using KASPar assays (LGC Genomics) according to manufacturer’s instructions in an Applied Biosystems 7500 Fast real–time PCR system (Thermo Fisher).

Lysis:

Article Title: Microglia-mediated recovery from ALS-relevant motor neuron degeneration in a mouse model of TDP-43 proteinopathy
Article Snippet: Mouse tissue samples were homogenized in QIAzol lysis buffer (Qiagen), chloroform was added and they were spun down at 12000 rpm 4C for 15min. .. The qPCR plate was read using Applied Biosystems 7500 Fast Real Time PCR system.

Software:

Article Title: H7N9 Avian Influenza Virus Is Efficiently Transmissible and Induces an Antibody Response in Chickens
Article Snippet: The primers used for qRT-PCR were designed using the Oligo 7 software (Molecular Biology Insights Inc., Cascade, CO, USA). .. The qRT-PCR was carried out using a 7500 Fast Real-Time PCR system (Applied Biosystems, Foster City, CA, USA).

SYBR Green Assay:

Recombinant:

Article Title: Recognition of DHN-melanin by MelLec, is required for protective immunity to Aspergillus
Article Snippet: Genotyping of the nonsynonymous rs2306894 SNP in the CLEC1A gene was performed using KASPar assays (LGC Genomics) according to manufacturer’s instructions in an Applied Biosystems 7500 Fast real–time PCR system (Thermo Fisher). .. Genotyping of the nonsynonymous rs2306894 SNP in the CLEC1A gene was performed using KASPar assays (LGC Genomics) according to manufacturer’s instructions in an Applied Biosystems 7500 Fast real–time PCR system (Thermo Fisher).

Activation Assay:

Standard Deviation:

Staining:

TaqMan SNP Genotyping Assay:

Article Title: Functional and genetic evidence that the Mal/TIRAP allele variant 180L has been selected by providing protection against septic shock
Article Snippet: Genotyping of the Mal/ TIRAP S180L polymorphism was performed by using TaqMan, SNP Genotyping Assay (Applied Biosystems). .. Thermal cycling was performed on a fast optical 96-well reaction plate on the 7500 Fast Real-Time PCR system (Applied Biosystems) as follows: Initial denaturation and enzyme activation at 95 °C for 10 min, followed by 40 cycles of denaturation at 95 °C for 15 s, and annealing/extension at 60 °C for 1 min. Mal SNP polymorphism was determined by performing an Allelic Discrimination Assay run on the 7500 Fast Real-Time PCR system (Applied Biosystems).

Structured Review

Related Products / Commonly Used Together

Images

1) Product Images from "PM01183, a new DNA minor groove covalent binder with potent in vitro and in vivo anti-tumour activity"

2) Product Images from "RNAseq Transcriptional Profiling following Whip Development in Sugarcane Smut Disease"

3) Product Images from "Complement factor 5 (C5) p.A252T mutation is prevalent in, but not restricted to, sub‐Saharan Africa: implications for the susceptibility to meningococcal disease"

4) Product Images from "Comprehensive Exploration of Novel Chimeric Transcripts in Clear Cell Renal Cell Carcinomas Using Whole Transcriptome Analysis"

5) Product Images from "Fluorescent Duplex Allele-Specific PCR and Amplicon Melting for Rapid Homogeneous mtDNA Haplogroup H Screening and Sensitive Mixture Detection"

6) Product Images from "Performance Evaluation of the Real-Q Cytomegalovirus (CMV) Quantification Kit Using Two Real-Time PCR Systems for Quantifying CMV DNA in Whole Blood"

Related Articles

Amplification:

Synthesized:

Quantitative RT-PCR:

Real-time Polymerase Chain Reaction:

Quantitation Assay:

Luciferase:

Expressing:

Transplantation Assay:

Western Blot:

Hybridization:

FACS:

Gas Chromatography:

Concentration Assay:

Infection:

Generated:

Polymerase Chain Reaction:

Binding Assay:

Genotyping Assay:

Fluorescence:

Mutagenesis:

Isolation:

Sequencing:

Microscopy:

Purification:

Reverse Transcription Polymerase Chain Reaction:

Selection:

Lysis:

Software:

SYBR Green Assay:

Recombinant:

Activation Assay:

Standard Deviation:

Staining:

TaqMan SNP Genotyping Assay:

Similar Products

Image Search Results