Journal: Nature Communications

Article Title: An interphase actin wave promotes mitochondrial content mixing and organelle homeostasis

doi: 10.1038/s41467-024-48189-1

Figure Lengend Snippet: A Timelapse images of interphase actin wave in HeLa cells; F-actin and mitochondria marked with Lifeact-GFP and mito-DsRed2, respectively. Yellow arrow and dotted line indicate the position of the wave. Insets are displayed with enhanced contrast for ease of viewing. Scale bar 10 μm for whole cell images, 2 μm for insets. B Representative images of phalloidin (F-actin marker) and anti-TOMM20 (mitochondrial marker) in interphase cells treated with siRNAs to either FMNL1, 2 or 3. Scale bar 10 μm for whole cell images and 2 μm for insets. Cell boundaries are outlined in cyan. C Quantitation of actin wave size for each group in interphase cells, where Whiskers represent 10–90 th percentile, center lines indicate medians, and plus signs indicate means. n = 60 across 3 biological replicates. D Percent of cells displaying an actin wave, bars represent medians. n = 3 biologically independent samples. E Quantitation from western blot and qPCR experiments examining the knock-down efficiencies of FMNL1, 2 and 3, siRNAs. Bars represent means. n = 3 and 4 biologically independent experiments for western blot and qPCR experiments, respectively. F Representative images of GFP-FMNL1 recruitment to actin wave-positive mitochondria, where F-actin is marked by phalloidin and mitochondria are marked by a TOMM20 antibody. Whole cell image scale bar is 10 μm, medium zoom inset scale bar is 5 μm, and high zoom scale bar is 1 μm. Experiment repeated 3 times with similar results. Accompanying are line scans where all signal is normalized to cytosolic signal. A – F Differently colored points indicate different biological replicates. Statistical test used was Kruskal-Wallis test with Dunn’s multiple comparisons. Source data are provided as a Source Data file. *, **, and *** indicate p -values of < 0.05, ≤ 0.005, and ≤ 0.0005 respectively.

Article Snippet: The plasmids used in this study are as follows: Lifeact-EGFP (ref. ), Lifeact-mScarlet-N1 (Addgene, 85054), GFP-FMNL1 (subcloned from ref. ), GFP-FMNL1 S1031A (subcloned), GFP-FMNL1 S1031E (subcloned), mito-sBFP2-C1 (ref. ), GCaMP6s (Addgene, 40753), Lifeact-miRFP (Addgene, 79993), Mito-DsRed2 (gift from T. Schwarz, Harvard Medical School, Boston), Halo-Sec61B (Addgene, 123285), mito-SNAP (subcloned from Mito-DsRed2 in pSNAPf [New England Biolabs]), and Mito-paGFP (Addgene, 23348). siRNAs utilized were: Control (ON-TARGETplus, Horizon, D-001810-01-20), FMNL1 (Santa Cruz, sc-62325), Alternative FMNL1 (Horizon pool: CCUCAAACGGGCUGGUGCAUU, GAGCCUGGCCUGUAACUUAUU, and AAGCUGGAUUUCCGAGGCUUU), FMNL2 (Santa Cruz, sc-62327), FMNL3 (Santa Cruz, sc-62329), ARP3 (Santa Cruz, sc-29739), WHAMM (Horizon, L-022415-01), CDK1 (Dharmacon; GUAUAAGGGUAGACACAAAUU).

Techniques: Marker, Quantitation Assay, Western Blot

Journal: Nature Communications

Article Title: An interphase actin wave promotes mitochondrial content mixing and organelle homeostasis

doi: 10.1038/s41467-024-48189-1

Figure Lengend Snippet: A FMNL1 schematic ( B ) MSMS scan of residues 1024–1034 (1 experiment). C Representative GFP-FMNL1 IP from cells treated with vehicle ( ~ 2 h DMSO) or adavosertib ( ~ 6.5 h 300 nM). Probed with anti-GFP and anti-phoso-CDK1 substrate sequence. Repeated 3X. D Effects of ~4 h adavosertib at 300 nM on wave. Unequal contrasting between groups for ease of viewing. E Effects of CDK1 inhibitors on wave. Asterisk denotes contrast adjustment between conditions, performed as acquisition parameters varied throughout experiment. F CDK1 siRNA treatment. G Effects of adavosertib on wave speed; bars represent means with SEM. Two-sided Student’s t-test. N = 20 and 23 cells across 4 experiments for DMSO and Wee1 inhibitor, respectively. H Effects of CDK1 inhibitors on wave area. CDK1 inhibitors tested in a larger screen; DMSO data run in parallel previously published in Extended figure 8 A of ref. . Analyzed by Kruskal-Wallis test with Dunn’s multiple comparisons was run. n = 151 and 212 cells across 3 experiments for Ro3306 and CGP74 conditions, respectively. I Effects of CDK1 knockdown on wave area. Kruskal-Wallis test with Dunn’s multiple comparisons. n = 60 cells across 3 experiments. J CDK1 knockdown (see Figure ). Means from 3 experiments. K Effects of GFP-FMNL1 WT and S1031A on wave; staining TOMM20 and phalloidin. GFP signal for ‘GFP alone’ condition was differentially scaled. L Wave areas analyzed by Kruskal-Wallis test, Dunn’s multiple comparisons; 40 cells across 4 experiments. M Western blot of GFP-FMNL1 WT and S1031A. N Mean fluorescence: GFP-FMNL1 WT/S1031A. Bars indicate means of triangles, which represent means of 4 biological replicates. O Effects of S1031E on wave; staining for TOMM20 and phalloidin. P Effects on wave area; two-sided Mann-Whitney test, 60 cells across 3 experiments. Q Western of GFP-FMNL1 S1031E. R Mean fluorescence: GFP-FMNL1 WT/S1031E. A – R Scale bars: 10 μm for cell images, 2 μm for insets. For blots, antibody/total protein approximately aligned/scaled the same; kDa, unit of molecular weight. Box plots: center lines indicate medians, plus signs indicate means, error bars = 10–90th percentile. Source data provided. *, **, and *** indicate p -values of < 0.05, ≤ 0.005, and ≤ 0.0005 respectively.

Article Snippet: The plasmids used in this study are as follows: Lifeact-EGFP (ref. ), Lifeact-mScarlet-N1 (Addgene, 85054), GFP-FMNL1 (subcloned from ref. ), GFP-FMNL1 S1031A (subcloned), GFP-FMNL1 S1031E (subcloned), mito-sBFP2-C1 (ref. ), GCaMP6s (Addgene, 40753), Lifeact-miRFP (Addgene, 79993), Mito-DsRed2 (gift from T. Schwarz, Harvard Medical School, Boston), Halo-Sec61B (Addgene, 123285), mito-SNAP (subcloned from Mito-DsRed2 in pSNAPf [New England Biolabs]), and Mito-paGFP (Addgene, 23348). siRNAs utilized were: Control (ON-TARGETplus, Horizon, D-001810-01-20), FMNL1 (Santa Cruz, sc-62325), Alternative FMNL1 (Horizon pool: CCUCAAACGGGCUGGUGCAUU, GAGCCUGGCCUGUAACUUAUU, and AAGCUGGAUUUCCGAGGCUUU), FMNL2 (Santa Cruz, sc-62327), FMNL3 (Santa Cruz, sc-62329), ARP3 (Santa Cruz, sc-29739), WHAMM (Horizon, L-022415-01), CDK1 (Dharmacon; GUAUAAGGGUAGACACAAAUU).

Techniques: Sequencing, Staining, Western Blot, Fluorescence, MANN-WHITNEY, Molecular Weight

Journal: Nature Communications

Article Title: An interphase actin wave promotes mitochondrial content mixing and organelle homeostasis

doi: 10.1038/s41467-024-48189-1

Figure Lengend Snippet: A Representative images of TMRE (mitochondrial membrane potential indicator, incubated at 45 nM for 15 mins) and Mito-sBFP2 in live interphase HeLa cells treated with siRNA to FMNL1, ARP3, or WHAMM. Shown in cyan are outlines of cells as determined by Mito-sBFP2 signal. B Average mitochondrial TMRE intensity per cell. Triangles represent medians, bars are means with SEM. Left panel, data analyzed by one-way ANOVA with Dunnett’s multiple comparison test. Right panel, data analyzed by a two-sided Student’s T test. Note break in Y axis, where top and bottom segments are differentially scaled. n = 3 biologically independent experiments. C OCR from FMNL1 knock-down and control cells analyzed using Seahorse Bioanalyzer; example traces and quantitation across multiple independent experiments are shown. In trace, points are means and error bars represent SD. In graph, lines indicate means, error bars represent SEM, and a two-sided Student’s T test was applied. n = 10 biological replicates. D Representative images of CellROX (cellular ROS indicator, incubated at 1:500 for 30 min) in live interphase cells treated with siRNA to FMNL1, ARP3, or WHAMM. Outlines of cells in cyan determined by CellMask signal. E Quantitation of average cellular CellROX intensity, triangles represent means, two-sided ratio paired-T tests were used for statistical analysis. For Control vs. FMNL1, n = 4 biologically independent experiments. For other comparisons n = 3 biologically independent experiments. F Quantitation of western blot experiments examining knock-down efficiencies of ARP3 and WHAMM siRNAs. Bars represent means. n = 3 and 4 biological replicates for ARP3si and WHAMMsi comparisons, respectively. A – F Scale bars are 10 μm. ≥ 3 independent experiments. Different colors in graphs represent different biological replicates. Source data are provided as a Source Data file. *, **, and *** indicate p -values of < 0.05, ≤ 0.005, and ≤ 0.0005 respectively.

Article Snippet: The plasmids used in this study are as follows: Lifeact-EGFP (ref. ), Lifeact-mScarlet-N1 (Addgene, 85054), GFP-FMNL1 (subcloned from ref. ), GFP-FMNL1 S1031A (subcloned), GFP-FMNL1 S1031E (subcloned), mito-sBFP2-C1 (ref. ), GCaMP6s (Addgene, 40753), Lifeact-miRFP (Addgene, 79993), Mito-DsRed2 (gift from T. Schwarz, Harvard Medical School, Boston), Halo-Sec61B (Addgene, 123285), mito-SNAP (subcloned from Mito-DsRed2 in pSNAPf [New England Biolabs]), and Mito-paGFP (Addgene, 23348). siRNAs utilized were: Control (ON-TARGETplus, Horizon, D-001810-01-20), FMNL1 (Santa Cruz, sc-62325), Alternative FMNL1 (Horizon pool: CCUCAAACGGGCUGGUGCAUU, GAGCCUGGCCUGUAACUUAUU, and AAGCUGGAUUUCCGAGGCUUU), FMNL2 (Santa Cruz, sc-62327), FMNL3 (Santa Cruz, sc-62329), ARP3 (Santa Cruz, sc-29739), WHAMM (Horizon, L-022415-01), CDK1 (Dharmacon; GUAUAAGGGUAGACACAAAUU).

Techniques: Membrane, Incubation, Comparison, Quantitation Assay, Western Blot

Journal: Nature Communications

Article Title: An interphase actin wave promotes mitochondrial content mixing and organelle homeostasis

doi: 10.1038/s41467-024-48189-1

Figure Lengend Snippet: A Timelapse images of region of interest in live interphase cell expressing Lifeact-GFP (F-actin marker) and mito-DsRed2. Two distinct mitochondria are outlined in yellow and cyan and depicted as a cartoon. Scale bar is 2 μm. B Timelapse images of live interphase cells expressing mito-photoactivatable GFP and mito-DsRed2 after knock down of FMNL1. The total mitochondrial channels were individually scaled for ease of viewing. Approximate segmented PA-GFP signal is shown as a mask. Scale bar is 20 μm for images of whole cells, 10 μm for insets. Accompanying is quantitation for this experiment, where percent change in PA-GFP area was measured. Means and SEMs are depicted and a two-sided Student’s T test was performed. n = 21 cells across 7 independent experiments. C Quantitation from manual tracking of mitochondria recently sampled by actin wave and mitochondria not recently sampled by actin wave. Cells were expressing Lifeact-mScarlet and mito-mEmerald. Bars represent medians and a two-sided Mann-Whitney test was performed for statistical analysis. n = 11 cells across 3 independent experiments. D Cartoon depicting how the interphase actin wave might promote mitochondrial hetero-fusion. A – D In graphs, different colors represent different biological replicates. 3 or more biological replicates. Source data are provided as a Source Data file. *, **, and *** indicate p -values of < 0.05, ≤ 0.005, and ≤ 0.0005 respectively.

Article Snippet: The plasmids used in this study are as follows: Lifeact-EGFP (ref. ), Lifeact-mScarlet-N1 (Addgene, 85054), GFP-FMNL1 (subcloned from ref. ), GFP-FMNL1 S1031A (subcloned), GFP-FMNL1 S1031E (subcloned), mito-sBFP2-C1 (ref. ), GCaMP6s (Addgene, 40753), Lifeact-miRFP (Addgene, 79993), Mito-DsRed2 (gift from T. Schwarz, Harvard Medical School, Boston), Halo-Sec61B (Addgene, 123285), mito-SNAP (subcloned from Mito-DsRed2 in pSNAPf [New England Biolabs]), and Mito-paGFP (Addgene, 23348). siRNAs utilized were: Control (ON-TARGETplus, Horizon, D-001810-01-20), FMNL1 (Santa Cruz, sc-62325), Alternative FMNL1 (Horizon pool: CCUCAAACGGGCUGGUGCAUU, GAGCCUGGCCUGUAACUUAUU, and AAGCUGGAUUUCCGAGGCUUU), FMNL2 (Santa Cruz, sc-62327), FMNL3 (Santa Cruz, sc-62329), ARP3 (Santa Cruz, sc-29739), WHAMM (Horizon, L-022415-01), CDK1 (Dharmacon; GUAUAAGGGUAGACACAAAUU).

Techniques: Expressing, Marker, Quantitation Assay, MANN-WHITNEY