rneasy ffpe kit  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    RNeasy FFPE Kit
    Description:
    For purification of total RNA from formalin fixed paraffin embedded tissue sections Kit contents Qiagen RNeasy FFPE Kit 50 preps 14 to 30L Elution Volume FFPE Tissue Sample Total RNA Purification Spin Column Format Silica Technology Ideal for PCR qPCR Real time RT PCR Microarray Includes 50 RNeasy MinElute Spin Columns Collection Tubes Proteinase K RNase free DNase I DNase Booster Buffer RNase free Buffers RNase free Water Benefits Novel method to overcome formalin crosslinking Efficient release of RNA without compromising integrity Streamlined protocol providing RNA in just 85 minu
    Catalog Number:
    73504
    Price:
    445
    Category:
    RNeasy FFPE Kit
    Buy from Supplier


    Structured Review

    Qiagen rneasy ffpe kit
    RNeasy FFPE Kit
    For purification of total RNA from formalin fixed paraffin embedded tissue sections Kit contents Qiagen RNeasy FFPE Kit 50 preps 14 to 30L Elution Volume FFPE Tissue Sample Total RNA Purification Spin Column Format Silica Technology Ideal for PCR qPCR Real time RT PCR Microarray Includes 50 RNeasy MinElute Spin Columns Collection Tubes Proteinase K RNase free DNase I DNase Booster Buffer RNase free Buffers RNase free Water Benefits Novel method to overcome formalin crosslinking Efficient release of RNA without compromising integrity Streamlined protocol providing RNA in just 85 minu
    https://www.bioz.com/result/rneasy ffpe kit/product/Qiagen
    Average 90 stars, based on 41175 article reviews
    Price from $9.99 to $1999.99
    rneasy ffpe kit - by Bioz Stars, 2020-01
    90/100 stars

    Images

    1) Product Images from "Upregulation of P2Y2R, Active uPA, and PAI-1 Are Essential Components of Hantavirus Cardiopulmonary Syndrome"

    Article Title: Upregulation of P2Y2R, Active uPA, and PAI-1 Are Essential Components of Hantavirus Cardiopulmonary Syndrome

    Journal: Frontiers in Cellular and Infection Microbiology

    doi: 10.3389/fcimb.2018.00169

    P2Y 2 R expression is significantly upregulated in HCPS compared to controls. RNA was extracted from lung tissues samples with the Qiagen RNeasy FFPE kit (cat# 73504) and quantified with a Thermo Fisher Scientific Nanodrop. P2Y 2 R expression levels were measured by the TaqMan assay using a WT P2Y 2 R plasmid as standard. P2Y 2 R copy #s were normalized to total RNA extracted from the embedded tissues. Each sample slice was measured in triplicate. (A) The plot of P2Y 2 R for each HCPS patient, shown on the x-axis as H1-H22. Each data point per patient represents a triplicate measurement of P2Y 2 R expression in a 10 μm slice cut from the FFPE blocks. The number of segments analyzed is shown for each case above the replicate data points (e.g., n = 11 for H1). Ninety-seven distinct segments from all cases were analyzed. Lung tissues from two decedents (H4, and H9) were not available. The error bars represent the median and range. For all HCPS samples, the minimum, median, maximum and mean values were 0.0055, 2.10, 24.88, and 4.1 ± 0.48 (SEM). (B,C) Plot of P2Y 2 R for pneumonia (P) and gunshot wound cases (GSW). The experimental conditions are similar to those described for HCPS. Cases for which no lung tissue samples were available were excluded from the graph. For all pneumonia tissue segment samples ( n = 39), the minimum, median, maximum and mean values were 0.0005, 0.07, 4.4, 0.54 ± 0.16. For all GSW samples ( n = 21), the minimum, median, maximum and mean values were 0.0052, 0.18, 2.4, and 0.46 ± 0.10 (SEM).
    Figure Legend Snippet: P2Y 2 R expression is significantly upregulated in HCPS compared to controls. RNA was extracted from lung tissues samples with the Qiagen RNeasy FFPE kit (cat# 73504) and quantified with a Thermo Fisher Scientific Nanodrop. P2Y 2 R expression levels were measured by the TaqMan assay using a WT P2Y 2 R plasmid as standard. P2Y 2 R copy #s were normalized to total RNA extracted from the embedded tissues. Each sample slice was measured in triplicate. (A) The plot of P2Y 2 R for each HCPS patient, shown on the x-axis as H1-H22. Each data point per patient represents a triplicate measurement of P2Y 2 R expression in a 10 μm slice cut from the FFPE blocks. The number of segments analyzed is shown for each case above the replicate data points (e.g., n = 11 for H1). Ninety-seven distinct segments from all cases were analyzed. Lung tissues from two decedents (H4, and H9) were not available. The error bars represent the median and range. For all HCPS samples, the minimum, median, maximum and mean values were 0.0055, 2.10, 24.88, and 4.1 ± 0.48 (SEM). (B,C) Plot of P2Y 2 R for pneumonia (P) and gunshot wound cases (GSW). The experimental conditions are similar to those described for HCPS. Cases for which no lung tissue samples were available were excluded from the graph. For all pneumonia tissue segment samples ( n = 39), the minimum, median, maximum and mean values were 0.0005, 0.07, 4.4, 0.54 ± 0.16. For all GSW samples ( n = 21), the minimum, median, maximum and mean values were 0.0052, 0.18, 2.4, and 0.46 ± 0.10 (SEM).

    Techniques Used: Expressing, Formalin-fixed Paraffin-Embedded, TaqMan Assay, Plasmid Preparation

    2) Product Images from "Upregulation of P2Y2R, Active uPA, and PAI-1 Are Essential Components of Hantavirus Cardiopulmonary Syndrome"

    Article Title: Upregulation of P2Y2R, Active uPA, and PAI-1 Are Essential Components of Hantavirus Cardiopulmonary Syndrome

    Journal: Frontiers in Cellular and Infection Microbiology

    doi: 10.3389/fcimb.2018.00169

    P2Y 2 R expression is significantly upregulated in HCPS compared to controls. RNA was extracted from lung tissues samples with the Qiagen RNeasy FFPE kit (cat# 73504) and quantified with a Thermo Fisher Scientific Nanodrop. P2Y 2 R expression levels were measured by the TaqMan assay using a WT P2Y 2 R plasmid as standard. P2Y 2 R copy #s were normalized to total RNA extracted from the embedded tissues. Each sample slice was measured in triplicate. (A) The plot of P2Y 2 R for each HCPS patient, shown on the x-axis as H1-H22. Each data point per patient represents a triplicate measurement of P2Y 2 R expression in a 10 μm slice cut from the FFPE blocks. The number of segments analyzed is shown for each case above the replicate data points (e.g., n = 11 for H1). Ninety-seven distinct segments from all cases were analyzed. Lung tissues from two decedents (H4, and H9) were not available. The error bars represent the median and range. For all HCPS samples, the minimum, median, maximum and mean values were 0.0055, 2.10, 24.88, and 4.1 ± 0.48 (SEM). (B,C) Plot of P2Y 2 R for pneumonia (P) and gunshot wound cases (GSW). The experimental conditions are similar to those described for HCPS. Cases for which no lung tissue samples were available were excluded from the graph. For all pneumonia tissue segment samples ( n = 39), the minimum, median, maximum and mean values were 0.0005, 0.07, 4.4, 0.54 ± 0.16. For all GSW samples ( n = 21), the minimum, median, maximum and mean values were 0.0052, 0.18, 2.4, and 0.46 ± 0.10 (SEM).
    Figure Legend Snippet: P2Y 2 R expression is significantly upregulated in HCPS compared to controls. RNA was extracted from lung tissues samples with the Qiagen RNeasy FFPE kit (cat# 73504) and quantified with a Thermo Fisher Scientific Nanodrop. P2Y 2 R expression levels were measured by the TaqMan assay using a WT P2Y 2 R plasmid as standard. P2Y 2 R copy #s were normalized to total RNA extracted from the embedded tissues. Each sample slice was measured in triplicate. (A) The plot of P2Y 2 R for each HCPS patient, shown on the x-axis as H1-H22. Each data point per patient represents a triplicate measurement of P2Y 2 R expression in a 10 μm slice cut from the FFPE blocks. The number of segments analyzed is shown for each case above the replicate data points (e.g., n = 11 for H1). Ninety-seven distinct segments from all cases were analyzed. Lung tissues from two decedents (H4, and H9) were not available. The error bars represent the median and range. For all HCPS samples, the minimum, median, maximum and mean values were 0.0055, 2.10, 24.88, and 4.1 ± 0.48 (SEM). (B,C) Plot of P2Y 2 R for pneumonia (P) and gunshot wound cases (GSW). The experimental conditions are similar to those described for HCPS. Cases for which no lung tissue samples were available were excluded from the graph. For all pneumonia tissue segment samples ( n = 39), the minimum, median, maximum and mean values were 0.0005, 0.07, 4.4, 0.54 ± 0.16. For all GSW samples ( n = 21), the minimum, median, maximum and mean values were 0.0052, 0.18, 2.4, and 0.46 ± 0.10 (SEM).

    Techniques Used: Expressing, Formalin-fixed Paraffin-Embedded, TaqMan Assay, Plasmid Preparation

    3) Product Images from "Reduced expression levels of the death-associated protein kinase and E-cadherin are correlated with the development of esophageal squamous cell carcinoma"

    Article Title: Reduced expression levels of the death-associated protein kinase and E-cadherin are correlated with the development of esophageal squamous cell carcinoma

    Journal: Experimental and Therapeutic Medicine

    doi: 10.3892/etm.2013.916

    Quantitative RT-PCR analysis of DAPK and E-cadherin mRNA levels in ESCC and adjacent normal tissues. Total RNA was harvested from tissues using the RNeasy FFPE kit (Qiagen) according to the manufacturer’s instructions. The RT-PCR experiments were repeated at least 3 times. RNA was reverse transcribed into cDNA using random primers in a Reverse Transcription II system (Promega) according to the manufacturer’s instructions. Expression of DAPK and E-cadherin mRNAs was quantified by quantitative PCR using an ABI Prism Sequence Detection System (Applied Biosystems). Template-negative and RT-negative conditions were used as controls. Amplification of the endogenous GAPDH cDNA was monitored. Levels (mean values) of DAPK and E-cadherin transcripts in patients were calculated. RT-PCR, reverse transcription-PCR; ESCC, esophageal squamous cell carcinoma; DAPK, death-associated protein kinase.
    Figure Legend Snippet: Quantitative RT-PCR analysis of DAPK and E-cadherin mRNA levels in ESCC and adjacent normal tissues. Total RNA was harvested from tissues using the RNeasy FFPE kit (Qiagen) according to the manufacturer’s instructions. The RT-PCR experiments were repeated at least 3 times. RNA was reverse transcribed into cDNA using random primers in a Reverse Transcription II system (Promega) according to the manufacturer’s instructions. Expression of DAPK and E-cadherin mRNAs was quantified by quantitative PCR using an ABI Prism Sequence Detection System (Applied Biosystems). Template-negative and RT-negative conditions were used as controls. Amplification of the endogenous GAPDH cDNA was monitored. Levels (mean values) of DAPK and E-cadherin transcripts in patients were calculated. RT-PCR, reverse transcription-PCR; ESCC, esophageal squamous cell carcinoma; DAPK, death-associated protein kinase.

    Techniques Used: Quantitative RT-PCR, Formalin-fixed Paraffin-Embedded, Reverse Transcription Polymerase Chain Reaction, Expressing, Real-time Polymerase Chain Reaction, Sequencing, Amplification, Polymerase Chain Reaction

    Related Articles

    Amplification:

    Article Title: Phase II trial of dacomitinib, a pan–human EGFR tyrosine kinase inhibitor, in recurrent glioblastoma patients with EGFR amplification
    Article Snippet: .. Total RNA from FFPE tissues of EGFR amplified tumors was extracted using the RNeasy FFPE Kit (Qiagen) according to manufacturer’s protocol. .. A total of 1 µg of RNA was reverse transcribed for the synthesis of cDNA using the PrimeScript RT kit (Takara Bio) following the manufacturer’s instructions.

    Article Title: Premature ovarian aging in BRCA carriers: a prototype of systemic precocious aging?
    Article Snippet: Ovarian gene expression analysis by qPCR Purification of total RNA from formalin fixed, paraffin-embedded microdissected ovarian tissue was made by RNeasy-FFPE kit according to the manufacturer’s instructions (QIAGEN GmbH, Hilden, Germany). .. In each run, 20 ng of cDNA per reaction were used as an amplification template.

    Synthesized:

    Article Title: CD164 identifies CD4+ T cells highly expressing genes associated with malignancy in Sézary syndrome: the Sézary signature genes, FCRL3, Tox and miR-214
    Article Snippet: For skin samples, total RNA was extracted from formalin-fixed paraffin embedded (FFPE) samples and normal tissue using the Qiagen RNeasy FFPE Kit and Fibrous Tissue Kit (Qiagen) following the manufacturers’ instructions. .. Single-stranded cDNA was synthesized by reverse transcription of 40 nanograms of RNA from CD164+ /CD164− CD4+ T cells and skin biopsies using the High Capacity RNA to cDNA Kit (Applied Biosystems) for further analysis.

    Blocking Assay:

    Article Title: Evaluation of MCT1, MCT4 and CD147 Genes in Peripheral Blood Cells of Breast Cancer Patients and Their Potential Use as Diagnostic and Prognostic Markers
    Article Snippet: RNA Extraction from Paraffin-Embedded Material Two 10 μm sections per block were obtained with the aid of a microtome from the pathology department of FMABC. .. For total RNA isolation, RNeasy FFPE kit (Qiagen, cat. no. 74404, Hilden, Germany) was used according to manufacturer’s directions.

    Article Title: Fusobacterium nucleatum promotes colorectal carcinogenesis by modulating E-cadherin/β-catenin signaling via its FadA adhesin
    Article Snippet: A representative block of colon adenocarcinoma (or adenoma) and a block of normal colon from the same patient were used. .. RNA was extracted using PureLink FFPE Total RNA Isolation Kit (Invitrogen) or RNeasy FFPE Kit (Qiagen).

    Article Title: EZH2 Is Associated with Malignant Behavior in Pancreatic IPMN via p27Kip1 Downregulation
    Article Snippet: Formalin-fixed paraffin-embedded block with IPMN lesion or normal pancreatic duct was sectioned into 10-µm, 6–12 serial pieces. .. Then, total RNA was extracted using RNeasy FFPE Kit (QIAGEN) according to each instruction manual.

    Real-time Polymerase Chain Reaction:

    Article Title: Phase II trial of dacomitinib, a pan–human EGFR tyrosine kinase inhibitor, in recurrent glioblastoma patients with EGFR amplification
    Article Snippet: Total RNA from FFPE tissues of EGFR amplified tumors was extracted using the RNeasy FFPE Kit (Qiagen) according to manufacturer’s protocol. .. Real-time PCR to amplify EGFR vIII and hypoxanthine-guanine phosphoribosyltransferase (HPRT1) as the control gene was performed on LightCycler 480 using the SYBR Green method (Roche).

    Article Title: Premature ovarian aging in BRCA carriers: a prototype of systemic precocious aging?
    Article Snippet: .. Ovarian gene expression analysis by qPCR Purification of total RNA from formalin fixed, paraffin-embedded microdissected ovarian tissue was made by RNeasy-FFPE kit according to the manufacturer’s instructions (QIAGEN GmbH, Hilden, Germany). .. Ovarian mRNA was quantified [ ]; first-strand cDNA was created by RT (Applied biosystems, Foster City, California) in 35 cycles with 0.4 μM gene-specific primers using ready-mix mixture (Sigma). mRNA amount were assessed by SYBR green reagent (SYBR Green PCR Master Mix, ABI, Carlsbad, CA, USA) on an ABI Prism 7900 Sequence PCR machine.

    Article Title: CD164 identifies CD4+ T cells highly expressing genes associated with malignancy in Sézary syndrome: the Sézary signature genes, FCRL3, Tox and miR-214
    Article Snippet: Paragraph title: RNA isolation and quantitative real time PCR ... For skin samples, total RNA was extracted from formalin-fixed paraffin embedded (FFPE) samples and normal tissue using the Qiagen RNeasy FFPE Kit and Fibrous Tissue Kit (Qiagen) following the manufacturers’ instructions.

    Article Title: Targeted Resequencing Reveals ALK Fusions in Non-Small Cell Lung Carcinomas Detected by FISH, Immunohistochemistry, and Real-Time RT-PCR: A Comparison of Four Methods
    Article Snippet: Following xylene deparaffinization of a 16 μ M FFPE section, total RNA was extracted using the RNeasy FFPE Kit (Qiagen GmbH, Hilden, Germany) according to the manufacturer's protocol. .. 100–500 ng of the extracted RNA was used for reverse transcription and real-time PCR in each of the four reactions of the EML4-ALK fusion gene detection kit according to the manufacturer's protocol.

    Article Title: EZH2 Is Associated with Malignant Behavior in Pancreatic IPMN via p27Kip1 Downregulation
    Article Snippet: Paragraph title: RNA extraction from formalin-fixed paraffin-embedded specimens and real time PCR analyses ... Then, total RNA was extracted using RNeasy FFPE Kit (QIAGEN) according to each instruction manual.

    Incubation:

    Article Title: Quantitation of Gene Expression in Formaldehyde-Fixed and Fluorescence-Activated Sorted Cells
    Article Snippet: Total RNA was isolated from fixed cells using reagents from the RNeasy FFPE kit (Qiagen) and the RNeasy Plus Mini Kit (Qiagen), following a modified version of the manufacturers’ protocols. .. Following the addition of 10 µl of proteinase K, samples were incubated at 56°C for 15 minutes, then at 80°C for 15 minutes.

    Formalin-fixed Paraffin-Embedded:

    Article Title: Phase II trial of dacomitinib, a pan–human EGFR tyrosine kinase inhibitor, in recurrent glioblastoma patients with EGFR amplification
    Article Snippet: .. Total RNA from FFPE tissues of EGFR amplified tumors was extracted using the RNeasy FFPE Kit (Qiagen) according to manufacturer’s protocol. .. A total of 1 µg of RNA was reverse transcribed for the synthesis of cDNA using the PrimeScript RT kit (Takara Bio) following the manufacturer’s instructions.

    Article Title: Premature ovarian aging in BRCA carriers: a prototype of systemic precocious aging?
    Article Snippet: .. Ovarian gene expression analysis by qPCR Purification of total RNA from formalin fixed, paraffin-embedded microdissected ovarian tissue was made by RNeasy-FFPE kit according to the manufacturer’s instructions (QIAGEN GmbH, Hilden, Germany). .. Ovarian mRNA was quantified [ ]; first-strand cDNA was created by RT (Applied biosystems, Foster City, California) in 35 cycles with 0.4 μM gene-specific primers using ready-mix mixture (Sigma). mRNA amount were assessed by SYBR green reagent (SYBR Green PCR Master Mix, ABI, Carlsbad, CA, USA) on an ABI Prism 7900 Sequence PCR machine.

    Article Title: TGFbeta and miRNA regulation in familial and sporadic breast cancer
    Article Snippet: .. MiRNA expression profiling Ten μm-thick formalin-fixed, paraffin-embedded sections were used to extract total RNA, including microRNAs, using the RNeasy® FFPE Kit (QIAGEN) according to the manufacturer's protocol. .. 500 ng of RNA of each sample was labelled using the 3DNA Array Detection FlashTagTM RNA Labeling Kit according to the manufacturer's instructions, and analyzed with the GeneChip miRNA v. 1.0 Array (Affymetrix).

    Article Title: Evaluation of MCT1, MCT4 and CD147 Genes in Peripheral Blood Cells of Breast Cancer Patients and Their Potential Use as Diagnostic and Prognostic Markers
    Article Snippet: .. For total RNA isolation, RNeasy FFPE kit (Qiagen, cat. no. 74404, Hilden, Germany) was used according to manufacturer’s directions. .. The extracted material was quantified by a NanoVue Plus spectrophotometer.

    Article Title: Quantitation of Gene Expression in Formaldehyde-Fixed and Fluorescence-Activated Sorted Cells
    Article Snippet: .. Total RNA was isolated from fixed cells using reagents from the RNeasy FFPE kit (Qiagen) and the RNeasy Plus Mini Kit (Qiagen), following a modified version of the manufacturers’ protocols. ..

    Article Title: Mir-486-5p Downregulation Marks an Early Event in Colorectal Carcinogenesis
    Article Snippet: .. As above, RNA was isolated from the FFPE patient tissue sample slides, using the RNeasy FFPE Kit, and the RNA isolation was performed by a single technician to reduce inter-operator variation. .. RNA was similarly submitted to the OHSU Gene Profiling Shared Resource for RNA quality assessment and quantitation.

    Article Title: CD164 identifies CD4+ T cells highly expressing genes associated with malignancy in Sézary syndrome: the Sézary signature genes, FCRL3, Tox and miR-214
    Article Snippet: .. For skin samples, total RNA was extracted from formalin-fixed paraffin embedded (FFPE) samples and normal tissue using the Qiagen RNeasy FFPE Kit and Fibrous Tissue Kit (Qiagen) following the manufacturers’ instructions. .. Single-stranded cDNA was synthesized by reverse transcription of 40 nanograms of RNA from CD164+ /CD164− CD4+ T cells and skin biopsies using the High Capacity RNA to cDNA Kit (Applied Biosystems) for further analysis.

    Article Title: Targeted Resequencing Reveals ALK Fusions in Non-Small Cell Lung Carcinomas Detected by FISH, Immunohistochemistry, and Real-Time RT-PCR: A Comparison of Four Methods
    Article Snippet: .. Following xylene deparaffinization of a 16 μ M FFPE section, total RNA was extracted using the RNeasy FFPE Kit (Qiagen GmbH, Hilden, Germany) according to the manufacturer's protocol. .. RNA was quantified using the Qubit fluorometric quantitation system (Life Technologies, Carlsbad, CA, USA).

    Article Title: Clinical sequencing defines the genomic landscape of metastatic colorectal cancer
    Article Snippet: .. Using the RNeasy FFPE kit (Qiagen) and mineral oil de-paraffins methods, RNA was extracted from cases with exon 9 APC intronic alterations. .. Digital Droplet PCR assay to detect APC_Exon9_Splicing was designed using Prime3Plus and ordered through Biorad: forward primer 5′AGAAATCAACATGGCAACT 3′; Reverse primer: 5′ACTAGAACTCAAAACACTGG 3′; wild-type (WT) probe: 5′TAATGGTCAGGGTTCAACTAC 3′-HEX_IowaBlack; mutation specific probe: 5′TGGTCAGTTTTTAGGGTTCA 3′-FAM_IowaBlack.

    Article Title: FFPEcap-seq: a method for sequencing capped RNAs in formalin-fixed paraffin-embedded samples
    Article Snippet: .. Four 20 µm scrolls were collected from these samples, and RNA was extracted using the RNeasy FFPE kit (QIAGEN). .. RNA concentration was measured using a Qubit 2.0 with the RNA high sensitivity or RNA broad range assay (Thermo Fisher Scientific), depending on the concentration.

    Article Title: Fusobacterium nucleatum promotes colorectal carcinogenesis by modulating E-cadherin/β-catenin signaling via its FadA adhesin
    Article Snippet: .. RNA was extracted using PureLink FFPE Total RNA Isolation Kit (Invitrogen) or RNeasy FFPE Kit (Qiagen). .. Total RNA was extracted from CRC cells, xenografts, or clinical specimens. cDNA synthesis and RT-PCR were performed as previously described, using primers listed in ( ).

    Article Title: LMO2 Is a Novel Predictive Marker for a Better Prognosis in Pancreatic Cancer 1
    Article Snippet: .. Total RNA was extracted using an RNeasy FFPE Kit (Qiagen, Tokyo, Japan) with DNase I treatment according to the manufacturer's instructions. .. Total RNA was extracted from bulk tissues using an RNeasy Mini Kit (Qiagen) and from pellets of cultured cells using a High Pure RNA Kit (Roche Diagnostics, Mannheim, Germany) with DNase I treatment (Roche Diagnostics) according to the corresponding manufacturer's instructions.

    Article Title: The lincRNA MIRAT binds to IQGAP1 and modulates the MAPK pathway in NRAS mutant melanoma
    Article Snippet: .. RNA was extracted using RNeasy FFPE kit (Qiagen, Valencia, CA). .. RNA yield and A260/A280 ratio were monitored with a NanoDrop ND-1000 spectrometer (NanoDrop Technologies).

    Article Title: EZH2 Is Associated with Malignant Behavior in Pancreatic IPMN via p27Kip1 Downregulation
    Article Snippet: .. Then, total RNA was extracted using RNeasy FFPE Kit (QIAGEN) according to each instruction manual. .. Total RNA was converted to cDNA by reverse transcription polymerase chain reaction (RT-PCR).

    Expressing:

    Article Title: Premature ovarian aging in BRCA carriers: a prototype of systemic precocious aging?
    Article Snippet: .. Ovarian gene expression analysis by qPCR Purification of total RNA from formalin fixed, paraffin-embedded microdissected ovarian tissue was made by RNeasy-FFPE kit according to the manufacturer’s instructions (QIAGEN GmbH, Hilden, Germany). .. Ovarian mRNA was quantified [ ]; first-strand cDNA was created by RT (Applied biosystems, Foster City, California) in 35 cycles with 0.4 μM gene-specific primers using ready-mix mixture (Sigma). mRNA amount were assessed by SYBR green reagent (SYBR Green PCR Master Mix, ABI, Carlsbad, CA, USA) on an ABI Prism 7900 Sequence PCR machine.

    Article Title: TGFbeta and miRNA regulation in familial and sporadic breast cancer
    Article Snippet: .. MiRNA expression profiling Ten μm-thick formalin-fixed, paraffin-embedded sections were used to extract total RNA, including microRNAs, using the RNeasy® FFPE Kit (QIAGEN) according to the manufacturer's protocol. .. 500 ng of RNA of each sample was labelled using the 3DNA Array Detection FlashTagTM RNA Labeling Kit according to the manufacturer's instructions, and analyzed with the GeneChip miRNA v. 1.0 Array (Affymetrix).

    Article Title: CD164 identifies CD4+ T cells highly expressing genes associated with malignancy in Sézary syndrome: the Sézary signature genes, FCRL3, Tox and miR-214
    Article Snippet: To assess the expression of T-plastin, Gata-3, STAT-4, FCRL3, and Tox on sorted CD164+ /CD164− CD4+ T cells, total RNA was extracted from sorted and normal CD4+ T cells using the Qiagen RNeasy Mini Kit (Qiagen) according to the manufacturers’ instructions. .. For skin samples, total RNA was extracted from formalin-fixed paraffin embedded (FFPE) samples and normal tissue using the Qiagen RNeasy FFPE Kit and Fibrous Tissue Kit (Qiagen) following the manufacturers’ instructions.

    Article Title: Ribonucleic Acid Extraction From Archival Formalin Fixed Paraffin Embedded Myocardial Tissues for Gene Expression and Pathogen Detection
    Article Snippet: Paragraph title: Expression of GAPDH by RT ‐ PCR ... mRNA of GAPDH was detected in RNA of all the 16 samples (100%) extracted by RNeasy FFPE kit (Qiagen), 12/16 RNA samples extracted by Trizol method (Tri Reagent, GIBCO), and in none of the RNA sample extracted by SDS method (Amresco) (Fig. ).

    Article Title: EZH2 Is Associated with Malignant Behavior in Pancreatic IPMN via p27Kip1 Downregulation
    Article Snippet: Then, total RNA was extracted using RNeasy FFPE Kit (QIAGEN) according to each instruction manual. .. To measure mRNA expression levels of EZH2 and p27Kip1 , real time PCR assay was performed using LightCycler 480 (Roche) system.

    Modification:

    Article Title: Quantitation of Gene Expression in Formaldehyde-Fixed and Fluorescence-Activated Sorted Cells
    Article Snippet: .. Total RNA was isolated from fixed cells using reagents from the RNeasy FFPE kit (Qiagen) and the RNeasy Plus Mini Kit (Qiagen), following a modified version of the manufacturers’ protocols. ..

    Derivative Assay:

    Article Title: Phase II trial of dacomitinib, a pan–human EGFR tyrosine kinase inhibitor, in recurrent glioblastoma patients with EGFR amplification
    Article Snippet: Total RNA from FFPE tissues of EGFR amplified tumors was extracted using the RNeasy FFPE Kit (Qiagen) according to manufacturer’s protocol. .. EGFR vIII and HPRT1 primer sequences were derived from the Yoshimoto K report.

    Article Title: TGFbeta and miRNA regulation in familial and sporadic breast cancer
    Article Snippet: MiRNA expression profiling Ten μm-thick formalin-fixed, paraffin-embedded sections were used to extract total RNA, including microRNAs, using the RNeasy® FFPE Kit (QIAGEN) according to the manufacturer's protocol. .. This contains 46,228 probes comprising 7,815 probe sets, and covers 71 organisms including 848 human miRNAs derived from the Sanger miRBase and miRNA database v11 (April 15, 2008, http://microrna.sanger.ac.uk ).

    Article Title: Fusobacterium nucleatum promotes colorectal carcinogenesis by modulating E-cadherin/β-catenin signaling via its FadA adhesin
    Article Snippet: In addition, normal colon tissues were derived from 14 individuals undergoing resection for benign colon pathology or resection of adjacent organs. .. RNA was extracted using PureLink FFPE Total RNA Isolation Kit (Invitrogen) or RNeasy FFPE Kit (Qiagen).

    Polymerase Chain Reaction:

    Article Title: Phase II trial of dacomitinib, a pan–human EGFR tyrosine kinase inhibitor, in recurrent glioblastoma patients with EGFR amplification
    Article Snippet: Paragraph title: Real-time reverse transcription PCR ... Total RNA from FFPE tissues of EGFR amplified tumors was extracted using the RNeasy FFPE Kit (Qiagen) according to manufacturer’s protocol.

    Article Title: Premature ovarian aging in BRCA carriers: a prototype of systemic precocious aging?
    Article Snippet: Ovarian gene expression analysis by qPCR Purification of total RNA from formalin fixed, paraffin-embedded microdissected ovarian tissue was made by RNeasy-FFPE kit according to the manufacturer’s instructions (QIAGEN GmbH, Hilden, Germany). .. Ovarian mRNA was quantified [ ]; first-strand cDNA was created by RT (Applied biosystems, Foster City, California) in 35 cycles with 0.4 μM gene-specific primers using ready-mix mixture (Sigma). mRNA amount were assessed by SYBR green reagent (SYBR Green PCR Master Mix, ABI, Carlsbad, CA, USA) on an ABI Prism 7900 Sequence PCR machine.

    Article Title: Clinical sequencing defines the genomic landscape of metastatic colorectal cancer
    Article Snippet: Paragraph title: Digital droplet PCR ... Using the RNeasy FFPE kit (Qiagen) and mineral oil de-paraffins methods, RNA was extracted from cases with exon 9 APC intronic alterations.

    Sequencing:

    Article Title: Premature ovarian aging in BRCA carriers: a prototype of systemic precocious aging?
    Article Snippet: Ovarian gene expression analysis by qPCR Purification of total RNA from formalin fixed, paraffin-embedded microdissected ovarian tissue was made by RNeasy-FFPE kit according to the manufacturer’s instructions (QIAGEN GmbH, Hilden, Germany). .. Ovarian mRNA was quantified [ ]; first-strand cDNA was created by RT (Applied biosystems, Foster City, California) in 35 cycles with 0.4 μM gene-specific primers using ready-mix mixture (Sigma). mRNA amount were assessed by SYBR green reagent (SYBR Green PCR Master Mix, ABI, Carlsbad, CA, USA) on an ABI Prism 7900 Sequence PCR machine.

    Mutagenesis:

    Article Title: Clinical sequencing defines the genomic landscape of metastatic colorectal cancer
    Article Snippet: Using the RNeasy FFPE kit (Qiagen) and mineral oil de-paraffins methods, RNA was extracted from cases with exon 9 APC intronic alterations. .. Digital Droplet PCR assay to detect APC_Exon9_Splicing was designed using Prime3Plus and ordered through Biorad: forward primer 5′AGAAATCAACATGGCAACT 3′; Reverse primer: 5′ACTAGAACTCAAAACACTGG 3′; wild-type (WT) probe: 5′TAATGGTCAGGGTTCAACTAC 3′-HEX_IowaBlack; mutation specific probe: 5′TGGTCAGTTTTTAGGGTTCA 3′-FAM_IowaBlack.

    Isolation:

    Article Title: Evaluation of MCT1, MCT4 and CD147 Genes in Peripheral Blood Cells of Breast Cancer Patients and Their Potential Use as Diagnostic and Prognostic Markers
    Article Snippet: .. For total RNA isolation, RNeasy FFPE kit (Qiagen, cat. no. 74404, Hilden, Germany) was used according to manufacturer’s directions. .. The extracted material was quantified by a NanoVue Plus spectrophotometer.

    Article Title: Quantitation of Gene Expression in Formaldehyde-Fixed and Fluorescence-Activated Sorted Cells
    Article Snippet: .. Total RNA was isolated from fixed cells using reagents from the RNeasy FFPE kit (Qiagen) and the RNeasy Plus Mini Kit (Qiagen), following a modified version of the manufacturers’ protocols. ..

    Article Title: Mir-486-5p Downregulation Marks an Early Event in Colorectal Carcinogenesis
    Article Snippet: .. As above, RNA was isolated from the FFPE patient tissue sample slides, using the RNeasy FFPE Kit, and the RNA isolation was performed by a single technician to reduce inter-operator variation. .. RNA was similarly submitted to the OHSU Gene Profiling Shared Resource for RNA quality assessment and quantitation.

    Article Title: CD164 identifies CD4+ T cells highly expressing genes associated with malignancy in Sézary syndrome: the Sézary signature genes, FCRL3, Tox and miR-214
    Article Snippet: Paragraph title: RNA isolation and quantitative real time PCR ... For skin samples, total RNA was extracted from formalin-fixed paraffin embedded (FFPE) samples and normal tissue using the Qiagen RNeasy FFPE Kit and Fibrous Tissue Kit (Qiagen) following the manufacturers’ instructions.

    Article Title: Fusobacterium nucleatum promotes colorectal carcinogenesis by modulating E-cadherin/β-catenin signaling via its FadA adhesin
    Article Snippet: .. RNA was extracted using PureLink FFPE Total RNA Isolation Kit (Invitrogen) or RNeasy FFPE Kit (Qiagen). .. Total RNA was extracted from CRC cells, xenografts, or clinical specimens. cDNA synthesis and RT-PCR were performed as previously described, using primers listed in ( ).

    Article Title: LMO2 Is a Novel Predictive Marker for a Better Prognosis in Pancreatic Cancer 1
    Article Snippet: Paragraph title: RNA Isolation from Microdissected and FFPE Samples ... Total RNA was extracted using an RNeasy FFPE Kit (Qiagen, Tokyo, Japan) with DNase I treatment according to the manufacturer's instructions.

    Labeling:

    Article Title: TGFbeta and miRNA regulation in familial and sporadic breast cancer
    Article Snippet: MiRNA expression profiling Ten μm-thick formalin-fixed, paraffin-embedded sections were used to extract total RNA, including microRNAs, using the RNeasy® FFPE Kit (QIAGEN) according to the manufacturer's protocol. .. 500 ng of RNA of each sample was labelled using the 3DNA Array Detection FlashTagTM RNA Labeling Kit according to the manufacturer's instructions, and analyzed with the GeneChip miRNA v. 1.0 Array (Affymetrix).

    Purification:

    Article Title: Premature ovarian aging in BRCA carriers: a prototype of systemic precocious aging?
    Article Snippet: .. Ovarian gene expression analysis by qPCR Purification of total RNA from formalin fixed, paraffin-embedded microdissected ovarian tissue was made by RNeasy-FFPE kit according to the manufacturer’s instructions (QIAGEN GmbH, Hilden, Germany). .. Ovarian mRNA was quantified [ ]; first-strand cDNA was created by RT (Applied biosystems, Foster City, California) in 35 cycles with 0.4 μM gene-specific primers using ready-mix mixture (Sigma). mRNA amount were assessed by SYBR green reagent (SYBR Green PCR Master Mix, ABI, Carlsbad, CA, USA) on an ABI Prism 7900 Sequence PCR machine.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Ribonucleic Acid Extraction From Archival Formalin Fixed Paraffin Embedded Myocardial Tissues for Gene Expression and Pathogen Detection
    Article Snippet: Paragraph title: Expression of GAPDH by RT ‐ PCR ... mRNA of GAPDH was detected in RNA of all the 16 samples (100%) extracted by RNeasy FFPE kit (Qiagen), 12/16 RNA samples extracted by Trizol method (Tri Reagent, GIBCO), and in none of the RNA sample extracted by SDS method (Amresco) (Fig. ).

    Article Title: EZH2 Is Associated with Malignant Behavior in Pancreatic IPMN via p27Kip1 Downregulation
    Article Snippet: Then, total RNA was extracted using RNeasy FFPE Kit (QIAGEN) according to each instruction manual. .. Total RNA was converted to cDNA by reverse transcription polymerase chain reaction (RT-PCR).

    Quantitative RT-PCR:

    Article Title: CD164 identifies CD4+ T cells highly expressing genes associated with malignancy in Sézary syndrome: the Sézary signature genes, FCRL3, Tox and miR-214
    Article Snippet: For skin samples, total RNA was extracted from formalin-fixed paraffin embedded (FFPE) samples and normal tissue using the Qiagen RNeasy FFPE Kit and Fibrous Tissue Kit (Qiagen) following the manufacturers’ instructions. .. QRT-PCR was performed using Taqman gene expression assays (Applied Biosystems) with Taqman Gene Expression Master Mix (Applied Biosystems) according to the manufacturers’ instructions.

    Article Title: Targeted Resequencing Reveals ALK Fusions in Non-Small Cell Lung Carcinomas Detected by FISH, Immunohistochemistry, and Real-Time RT-PCR: A Comparison of Four Methods
    Article Snippet: Paragraph title: 2.4. Real-Time RT-PCR ... Following xylene deparaffinization of a 16 μ M FFPE section, total RNA was extracted using the RNeasy FFPE Kit (Qiagen GmbH, Hilden, Germany) according to the manufacturer's protocol.

    Article Title: LMO2 Is a Novel Predictive Marker for a Better Prognosis in Pancreatic Cancer 1
    Article Snippet: After the microdissection, total RNA was extracted from the selected cells and subjected to qRT-PCR for quantification of LMO2 as described previously [ ]. .. Total RNA was extracted using an RNeasy FFPE Kit (Qiagen, Tokyo, Japan) with DNase I treatment according to the manufacturer's instructions.

    SYBR Green Assay:

    Article Title: Phase II trial of dacomitinib, a pan–human EGFR tyrosine kinase inhibitor, in recurrent glioblastoma patients with EGFR amplification
    Article Snippet: Total RNA from FFPE tissues of EGFR amplified tumors was extracted using the RNeasy FFPE Kit (Qiagen) according to manufacturer’s protocol. .. Real-time PCR to amplify EGFR vIII and hypoxanthine-guanine phosphoribosyltransferase (HPRT1) as the control gene was performed on LightCycler 480 using the SYBR Green method (Roche).

    Article Title: Premature ovarian aging in BRCA carriers: a prototype of systemic precocious aging?
    Article Snippet: Ovarian gene expression analysis by qPCR Purification of total RNA from formalin fixed, paraffin-embedded microdissected ovarian tissue was made by RNeasy-FFPE kit according to the manufacturer’s instructions (QIAGEN GmbH, Hilden, Germany). .. Ovarian mRNA was quantified [ ]; first-strand cDNA was created by RT (Applied biosystems, Foster City, California) in 35 cycles with 0.4 μM gene-specific primers using ready-mix mixture (Sigma). mRNA amount were assessed by SYBR green reagent (SYBR Green PCR Master Mix, ABI, Carlsbad, CA, USA) on an ABI Prism 7900 Sequence PCR machine.

    RNA Extraction:

    Article Title: Evaluation of MCT1, MCT4 and CD147 Genes in Peripheral Blood Cells of Breast Cancer Patients and Their Potential Use as Diagnostic and Prognostic Markers
    Article Snippet: Paragraph title: 4.3. RNA Extraction from Paraffin-Embedded Material ... For total RNA isolation, RNeasy FFPE kit (Qiagen, cat. no. 74404, Hilden, Germany) was used according to manufacturer’s directions.

    Article Title: LMO2 Is a Novel Predictive Marker for a Better Prognosis in Pancreatic Cancer 1
    Article Snippet: Macrodissection was performed using a safety blade to enrich the neoplastic cell population, and 3 to 10 sections were used for RNA extraction. .. Total RNA was extracted using an RNeasy FFPE Kit (Qiagen, Tokyo, Japan) with DNase I treatment according to the manufacturer's instructions.

    Article Title: The lincRNA MIRAT binds to IQGAP1 and modulates the MAPK pathway in NRAS mutant melanoma
    Article Snippet: Paragraph title: Patient sample collection and RNA extraction ... RNA was extracted using RNeasy FFPE kit (Qiagen, Valencia, CA).

    Article Title: EZH2 Is Associated with Malignant Behavior in Pancreatic IPMN via p27Kip1 Downregulation
    Article Snippet: Paragraph title: RNA extraction from formalin-fixed paraffin-embedded specimens and real time PCR analyses ... Then, total RNA was extracted using RNeasy FFPE Kit (QIAGEN) according to each instruction manual.

    Laser Capture Microdissection:

    Article Title: LMO2 Is a Novel Predictive Marker for a Better Prognosis in Pancreatic Cancer 1
    Article Snippet: After the microdissection, total RNA was extracted from the selected cells and subjected to qRT-PCR for quantification of LMO2 as described previously [ ]. .. Total RNA was extracted using an RNeasy FFPE Kit (Qiagen, Tokyo, Japan) with DNase I treatment according to the manufacturer's instructions.

    Quantitation Assay:

    Article Title: Targeted Resequencing Reveals ALK Fusions in Non-Small Cell Lung Carcinomas Detected by FISH, Immunohistochemistry, and Real-Time RT-PCR: A Comparison of Four Methods
    Article Snippet: Following xylene deparaffinization of a 16 μ M FFPE section, total RNA was extracted using the RNeasy FFPE Kit (Qiagen GmbH, Hilden, Germany) according to the manufacturer's protocol. .. RNA was quantified using the Qubit fluorometric quantitation system (Life Technologies, Carlsbad, CA, USA).

    Spectrophotometry:

    Article Title: Evaluation of MCT1, MCT4 and CD147 Genes in Peripheral Blood Cells of Breast Cancer Patients and Their Potential Use as Diagnostic and Prognostic Markers
    Article Snippet: For total RNA isolation, RNeasy FFPE kit (Qiagen, cat. no. 74404, Hilden, Germany) was used according to manufacturer’s directions. .. The extracted material was quantified by a NanoVue Plus spectrophotometer.

    Staining:

    Article Title: EZH2 Is Associated with Malignant Behavior in Pancreatic IPMN via p27Kip1 Downregulation
    Article Snippet: IPMN lesions and normal pancreatic ducts were macro-dissectioned in comparison with H & E staining ( ). .. Then, total RNA was extracted using RNeasy FFPE Kit (QIAGEN) according to each instruction manual.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Qiagen rneasy ffpe kit
    qRT-PCR analysis of RNA samples isolated with the RecoverAll or <t>RNeasy</t> kit. Total RNA was extracted in triplicate from five different <t>FFPE</t> tissue blocks using the indicated method. Each RNA sample was analyzed in duplicate using qRT-PCR assays specific
    Rneasy Ffpe Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 113 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rneasy ffpe kit/product/Qiagen
    Average 90 stars, based on 113 article reviews
    Price from $9.99 to $1999.99
    rneasy ffpe kit - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results


    qRT-PCR analysis of RNA samples isolated with the RecoverAll or RNeasy kit. Total RNA was extracted in triplicate from five different FFPE tissue blocks using the indicated method. Each RNA sample was analyzed in duplicate using qRT-PCR assays specific

    Journal:

    Article Title: Evaluation and Validation of Total RNA Extraction Methods for MicroRNA Expression Analyses in Formalin-Fixed, Paraffin-Embedded Tissues

    doi: 10.2353/jmoldx.2008.070153

    Figure Lengend Snippet: qRT-PCR analysis of RNA samples isolated with the RecoverAll or RNeasy kit. Total RNA was extracted in triplicate from five different FFPE tissue blocks using the indicated method. Each RNA sample was analyzed in duplicate using qRT-PCR assays specific

    Article Snippet: In the case of the RNeasy FFPE Kit, a supplementary protocol for “co-purification” of total RNA and miRNA from FFPE tissue sections using the RNeasy FFPE Kit was used.

    Techniques: Quantitative RT-PCR, Isolation, Formalin-fixed Paraffin-Embedded