7500 fast real time pcr system  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher 7500 fast real time pcr system
    7500 Fast Real Time Pcr System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1800 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/7500 fast real time pcr system/product/Thermo Fisher
    Average 99 stars, based on 1800 article reviews
    Price from $9.99 to $1999.99
    7500 fast real time pcr system - by Bioz Stars, 2020-01
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Prion gene paralogs are dispensable for early zebrafish development and have nonadditive roles in seizure susceptibility
    Article Snippet: HRM data were generated using the Applied Biosystems 7500 Fast Real-Time PCR system with MeltDoctorTM HRM Master Mix. .. Data were then analyzed using the High ReSolution Melt (Version 2.0, High ReSolution Melt, ThermoFisher Scientific). ) and cloned into the pCR2.1 Topo vector as per the instructions in the TOPO TA cloning kit (Invitrogen/ThermoFisher Scientific catalog no. K4500-01).

    Amplification:

    Article Title: A Paradigm of Endothelium-Protective and Stent-Free Anti-Restenotic Therapy Using Biomimetic Nanoclusters
    Article Snippet: Purified mRNA (1 μg) was used for the first-strand cDNA synthesis and quantitative RT-PCR was performed using the 7500 Fast Real-Time PCR System (Applied Biosystems, Carlsbad, CA). .. Each cDNA template was amplified in triplicates using SYBR Green PCR Master Mix, with the following primer sets: Rat VCAM1 forward primer CTCCTCTCGGGAAATGCCAC, reverse primer AACAACGGAATCCCCAACCT; Rat MCP1 forward primer CTTCCAAGTGGCTAAGGGCA, reverse primer TCAAAGGGAGTCGGGGATCT; Rat Flk1 forward primer CTTCCAAGTGGCTAAGGGCA, reverse primer TCAAAGGGAGTCGGGGATCT; Rat GAPDH forward primer GACATGCCGCCTGGAGAAAC, reverse primer AGCCCAGGATGCCCTTTAGT.

    Article Title: The dual role of the centrosome in organizing the microtubule network in interphase
    Article Snippet: .. Optimization and amplification of each specific gene product were performed using the Applied Biosystems 7500 Fast Real‐time PCR System (Thermo Fisher Scientific). .. Relative mRNA expression levels of the indicated genes were calculated by the 2 − Δ Δ C T method, using the expression of the GAPDH housekeeping gene as endogenous control.

    Article Title: Histone methylation regulator PTIP is required to maintain normal and leukemic bone marrow niches
    Article Snippet: One microgram of total RNA was treated with amplification-grade DNaseI (Qiagen) and was reverse-transcribed with the SuperScript III SuperMix system (Invitrogen), according to the manufacturers’ protocols. mRNA levels were analyzed via RT-qPCR analysis using the iTaq SYBR Green Supermix (Bio-Rad Laboratories), according to the manufacturer’s protocol. .. Reactions were performed on an ABI 7900HT Fast Real-Time PCR system or a 7500 Fast Real-Time PCR System (Thermo Fisher Scientific).

    Synthesized:

    Article Title: Increased interleukin-26 expression in proliferative diabetic retinopathy
    Article Snippet: RNA was abstracted from the PBMCs with Trizol Reagent (Takara, Japan) complied with the manufacturer's instruction. cDNA was synthesized using Superscript III Reverse Transcriptase (Takara, Japan) and then the synthesized first-strand of cDNA was measured by real-time quantitative PCR analysis with SYBR Green labeling method. .. Quantitative PCR was conducted by an Applied Biosystems 7500 Fast Real-Time PCR System (Foster City, CA).

    Article Title: The dual role of the centrosome in organizing the microtubule network in interphase
    Article Snippet: Complementary DNA (cDNA) was synthesized with 3 μg of total RNA using random hexamers and SuperScript III Reverse Transcriptase (Invitrogen™). cDNAs were diluted in sterile water and used as template for the amplification by the PCR. .. Optimization and amplification of each specific gene product were performed using the Applied Biosystems 7500 Fast Real‐time PCR System (Thermo Fisher Scientific).

    Article Title: Hypoxic cancer-associated fibroblasts increase NCBP2-AS2/HIAR to promote endothelial sprouting through enhanced VEGF signaling
    Article Snippet: Total RNA extraction and DNase treatment were performed following the manufacturer’s instructions of the RNeasy kit (Qiagen). cDNA was synthesized using iScript kit (BioRad) using 500 ng to 1 μg of RNA. cDNA was diluted 1:10 and 2 μl were used in each RT-qPCR reaction (technical triplicates), with 10 μl of iTAQ Universal SYBR Green Supermix (BioRad) and 400 nM of primers forward and reverse diluted in 8 μl of water. .. Runs were performed in a 7500 Fast Real Time PCR System (Applied Biosystems).

    Article Title: Terpene profiling, transcriptome analysis and characterization of cis-β-terpineol synthase from Ocimum
    Article Snippet: For semi-quantitative PCR, 2 µg DNase-treated RNA, each of young and mature leaves were mixed together and cDNA was synthesized as described. .. For qRT–PCR reactions, elongation factor-1 (EF1) was used as an endogenous control and the reactions were carried out in triplicates for 3 biological replicates in the 7500 Fast Real Time PCR System (Thermo Scientific).

    TA Cloning:

    Article Title: Prion gene paralogs are dispensable for early zebrafish development and have nonadditive roles in seizure susceptibility
    Article Snippet: HRM data were generated using the Applied Biosystems 7500 Fast Real-Time PCR system with MeltDoctorTM HRM Master Mix. .. Data were then analyzed using the High ReSolution Melt (Version 2.0, High ReSolution Melt, ThermoFisher Scientific). ) and cloned into the pCR2.1 Topo vector as per the instructions in the TOPO TA cloning kit (Invitrogen/ThermoFisher Scientific catalog no. K4500-01).

    Quantitative RT-PCR:

    Article Title: A Paradigm of Endothelium-Protective and Stent-Free Anti-Restenotic Therapy Using Biomimetic Nanoclusters
    Article Snippet: .. Purified mRNA (1 μg) was used for the first-strand cDNA synthesis and quantitative RT-PCR was performed using the 7500 Fast Real-Time PCR System (Applied Biosystems, Carlsbad, CA). .. Each cDNA template was amplified in triplicates using SYBR Green PCR Master Mix, with the following primer sets: Rat VCAM1 forward primer CTCCTCTCGGGAAATGCCAC, reverse primer AACAACGGAATCCCCAACCT; Rat MCP1 forward primer CTTCCAAGTGGCTAAGGGCA, reverse primer TCAAAGGGAGTCGGGGATCT; Rat Flk1 forward primer CTTCCAAGTGGCTAAGGGCA, reverse primer TCAAAGGGAGTCGGGGATCT; Rat GAPDH forward primer GACATGCCGCCTGGAGAAAC, reverse primer AGCCCAGGATGCCCTTTAGT.

    Article Title: Increased interleukin-26 expression in proliferative diabetic retinopathy
    Article Snippet: Paragraph title: Real-time Quantitative RT-PCR ... Quantitative PCR was conducted by an Applied Biosystems 7500 Fast Real-Time PCR System (Foster City, CA).

    Article Title: Hypoxic cancer-associated fibroblasts increase NCBP2-AS2/HIAR to promote endothelial sprouting through enhanced VEGF signaling
    Article Snippet: Paragraph title: Reverse transcription polymerase chain reaction (RT-qPCR) ... Runs were performed in a 7500 Fast Real Time PCR System (Applied Biosystems).

    Article Title: Thyroid hormone receptor β1 stimulates ABCB4 to increase biliary phosphatidylcholine excretion in mice
    Article Snippet: .. Quantitative real-time RT-PCR (qRT-PCR) was performed on a SYBR Green PCR Master Mix and with the 7500 Fast Real-Time PCR System (Applied Biosystems, Life Technologies, Vienna, Austria). qRT-PCR was performed in a 20 μl reaction mixture containing SYBR Green PCR Master Mix, primer couples, and cDNA. ..

    Article Title: Fibromodulin Is Essential for Fetal-Type Scarless Cutaneous Wound Healing
    Article Snippet: .. Expression of mRNA was measured by real-time quantitative RT-PCR using TaqMan Gene Expression Assays on a 7500 Fast Real-Time PCR System (Applied Biosystems, Foster City, CA). .. Concurrent expression of glyceraldehyde-3-phosphate dehydrogenase (Gapdh) was also assessed in separate tubes for each RT reaction with TaqMan Rodent Gapdh control reagents (Applied Biosystems).

    Article Title: Histone methylation regulator PTIP is required to maintain normal and leukemic bone marrow niches
    Article Snippet: Paragraph title: RT-qPCR. ... Reactions were performed on an ABI 7900HT Fast Real-Time PCR system or a 7500 Fast Real-Time PCR System (Thermo Fisher Scientific).

    Article Title: Angiopoietin/Tie2 Axis Regulates the Age-at-Injury Cerebrovascular Response to Traumatic Brain Injury
    Article Snippet: .. The reverse transcription was performed by incubating the reaction mixes at 16°C for 30 min; 42°C for 30 min; 85°C for 5 min. qRT-PCR was performed in 18 μl of qRT-PCR mix (6.9 μl of water, 1.2 μl of miRNA-specific RT products, 0.9 μl of 20× miRNA-specific TaqMan small RNA assay mix, 9 μl of 2× TaqMan Fast Universal PCR Master Mix) on a 7500 Fast Real-Time PCR System (Thermo Fisher Scientific) following the manufacturer's recommendation. .. The relative miRNA expression levels in specific treatment groups were referred to the control group by normalizing to endogenous small RNA control, snoRNA 202, and calculating with the 2−ΔΔCt formula (ΔCt = Cttarget miRNA − CtsnoRNA202 , ΔΔCt = ΔCt treatment − ΔCt control ).

    Article Title: Tributyltin induces a transcriptional response without a brite adipocyte signature in adipocyte models
    Article Snippet: For RT-qPCR analyses, cDNA was prepared from total RNA using the GoScript™ Reverse Transcription System (Promega), with a 1:1 mixture of random and Oligo (dT)15 primers. .. The qPCR reactions were performed using a 7500 Fast Real-Time PCR System (Applied Biosystems, Carlsbad, CA): hot-start activation at 95°C for 2 min, 40 cycles of denaturation (95°C for 15 sec) and annealing/extension (55°C for 60 sec).

    Article Title: Terpene profiling, transcriptome analysis and characterization of cis-β-terpineol synthase from Ocimum
    Article Snippet: .. For qRT–PCR reactions, elongation factor-1 (EF1) was used as an endogenous control and the reactions were carried out in triplicates for 3 biological replicates in the 7500 Fast Real Time PCR System (Thermo Scientific). ..

    SYBR Green Assay:

    Article Title: A Paradigm of Endothelium-Protective and Stent-Free Anti-Restenotic Therapy Using Biomimetic Nanoclusters
    Article Snippet: Purified mRNA (1 μg) was used for the first-strand cDNA synthesis and quantitative RT-PCR was performed using the 7500 Fast Real-Time PCR System (Applied Biosystems, Carlsbad, CA). .. Each cDNA template was amplified in triplicates using SYBR Green PCR Master Mix, with the following primer sets: Rat VCAM1 forward primer CTCCTCTCGGGAAATGCCAC, reverse primer AACAACGGAATCCCCAACCT; Rat MCP1 forward primer CTTCCAAGTGGCTAAGGGCA, reverse primer TCAAAGGGAGTCGGGGATCT; Rat Flk1 forward primer CTTCCAAGTGGCTAAGGGCA, reverse primer TCAAAGGGAGTCGGGGATCT; Rat GAPDH forward primer GACATGCCGCCTGGAGAAAC, reverse primer AGCCCAGGATGCCCTTTAGT.

    Article Title: Increased interleukin-26 expression in proliferative diabetic retinopathy
    Article Snippet: RNA was abstracted from the PBMCs with Trizol Reagent (Takara, Japan) complied with the manufacturer's instruction. cDNA was synthesized using Superscript III Reverse Transcriptase (Takara, Japan) and then the synthesized first-strand of cDNA was measured by real-time quantitative PCR analysis with SYBR Green labeling method. .. Quantitative PCR was conducted by an Applied Biosystems 7500 Fast Real-Time PCR System (Foster City, CA).

    Article Title: Hypoxic cancer-associated fibroblasts increase NCBP2-AS2/HIAR to promote endothelial sprouting through enhanced VEGF signaling
    Article Snippet: Total RNA extraction and DNase treatment were performed following the manufacturer’s instructions of the RNeasy kit (Qiagen). cDNA was synthesized using iScript kit (BioRad) using 500 ng to 1 μg of RNA. cDNA was diluted 1:10 and 2 μl were used in each RT-qPCR reaction (technical triplicates), with 10 μl of iTAQ Universal SYBR Green Supermix (BioRad) and 400 nM of primers forward and reverse diluted in 8 μl of water. .. Runs were performed in a 7500 Fast Real Time PCR System (Applied Biosystems).

    Article Title: Thyroid hormone receptor β1 stimulates ABCB4 to increase biliary phosphatidylcholine excretion in mice
    Article Snippet: .. Quantitative real-time RT-PCR (qRT-PCR) was performed on a SYBR Green PCR Master Mix and with the 7500 Fast Real-Time PCR System (Applied Biosystems, Life Technologies, Vienna, Austria). qRT-PCR was performed in a 20 μl reaction mixture containing SYBR Green PCR Master Mix, primer couples, and cDNA. ..

    Article Title: Histone methylation regulator PTIP is required to maintain normal and leukemic bone marrow niches
    Article Snippet: One microgram of total RNA was treated with amplification-grade DNaseI (Qiagen) and was reverse-transcribed with the SuperScript III SuperMix system (Invitrogen), according to the manufacturers’ protocols. mRNA levels were analyzed via RT-qPCR analysis using the iTaq SYBR Green Supermix (Bio-Rad Laboratories), according to the manufacturer’s protocol. .. Reactions were performed on an ABI 7900HT Fast Real-Time PCR system or a 7500 Fast Real-Time PCR System (Thermo Fisher Scientific).

    Article Title: Terpene profiling, transcriptome analysis and characterization of cis-β-terpineol synthase from Ocimum
    Article Snippet: A typical reaction consisted of 5 µL of SYBR Green master-mix, 0.5 µL each of forward and reverse primer (10 µM) and 1 µL of diluted cDNA (1:2) with nuclease-free water added to make up a volume of 10 µL. .. For qRT–PCR reactions, elongation factor-1 (EF1) was used as an endogenous control and the reactions were carried out in triplicates for 3 biological replicates in the 7500 Fast Real Time PCR System (Thermo Scientific).

    Microarray:

    Article Title: Tributyltin induces a transcriptional response without a brite adipocyte signature in adipocyte models
    Article Snippet: Microarray analyses were performed by the Boston University Microarray and Sequencing Resource using GeneChip® Mouse Gene 2.0ST arrays (Affymetrix, Santa Clara, CA). .. The qPCR reactions were performed using a 7500 Fast Real-Time PCR System (Applied Biosystems, Carlsbad, CA): hot-start activation at 95°C for 2 min, 40 cycles of denaturation (95°C for 15 sec) and annealing/extension (55°C for 60 sec).

    Incubation:

    Article Title: Comparison between DiaPlexQ™ STI6 and GeneFinder™ STD I/STD II multiplex Real‐time PCR Kits in the detection of six sexually transmitted disease pathogens, et al. Comparison between DiaPlexQ™ STI6 and GeneFinder™ STD I/STD II multiplex Real‐time PCR Kits in the detection of six sexually transmitted disease pathogens
    Article Snippet: PCR was conducted using the 7500 Fast Real‐Time PCR System (Applied Biosystems, Foster City, CA, USA). .. The mixture was incubated at 50˚C for 3 minutes to activate the uracil‐DNA glycosylase (UDG) system, followed by pre‐denaturation at 95˚C for 15 minutes and 45 cycles of PCR (20 seconds at 95˚C and 40 seconds at 60˚C).

    TALENs:

    Article Title: Prion gene paralogs are dispensable for early zebrafish development and have nonadditive roles in seizure susceptibility
    Article Snippet: The first step in our analyses of TALEN effectiveness was to determine whether TALENs induced somatic mutations in injected embryos (F0 generation). .. HRM data were generated using the Applied Biosystems 7500 Fast Real-Time PCR system with MeltDoctorTM HRM Master Mix.

    Expressing:

    Article Title: Deficit in PINK1/PARKIN-mediated mitochondrial autophagy at late stages of dystrophic cardiomyopathy
    Article Snippet: .. Real-time PCR was performed using a 7500 Fast Real-Time PCR system (Applied Biosystems) with TaqMan Gene Expression detection assay. .. Mice were intraperitoneally injected 10 mg/kg chloroquine, 10 mg/kg rapamycin, 15 mg/kg DNP, and sacrificed 4, 12, and 12 h later, respectively.

    Article Title: Increased interleukin-26 expression in proliferative diabetic retinopathy
    Article Snippet: Quantitative PCR was conducted by an Applied Biosystems 7500 Fast Real-Time PCR System (Foster City, CA). .. To investigate IL-26 expression, we used the following primer sequences: β-actin, forward 5′-AGG GAA ATC GTG CGT GAC-3′, reverse 5′-CGC TCA TTG CCG ATA GTG-3′; human IL-26, forward 5′-CAATTGCAAGGCTGCAAGAA-3′, reverse 5′-TCTCTAGCTGATGAAGCACAGGAA-3′.

    Article Title: The dual role of the centrosome in organizing the microtubule network in interphase
    Article Snippet: Optimization and amplification of each specific gene product were performed using the Applied Biosystems 7500 Fast Real‐time PCR System (Thermo Fisher Scientific). .. Relative mRNA expression levels of the indicated genes were calculated by the 2 − Δ Δ C T method, using the expression of the GAPDH housekeeping gene as endogenous control.

    Article Title: Thyroid hormone receptor β1 stimulates ABCB4 to increase biliary phosphatidylcholine excretion in mice
    Article Snippet: Quantitative real-time RT-PCR (qRT-PCR) was performed on a SYBR Green PCR Master Mix and with the 7500 Fast Real-Time PCR System (Applied Biosystems, Life Technologies, Vienna, Austria). qRT-PCR was performed in a 20 μl reaction mixture containing SYBR Green PCR Master Mix, primer couples, and cDNA. .. All expression data were normalized to 36B4 as reference gene.

    Article Title: Fibromodulin Is Essential for Fetal-Type Scarless Cutaneous Wound Healing
    Article Snippet: .. Expression of mRNA was measured by real-time quantitative RT-PCR using TaqMan Gene Expression Assays on a 7500 Fast Real-Time PCR System (Applied Biosystems, Foster City, CA). .. Concurrent expression of glyceraldehyde-3-phosphate dehydrogenase (Gapdh) was also assessed in separate tubes for each RT reaction with TaqMan Rodent Gapdh control reagents (Applied Biosystems).

    Article Title: Angiopoietin/Tie2 Axis Regulates the Age-at-Injury Cerebrovascular Response to Traumatic Brain Injury
    Article Snippet: Paragraph title: Quantification of miRNA expression. ... The reverse transcription was performed by incubating the reaction mixes at 16°C for 30 min; 42°C for 30 min; 85°C for 5 min. qRT-PCR was performed in 18 μl of qRT-PCR mix (6.9 μl of water, 1.2 μl of miRNA-specific RT products, 0.9 μl of 20× miRNA-specific TaqMan small RNA assay mix, 9 μl of 2× TaqMan Fast Universal PCR Master Mix) on a 7500 Fast Real-Time PCR System (Thermo Fisher Scientific) following the manufacturer's recommendation.

    Article Title: Tributyltin induces a transcriptional response without a brite adipocyte signature in adipocyte models
    Article Snippet: Paragraph title: mRNA Expression. ... The qPCR reactions were performed using a 7500 Fast Real-Time PCR System (Applied Biosystems, Carlsbad, CA): hot-start activation at 95°C for 2 min, 40 cycles of denaturation (95°C for 15 sec) and annealing/extension (55°C for 60 sec).

    Modification:

    Article Title: Prion gene paralogs are dispensable for early zebrafish development and have nonadditive roles in seizure susceptibility
    Article Snippet: For detection of both somatic and germline-transmitted mutations in embryos, genomic DNA was isolated from pools of test fish (injected F0 embryos for detection of somatic mutations or offspring of F0 embryos for detection of germline-transmitted mutations) or un-injected WT AB strain fish at either 24 hpf or 3 dpf using a protocol modified from Ref. . .. HRM data were generated using the Applied Biosystems 7500 Fast Real-Time PCR system with MeltDoctorTM HRM Master Mix.

    Concentration Assay:

    Article Title: Intestinal epithelial cell-specific Raptor is essential for high fat diet-induced weight gain in mice
    Article Snippet: NanoDrop Spectrophotometer (ND-1000; NanoDrop Technologies, Wilmington, DE) was used to determine RNA concentration of samples. .. RNA expression was determined with the Applied Biosystems 7500 Fast Real-Time PCR system using a GDF15 primer with normalization to a β-actin endogenous control (both from Applied Biosystems, Foster City, CA).

    TaqMan microRNA Assay:

    Article Title: Angiopoietin/Tie2 Axis Regulates the Age-at-Injury Cerebrovascular Response to Traumatic Brain Injury
    Article Snippet: As we described previously ( , ), the TaqMan miRNA assay kit (Thermo Fisher Scientific) was used to quantify miRNA expression per the manufacturer's instructions. .. The reverse transcription was performed by incubating the reaction mixes at 16°C for 30 min; 42°C for 30 min; 85°C for 5 min. qRT-PCR was performed in 18 μl of qRT-PCR mix (6.9 μl of water, 1.2 μl of miRNA-specific RT products, 0.9 μl of 20× miRNA-specific TaqMan small RNA assay mix, 9 μl of 2× TaqMan Fast Universal PCR Master Mix) on a 7500 Fast Real-Time PCR System (Thermo Fisher Scientific) following the manufacturer's recommendation.

    Generated:

    Article Title: Prion gene paralogs are dispensable for early zebrafish development and have nonadditive roles in seizure susceptibility
    Article Snippet: .. HRM data were generated using the Applied Biosystems 7500 Fast Real-Time PCR system with MeltDoctorTM HRM Master Mix. .. Data were then analyzed using the High ReSolution Melt (Version 2.0, High ReSolution Melt, ThermoFisher Scientific). ) and cloned into the pCR2.1 Topo vector as per the instructions in the TOPO TA cloning kit (Invitrogen/ThermoFisher Scientific catalog no. K4500-01).

    Polymerase Chain Reaction:

    Article Title: Deficit in PINK1/PARKIN-mediated mitochondrial autophagy at late stages of dystrophic cardiomyopathy
    Article Snippet: Paragraph title: 2.6. RNA isolation and real-time reverse transcription PCR ... Real-time PCR was performed using a 7500 Fast Real-Time PCR system (Applied Biosystems) with TaqMan Gene Expression detection assay.

    Article Title: A Paradigm of Endothelium-Protective and Stent-Free Anti-Restenotic Therapy Using Biomimetic Nanoclusters
    Article Snippet: Purified mRNA (1 μg) was used for the first-strand cDNA synthesis and quantitative RT-PCR was performed using the 7500 Fast Real-Time PCR System (Applied Biosystems, Carlsbad, CA). .. Each cDNA template was amplified in triplicates using SYBR Green PCR Master Mix, with the following primer sets: Rat VCAM1 forward primer CTCCTCTCGGGAAATGCCAC, reverse primer AACAACGGAATCCCCAACCT; Rat MCP1 forward primer CTTCCAAGTGGCTAAGGGCA, reverse primer TCAAAGGGAGTCGGGGATCT; Rat Flk1 forward primer CTTCCAAGTGGCTAAGGGCA, reverse primer TCAAAGGGAGTCGGGGATCT; Rat GAPDH forward primer GACATGCCGCCTGGAGAAAC, reverse primer AGCCCAGGATGCCCTTTAGT.

    Article Title: The dual role of the centrosome in organizing the microtubule network in interphase
    Article Snippet: Complementary DNA (cDNA) was synthesized with 3 μg of total RNA using random hexamers and SuperScript III Reverse Transcriptase (Invitrogen™). cDNAs were diluted in sterile water and used as template for the amplification by the PCR. .. Optimization and amplification of each specific gene product were performed using the Applied Biosystems 7500 Fast Real‐time PCR System (Thermo Fisher Scientific).

    Article Title: Thyroid hormone receptor β1 stimulates ABCB4 to increase biliary phosphatidylcholine excretion in mice
    Article Snippet: .. Quantitative real-time RT-PCR (qRT-PCR) was performed on a SYBR Green PCR Master Mix and with the 7500 Fast Real-Time PCR System (Applied Biosystems, Life Technologies, Vienna, Austria). qRT-PCR was performed in a 20 μl reaction mixture containing SYBR Green PCR Master Mix, primer couples, and cDNA. ..

    Article Title: Angiopoietin/Tie2 Axis Regulates the Age-at-Injury Cerebrovascular Response to Traumatic Brain Injury
    Article Snippet: .. The reverse transcription was performed by incubating the reaction mixes at 16°C for 30 min; 42°C for 30 min; 85°C for 5 min. qRT-PCR was performed in 18 μl of qRT-PCR mix (6.9 μl of water, 1.2 μl of miRNA-specific RT products, 0.9 μl of 20× miRNA-specific TaqMan small RNA assay mix, 9 μl of 2× TaqMan Fast Universal PCR Master Mix) on a 7500 Fast Real-Time PCR System (Thermo Fisher Scientific) following the manufacturer's recommendation. .. The relative miRNA expression levels in specific treatment groups were referred to the control group by normalizing to endogenous small RNA control, snoRNA 202, and calculating with the 2−ΔΔCt formula (ΔCt = Cttarget miRNA − CtsnoRNA202 , ΔΔCt = ΔCt treatment − ΔCt control ).

    Article Title: Comparison between DiaPlexQ™ STI6 and GeneFinder™ STD I/STD II multiplex Real‐time PCR Kits in the detection of six sexually transmitted disease pathogens, et al. Comparison between DiaPlexQ™ STI6 and GeneFinder™ STD I/STD II multiplex Real‐time PCR Kits in the detection of six sexually transmitted disease pathogens
    Article Snippet: .. PCR was conducted using the 7500 Fast Real‐Time PCR System (Applied Biosystems, Foster City, CA, USA). .. The mixture was incubated at 50˚C for 3 minutes to activate the uracil‐DNA glycosylase (UDG) system, followed by pre‐denaturation at 95˚C for 15 minutes and 45 cycles of PCR (20 seconds at 95˚C and 40 seconds at 60˚C).

    Transmission Assay:

    Article Title: Prion gene paralogs are dispensable for early zebrafish development and have nonadditive roles in seizure susceptibility
    Article Snippet: F0 fish were then bred, and pools of F1 generation embryos were screened for successful germline transmission of TALEN-induced mutations. .. HRM data were generated using the Applied Biosystems 7500 Fast Real-Time PCR system with MeltDoctorTM HRM Master Mix.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Hypoxic cancer-associated fibroblasts increase NCBP2-AS2/HIAR to promote endothelial sprouting through enhanced VEGF signaling
    Article Snippet: Paragraph title: Reverse transcription polymerase chain reaction (RT-qPCR) ... Runs were performed in a 7500 Fast Real Time PCR System (Applied Biosystems).

    Article Title: Terpene profiling, transcriptome analysis and characterization of cis-β-terpineol synthase from Ocimum
    Article Snippet: Semi-quantitative RT–PCR (sqRT–PCR) was performed for all three TPS s in 10 µL reaction consisting of 5 µL of 2X Jumpstart readymix, 1 µL each of 10 µM gene specific forward and reverse primers, 1 µL of cDNA optimized with endogenous control (18S rRNA) and nuclease free water was added to make up a volume of 10 µL. .. For qRT–PCR reactions, elongation factor-1 (EF1) was used as an endogenous control and the reactions were carried out in triplicates for 3 biological replicates in the 7500 Fast Real Time PCR System (Thermo Scientific).

    Injection:

    Article Title: Prion gene paralogs are dispensable for early zebrafish development and have nonadditive roles in seizure susceptibility
    Article Snippet: For detection of both somatic and germline-transmitted mutations in embryos, genomic DNA was isolated from pools of test fish (injected F0 embryos for detection of somatic mutations or offspring of F0 embryos for detection of germline-transmitted mutations) or un-injected WT AB strain fish at either 24 hpf or 3 dpf using a protocol modified from Ref. . .. HRM data were generated using the Applied Biosystems 7500 Fast Real-Time PCR system with MeltDoctorTM HRM Master Mix.

    Isolation:

    Article Title: Deficit in PINK1/PARKIN-mediated mitochondrial autophagy at late stages of dystrophic cardiomyopathy
    Article Snippet: Paragraph title: 2.6. RNA isolation and real-time reverse transcription PCR ... Real-time PCR was performed using a 7500 Fast Real-Time PCR system (Applied Biosystems) with TaqMan Gene Expression detection assay.

    Article Title: A Paradigm of Endothelium-Protective and Stent-Free Anti-Restenotic Therapy Using Biomimetic Nanoclusters
    Article Snippet: mRNA was isolated from collected carotid segments using TRIzol following the manufacturer’s instructions. .. Purified mRNA (1 μg) was used for the first-strand cDNA synthesis and quantitative RT-PCR was performed using the 7500 Fast Real-Time PCR System (Applied Biosystems, Carlsbad, CA).

    Article Title: The dual role of the centrosome in organizing the microtubule network in interphase
    Article Snippet: Paragraph title: RNA isolation, retro‐transcription, and real‐time PCR ... Optimization and amplification of each specific gene product were performed using the Applied Biosystems 7500 Fast Real‐time PCR System (Thermo Fisher Scientific).

    Article Title: Hypoxic cancer-associated fibroblasts increase NCBP2-AS2/HIAR to promote endothelial sprouting through enhanced VEGF signaling
    Article Snippet: For mRNA isolation, 5x105 cells were seeded in 6-well plate. .. Runs were performed in a 7500 Fast Real Time PCR System (Applied Biosystems).

    Article Title: Thyroid hormone receptor β1 stimulates ABCB4 to increase biliary phosphatidylcholine excretion in mice
    Article Snippet: Paragraph title: RNA isolation and qRT-PCR analysis ... Quantitative real-time RT-PCR (qRT-PCR) was performed on a SYBR Green PCR Master Mix and with the 7500 Fast Real-Time PCR System (Applied Biosystems, Life Technologies, Vienna, Austria). qRT-PCR was performed in a 20 μl reaction mixture containing SYBR Green PCR Master Mix, primer couples, and cDNA.

    Article Title: Prion gene paralogs are dispensable for early zebrafish development and have nonadditive roles in seizure susceptibility
    Article Snippet: For detection of both somatic and germline-transmitted mutations in embryos, genomic DNA was isolated from pools of test fish (injected F0 embryos for detection of somatic mutations or offspring of F0 embryos for detection of germline-transmitted mutations) or un-injected WT AB strain fish at either 24 hpf or 3 dpf using a protocol modified from Ref. . .. HRM data were generated using the Applied Biosystems 7500 Fast Real-Time PCR system with MeltDoctorTM HRM Master Mix.

    Article Title: Fibromodulin Is Essential for Fetal-Type Scarless Cutaneous Wound Healing
    Article Snippet: Total RNA was isolated using the RNeasy FFPE Kit (Qiagen). .. Expression of mRNA was measured by real-time quantitative RT-PCR using TaqMan Gene Expression Assays on a 7500 Fast Real-Time PCR System (Applied Biosystems, Foster City, CA).

    Article Title: Histone methylation regulator PTIP is required to maintain normal and leukemic bone marrow niches
    Article Snippet: Cells were spun down and washed once with cold PBS; then RNA was isolated with a Qiagen RNeasy kit (Qiagen) according to the manufacturer’s protocol. .. Reactions were performed on an ABI 7900HT Fast Real-Time PCR system or a 7500 Fast Real-Time PCR System (Thermo Fisher Scientific).

    Article Title: Angiopoietin/Tie2 Axis Regulates the Age-at-Injury Cerebrovascular Response to Traumatic Brain Injury
    Article Snippet: Briefly, 16.5 ng (3.3 μl) total RNA, isolated as described above, was reverse transcribed using the TaqMan MicroRNA Reverse Transcription kit (Thermo Fisher Scientific) with miRNA-specific RT primers in 10 μl of reverse transcription mix (2.8 μl of water, 1 μl of 10× RT buffer, 0.1 μl of 100 m m dNTPs, 0.13 μl of RNase inhibitor at 20 U/ μl), 0.67 μl of MutiScribe reverse transcriptase at 50 U/μl, and 2 μl of 5× RT primers). .. The reverse transcription was performed by incubating the reaction mixes at 16°C for 30 min; 42°C for 30 min; 85°C for 5 min. qRT-PCR was performed in 18 μl of qRT-PCR mix (6.9 μl of water, 1.2 μl of miRNA-specific RT products, 0.9 μl of 20× miRNA-specific TaqMan small RNA assay mix, 9 μl of 2× TaqMan Fast Universal PCR Master Mix) on a 7500 Fast Real-Time PCR System (Thermo Fisher Scientific) following the manufacturer's recommendation.

    Detection Assay:

    Article Title: Deficit in PINK1/PARKIN-mediated mitochondrial autophagy at late stages of dystrophic cardiomyopathy
    Article Snippet: .. Real-time PCR was performed using a 7500 Fast Real-Time PCR system (Applied Biosystems) with TaqMan Gene Expression detection assay. .. Mice were intraperitoneally injected 10 mg/kg chloroquine, 10 mg/kg rapamycin, 15 mg/kg DNP, and sacrificed 4, 12, and 12 h later, respectively.

    Size-exclusion Chromatography:

    Article Title: Tributyltin induces a transcriptional response without a brite adipocyte signature in adipocyte models
    Article Snippet: .. The qPCR reactions were performed using a 7500 Fast Real-Time PCR System (Applied Biosystems, Carlsbad, CA): hot-start activation at 95°C for 2 min, 40 cycles of denaturation (95°C for 15 sec) and annealing/extension (55°C for 60 sec). ..

    Labeling:

    Article Title: Increased interleukin-26 expression in proliferative diabetic retinopathy
    Article Snippet: RNA was abstracted from the PBMCs with Trizol Reagent (Takara, Japan) complied with the manufacturer's instruction. cDNA was synthesized using Superscript III Reverse Transcriptase (Takara, Japan) and then the synthesized first-strand of cDNA was measured by real-time quantitative PCR analysis with SYBR Green labeling method. .. Quantitative PCR was conducted by an Applied Biosystems 7500 Fast Real-Time PCR System (Foster City, CA).

    Purification:

    Article Title: A Paradigm of Endothelium-Protective and Stent-Free Anti-Restenotic Therapy Using Biomimetic Nanoclusters
    Article Snippet: .. Purified mRNA (1 μg) was used for the first-strand cDNA synthesis and quantitative RT-PCR was performed using the 7500 Fast Real-Time PCR System (Applied Biosystems, Carlsbad, CA). .. Each cDNA template was amplified in triplicates using SYBR Green PCR Master Mix, with the following primer sets: Rat VCAM1 forward primer CTCCTCTCGGGAAATGCCAC, reverse primer AACAACGGAATCCCCAACCT; Rat MCP1 forward primer CTTCCAAGTGGCTAAGGGCA, reverse primer TCAAAGGGAGTCGGGGATCT; Rat Flk1 forward primer CTTCCAAGTGGCTAAGGGCA, reverse primer TCAAAGGGAGTCGGGGATCT; Rat GAPDH forward primer GACATGCCGCCTGGAGAAAC, reverse primer AGCCCAGGATGCCCTTTAGT.

    Sequencing:

    Article Title: Prion gene paralogs are dispensable for early zebrafish development and have nonadditive roles in seizure susceptibility
    Article Snippet: HRM data were generated using the Applied Biosystems 7500 Fast Real-Time PCR system with MeltDoctorTM HRM Master Mix. .. Clones with a different melt profile compared with control clones were mini-prepped with a Qiaprep Spin Miniprep Kit (Qiagen catalog no. 27106, Toronto, Ontario, Canada) and submitted to the Molecular Biology Service Unit, University of Alberta, for sequencing.

    Article Title: Tributyltin induces a transcriptional response without a brite adipocyte signature in adipocyte models
    Article Snippet: Microarray analyses were performed by the Boston University Microarray and Sequencing Resource using GeneChip® Mouse Gene 2.0ST arrays (Affymetrix, Santa Clara, CA). .. The qPCR reactions were performed using a 7500 Fast Real-Time PCR System (Applied Biosystems, Carlsbad, CA): hot-start activation at 95°C for 2 min, 40 cycles of denaturation (95°C for 15 sec) and annealing/extension (55°C for 60 sec).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Comparison between DiaPlexQ™ STI6 and GeneFinder™ STD I/STD II multiplex Real‐time PCR Kits in the detection of six sexually transmitted disease pathogens, et al. Comparison between DiaPlexQ™ STI6 and GeneFinder™ STD I/STD II multiplex Real‐time PCR Kits in the detection of six sexually transmitted disease pathogens
    Article Snippet: DNA was extracted using a QIAamp DNA Mini Kit (Qiagen cat51304; Qiagen, Hilden, Germany) according to the manufacturer's instructions. .. PCR was conducted using the 7500 Fast Real‐Time PCR System (Applied Biosystems, Foster City, CA, USA).

    RNA Extraction:

    Article Title: Hypoxic cancer-associated fibroblasts increase NCBP2-AS2/HIAR to promote endothelial sprouting through enhanced VEGF signaling
    Article Snippet: Total RNA extraction and DNase treatment were performed following the manufacturer’s instructions of the RNeasy kit (Qiagen). cDNA was synthesized using iScript kit (BioRad) using 500 ng to 1 μg of RNA. cDNA was diluted 1:10 and 2 μl were used in each RT-qPCR reaction (technical triplicates), with 10 μl of iTAQ Universal SYBR Green Supermix (BioRad) and 400 nM of primers forward and reverse diluted in 8 μl of water. .. Runs were performed in a 7500 Fast Real Time PCR System (Applied Biosystems).

    Plasmid Preparation:

    Article Title: Prion gene paralogs are dispensable for early zebrafish development and have nonadditive roles in seizure susceptibility
    Article Snippet: HRM data were generated using the Applied Biosystems 7500 Fast Real-Time PCR system with MeltDoctorTM HRM Master Mix. .. Data were then analyzed using the High ReSolution Melt (Version 2.0, High ReSolution Melt, ThermoFisher Scientific). ) and cloned into the pCR2.1 Topo vector as per the instructions in the TOPO TA cloning kit (Invitrogen/ThermoFisher Scientific catalog no. K4500-01).

    Real-time Polymerase Chain Reaction:

    Article Title: Deficit in PINK1/PARKIN-mediated mitochondrial autophagy at late stages of dystrophic cardiomyopathy
    Article Snippet: .. Real-time PCR was performed using a 7500 Fast Real-Time PCR system (Applied Biosystems) with TaqMan Gene Expression detection assay. .. Mice were intraperitoneally injected 10 mg/kg chloroquine, 10 mg/kg rapamycin, 15 mg/kg DNP, and sacrificed 4, 12, and 12 h later, respectively.

    Article Title: A Paradigm of Endothelium-Protective and Stent-Free Anti-Restenotic Therapy Using Biomimetic Nanoclusters
    Article Snippet: .. Purified mRNA (1 μg) was used for the first-strand cDNA synthesis and quantitative RT-PCR was performed using the 7500 Fast Real-Time PCR System (Applied Biosystems, Carlsbad, CA). .. Each cDNA template was amplified in triplicates using SYBR Green PCR Master Mix, with the following primer sets: Rat VCAM1 forward primer CTCCTCTCGGGAAATGCCAC, reverse primer AACAACGGAATCCCCAACCT; Rat MCP1 forward primer CTTCCAAGTGGCTAAGGGCA, reverse primer TCAAAGGGAGTCGGGGATCT; Rat Flk1 forward primer CTTCCAAGTGGCTAAGGGCA, reverse primer TCAAAGGGAGTCGGGGATCT; Rat GAPDH forward primer GACATGCCGCCTGGAGAAAC, reverse primer AGCCCAGGATGCCCTTTAGT.

    Article Title: Pigment Visibility on Rectal Swabs Used To Detect Enteropathogens: a Prospective Cohort Study
    Article Snippet: .. The reaction was performed using a 7500 Fast real-time PCR system (Applied Biosystems, Foster City, CA, USA). ..

    Article Title: Increased interleukin-26 expression in proliferative diabetic retinopathy
    Article Snippet: .. Quantitative PCR was conducted by an Applied Biosystems 7500 Fast Real-Time PCR System (Foster City, CA). .. To investigate IL-26 expression, we used the following primer sequences: β-actin, forward 5′-AGG GAA ATC GTG CGT GAC-3′, reverse 5′-CGC TCA TTG CCG ATA GTG-3′; human IL-26, forward 5′-CAATTGCAAGGCTGCAAGAA-3′, reverse 5′-TCTCTAGCTGATGAAGCACAGGAA-3′.

    Article Title: The dual role of the centrosome in organizing the microtubule network in interphase
    Article Snippet: .. Optimization and amplification of each specific gene product were performed using the Applied Biosystems 7500 Fast Real‐time PCR System (Thermo Fisher Scientific). .. Relative mRNA expression levels of the indicated genes were calculated by the 2 − Δ Δ C T method, using the expression of the GAPDH housekeeping gene as endogenous control.

    Article Title: Hypoxic cancer-associated fibroblasts increase NCBP2-AS2/HIAR to promote endothelial sprouting through enhanced VEGF signaling
    Article Snippet: .. Runs were performed in a 7500 Fast Real Time PCR System (Applied Biosystems). .. Runs were performed in a 7500 Fast Real Time PCR System (Applied Biosystems).

    Article Title: Thyroid hormone receptor β1 stimulates ABCB4 to increase biliary phosphatidylcholine excretion in mice
    Article Snippet: .. Quantitative real-time RT-PCR (qRT-PCR) was performed on a SYBR Green PCR Master Mix and with the 7500 Fast Real-Time PCR System (Applied Biosystems, Life Technologies, Vienna, Austria). qRT-PCR was performed in a 20 μl reaction mixture containing SYBR Green PCR Master Mix, primer couples, and cDNA. ..

    Article Title: Intestinal epithelial cell-specific Raptor is essential for high fat diet-induced weight gain in mice
    Article Snippet: .. RNA expression was determined with the Applied Biosystems 7500 Fast Real-Time PCR system using a GDF15 primer with normalization to a β-actin endogenous control (both from Applied Biosystems, Foster City, CA). ..

    Article Title: Prion gene paralogs are dispensable for early zebrafish development and have nonadditive roles in seizure susceptibility
    Article Snippet: .. HRM data were generated using the Applied Biosystems 7500 Fast Real-Time PCR system with MeltDoctorTM HRM Master Mix. .. Data were then analyzed using the High ReSolution Melt (Version 2.0, High ReSolution Melt, ThermoFisher Scientific). ) and cloned into the pCR2.1 Topo vector as per the instructions in the TOPO TA cloning kit (Invitrogen/ThermoFisher Scientific catalog no. K4500-01).

    Article Title: Fibromodulin Is Essential for Fetal-Type Scarless Cutaneous Wound Healing
    Article Snippet: .. Expression of mRNA was measured by real-time quantitative RT-PCR using TaqMan Gene Expression Assays on a 7500 Fast Real-Time PCR System (Applied Biosystems, Foster City, CA). .. Concurrent expression of glyceraldehyde-3-phosphate dehydrogenase (Gapdh) was also assessed in separate tubes for each RT reaction with TaqMan Rodent Gapdh control reagents (Applied Biosystems).

    Article Title: Histone methylation regulator PTIP is required to maintain normal and leukemic bone marrow niches
    Article Snippet: .. Reactions were performed on an ABI 7900HT Fast Real-Time PCR system or a 7500 Fast Real-Time PCR System (Thermo Fisher Scientific). ..

    Article Title: Angiopoietin/Tie2 Axis Regulates the Age-at-Injury Cerebrovascular Response to Traumatic Brain Injury
    Article Snippet: .. The reverse transcription was performed by incubating the reaction mixes at 16°C for 30 min; 42°C for 30 min; 85°C for 5 min. qRT-PCR was performed in 18 μl of qRT-PCR mix (6.9 μl of water, 1.2 μl of miRNA-specific RT products, 0.9 μl of 20× miRNA-specific TaqMan small RNA assay mix, 9 μl of 2× TaqMan Fast Universal PCR Master Mix) on a 7500 Fast Real-Time PCR System (Thermo Fisher Scientific) following the manufacturer's recommendation. .. The relative miRNA expression levels in specific treatment groups were referred to the control group by normalizing to endogenous small RNA control, snoRNA 202, and calculating with the 2−ΔΔCt formula (ΔCt = Cttarget miRNA − CtsnoRNA202 , ΔΔCt = ΔCt treatment − ΔCt control ).

    Article Title: Tributyltin induces a transcriptional response without a brite adipocyte signature in adipocyte models
    Article Snippet: .. The qPCR reactions were performed using a 7500 Fast Real-Time PCR System (Applied Biosystems, Carlsbad, CA): hot-start activation at 95°C for 2 min, 40 cycles of denaturation (95°C for 15 sec) and annealing/extension (55°C for 60 sec). ..

    Article Title: Terpene profiling, transcriptome analysis and characterization of cis-β-terpineol synthase from Ocimum
    Article Snippet: .. For qRT–PCR reactions, elongation factor-1 (EF1) was used as an endogenous control and the reactions were carried out in triplicates for 3 biological replicates in the 7500 Fast Real Time PCR System (Thermo Scientific). ..

    Article Title: Comparison between DiaPlexQ™ STI6 and GeneFinder™ STD I/STD II multiplex Real‐time PCR Kits in the detection of six sexually transmitted disease pathogens, et al. Comparison between DiaPlexQ™ STI6 and GeneFinder™ STD I/STD II multiplex Real‐time PCR Kits in the detection of six sexually transmitted disease pathogens
    Article Snippet: .. PCR was conducted using the 7500 Fast Real‐Time PCR System (Applied Biosystems, Foster City, CA, USA). .. The mixture was incubated at 50˚C for 3 minutes to activate the uracil‐DNA glycosylase (UDG) system, followed by pre‐denaturation at 95˚C for 15 minutes and 45 cycles of PCR (20 seconds at 95˚C and 40 seconds at 60˚C).

    Multiplex Assay:

    Article Title: Comparison between DiaPlexQ™ STI6 and GeneFinder™ STD I/STD II multiplex Real‐time PCR Kits in the detection of six sexually transmitted disease pathogens, et al. Comparison between DiaPlexQ™ STI6 and GeneFinder™ STD I/STD II multiplex Real‐time PCR Kits in the detection of six sexually transmitted disease pathogens
    Article Snippet: For the DiaPlexQ assay, extracted DNA (5 μL) was added to a tube containing 15 μL of PCR premix (10 μL of 2X Multiplex Real‐Time PCR Smart mix and 5 μL of Primer & Probe Mixture). .. PCR was conducted using the 7500 Fast Real‐Time PCR System (Applied Biosystems, Foster City, CA, USA).

    RNA Expression:

    Article Title: Intestinal epithelial cell-specific Raptor is essential for high fat diet-induced weight gain in mice
    Article Snippet: .. RNA expression was determined with the Applied Biosystems 7500 Fast Real-Time PCR system using a GDF15 primer with normalization to a β-actin endogenous control (both from Applied Biosystems, Foster City, CA). ..

    Laser Capture Microdissection:

    Article Title: Fibromodulin Is Essential for Fetal-Type Scarless Cutaneous Wound Healing
    Article Snippet: Total RNA of unwounded E16 and E18 fetal rat skin was isolated using the RNeasy Mini Kit with DNase treatment (Qiagen, Valencia, CA), while wound tissues were collected by microdissection from tissue sections. .. Expression of mRNA was measured by real-time quantitative RT-PCR using TaqMan Gene Expression Assays on a 7500 Fast Real-Time PCR System (Applied Biosystems, Foster City, CA).

    Spectrophotometry:

    Article Title: Deficit in PINK1/PARKIN-mediated mitochondrial autophagy at late stages of dystrophic cardiomyopathy
    Article Snippet: Total RNA was isolated using Tri-Reagent® and Direct-zol RNA MiniPrep kit according to manufacturer’s instructions (Zymo Research, Irvine, CA) and quantified with a Nanodrop ND-1000 Spectrophotometer (Nanodrop Technologies, Wilmington, DE). .. Real-time PCR was performed using a 7500 Fast Real-Time PCR system (Applied Biosystems) with TaqMan Gene Expression detection assay.

    Article Title: Intestinal epithelial cell-specific Raptor is essential for high fat diet-induced weight gain in mice
    Article Snippet: NanoDrop Spectrophotometer (ND-1000; NanoDrop Technologies, Wilmington, DE) was used to determine RNA concentration of samples. .. RNA expression was determined with the Applied Biosystems 7500 Fast Real-Time PCR system using a GDF15 primer with normalization to a β-actin endogenous control (both from Applied Biosystems, Foster City, CA).

    Activation Assay:

    Article Title: Tributyltin induces a transcriptional response without a brite adipocyte signature in adipocyte models
    Article Snippet: .. The qPCR reactions were performed using a 7500 Fast Real-Time PCR System (Applied Biosystems, Carlsbad, CA): hot-start activation at 95°C for 2 min, 40 cycles of denaturation (95°C for 15 sec) and annealing/extension (55°C for 60 sec). ..

    Formalin-fixed Paraffin-Embedded:

    Article Title: Fibromodulin Is Essential for Fetal-Type Scarless Cutaneous Wound Healing
    Article Snippet: Total RNA was isolated using the RNeasy FFPE Kit (Qiagen). .. Expression of mRNA was measured by real-time quantitative RT-PCR using TaqMan Gene Expression Assays on a 7500 Fast Real-Time PCR System (Applied Biosystems, Foster City, CA).

    Fluorescence In Situ Hybridization:

    Article Title: Prion gene paralogs are dispensable for early zebrafish development and have nonadditive roles in seizure susceptibility
    Article Snippet: For detection of both somatic and germline-transmitted mutations in embryos, genomic DNA was isolated from pools of test fish (injected F0 embryos for detection of somatic mutations or offspring of F0 embryos for detection of germline-transmitted mutations) or un-injected WT AB strain fish at either 24 hpf or 3 dpf using a protocol modified from Ref. . .. HRM data were generated using the Applied Biosystems 7500 Fast Real-Time PCR system with MeltDoctorTM HRM Master Mix.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher 7500 fast real time pcr system
    7500 Fast Real Time Pcr System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1800 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/7500 fast real time pcr system/product/Thermo Fisher
    Average 90 stars, based on 1800 article reviews
    Price from $9.99 to $1999.99
    7500 fast real time pcr system - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    N/A
    Tower Computer Kit for the Applied Biosystems 7500 and 7300 Real Time PCR Systems Monitor is not included Used With7500 Real Time PCR System with Dell Tower For Research Use
      Buy from Supplier

    N/A
    Notebook Computer Kit for the Applied Biosystems 7500 and 7300 Real Time PCR Systems Used With7500 Real Time PCR System with Dell Notebook For Research Use Only Not for use
      Buy from Supplier

    Image Search Results