cel48s  (ATCC)

Journal: Biotechnology for Biofuels

Article Title: A synthetic biology approach for evaluating the functional contribution of designer cellulosome components to deconstruction of cellulosic substrates

doi: 10.1186/1754-6834-6-182

Figure Lengend Snippet: Schematic representation of the recombinant proteins used in this study. The modular notation, structure and molecular mass of each protein are indicated. Red, yellow and light blue indicate C. thermocellum -derived cohesin/dockerin, carbohydrate binding module (CBM) and enzyme-related components, respectively. Dark blue indicates A. cellulolyticus -derived cohesin/dockerin modules, and green indicates B. cellulosolvens -derived modules. ( a ) The basic chimaeric scaffoldin containing three divergent cohesins: the third cohesin of scaffoldin ScaC from A. cellulolyticus ( A ), the third cohesin of ScaB from B. cellulosolvens ( B ), the second cohesin of the CipA scaffoldin from C. thermocellum ( T ) plus a CBM3a module of the same scaffoldin ( c ). See Additional file 1: Table S1 for the molecular weights of the respective chimaeric scaffoldins. ( b ) The length of each module and its C-flanking linkers in amino acid residues. ( c ) Recombinant cellulases used in this study. In the modular notation of the enzymes, the number indicates the GH family of the catalytic domain. S, K and A indicate the original name of the enzyme (Cel48S, Cel9K and Cel8A, respectively). The chimaeric Cel9K includes a CBM4 and Ig domain on the N-terminal portion of the enzyme. Lowercase t, a and b indicate the source of the dockerin module ( C. thermocellum , A. cellulolyticus and B. cellulosolvens respectively).

Article Snippet: The recombinant wild-type family-48 exocellulase, Cel48S (48S- t ) , was amplified from C. thermocellum ATCC 27405 genomic DNA with the following forward and reverse primers, 5′ CAGTCCATGGGTCCTACAAAGGCACCTAC 3′ and 5′ CGCGAAGCTTTTAATGGTGATGGTGATGGTGG 3′, respectively ( NcoI and HindIII restriction sites in boldface), that allow their incorporation into pET28a.

Techniques: Recombinant, Derivative Assay, Binding Assay

Journal: Biotechnology for Biofuels

Article Title: A synthetic biology approach for evaluating the functional contribution of designer cellulosome components to deconstruction of cellulosic substrates

doi: 10.1186/1754-6834-6-182

Figure Lengend Snippet: Specificity of the cohesin-borne scaffoldin for its matching dockerins (a) and of the dockerin-bearing enzymes for their target cohesins (b-d). The interaction between scaffoldin 19L (Scaf19L) and its matching dockerins was examined ( a ) using a standardized matching fusion-protein system . Scaf19L was coated onto the wells of a microtiter plate and was subjected to interaction with Xyn-Doc fusion proteins, Xyn-Doc t (red), Xyn-Doc a (blue), Xyn-Doc b (green), and a non-matching control Xyn-Doc f, the divergent dockerin of which was derived from a cellulosomal component of the rumen bacterium, Ruminococcus flavefaciens (black). Anti-xylanase antibodies were used, together with a second antibody-conjugated enzyme system to promote a chromogenic reaction. Similarly, the interaction between the enzymes via their dockerin module to matching and non-matching cohesins was examined. In this case, 9K- a ( b ), 48S- t ( c ) and 8A- b ( d ), which bear an A. cellulolyticus , C. thermocellum and B. cellulosolvens dockerin, respectively, were coated onto the wells of microtiter plates and subjected to interaction with the designated carbohydrate binding module (CBM)-fused cohesin modules, Coh T (red), Coh A (blue) and Coh B (green).

Article Snippet: The recombinant wild-type family-48 exocellulase, Cel48S (48S- t ) , was amplified from C. thermocellum ATCC 27405 genomic DNA with the following forward and reverse primers, 5′ CAGTCCATGGGTCCTACAAAGGCACCTAC 3′ and 5′ CGCGAAGCTTTTAATGGTGATGGTGATGGTGG 3′, respectively ( NcoI and HindIII restriction sites in boldface), that allow their incorporation into pET28a.

Techniques: Derivative Assay, Binding Assay

Journal: Biotechnology for Biofuels

Article Title: A synthetic biology approach for evaluating the functional contribution of designer cellulosome components to deconstruction of cellulosic substrates

doi: 10.1186/1754-6834-6-182

Figure Lengend Snippet: Electrophoretic mobility of components and assembled complexes on non-denaturing PAGE (a) and SDS-PAGE (b). Equimolar concentrations of the enzymes 48S- t , 9K- a and 8A- b (lanes 1 to 3 respectively) and the matching scaffoldins without intermodular linkers, with short and long intermodular linkers (Scaf19N, Scaf19S and Scaf19L designated as: N, S and L, lanes 4 to 6, respectively) were interacted to form the respective designer cellulosome complexes (lanes 6 to 9). Mr, molecular mass marker.

Article Snippet: The recombinant wild-type family-48 exocellulase, Cel48S (48S- t ) , was amplified from C. thermocellum ATCC 27405 genomic DNA with the following forward and reverse primers, 5′ CAGTCCATGGGTCCTACAAAGGCACCTAC 3′ and 5′ CGCGAAGCTTTTAATGGTGATGGTGATGGTGG 3′, respectively ( NcoI and HindIII restriction sites in boldface), that allow their incorporation into pET28a.

Techniques: SDS Page, Marker

Journal: Biotechnology for Biofuels

Article Title: A synthetic biology approach for evaluating the functional contribution of designer cellulosome components to deconstruction of cellulosic substrates

doi: 10.1186/1754-6834-6-182

Figure Lengend Snippet: Superdex 200 gel filtration fast protein liquid chromatography (FPLC) elution profile of a designer-cellulosome complex composed of three chimaeric C. thermocellum enzymes, 9K- a, 48S- t and 8A- b, assembled on a trivalent chimaeric scaffoldin (Scaf19N) without intermodular linkers. The elution profile of each of the single components was used as a marker. The curves are labeled as follows: ( a ) 8A- b : green, 51.6 kDa, ( b ) 48S- t : red, 81.6 kDa|, ( c ) 9K- a : blue, 101.4 kDa, ( d ) scaffoldin 19N: magenta, 66 kDa, and ( e ) designer cellulosome complex: black with gray filling. The gel on the bottom shows the SDS-PAGE analysis of the designated elution fractions of the designer cellulosome complexes.

Article Snippet: The recombinant wild-type family-48 exocellulase, Cel48S (48S- t ) , was amplified from C. thermocellum ATCC 27405 genomic DNA with the following forward and reverse primers, 5′ CAGTCCATGGGTCCTACAAAGGCACCTAC 3′ and 5′ CGCGAAGCTTTTAATGGTGATGGTGATGGTGG 3′, respectively ( NcoI and HindIII restriction sites in boldface), that allow their incorporation into pET28a.

Techniques: Filtration, Fast Protein Liquid Chromatography, Marker, Labeling, SDS Page

Journal: Biotechnology for Biofuels

Article Title: A synthetic biology approach for evaluating the functional contribution of designer cellulosome components to deconstruction of cellulosic substrates

doi: 10.1186/1754-6834-6-182

Figure Lengend Snippet: Comparative hydrolysis of Avicel by the 14 sets of designer cellulosomes. The modular composition of each set and the scaffoldin number is denoted on the x-axis. Upper panel: the carbohydrate binding module (CBM) of the designer scaffoldin is at one of the terminal positions (N or C terminus). Lower panel: the CBM module of the designer scaffoldin is in an internal position. Each designer-cellulosome set is assembled either without intermodular linker scaffoldin (light brown), with short intermodular linker scaffoldin (medium brown), and with long intermodular linker scaffoldin (dark brown). Controls: Free: corresponds to the combined activity of 48S- t , 9K- a and 8A- b. CBM-Coh represents a cellulose-targeting control, corresponding to the activity of the three dockerin-bearing enzymes, each attached separately to its matching cohesin module fused to a CBM. Reactions were carried out for 72 h. Enzymatic activity was defined by mM reducing sugars as determined by a glucose standard curve. All reactions were carried out in triplicate and repeated three times. Standard deviations of at least three experiments are indicated.

Article Snippet: The recombinant wild-type family-48 exocellulase, Cel48S (48S- t ) , was amplified from C. thermocellum ATCC 27405 genomic DNA with the following forward and reverse primers, 5′ CAGTCCATGGGTCCTACAAAGGCACCTAC 3′ and 5′ CGCGAAGCTTTTAATGGTGATGGTGATGGTGG 3′, respectively ( NcoI and HindIII restriction sites in boldface), that allow their incorporation into pET28a.

Techniques: Binding Assay, Activity Assay

Journal: Molecules

Article Title: Chiral Derivatives of Xanthones with Antimicrobial Activity

doi: 10.3390/molecules24020314

Figure Lengend Snippet: Anti-bacterial activity of xanthone derivatives with 2-hydro-3-amino and piperazine groups.

Article Snippet: 48S , R 1 =R 2 =R 3 =H , , ATCC 700684-28 HP 132/194-30 HP 115/168-30 , ATCC 43504-21 HP 125/180-28 HP 139/202-38 HP 143/207-36 , HP 126/181-28 HP 106/154-26.

Techniques: Activity Assay