Structured Review

Millipore 6 fam
Local sequence preferences at the XPF–ERCC1 incision site on the substrate affects the rate of cleavage. ( A ) Stem–loop structure showing the positions of substituted bases X and Y in the duplex. Xc and Yc are the complementary bases to X and Y, A is used complementary to U. ( B ) Kinetic data where X and Y were substituted with each of the four bases. Data are mean of triplicate samples, ±1 standard error. ( C ) Incisions produced by 4.27 nM XPF–ERCC1 on 5′ <t>6-FAM-labelled</t> stem–loop substrates with bases at X and Y as indicated. Arrow shows cleavage product. Reactions were incubated for 15 min at 25°C and therefore did not run to completion. ( D ) Kinetic data where X and Y were substituted with the indicated bases. Data are mean of triplicate samples +/− standard error.
6 Fam, supplied by Millipore, used in various techniques. Bioz Stars score: 87/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/6 fam/product/Millipore
Average 87 stars, based on 4 article reviews
Price from $9.99 to $1999.99
6 fam - by Bioz Stars, 2020-01
87/100 stars

Images

1) Product Images from "Fluorescence-based incision assay for human XPF-ERCC1 activity identifies important elements of DNA junction recognition"

Article Title: Fluorescence-based incision assay for human XPF-ERCC1 activity identifies important elements of DNA junction recognition

Journal: Nucleic Acids Research

doi: 10.1093/nar/gks284

Local sequence preferences at the XPF–ERCC1 incision site on the substrate affects the rate of cleavage. ( A ) Stem–loop structure showing the positions of substituted bases X and Y in the duplex. Xc and Yc are the complementary bases to X and Y, A is used complementary to U. ( B ) Kinetic data where X and Y were substituted with each of the four bases. Data are mean of triplicate samples, ±1 standard error. ( C ) Incisions produced by 4.27 nM XPF–ERCC1 on 5′ 6-FAM-labelled stem–loop substrates with bases at X and Y as indicated. Arrow shows cleavage product. Reactions were incubated for 15 min at 25°C and therefore did not run to completion. ( D ) Kinetic data where X and Y were substituted with the indicated bases. Data are mean of triplicate samples +/− standard error.
Figure Legend Snippet: Local sequence preferences at the XPF–ERCC1 incision site on the substrate affects the rate of cleavage. ( A ) Stem–loop structure showing the positions of substituted bases X and Y in the duplex. Xc and Yc are the complementary bases to X and Y, A is used complementary to U. ( B ) Kinetic data where X and Y were substituted with each of the four bases. Data are mean of triplicate samples, ±1 standard error. ( C ) Incisions produced by 4.27 nM XPF–ERCC1 on 5′ 6-FAM-labelled stem–loop substrates with bases at X and Y as indicated. Arrow shows cleavage product. Reactions were incubated for 15 min at 25°C and therefore did not run to completion. ( D ) Kinetic data where X and Y were substituted with the indicated bases. Data are mean of triplicate samples +/− standard error.

Techniques Used: Sequencing, Produced, Incubation

Related Articles

Amplification:

Article Title: How Ebola Impacts Genetics of Western Lowland Gorilla Populations
Article Snippet: PCR mixtures (10 µl final volumes) contained 1 µl of template DNA, 0.16 mM dNTP, 0.4 µM R-Primer, 0.4 µM F-Primer fluorescently labelled with one of 6-FAM (Sigma), VIC, NED, PET (Applied Biosystems), 0.6 U Taq DNA polymerase and 1·X buffer (Qiagen). .. PCR mixtures (10 µl final volumes) contained 1 µl of template DNA, 0.16 mM dNTP, 0.4 µM R-Primer, 0.4 µM F-Primer fluorescently labelled with one of 6-FAM (Sigma), VIC, NED, PET (Applied Biosystems), 0.6 U Taq DNA polymerase and 1·X buffer (Qiagen).

Positive Control:

Article Title: A diagnostic PCR assay for the detection of an Australian epidemic strain of Pseudomonas aeruginosa
Article Snippet: Probe RTHW2-P (Additional File ) was labelled with fluorescent dye 6-FAM at the 5' end and nonfluorescent quencher BHQ1 at the 3' end (Sigma). .. Real-time PCR mixtures contained, 0.8 μM concentrations of each primer, 0.6 μM concentration of the probe, ABsoluteTM QPCR ROX (500 nM) Mix (ABgene) and either 1 μl (genomic) or 5 μl (Whatman FTA® Elute card) of template DNA.

Article Title: How Ebola Impacts Genetics of Western Lowland Gorilla Populations
Article Snippet: PCR mixtures (10 µl final volumes) contained 1 µl of template DNA, 0.16 mM dNTP, 0.4 µM R-Primer, 0.4 µM F-Primer fluorescently labelled with one of 6-FAM (Sigma), VIC, NED, PET (Applied Biosystems), 0.6 U Taq DNA polymerase and 1·X buffer (Qiagen). .. PCR mixtures (10 µl final volumes) contained 1 µl of template DNA, 0.16 mM dNTP, 0.4 µM R-Primer, 0.4 µM F-Primer fluorescently labelled with one of 6-FAM (Sigma), VIC, NED, PET (Applied Biosystems), 0.6 U Taq DNA polymerase and 1·X buffer (Qiagen).

Synthesized:

Article Title: A genome-wide linkage scan identifies multiple quantitative trait loci for HDL-cholesterol levels in families with premature CAD and MI
Article Snippet: Genome-wide genotyping of microsatellite markers was performed by the National Heart, Lung, and Blood Insti­tute (NHLBI) Mammalian Genotyping Services directed by Dr. James L. Weber at Center for Medical Genetics, Marshfield Clinic, using Screening Set 11 with 408 markers that span the human genome at approximately every 10 cM ( ). .. For fine mapping, additional markers were selected from the Marshfield database, synthesized, tagged with 6′-FAM (Sigma), and genotyped using an ABI 3100 genetic analyzer (Applied Biosystems) as previously described ( ). .. The quality of genotyping for markers used for fine mapping was high.

Electrophoresis:

Article Title: NTR1 is required for transcription elongation checkpoints at alternative exons in Arabidopsis
Article Snippet: Serial decimal dilutions were used for low stringency selection on –LHT (leucin, trypsin and histidine deficient) plates and high stringency selection on –LHTA (leucin, trypsin, histidine and adenine deficient) plates. .. Splicing analysis was performed using 6-FAM (Sigma-Aldrich) labelled forward primer and capillary electrophoresis on ABI3730 DNA Analyzer (Life Technologies) as described (Simpson et al , ; Raczynska et al , ). .. Primer sequences for alternative spliced mRNA are given in .

Electro Mobility Shift Assay:

Article Title: Myc interacts with Max and Miz1 to repress C/EBP? promoter activity and gene expression
Article Snippet: Paragraph title: Electromobility Shift Assay (EMSA) ... Probes used in EMSA reactions were 5' end-labeled with 6-FAM (6-Carboxyfluorescein, Sigma).

Genome Wide:

Article Title: A genome-wide linkage scan identifies multiple quantitative trait loci for HDL-cholesterol levels in families with premature CAD and MI
Article Snippet: Genome-wide genotyping of microsatellite markers was performed by the National Heart, Lung, and Blood Insti­tute (NHLBI) Mammalian Genotyping Services directed by Dr. James L. Weber at Center for Medical Genetics, Marshfield Clinic, using Screening Set 11 with 408 markers that span the human genome at approximately every 10 cM ( ). .. For fine mapping, additional markers were selected from the Marshfield database, synthesized, tagged with 6′-FAM (Sigma), and genotyped using an ABI 3100 genetic analyzer (Applied Biosystems) as previously described ( ).

Acrylamide Gel Assay:

Article Title: Myc interacts with Max and Miz1 to repress C/EBP? promoter activity and gene expression
Article Snippet: Probes used in EMSA reactions were 5' end-labeled with 6-FAM (6-Carboxyfluorescein, Sigma). .. To perform EMSA competition assays unlabelled probes were pre-incubated with Miz1 in binding buffer for 10 min prior to addition of the labeled probe.

Generated:

Article Title: Myc interacts with Max and Miz1 to repress C/EBP? promoter activity and gene expression
Article Snippet: DNA probes (a to g) were generated by PCR using mouse C/EBPδ promoter (1.7 kb fragment) as template. .. Probes used in EMSA reactions were 5' end-labeled with 6-FAM (6-Carboxyfluorescein, Sigma).

Inhibition:

Article Title: A diagnostic PCR assay for the detection of an Australian epidemic strain of Pseudomonas aeruginosa
Article Snippet: Probe RTHW2-P (Additional File ) was labelled with fluorescent dye 6-FAM at the 5' end and nonfluorescent quencher BHQ1 at the 3' end (Sigma). .. Real-time PCR mixtures contained, 0.8 μM concentrations of each primer, 0.6 μM concentration of the probe, ABsoluteTM QPCR ROX (500 nM) Mix (ABgene) and either 1 μl (genomic) or 5 μl (Whatman FTA® Elute card) of template DNA.

Polymerase Chain Reaction:

Article Title: Myc interacts with Max and Miz1 to repress C/EBP? promoter activity and gene expression
Article Snippet: DNA probes (a to g) were generated by PCR using mouse C/EBPδ promoter (1.7 kb fragment) as template. .. Probes used in EMSA reactions were 5' end-labeled with 6-FAM (6-Carboxyfluorescein, Sigma).

Article Title: Association of microsatellite polymorphisms of the GPDS1 locus with normal tension glaucoma in the Japanese population
Article Snippet: The reaction was carried out in a PCR thermal cycler (GeneAmp System 9700, Applied Biosystems, Foster City, CA, USA). .. The forward primer was labeled with 6-FAM (Sigma-Aldrich, St. Louis, USA) at the 5′ end (Table ).

Article Title: A diagnostic PCR assay for the detection of an Australian epidemic strain of Pseudomonas aeruginosa
Article Snippet: Probe RTHW2-P (Additional File ) was labelled with fluorescent dye 6-FAM at the 5' end and nonfluorescent quencher BHQ1 at the 3' end (Sigma). .. Real-time PCR mixtures contained, 0.8 μM concentrations of each primer, 0.6 μM concentration of the probe, ABsoluteTM QPCR ROX (500 nM) Mix (ABgene) and either 1 μl (genomic) or 5 μl (Whatman FTA® Elute card) of template DNA.

Article Title: How Ebola Impacts Genetics of Western Lowland Gorilla Populations
Article Snippet: The 17 microsatellite loci were used because of their high polymorphisms previously detected in gorilla and other primate species (D1s533, D1s548, D1s550, D2s1326, D2s1329, D2s1368, D4s243, D5s820, D5s1470, D6s474, D7s794, D7s817, D10s1432, D16s2624, D18s536, D20s206, vWF, – ). .. PCR mixtures (10 µl final volumes) contained 1 µl of template DNA, 0.16 mM dNTP, 0.4 µM R-Primer, 0.4 µM F-Primer fluorescently labelled with one of 6-FAM (Sigma), VIC, NED, PET (Applied Biosystems), 0.6 U Taq DNA polymerase and 1·X buffer (Qiagen). .. Cycling was performed under the following conditions: 94°C for 15 min, 50 cycles of 30 s at 94°C, 30 s at 50–60°C, and 30 s at 72°C and a final step of 10 min at 72°C; annealing temperatures depended on loci.

IF-P:

Article Title: NTR1 is required for transcription elongation checkpoints at alternative exons in Arabidopsis
Article Snippet: Splicing analysis was performed using 6-FAM (Sigma-Aldrich) labelled forward primer and capillary electrophoresis on ABI3730 DNA Analyzer (Life Technologies) as described (Simpson et al , ; Raczynska et al , ). .. Splicing analysis was performed using 6-FAM (Sigma-Aldrich) labelled forward primer and capillary electrophoresis on ABI3730 DNA Analyzer (Life Technologies) as described (Simpson et al , ; Raczynska et al , ).

Binding Assay:

Article Title: Myc interacts with Max and Miz1 to repress C/EBP? promoter activity and gene expression
Article Snippet: Probes used in EMSA reactions were 5' end-labeled with 6-FAM (6-Carboxyfluorescein, Sigma). .. EMSAs were performed by incubating labeled probes (20 ng) with purified Miz1 protein in binding buffer (10 mM Tris pH 7.9, 4 mM MgCl2, 5% glycerol, 0.1 mM DTT, 20 ng/μl poly(dI:dC) and 0.2% NP-40) for one hour at room temperature.

Fluorescence:

Article Title: Fluorescence-based incision assay for human XPF-ERCC1 activity identifies important elements of DNA junction recognition
Article Snippet: Paragraph title: Microplate fluorescence incision assay ... Polyacrylamide gel electrophoresis (PAGE)-purified oligonucleotides labelled 5′ with 6-FAM and 3′-with dabcyl ([4-((4-(dimethyllamino) phenyl)azo)benzoic acid) (pre-labelled molecular beacons from Sigma).

Mutagenesis:

Article Title: How Ebola Impacts Genetics of Western Lowland Gorilla Populations
Article Snippet: We used the mean heterozygoty calculated of genotyped loci and fixed the mutation rate to 10−3 . .. PCR mixtures (10 µl final volumes) contained 1 µl of template DNA, 0.16 mM dNTP, 0.4 µM R-Primer, 0.4 µM F-Primer fluorescently labelled with one of 6-FAM (Sigma), VIC, NED, PET (Applied Biosystems), 0.6 U Taq DNA polymerase and 1·X buffer (Qiagen).

Size-exclusion Chromatography:

Article Title: Association of microsatellite polymorphisms of the GPDS1 locus with normal tension glaucoma in the Japanese population
Article Snippet: The forward primer was labeled with 6-FAM (Sigma-Aldrich, St. Louis, USA) at the 5′ end (Table ). .. The forward primer was labeled with 6-FAM (Sigma-Aldrich, St. Louis, USA) at the 5′ end (Table ).

Labeling:

Article Title: Myc interacts with Max and Miz1 to repress C/EBP? promoter activity and gene expression
Article Snippet: Probes used in EMSA reactions were 5' end-labeled with 6-FAM (6-Carboxyfluorescein, Sigma). .. EMSAs were performed by incubating labeled probes (20 ng) with purified Miz1 protein in binding buffer (10 mM Tris pH 7.9, 4 mM MgCl2, 5% glycerol, 0.1 mM DTT, 20 ng/μl poly(dI:dC) and 0.2% NP-40) for one hour at room temperature.

Article Title: Structural basis for the regulation of enzymatic activity of Regnase-1 by domain-domain interactions
Article Snippet: For the domain-domain interaction analyses between the NTD and the PIN domain, 1 H-15 N HSQC spectra of uniformly 15 N-labeled proteins in the concentration of 100 μM were obtained in the presence of 3 or 6 molar equivalents of unlabeled proteins. .. The fluorescently labeled RNAs at the 5′-end by 6-FAM were purchased from SIGMA-ALDORICH. .. The RNA sequences used in this study were shown below.

Article Title: Association of microsatellite polymorphisms of the GPDS1 locus with normal tension glaucoma in the Japanese population
Article Snippet: The reaction was carried out in a PCR thermal cycler (GeneAmp System 9700, Applied Biosystems, Foster City, CA, USA). .. The forward primer was labeled with 6-FAM (Sigma-Aldrich, St. Louis, USA) at the 5′ end (Table ). .. To determine the number of microsatellite repeats, the PCR products were denatured at 97 °C for 2 min, mixed with formamide, and electrophoresed in an ABI3130 Genetic Analyzer (Applied Biosystems).

Sequencing:

Article Title: A genome-wide linkage scan identifies multiple quantitative trait loci for HDL-cholesterol levels in families with premature CAD and MI
Article Snippet: For fine mapping, additional markers were selected from the Marshfield database, synthesized, tagged with 6′-FAM (Sigma), and genotyped using an ABI 3100 genetic analyzer (Applied Biosystems) as previously described ( ). .. For fine mapping, additional markers were selected from the Marshfield database, synthesized, tagged with 6′-FAM (Sigma), and genotyped using an ABI 3100 genetic analyzer (Applied Biosystems) as previously described ( ).

Polyacrylamide Gel Electrophoresis:

Article Title: Fluorescence-based incision assay for human XPF-ERCC1 activity identifies important elements of DNA junction recognition
Article Snippet: One plate was removed from the gel and the fluorescence measured directly on a STORM phosphorimager (blue channel for 6-FAM and red channel for Cy5). .. Polyacrylamide gel electrophoresis (PAGE)-purified oligonucleotides labelled 5′ with 6-FAM and 3′-with dabcyl ([4-((4-(dimethyllamino) phenyl)azo)benzoic acid) (pre-labelled molecular beacons from Sigma). .. These were diluted to 100 µM in T.E containing 50 mM NaCl and stored at −20°C.

Software:

Article Title: Fluorescence-based incision assay for human XPF-ERCC1 activity identifies important elements of DNA junction recognition
Article Snippet: Polyacrylamide gel electrophoresis (PAGE)-purified oligonucleotides labelled 5′ with 6-FAM and 3′-with dabcyl ([4-((4-(dimethyllamino) phenyl)azo)benzoic acid) (pre-labelled molecular beacons from Sigma). .. Polyacrylamide gel electrophoresis (PAGE)-purified oligonucleotides labelled 5′ with 6-FAM and 3′-with dabcyl ([4-((4-(dimethyllamino) phenyl)azo)benzoic acid) (pre-labelled molecular beacons from Sigma).

Article Title: Association of microsatellite polymorphisms of the GPDS1 locus with normal tension glaucoma in the Japanese population
Article Snippet: The forward primer was labeled with 6-FAM (Sigma-Aldrich, St. Louis, USA) at the 5′ end (Table ). .. To determine the number of microsatellite repeats, the PCR products were denatured at 97 °C for 2 min, mixed with formamide, and electrophoresed in an ABI3130 Genetic Analyzer (Applied Biosystems).

Article Title: A diagnostic PCR assay for the detection of an Australian epidemic strain of Pseudomonas aeruginosa
Article Snippet: Primers and TaqMan® MGB probes (Applied Biosystems) were designed from regions of the sequences of the HW2 locus and the oprL gene using the Primer Express® Software v1.0 program (Applied Biosystems). .. Probe RTHW2-P (Additional File ) was labelled with fluorescent dye 6-FAM at the 5' end and nonfluorescent quencher BHQ1 at the 3' end (Sigma).

Article Title: How Ebola Impacts Genetics of Western Lowland Gorilla Populations
Article Snippet: PCR mixtures (10 µl final volumes) contained 1 µl of template DNA, 0.16 mM dNTP, 0.4 µM R-Primer, 0.4 µM F-Primer fluorescently labelled with one of 6-FAM (Sigma), VIC, NED, PET (Applied Biosystems), 0.6 U Taq DNA polymerase and 1·X buffer (Qiagen). .. PCR mixtures (10 µl final volumes) contained 1 µl of template DNA, 0.16 mM dNTP, 0.4 µM R-Primer, 0.4 µM F-Primer fluorescently labelled with one of 6-FAM (Sigma), VIC, NED, PET (Applied Biosystems), 0.6 U Taq DNA polymerase and 1·X buffer (Qiagen).

Real-time Polymerase Chain Reaction:

Article Title: A diagnostic PCR assay for the detection of an Australian epidemic strain of Pseudomonas aeruginosa
Article Snippet: Paragraph title: Quantitative Real-time PCR ... Probe RTHW2-P (Additional File ) was labelled with fluorescent dye 6-FAM at the 5' end and nonfluorescent quencher BHQ1 at the 3' end (Sigma).

Positron Emission Tomography:

Article Title: How Ebola Impacts Genetics of Western Lowland Gorilla Populations
Article Snippet: The 17 microsatellite loci were used because of their high polymorphisms previously detected in gorilla and other primate species (D1s533, D1s548, D1s550, D2s1326, D2s1329, D2s1368, D4s243, D5s820, D5s1470, D6s474, D7s794, D7s817, D10s1432, D16s2624, D18s536, D20s206, vWF, – ). .. PCR mixtures (10 µl final volumes) contained 1 µl of template DNA, 0.16 mM dNTP, 0.4 µM R-Primer, 0.4 µM F-Primer fluorescently labelled with one of 6-FAM (Sigma), VIC, NED, PET (Applied Biosystems), 0.6 U Taq DNA polymerase and 1·X buffer (Qiagen). .. Cycling was performed under the following conditions: 94°C for 15 min, 50 cycles of 30 s at 94°C, 30 s at 50–60°C, and 30 s at 72°C and a final step of 10 min at 72°C; annealing temperatures depended on loci.

Incubation:

Article Title: Myc interacts with Max and Miz1 to repress C/EBP? promoter activity and gene expression
Article Snippet: Probes used in EMSA reactions were 5' end-labeled with 6-FAM (6-Carboxyfluorescein, Sigma). .. To perform EMSA competition assays unlabelled probes were pre-incubated with Miz1 in binding buffer for 10 min prior to addition of the labeled probe.

Concentration Assay:

Article Title: Fluorescence-based incision assay for human XPF-ERCC1 activity identifies important elements of DNA junction recognition
Article Snippet: Polyacrylamide gel electrophoresis (PAGE)-purified oligonucleotides labelled 5′ with 6-FAM and 3′-with dabcyl ([4-((4-(dimethyllamino) phenyl)azo)benzoic acid) (pre-labelled molecular beacons from Sigma). .. Polyacrylamide gel electrophoresis (PAGE)-purified oligonucleotides labelled 5′ with 6-FAM and 3′-with dabcyl ([4-((4-(dimethyllamino) phenyl)azo)benzoic acid) (pre-labelled molecular beacons from Sigma).

Article Title: A diagnostic PCR assay for the detection of an Australian epidemic strain of Pseudomonas aeruginosa
Article Snippet: Probe RTHW2-P (Additional File ) was labelled with fluorescent dye 6-FAM at the 5' end and nonfluorescent quencher BHQ1 at the 3' end (Sigma). .. Probe RTHW2-P (Additional File ) was labelled with fluorescent dye 6-FAM at the 5' end and nonfluorescent quencher BHQ1 at the 3' end (Sigma).

Marker:

Article Title: Association of microsatellite polymorphisms of the GPDS1 locus with normal tension glaucoma in the Japanese population
Article Snippet: The forward primer was labeled with 6-FAM (Sigma-Aldrich, St. Louis, USA) at the 5′ end (Table ). .. To determine the number of microsatellite repeats, the PCR products were denatured at 97 °C for 2 min, mixed with formamide, and electrophoresed in an ABI3130 Genetic Analyzer (Applied Biosystems).

Variant Assay:

Article Title: NTR1 is required for transcription elongation checkpoints at alternative exons in Arabidopsis
Article Snippet: Splicing analysis was performed using 6-FAM (Sigma-Aldrich) labelled forward primer and capillary electrophoresis on ABI3730 DNA Analyzer (Life Technologies) as described (Simpson et al , ; Raczynska et al , ). .. Splicing analysis was performed using 6-FAM (Sigma-Aldrich) labelled forward primer and capillary electrophoresis on ABI3730 DNA Analyzer (Life Technologies) as described (Simpson et al , ; Raczynska et al , ).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 83
    Millipore 5 ccagaatctgttccagagcgtg 3
    5 Ccagaatctgttccagagcgtg 3, supplied by Millipore, used in various techniques. Bioz Stars score: 83/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/5 ccagaatctgttccagagcgtg 3/product/Millipore
    Average 83 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    5 ccagaatctgttccagagcgtg 3 - by Bioz Stars, 2020-01
    83/100 stars
      Buy from Supplier

    Image Search Results