zfs1 target a30 rna  (Integrated DNA Technologies)


Bioz Verified Symbol Integrated DNA Technologies is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Integrated DNA Technologies zfs1 target a30 rna
    Acceleration of deadenylation by Puf3 and <t>Zfs1.</t> ( A ) Coomassie-stained SDS-PAGE of pull-down assay showing binding of Ccr4-Not (subunits labelled in red) to immobilized MBP-Puf3 and MBP-Zfs1. ( B ) Schematic diagram of <t>RNA</t> substrates showing 5ʹ 6-FAM fluorescent label, position of Pumilio-response element (PRE; blue), AU-rich element (ARE; red), and 30-adenosine poly(A) tail. ( C ) Electrophoretic mobility shift assay (EMSA) showing the protein-RNA complexes used as substrates for deadenylation assays. Puf3 or Zfs1 (250 nM) was incubated with labelled RNA (200 nM) for 15 min at room temperature before resolving on a native polyacrylamide gel. ( D ) Control deadenylation assay with Puf3-target RNA showing that MBP alone does not have an effect on the deadenylation activity of Ccr4-Not. M is marker for RNA with and without a poly(A) 30 tail. ( E ) Average rates of Ccr4-Not-mediated deadenylation in the presence of Puf3 or Zfs1. Reaction rates were calculated by densitometric analysis of denaturing polyacrylamide gels. The most abundant RNA size decreased linearly with time, and average reaction rates in number of adenosines removed/min were determined by linear regression on triplicate measurements. Each experiment is presented as a single data point, and the mean of each triplicate experiment is plotted as a horizontal line. Statistical significance was calculated by one-way ANOVA in GraphPad Prism. *p=0.04; ***p=0.001. ( F ) Fully-deadenylated and non-deadenylated RNA exist simultaneously in reactions with Ccr4-Not and Puf3 or Zfs1. Experiments were performed as in Figure 1 with shorter time increments.
    Zfs1 Target A30 Rna, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 93/100, based on 1090 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/zfs1 target a30 rna/product/Integrated DNA Technologies
    Average 93 stars, based on 1090 article reviews
    Price from $9.99 to $1999.99
    zfs1 target a30 rna - by Bioz Stars, 2020-08
    93/100 stars

    Images

    1) Product Images from "RNA-binding proteins distinguish between similar sequence motifs to promote targeted deadenylation by Ccr4-Not"

    Article Title: RNA-binding proteins distinguish between similar sequence motifs to promote targeted deadenylation by Ccr4-Not

    Journal: eLife

    doi: 10.7554/eLife.40670

    Acceleration of deadenylation by Puf3 and Zfs1. ( A ) Coomassie-stained SDS-PAGE of pull-down assay showing binding of Ccr4-Not (subunits labelled in red) to immobilized MBP-Puf3 and MBP-Zfs1. ( B ) Schematic diagram of RNA substrates showing 5ʹ 6-FAM fluorescent label, position of Pumilio-response element (PRE; blue), AU-rich element (ARE; red), and 30-adenosine poly(A) tail. ( C ) Electrophoretic mobility shift assay (EMSA) showing the protein-RNA complexes used as substrates for deadenylation assays. Puf3 or Zfs1 (250 nM) was incubated with labelled RNA (200 nM) for 15 min at room temperature before resolving on a native polyacrylamide gel. ( D ) Control deadenylation assay with Puf3-target RNA showing that MBP alone does not have an effect on the deadenylation activity of Ccr4-Not. M is marker for RNA with and without a poly(A) 30 tail. ( E ) Average rates of Ccr4-Not-mediated deadenylation in the presence of Puf3 or Zfs1. Reaction rates were calculated by densitometric analysis of denaturing polyacrylamide gels. The most abundant RNA size decreased linearly with time, and average reaction rates in number of adenosines removed/min were determined by linear regression on triplicate measurements. Each experiment is presented as a single data point, and the mean of each triplicate experiment is plotted as a horizontal line. Statistical significance was calculated by one-way ANOVA in GraphPad Prism. *p=0.04; ***p=0.001. ( F ) Fully-deadenylated and non-deadenylated RNA exist simultaneously in reactions with Ccr4-Not and Puf3 or Zfs1. Experiments were performed as in Figure 1 with shorter time increments.
    Figure Legend Snippet: Acceleration of deadenylation by Puf3 and Zfs1. ( A ) Coomassie-stained SDS-PAGE of pull-down assay showing binding of Ccr4-Not (subunits labelled in red) to immobilized MBP-Puf3 and MBP-Zfs1. ( B ) Schematic diagram of RNA substrates showing 5ʹ 6-FAM fluorescent label, position of Pumilio-response element (PRE; blue), AU-rich element (ARE; red), and 30-adenosine poly(A) tail. ( C ) Electrophoretic mobility shift assay (EMSA) showing the protein-RNA complexes used as substrates for deadenylation assays. Puf3 or Zfs1 (250 nM) was incubated with labelled RNA (200 nM) for 15 min at room temperature before resolving on a native polyacrylamide gel. ( D ) Control deadenylation assay with Puf3-target RNA showing that MBP alone does not have an effect on the deadenylation activity of Ccr4-Not. M is marker for RNA with and without a poly(A) 30 tail. ( E ) Average rates of Ccr4-Not-mediated deadenylation in the presence of Puf3 or Zfs1. Reaction rates were calculated by densitometric analysis of denaturing polyacrylamide gels. The most abundant RNA size decreased linearly with time, and average reaction rates in number of adenosines removed/min were determined by linear regression on triplicate measurements. Each experiment is presented as a single data point, and the mean of each triplicate experiment is plotted as a horizontal line. Statistical significance was calculated by one-way ANOVA in GraphPad Prism. *p=0.04; ***p=0.001. ( F ) Fully-deadenylated and non-deadenylated RNA exist simultaneously in reactions with Ccr4-Not and Puf3 or Zfs1. Experiments were performed as in Figure 1 with shorter time increments.

    Techniques Used: Staining, SDS Page, Pull Down Assay, Binding Assay, Electrophoretic Mobility Shift Assay, Incubation, Activity Assay, Marker

    Characterization of Puf3 and Zfs1 domains required for accelerated deadenylation. ( A ) Coomassie-stained SDS-PAGE of purified RNA-binding domains: Puf3 residues 378–714 (Puf3 PUM ) and Zfs1 residues 322–392 (Zfs1 TZF ). ( B ) Electrophoretic mobility shift assay (EMSA) showing binding of the indicated RNA-binding proteins to poly(A)-containing RNAs used as substrates in deadenylation assays. ( C ) Average rates of Ccr4-Not-mediated deadenylation in the presence of the indicated Puf3 or Zfs1 variants. Reaction rates were calculated by densitometric analysis of denaturing polyacrylamide gels. The most abundant RNA size decreased linearly with time, and average reaction rates in number of adenosines removed/min were determined by linear regression on triplicate measurements. Each experiment is presented as a single data point, with the mean (n = 3) shown as a horizontal line. Statistical significance was calculated by one-way ANOVA in GraphPad Prism. *, p=0.05; ***, p=0.001, n.s., not significant. ( D, E ) Full deadenylation reactions performed in the presence of the indicated Puf3 or Zfs1 variants as in Figure 2A . ( F ) Coomassie-stained SDS-PAGE of purified Puf3 and Zfs1 N-terminal truncation variants. ( G ) Average rates of Ccr4-Not-mediated deadenylation in the presence of the indicated Puf3 or Zfs1 variants. The p-values are as in panel ( C ).
    Figure Legend Snippet: Characterization of Puf3 and Zfs1 domains required for accelerated deadenylation. ( A ) Coomassie-stained SDS-PAGE of purified RNA-binding domains: Puf3 residues 378–714 (Puf3 PUM ) and Zfs1 residues 322–392 (Zfs1 TZF ). ( B ) Electrophoretic mobility shift assay (EMSA) showing binding of the indicated RNA-binding proteins to poly(A)-containing RNAs used as substrates in deadenylation assays. ( C ) Average rates of Ccr4-Not-mediated deadenylation in the presence of the indicated Puf3 or Zfs1 variants. Reaction rates were calculated by densitometric analysis of denaturing polyacrylamide gels. The most abundant RNA size decreased linearly with time, and average reaction rates in number of adenosines removed/min were determined by linear regression on triplicate measurements. Each experiment is presented as a single data point, with the mean (n = 3) shown as a horizontal line. Statistical significance was calculated by one-way ANOVA in GraphPad Prism. *, p=0.05; ***, p=0.001, n.s., not significant. ( D, E ) Full deadenylation reactions performed in the presence of the indicated Puf3 or Zfs1 variants as in Figure 2A . ( F ) Coomassie-stained SDS-PAGE of purified Puf3 and Zfs1 N-terminal truncation variants. ( G ) Average rates of Ccr4-Not-mediated deadenylation in the presence of the indicated Puf3 or Zfs1 variants. The p-values are as in panel ( C ).

    Techniques Used: Staining, SDS Page, Purification, RNA Binding Assay, Electrophoretic Mobility Shift Assay, Binding Assay

    Analysis of RNA selectivity during deadenylation. ( A ) Quantification of on-target and off-target deadenylation rates. Densitometric analysis of the amount of fully deadenylated RNA was performed on gels shown in Figure 3A . Each experiment is presented as a single data point, and the mean of triplicate experiments is plotted as a horizontal line. Time for complete deadenylation, rather than change in modal poly(A) tail length, was calculated because these reactions contained low levels of intermediates between non-deadenylated and fully-deadenylated RNA. ns, not significant; *p=0.05; ***p=0.001. ( B ) Electrophoretic mobility shift assays showing selective RNA binding of Puf3 and Zfs1. A mixture of 100 nM fluorescein-labelled Puf3-target-A30 RNA (red) and 100 nM Alexa647-labelled Zfs1-target-A30 RNA (blue) was incubated with the indicated concentration of Puf3 or Zfs1. Gels were scanned with a Typhoon FLA-7000 with excitation at 478 nm (fluorescein detection) and 633 nm (Alexa647 detection), and images were superimposed with color overlay.
    Figure Legend Snippet: Analysis of RNA selectivity during deadenylation. ( A ) Quantification of on-target and off-target deadenylation rates. Densitometric analysis of the amount of fully deadenylated RNA was performed on gels shown in Figure 3A . Each experiment is presented as a single data point, and the mean of triplicate experiments is plotted as a horizontal line. Time for complete deadenylation, rather than change in modal poly(A) tail length, was calculated because these reactions contained low levels of intermediates between non-deadenylated and fully-deadenylated RNA. ns, not significant; *p=0.05; ***p=0.001. ( B ) Electrophoretic mobility shift assays showing selective RNA binding of Puf3 and Zfs1. A mixture of 100 nM fluorescein-labelled Puf3-target-A30 RNA (red) and 100 nM Alexa647-labelled Zfs1-target-A30 RNA (blue) was incubated with the indicated concentration of Puf3 or Zfs1. Gels were scanned with a Typhoon FLA-7000 with excitation at 478 nm (fluorescein detection) and 633 nm (Alexa647 detection), and images were superimposed with color overlay.

    Techniques Used: Electrophoretic Mobility Shift Assay, RNA Binding Assay, Incubation, Concentration Assay

    2) Product Images from "MiRNA-125a-5p: a regulator and predictor of gefitinib's effect on nasopharyngeal carcinoma"

    Article Title: MiRNA-125a-5p: a regulator and predictor of gefitinib's effect on nasopharyngeal carcinoma

    Journal: Cancer Cell International

    doi: 10.1186/1475-2867-14-24

    miR-125a-5p could mediate the anti-proliferation effect of gefitinib on NPC cells. (A) . Using oligo-miR-nc (FAM) as an example, a FAM reporter assay confirmed that the miRNA oligos used in this study were successfully transfected into HNE-1 and HK-1 cells. qRT-PCR revealed that the relative quantities of miR-125a-5p were decreased in cells transfected with oligo-miR-125a-5p inhibitor ( P
    Figure Legend Snippet: miR-125a-5p could mediate the anti-proliferation effect of gefitinib on NPC cells. (A) . Using oligo-miR-nc (FAM) as an example, a FAM reporter assay confirmed that the miRNA oligos used in this study were successfully transfected into HNE-1 and HK-1 cells. qRT-PCR revealed that the relative quantities of miR-125a-5p were decreased in cells transfected with oligo-miR-125a-5p inhibitor ( P

    Techniques Used: Reporter Assay, Transfection, Quantitative RT-PCR

    3) Product Images from "Comparison of metal-dependent catalysis by HIV-1 and ASV integrase proteins using a new and rapid, moderate throughput assay for joining activity in solution"

    Article Title: Comparison of metal-dependent catalysis by HIV-1 and ASV integrase proteins using a new and rapid, moderate throughput assay for joining activity in solution

    Journal: AIDS Research and Therapy

    doi: 10.1186/1742-6405-6-14

    Moderate-throughput solution assay for integrase joining activity . Panel A. Principles of a solution assay to measure integrase joining activity by fluorescence. Labeling and symbols are as in Figure 1. FAM stands for carboxyfluorescein labeled DNA, a circle with B denotes a biotin modified 3' end in the target oligodeoxynucleotide. Panel B. Comparison of HIV-1 and ASV IN joining activities in Mg ++ and Mn ++ . The dashed lines with squares show the activity of ASV IN and the solid lines with triangles show the activity of HIV-1 IN expressed as RFUs versus time. Filled and open symbols represent activity in Mn ++ and Mg ++ , respectively. The inset shows results from the same experiment, after 40 min. and up to 180 min. incubation. Panel C. Comparison of the joining activity of ASV IN with the recessed versus the blunt-ended donor oligodeoxynucleotides in the presence of Mg ++ (recessed donor oligodeoxynucleotide, dashed line with filled squares; blunt-ended donor oligodeoxynucleotide, solid line with filled circles).
    Figure Legend Snippet: Moderate-throughput solution assay for integrase joining activity . Panel A. Principles of a solution assay to measure integrase joining activity by fluorescence. Labeling and symbols are as in Figure 1. FAM stands for carboxyfluorescein labeled DNA, a circle with B denotes a biotin modified 3' end in the target oligodeoxynucleotide. Panel B. Comparison of HIV-1 and ASV IN joining activities in Mg ++ and Mn ++ . The dashed lines with squares show the activity of ASV IN and the solid lines with triangles show the activity of HIV-1 IN expressed as RFUs versus time. Filled and open symbols represent activity in Mn ++ and Mg ++ , respectively. The inset shows results from the same experiment, after 40 min. and up to 180 min. incubation. Panel C. Comparison of the joining activity of ASV IN with the recessed versus the blunt-ended donor oligodeoxynucleotides in the presence of Mg ++ (recessed donor oligodeoxynucleotide, dashed line with filled squares; blunt-ended donor oligodeoxynucleotide, solid line with filled circles).

    Techniques Used: Activity Assay, Fluorescence, Labeling, Modification, Incubation

    4) Product Images from "An orally bioavailable broad-spectrum antiviral inhibits SARS-CoV-2 and multiple endemic, epidemic and bat coronavirus"

    Article Title: An orally bioavailable broad-spectrum antiviral inhibits SARS-CoV-2 and multiple endemic, epidemic and bat coronavirus

    Journal: bioRxiv

    doi: 10.1101/2020.03.19.997890

    NHC is effective against multiple genetically distinct Bat-CoV. Top: Antiviral efficacy of NHC in HAE cells against SARS-like (HKU3, SHC014, group 2b) and MERS-like (HKU5, group 2c) bat-CoV. HAE cells were infected at an MOI of 0.5 in the presence of NHC in duplicate. After 48 hours, virus produced was titrated via plaque assay. Each data point represents the titer per culture. Bottom: qRT-PCR for CoV ORF1 and ORFN mRNA in total RNA from cultures in the top panel. Representative data from two separate experiments with two different cell donors are displayed.
    Figure Legend Snippet: NHC is effective against multiple genetically distinct Bat-CoV. Top: Antiviral efficacy of NHC in HAE cells against SARS-like (HKU3, SHC014, group 2b) and MERS-like (HKU5, group 2c) bat-CoV. HAE cells were infected at an MOI of 0.5 in the presence of NHC in duplicate. After 48 hours, virus produced was titrated via plaque assay. Each data point represents the titer per culture. Bottom: qRT-PCR for CoV ORF1 and ORFN mRNA in total RNA from cultures in the top panel. Representative data from two separate experiments with two different cell donors are displayed.

    Techniques Used: Infection, Produced, Plaque Assay, Quantitative RT-PCR

    Remdesivir resistance mutations in the highly conserved RNA-dependent RNA polymerase increase susceptibility to NHC. a , Neighbor-joining trees created with representatives from all four CoV genogroups showing the genetic similarity of CoV nsp12 (RdRp) and CoV spike glycoprotein, which mediates host tropism and entry into cells. Text color of the virus strain label corresponds to virus host species on the left. The heatmap adjacent to each neighbor-joining tree depicts percent amino acid identity (% A.A. similarity) against mouse hepatitis virus (MHV), SARS-CoV or MERS-CoV. b , Core residues of the CoV RdRp are highly conserved among CoV. The variation encompassed in panel a was modeled onto the RdRp structure of the SARS-CoV RdRp. c , Amino acid sequence of CoV in panel a at known resistance alleles to antiviral drug remdesivir (RDV). d , RDV resistant viruses are more susceptible to NHC antiviral activity. Virus titer reduction assay across a dose response of NHC with recombinant MHV bearing resistance mutations to RDV. Asterisks indicate statistically significant differences by Mann-Whitney test.
    Figure Legend Snippet: Remdesivir resistance mutations in the highly conserved RNA-dependent RNA polymerase increase susceptibility to NHC. a , Neighbor-joining trees created with representatives from all four CoV genogroups showing the genetic similarity of CoV nsp12 (RdRp) and CoV spike glycoprotein, which mediates host tropism and entry into cells. Text color of the virus strain label corresponds to virus host species on the left. The heatmap adjacent to each neighbor-joining tree depicts percent amino acid identity (% A.A. similarity) against mouse hepatitis virus (MHV), SARS-CoV or MERS-CoV. b , Core residues of the CoV RdRp are highly conserved among CoV. The variation encompassed in panel a was modeled onto the RdRp structure of the SARS-CoV RdRp. c , Amino acid sequence of CoV in panel a at known resistance alleles to antiviral drug remdesivir (RDV). d , RDV resistant viruses are more susceptible to NHC antiviral activity. Virus titer reduction assay across a dose response of NHC with recombinant MHV bearing resistance mutations to RDV. Asterisks indicate statistically significant differences by Mann-Whitney test.

    Techniques Used: Sequencing, Activity Assay, Recombinant, MANN-WHITNEY

    NHC potently Inhibits MERS-CoV, SARS-CoV and newly emerging SARS-CoV-2 Replication. a , NHC antiviral activity and cytotoxicity in Calu3 cells infected with MERS-CoV. Calu3 cells were infected in triplicate with MERS-CoV nanoluciferase (nLUC) at a multiplicity of infection (MOI) of 0.08 in the presence of a dose response of drug for 48 hours, after which replication was measured through quantitation of MERS-CoV–expressed nLUC. Cytotoxicity was measured in similarly treated but uninfected cultures via Cell-Titer-Glo assay. Data is combined from 3 independent experiments. b , NHC antiviral activity and cytotoxicity in Vero cells infected with SARS-CoV-2. Vero cells were infected in duplicate with SARS-CoV-2 clinical isolate virus at an MOI of 0.05 in the presence of a dose response of drug for 48 hours, after which replication was measured through quantitation of cell viability by Cell-Titer-Glo assay. Cytotoxicity was measured as in a . Data is combined from 2 independent experiments. c , NHC inhibits MERS-CoV virus production and RNA synthesis in primary human lung epithelial cell cultures (HAE). HAE cells were infected with MERS-CoV red fluorescent protein (RFP) at an MOI of 0.5 in duplicate in the presence of NHC for 48 hours, after which apical washes were collected for virus titration. qRT-PCR for MERS-CoV ORF1 and ORFN mRNA. Total RNA was isolated from cultures in c for qRT-PCR analysis. Representative data from three separate experiments with three different cell donors are displayed. PFU, plaque-forming units. d , NHC inhibits SARS-CoV virus production and RNA synthesis in primary human lung epithelial cell cultures (HAE). Studies performed as in c but with SARS-CoV green fluorescent protein (GFP). Representative data from two separate experiments with two different cell donors are displayed.
    Figure Legend Snippet: NHC potently Inhibits MERS-CoV, SARS-CoV and newly emerging SARS-CoV-2 Replication. a , NHC antiviral activity and cytotoxicity in Calu3 cells infected with MERS-CoV. Calu3 cells were infected in triplicate with MERS-CoV nanoluciferase (nLUC) at a multiplicity of infection (MOI) of 0.08 in the presence of a dose response of drug for 48 hours, after which replication was measured through quantitation of MERS-CoV–expressed nLUC. Cytotoxicity was measured in similarly treated but uninfected cultures via Cell-Titer-Glo assay. Data is combined from 3 independent experiments. b , NHC antiviral activity and cytotoxicity in Vero cells infected with SARS-CoV-2. Vero cells were infected in duplicate with SARS-CoV-2 clinical isolate virus at an MOI of 0.05 in the presence of a dose response of drug for 48 hours, after which replication was measured through quantitation of cell viability by Cell-Titer-Glo assay. Cytotoxicity was measured as in a . Data is combined from 2 independent experiments. c , NHC inhibits MERS-CoV virus production and RNA synthesis in primary human lung epithelial cell cultures (HAE). HAE cells were infected with MERS-CoV red fluorescent protein (RFP) at an MOI of 0.5 in duplicate in the presence of NHC for 48 hours, after which apical washes were collected for virus titration. qRT-PCR for MERS-CoV ORF1 and ORFN mRNA. Total RNA was isolated from cultures in c for qRT-PCR analysis. Representative data from three separate experiments with three different cell donors are displayed. PFU, plaque-forming units. d , NHC inhibits SARS-CoV virus production and RNA synthesis in primary human lung epithelial cell cultures (HAE). Studies performed as in c but with SARS-CoV green fluorescent protein (GFP). Representative data from two separate experiments with two different cell donors are displayed.

    Techniques Used: Activity Assay, Infection, Quantitation Assay, Glo Assay, Titration, Quantitative RT-PCR, Isolation

    NHC antiviral activity is associated with increased viral mutation rates. a , Both remdesivir (RDV) and NHC reduce MERS-CoV infectious virus production in primary human HAE. Cultures were infected with MERS-CoV red fluorescent protein (RFP) at an MOI of 0.5 in duplicate in the presence of vehicle, RDV or NHC for 48 hours, after which apical washes were collected for virus titration. Data is combined from two independent studies. b, A deep sequencing approach called Primer ID to gain accurate sequence data for single RNA genomes of MERS-CoV. c , The total error rate for MERS-CoV RNA isolated from cultures in panel a as determined by Primer ID. Error rate values are # mutations per 10,000 bases. Asterisks indicate significant differences as compared to untreated by 2-way ANOVA with a Dunnett’s multiple comparison test. d , description of potential NHC mutational spectra on both positive and negative sense viral RNA. e , Nucleotide transitions adenine (A) to guanine (G) and uridine (U) to cytosine (C) transitions are enriched in MERS-CoV genomic RNA in an NHC dose dependent manner.
    Figure Legend Snippet: NHC antiviral activity is associated with increased viral mutation rates. a , Both remdesivir (RDV) and NHC reduce MERS-CoV infectious virus production in primary human HAE. Cultures were infected with MERS-CoV red fluorescent protein (RFP) at an MOI of 0.5 in duplicate in the presence of vehicle, RDV or NHC for 48 hours, after which apical washes were collected for virus titration. Data is combined from two independent studies. b, A deep sequencing approach called Primer ID to gain accurate sequence data for single RNA genomes of MERS-CoV. c , The total error rate for MERS-CoV RNA isolated from cultures in panel a as determined by Primer ID. Error rate values are # mutations per 10,000 bases. Asterisks indicate significant differences as compared to untreated by 2-way ANOVA with a Dunnett’s multiple comparison test. d , description of potential NHC mutational spectra on both positive and negative sense viral RNA. e , Nucleotide transitions adenine (A) to guanine (G) and uridine (U) to cytosine (C) transitions are enriched in MERS-CoV genomic RNA in an NHC dose dependent manner.

    Techniques Used: Activity Assay, Mutagenesis, Infection, Titration, Sequencing, Isolation

    Prophylactic and therapeutic EIDD-2801 reduces MERS-CoV replication and pathogenesis coincident with increased viral mutation rates. Equivalent numbers of 10-14 week old male and female C57BL/6 hDPP4 mice were administered vehicle (10% PEG, 2.5% Cremophor RH40 in water) or NHC prodrug EIDD-2801 beginning at −2hr, +12, +24 or +48hr post infection and every 12hr thereafter by oral gavage (n = 10/group). Mice were intranasally infected with 5E+04 PFU mouse-adapted MERS-CoV M35C4 strain. a, Percent starting weight. Asterisks indicate differences by two-way ANOVA with Tukey’s multiple comparison test. b, Lung hemorrhage in mice from panel a scored on a scale of 0-4 where 0 is a normal pink healthy lung and 4 is a diffusely discolored dark red lung. c , Virus lung titer in mice from panel a as determined by plaque assay. Asterisks in both panel b and c indicate differences by Kruskal-Wallis with Dunn’s multiple comparison test. d , MERS-CoV genomic RNA in lung tissue by qRT-PCR. Asterisks indicate differences by one-way ANOVA with a Dunnett’s multiple comparison test. e , Pulmonary function by whole body plethysmography was performed daily on four animals per group. Asterisks indicate differences by two-way ANOVA with Tukey’s multiple comparison test. f , Workflow to measure mutation rate in MERS-CoV RNA and host transcript ISG15 by Primer ID in mouse lung tissue. g , Number of template consensus sequences for MERS-CoV nsp10 and ISG15. h , Total error rate in MERS-CoV nsp10 and ISG15. i , The cytosine to uridine transition rate in MERS-CoV nsp10 and ISG15. In panels g-i, asterisks indicate differences by two-way ANOVA with Tukey’s multiple comparison test. j , Codon change frequency in MERS-CoV nsp10. Asterisks indicate differences on Kruskal-Wallis with Dunn’s multiple comparison test.
    Figure Legend Snippet: Prophylactic and therapeutic EIDD-2801 reduces MERS-CoV replication and pathogenesis coincident with increased viral mutation rates. Equivalent numbers of 10-14 week old male and female C57BL/6 hDPP4 mice were administered vehicle (10% PEG, 2.5% Cremophor RH40 in water) or NHC prodrug EIDD-2801 beginning at −2hr, +12, +24 or +48hr post infection and every 12hr thereafter by oral gavage (n = 10/group). Mice were intranasally infected with 5E+04 PFU mouse-adapted MERS-CoV M35C4 strain. a, Percent starting weight. Asterisks indicate differences by two-way ANOVA with Tukey’s multiple comparison test. b, Lung hemorrhage in mice from panel a scored on a scale of 0-4 where 0 is a normal pink healthy lung and 4 is a diffusely discolored dark red lung. c , Virus lung titer in mice from panel a as determined by plaque assay. Asterisks in both panel b and c indicate differences by Kruskal-Wallis with Dunn’s multiple comparison test. d , MERS-CoV genomic RNA in lung tissue by qRT-PCR. Asterisks indicate differences by one-way ANOVA with a Dunnett’s multiple comparison test. e , Pulmonary function by whole body plethysmography was performed daily on four animals per group. Asterisks indicate differences by two-way ANOVA with Tukey’s multiple comparison test. f , Workflow to measure mutation rate in MERS-CoV RNA and host transcript ISG15 by Primer ID in mouse lung tissue. g , Number of template consensus sequences for MERS-CoV nsp10 and ISG15. h , Total error rate in MERS-CoV nsp10 and ISG15. i , The cytosine to uridine transition rate in MERS-CoV nsp10 and ISG15. In panels g-i, asterisks indicate differences by two-way ANOVA with Tukey’s multiple comparison test. j , Codon change frequency in MERS-CoV nsp10. Asterisks indicate differences on Kruskal-Wallis with Dunn’s multiple comparison test.

    Techniques Used: Mutagenesis, Mouse Assay, Infection, Plaque Assay, Quantitative RT-PCR

    5) Product Images from "Field-Applicable Recombinase Polymerase Amplification Assay for Rapid Detection of Mycoplasma capricolum subsp. capripneumoniae"

    Article Title: Field-Applicable Recombinase Polymerase Amplification Assay for Rapid Detection of Mycoplasma capricolum subsp. capripneumoniae

    Journal: Journal of Clinical Microbiology

    doi: 10.1128/JCM.00623-15

    Graph depicting the RPA amplification (development of fluorescence, mV) over time (minutes). (A) M. capricolum subsp. capripneumoniae DNA (5 × 10 6 to 5 × 10 0 copies/reaction) diluted in nuclease-free water. (B) M. capricolum subsp. capripneumoniae CCU (500 to 0.5 CCU/reaction) spiked in plasma from a healthy goat. Each graph represents the mean value from eight individual runs.
    Figure Legend Snippet: Graph depicting the RPA amplification (development of fluorescence, mV) over time (minutes). (A) M. capricolum subsp. capripneumoniae DNA (5 × 10 6 to 5 × 10 0 copies/reaction) diluted in nuclease-free water. (B) M. capricolum subsp. capripneumoniae CCU (500 to 0.5 CCU/reaction) spiked in plasma from a healthy goat. Each graph represents the mean value from eight individual runs.

    Techniques Used: Recombinase Polymerase Amplification, Amplification, Fluorescence

    6) Product Images from "Array of Synthetic Oligonucleotides to Generate Unique Multi-Target Artificial Positive Controls and Molecular Probe-Based Discrimination of Liposcelis Species"

    Article Title: Array of Synthetic Oligonucleotides to Generate Unique Multi-Target Artificial Positive Controls and Molecular Probe-Based Discrimination of Liposcelis Species

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0129810

    Multiplex TaqMan qPCR sensitivity assay. Assay was performed with 10-fold serially diluted multi target artificial positive control (APC) from 1 ng to 1 fg using primer and probe sets (A) ObsCo12F/12R/12P (72 bp), (B) BruCo5F/5R/5P (140 bp), (C) BosCo8F/8R/8P (96 bp), (D) PeaCo14F/14R/14P (67 bp), and (E) DecCo11F/11R/11P (99 bp). Different channels viz . orange, yellow, red, crimson and green corresponding to the different reporter dye (excitation/emission spectra in nm) viz . 6-ROXN (575/602), HEX (535/554), Cy5 (647/667) and Quasar705 (690/705) and 6-FAM (495/520), respectively.
    Figure Legend Snippet: Multiplex TaqMan qPCR sensitivity assay. Assay was performed with 10-fold serially diluted multi target artificial positive control (APC) from 1 ng to 1 fg using primer and probe sets (A) ObsCo12F/12R/12P (72 bp), (B) BruCo5F/5R/5P (140 bp), (C) BosCo8F/8R/8P (96 bp), (D) PeaCo14F/14R/14P (67 bp), and (E) DecCo11F/11R/11P (99 bp). Different channels viz . orange, yellow, red, crimson and green corresponding to the different reporter dye (excitation/emission spectra in nm) viz . 6-ROXN (575/602), HEX (535/554), Cy5 (647/667) and Quasar705 (690/705) and 6-FAM (495/520), respectively.

    Techniques Used: Multiplex Assay, Real-time Polymerase Chain Reaction, Sensitive Assay, Positive Control

    Multiplex TaqMan qPCR standard graphs. Standard graphs were generated using 10-fold serially diluted multi target artificial positive control (APC) from 1 ng to 1 fg using the primer and probe sets BruCo5F/5R/5P (140 bp), BosCo8F/8R/8P (96 bp), DecCo11F/11R/11P (99 bp), ObsCo12F/12R/12P (72 bp) and PeaCo14F/14R/14R (67 bp). Different channels viz . orange, yellow, red, crimson and green corresponding to different reporter dye (excitation/emission spectra in nm) viz . 6-ROXN (575/602), HEX (535/554), Cy5 (647/667) and Quasar705 (690/705) and 6-FAM (495/520).
    Figure Legend Snippet: Multiplex TaqMan qPCR standard graphs. Standard graphs were generated using 10-fold serially diluted multi target artificial positive control (APC) from 1 ng to 1 fg using the primer and probe sets BruCo5F/5R/5P (140 bp), BosCo8F/8R/8P (96 bp), DecCo11F/11R/11P (99 bp), ObsCo12F/12R/12P (72 bp) and PeaCo14F/14R/14R (67 bp). Different channels viz . orange, yellow, red, crimson and green corresponding to different reporter dye (excitation/emission spectra in nm) viz . 6-ROXN (575/602), HEX (535/554), Cy5 (647/667) and Quasar705 (690/705) and 6-FAM (495/520).

    Techniques Used: Multiplex Assay, Real-time Polymerase Chain Reaction, Generated, Positive Control

    7) Product Images from "mRNA Deadenylation Is Coupled to Translation Rates by the Differential Activities of Ccr4-Not Nucleases"

    Article Title: mRNA Deadenylation Is Coupled to Translation Rates by the Differential Activities of Ccr4-Not Nucleases

    Journal: Molecular Cell

    doi: 10.1016/j.molcel.2018.05.033

    Ccr4-Not Releases Pab1 from Short Poly(A) Tails (A) Fluorescence polarization assay showing interaction of Pab1 with 5′ 6-FAM-labeled A22, 10-mer-A12, and A12 RNAs. Error bars are standard error (n = 3 for A12; n = 5 for A22 and 10-mer-A12). K D s are represented as the mean ± standard error. (B) Deadenylation of A30 and 23-mer-A30 RNAs by Ccr4-Not analyzed by both denaturing PAGE (upper gels) and native PAGE (lower gels). Samples were collected from the same reaction at the indicated time points after addition of Ccr4-Not to allow a direct comparison between RNA product sizes and Pab1 binding, respectively. Pab1-bound substrate was prepared with one Pab1 molecule per RNA. Upper right panel is reproduced from Figure 1 C for comparison. (C) Representative SwitchSENSE sensograms showing the dissociation of Pab1 from the indicated RNA sequences. Rate constants and half-lives for dissociation with standard error are shown for measurements performed in triplicate. See also Figures S4–S6 .
    Figure Legend Snippet: Ccr4-Not Releases Pab1 from Short Poly(A) Tails (A) Fluorescence polarization assay showing interaction of Pab1 with 5′ 6-FAM-labeled A22, 10-mer-A12, and A12 RNAs. Error bars are standard error (n = 3 for A12; n = 5 for A22 and 10-mer-A12). K D s are represented as the mean ± standard error. (B) Deadenylation of A30 and 23-mer-A30 RNAs by Ccr4-Not analyzed by both denaturing PAGE (upper gels) and native PAGE (lower gels). Samples were collected from the same reaction at the indicated time points after addition of Ccr4-Not to allow a direct comparison between RNA product sizes and Pab1 binding, respectively. Pab1-bound substrate was prepared with one Pab1 molecule per RNA. Upper right panel is reproduced from Figure 1 C for comparison. (C) Representative SwitchSENSE sensograms showing the dissociation of Pab1 from the indicated RNA sequences. Rate constants and half-lives for dissociation with standard error are shown for measurements performed in triplicate. See also Figures S4–S6 .

    Techniques Used: Fluorescence, Labeling, Polyacrylamide Gel Electrophoresis, Clear Native PAGE, Binding Assay

    Shortening of Pab1-Bound Poly(A) Tails Is Catalyzed by Ccr4 (A) Deadenylation of a 23-mer-A30 RNA in the absence or presence of Pab1 by Ccr4-Not and variant complexes with mutations in the active site of Ccr4 (Ccr4-inactive), Caf1 (Caf1-inactive), or both Ccr4 and Caf1 (double-inactive). Densitometric analyses were performed on selected gels (bottom). (B) Global poly(A) tail length in wild-type (WT) S. cerevisiae and strains containing deletion of CCR4 or CAF1 . The red asterisk indicates incomplete deadenylation in the ccr4 Δ strain. Densitometric analyses were performed on selected gels (bottom). (C) Deadenylation of a 23-mer-A30 RNA by isolated Caf1 protein, Ccr4 (EEP nuclease domain), or the Caf1-Ccr4 heterodimer. (D) Coomassie-stained SDS-PAGE of pull-down assays showing binding of purified Ccr4 or Caf1 to immobilized GST-Pab1. Contaminant proteins are indicated with asterisks. In (A) and (C), Pab1-bound substrate was prepared with one Pab1 molecule per RNA. See also Figures S2 and S3 .
    Figure Legend Snippet: Shortening of Pab1-Bound Poly(A) Tails Is Catalyzed by Ccr4 (A) Deadenylation of a 23-mer-A30 RNA in the absence or presence of Pab1 by Ccr4-Not and variant complexes with mutations in the active site of Ccr4 (Ccr4-inactive), Caf1 (Caf1-inactive), or both Ccr4 and Caf1 (double-inactive). Densitometric analyses were performed on selected gels (bottom). (B) Global poly(A) tail length in wild-type (WT) S. cerevisiae and strains containing deletion of CCR4 or CAF1 . The red asterisk indicates incomplete deadenylation in the ccr4 Δ strain. Densitometric analyses were performed on selected gels (bottom). (C) Deadenylation of a 23-mer-A30 RNA by isolated Caf1 protein, Ccr4 (EEP nuclease domain), or the Caf1-Ccr4 heterodimer. (D) Coomassie-stained SDS-PAGE of pull-down assays showing binding of purified Ccr4 or Caf1 to immobilized GST-Pab1. Contaminant proteins are indicated with asterisks. In (A) and (C), Pab1-bound substrate was prepared with one Pab1 molecule per RNA. See also Figures S2 and S3 .

    Techniques Used: Variant Assay, Isolation, Staining, SDS Page, Binding Assay, Purification

    Pab1 Organization on the Poly(A) Tail (A) Deadenylation by Ccr4-inactive Ccr4-Not to map Pab1-binding site on A30 and 23-mer-A30 RNA substrates. Red asterisks indicate accumulated product poly(A) tail lengths. (B) Deadenylation reaction end points (180 min) following addition of Ccr4-inactive Ccr4-Not to A30 (top) and 23-mer-A30 (bottom) RNA substrates in the presence of the indicated Pab1 variants. Red asterisks indicate accumulated product poly(A) tail lengths. Full time courses are shown in Figures S4 A and S4B. Models of Pab1 binding to each RNA are shown on the right. (C) Deadenylation by Ccr4-inactive Ccr4-Not on 20-mer-A60 RNA in the absence or presence of Pab1 (2:1 molar ratio to RNA). Densitometric analysis of the reaction with Pab1 shows that the protected RNA fragment is ∼50–55 adenosines. A model for Pab1-RNA binding is shown. See also Figure S4 .
    Figure Legend Snippet: Pab1 Organization on the Poly(A) Tail (A) Deadenylation by Ccr4-inactive Ccr4-Not to map Pab1-binding site on A30 and 23-mer-A30 RNA substrates. Red asterisks indicate accumulated product poly(A) tail lengths. (B) Deadenylation reaction end points (180 min) following addition of Ccr4-inactive Ccr4-Not to A30 (top) and 23-mer-A30 (bottom) RNA substrates in the presence of the indicated Pab1 variants. Red asterisks indicate accumulated product poly(A) tail lengths. Full time courses are shown in Figures S4 A and S4B. Models of Pab1 binding to each RNA are shown on the right. (C) Deadenylation by Ccr4-inactive Ccr4-Not on 20-mer-A60 RNA in the absence or presence of Pab1 (2:1 molar ratio to RNA). Densitometric analysis of the reaction with Pab1 shows that the protected RNA fragment is ∼50–55 adenosines. A model for Pab1-RNA binding is shown. See also Figure S4 .

    Techniques Used: Binding Assay, RNA Binding Assay

    Pab1 Stimulates Stepwise Deadenylation by Ccr4-Not (A) Deadenylation by purified Ccr4-Not in the presence and absence of Pab1. The RNA substrate comprises 20 non-poly(A) nucleotides followed by a 60-adenosine poly(A) tail. RNA products (4-min time points) were resolved on a denaturing polyacrylamide gel. Pab1-bound substrates were prepared with two Pab1 molecules per RNA. (B) Coomassie-stained SDS-PAGE of pull-down assay showing binding of purified Ccr4-Not (red labels) to immobilized GST-Pab1. Purified proteins (before mixing), Input (proteins mixed before loading on resin), and Pull-down (proteins bound to resin after washing) are shown. The asterisk indicates a contaminant protein. (C) Deadenylation of 5′ fluorescently labeled 23-mer-A30 RNA substrate. Pab1-bound substrates were prepared with one Pab1 molecule per RNA. Poly(A) tail lengths are indicated, and RRM footprints are marked with red asterisks. (D) Deadenylation of 5′ fluorescently labeled 23-mer-A30 RNA substrates in the presence of Pab1 variants. The positions of footprints observed with wild-type Pab1 in (C) are indicated with red asterisks. See also Figures S1 and S2 .
    Figure Legend Snippet: Pab1 Stimulates Stepwise Deadenylation by Ccr4-Not (A) Deadenylation by purified Ccr4-Not in the presence and absence of Pab1. The RNA substrate comprises 20 non-poly(A) nucleotides followed by a 60-adenosine poly(A) tail. RNA products (4-min time points) were resolved on a denaturing polyacrylamide gel. Pab1-bound substrates were prepared with two Pab1 molecules per RNA. (B) Coomassie-stained SDS-PAGE of pull-down assay showing binding of purified Ccr4-Not (red labels) to immobilized GST-Pab1. Purified proteins (before mixing), Input (proteins mixed before loading on resin), and Pull-down (proteins bound to resin after washing) are shown. The asterisk indicates a contaminant protein. (C) Deadenylation of 5′ fluorescently labeled 23-mer-A30 RNA substrate. Pab1-bound substrates were prepared with one Pab1 molecule per RNA. Poly(A) tail lengths are indicated, and RRM footprints are marked with red asterisks. (D) Deadenylation of 5′ fluorescently labeled 23-mer-A30 RNA substrates in the presence of Pab1 variants. The positions of footprints observed with wild-type Pab1 in (C) are indicated with red asterisks. See also Figures S1 and S2 .

    Techniques Used: Purification, Staining, SDS Page, Pull Down Assay, Binding Assay, Labeling

    8) Product Images from "Structural Basis for Catalysis by Onconase"

    Article Title: Structural Basis for Catalysis by Onconase

    Journal:

    doi: 10.1016/j.jmb.2007.09.089

    pH– k cat / K M profile for the cleavage of 6-FAM–dArUdGdA–6-TAMRA by ONC. Assays were performed at 23 °C in 1.0 mM buffer containing NaCl (1.0 M). Determination of k cat / K M values was performed in triplicate. Data were fitted
    Figure Legend Snippet: pH– k cat / K M profile for the cleavage of 6-FAM–dArUdGdA–6-TAMRA by ONC. Assays were performed at 23 °C in 1.0 mM buffer containing NaCl (1.0 M). Determination of k cat / K M values was performed in triplicate. Data were fitted

    Techniques Used:

    Effect of Thr89 and Glu91 on the substrate specificity of ONC. Bars indicate the effect of replacing Thr89 or Glu91 on the value of k cat / K M for the cleavage of 6-FAM–dArUdGdA–6-TAMRA (UpG) and 6-FAM–dArUdAdA–6-TAMRA (UpA).
    Figure Legend Snippet: Effect of Thr89 and Glu91 on the substrate specificity of ONC. Bars indicate the effect of replacing Thr89 or Glu91 on the value of k cat / K M for the cleavage of 6-FAM–dArUdGdA–6-TAMRA (UpG) and 6-FAM–dArUdAdA–6-TAMRA (UpA).

    Techniques Used:

    9) Product Images from "Oligonucleotide-based assays for integrase activity"

    Article Title: Oligonucleotide-based assays for integrase activity

    Journal: Methods (San Diego, Calif.)

    doi: 10.1016/j.ymeth.2008.10.024

    Binding of HIV-1 IN to a 6-FAM-labeled, recessed viral DNA oligo. (A), Illustration of the reaction. (B), Anisotropy measurements. Diamonds (dashed lines) show results with 6-His-tagged IN; solid lines are results with untagged IN. Solid symbols show binding in the presence of MgCl 2 ; open symbols, in the presence of MnCl 2 . (C), Structure of 6-carbofluorescein (6-FAM). Conjugation occurs through the terminal phosphate.
    Figure Legend Snippet: Binding of HIV-1 IN to a 6-FAM-labeled, recessed viral DNA oligo. (A), Illustration of the reaction. (B), Anisotropy measurements. Diamonds (dashed lines) show results with 6-His-tagged IN; solid lines are results with untagged IN. Solid symbols show binding in the presence of MgCl 2 ; open symbols, in the presence of MnCl 2 . (C), Structure of 6-carbofluorescein (6-FAM). Conjugation occurs through the terminal phosphate.

    Techniques Used: Binding Assay, Labeling, Conjugation Assay

    10) Product Images from "SMCX and components of the TIP60 complex contribute to E2 regulation of the HPV E6/E7 promoter"

    Article Title: SMCX and components of the TIP60 complex contribute to E2 regulation of the HPV E6/E7 promoter

    Journal: Virology

    doi: 10.1016/j.virol.2014.08.022

    BPV1 E2 is present at the HPV18 LCR in HeLa cells ( A ) Map of the HPV18 viral genome in HeLa cells, with the DNA sequences that were amplified via PCR indicated. DNA sequences encompassing the transcription start site in the HPV18 LCR (B) or L1 ORF (C) and associated with BPV1 E2 were quantitated in HeLa/16E6/16E7/BE2 or HeLa/16E6/16E7/pOZN cells after ChIP using antibodies against the HA-tag on BPV1 E2 via qPCR. The fold change displayed on the y-axis represents data normalized to the β-actin transcriptional start site, with each bar representing the average of three experiments ± SD. Asterisks represent the level of significance (* p-value ≤ 0.05 and ** p-value ≤ 0.005), as determined via unpaired t-tests.
    Figure Legend Snippet: BPV1 E2 is present at the HPV18 LCR in HeLa cells ( A ) Map of the HPV18 viral genome in HeLa cells, with the DNA sequences that were amplified via PCR indicated. DNA sequences encompassing the transcription start site in the HPV18 LCR (B) or L1 ORF (C) and associated with BPV1 E2 were quantitated in HeLa/16E6/16E7/BE2 or HeLa/16E6/16E7/pOZN cells after ChIP using antibodies against the HA-tag on BPV1 E2 via qPCR. The fold change displayed on the y-axis represents data normalized to the β-actin transcriptional start site, with each bar representing the average of three experiments ± SD. Asterisks represent the level of significance (* p-value ≤ 0.05 and ** p-value ≤ 0.005), as determined via unpaired t-tests.

    Techniques Used: Amplification, Polymerase Chain Reaction, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction

    E2-mediated transcriptional repression of the HPV18 LCR in cervical cancer cells does not require other JARID1 family proteins C33A/16E2/18LCR c1 cells were transfected with the indicated siRNAs at a final concentration of 20 nM. (A) Cell extracts were harvested 72 h post-transfection to determine RLU and total protein levels. Experiments were performed in triplicate, with each bar representing the average ± SD. (B) SMCX and PLU1 transcript levels were quantitated by qPCR in cells transfected with the indicated siRNAs. The graph displays the relative mRNA levels normalized to β-actin transcript levels.
    Figure Legend Snippet: E2-mediated transcriptional repression of the HPV18 LCR in cervical cancer cells does not require other JARID1 family proteins C33A/16E2/18LCR c1 cells were transfected with the indicated siRNAs at a final concentration of 20 nM. (A) Cell extracts were harvested 72 h post-transfection to determine RLU and total protein levels. Experiments were performed in triplicate, with each bar representing the average ± SD. (B) SMCX and PLU1 transcript levels were quantitated by qPCR in cells transfected with the indicated siRNAs. The graph displays the relative mRNA levels normalized to β-actin transcript levels.

    Techniques Used: Transfection, Concentration Assay, Real-time Polymerase Chain Reaction

    11) Product Images from "Induction of hypervascularity without leakage or inflammation in transgenic mice overexpressing hypoxia-inducible factor-1?"

    Article Title: Induction of hypervascularity without leakage or inflammation in transgenic mice overexpressing hypoxia-inducible factor-1?

    Journal: Genes & Development

    doi: 10.1101/gad.914801

    Expression of total VEGF and VEGF isoforms. ( a ) Real-time RT–PCR determination of total VEGF isoform expression in ear skin of K14-HIF-1α, K14-HIF-1αΔODD, and K14-VEGF164 transgenic mice and nontransgenic controls. Three mice from each genotype were analyzed, and VEGF mRNA levels are calculated relative to histone 3.3A in each sample. Total VEGF mRNA levels are increased 80% in K14-HIF-1α transgenic mice compared with nontransgenic controls (* P = 0.02, Student’s t -test). Total VEGF mRNA is elevated 13-fold in K14-HIF-1αΔODD transgenic mice compared with nontransgenic controls (* P
    Figure Legend Snippet: Expression of total VEGF and VEGF isoforms. ( a ) Real-time RT–PCR determination of total VEGF isoform expression in ear skin of K14-HIF-1α, K14-HIF-1αΔODD, and K14-VEGF164 transgenic mice and nontransgenic controls. Three mice from each genotype were analyzed, and VEGF mRNA levels are calculated relative to histone 3.3A in each sample. Total VEGF mRNA levels are increased 80% in K14-HIF-1α transgenic mice compared with nontransgenic controls (* P = 0.02, Student’s t -test). Total VEGF mRNA is elevated 13-fold in K14-HIF-1αΔODD transgenic mice compared with nontransgenic controls (* P

    Techniques Used: Expressing, Quantitative RT-PCR, Transgenic Assay, Mouse Assay

    12) Product Images from "Antimicrobial nano-zinc oxide-2S albumin protein formulation significantly inhibits growth of “Candidatus Liberibacter asiaticus” in planta"

    Article Title: Antimicrobial nano-zinc oxide-2S albumin protein formulation significantly inhibits growth of “Candidatus Liberibacter asiaticus” in planta

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0204702

    (A) qPCR Amplification plot generated by known concentration of C Las genomic DNA to check efficiency and sensitivity of TaqMan-qPCR with HLBas-F/Rn-HLBp primer probe pair, Line-a = 12.5 ng, Line-b = 1.25 ng, Line-c = 0.125 ng, Line-d = 0.0125 ng, Line-e = 1.25 pg, Line-f = 0.125 pg and Line-g = 12.5 fg template DNA. (B) Sensitivity of the primer-probe combination (HLBas-F/Rn-HLBp specific) for C Las detection using TaqMan qPCR assay. The standard curve established between log of DNA concentrations vs. cycle threshold (Ct) obtained using 10-fold serial dilution of total genomic DNA of Mosambi plants infected with C Las (initial concentration 12.5 ng/μl, final concentration 12.5 fg/μl).
    Figure Legend Snippet: (A) qPCR Amplification plot generated by known concentration of C Las genomic DNA to check efficiency and sensitivity of TaqMan-qPCR with HLBas-F/Rn-HLBp primer probe pair, Line-a = 12.5 ng, Line-b = 1.25 ng, Line-c = 0.125 ng, Line-d = 0.0125 ng, Line-e = 1.25 pg, Line-f = 0.125 pg and Line-g = 12.5 fg template DNA. (B) Sensitivity of the primer-probe combination (HLBas-F/Rn-HLBp specific) for C Las detection using TaqMan qPCR assay. The standard curve established between log of DNA concentrations vs. cycle threshold (Ct) obtained using 10-fold serial dilution of total genomic DNA of Mosambi plants infected with C Las (initial concentration 12.5 ng/μl, final concentration 12.5 fg/μl).

    Techniques Used: Real-time Polymerase Chain Reaction, Amplification, Generated, Concentration Assay, Serial Dilution, Infection

    13) Product Images from "Nanoparticulate Delivery of Cancer Cell Membrane Elicits Multi-Antigenic Antitumor Immunity"

    Article Title: Nanoparticulate Delivery of Cancer Cell Membrane Elicits Multi-Antigenic Antitumor Immunity

    Journal: Advanced materials (Deerfield Beach, Fla.)

    doi: 10.1002/adma.201703969

    Characterization of in vivo T cell responses. a) Proliferation index of adoptively transferred pmel-1 CD8+ T cells after in vivo stimulation by CpG-CCNPs or various control formulations, including whole cell lysate with free CpG (WC + fCpG), CCNPs with free CpG (CCNP + fCpG), CCNPs, CpG-NPs, and blank solution (n = 3; mean ± SD). b,c) Tetramer staining analysis of T cells specific for gp100 (b) and TRP2 (c) after ex vivo restimulation of splenocytes from mice vaccinated with CpG-CCNPs or various control formulations (n = 3; mean ± SD). * p
    Figure Legend Snippet: Characterization of in vivo T cell responses. a) Proliferation index of adoptively transferred pmel-1 CD8+ T cells after in vivo stimulation by CpG-CCNPs or various control formulations, including whole cell lysate with free CpG (WC + fCpG), CCNPs with free CpG (CCNP + fCpG), CCNPs, CpG-NPs, and blank solution (n = 3; mean ± SD). b,c) Tetramer staining analysis of T cells specific for gp100 (b) and TRP2 (c) after ex vivo restimulation of splenocytes from mice vaccinated with CpG-CCNPs or various control formulations (n = 3; mean ± SD). * p

    Techniques Used: In Vivo, Staining, Ex Vivo, Mouse Assay

    Therapeutic efficacy. a–c) After challenge with B16–F10 cells on day 0, mice were treated using CpG-CCNPs combined with a checkpoint blockade cocktail of anti-CTLA4 plus anti-PD1 (αCTLA4/αPD1), CpG-CCNPs alone, or the checkpoint blockade cocktail alone on days 1, 2, 4 and 7. Average tumor sizes (a), survival (b), and individual tumor growth kinetics (c) were plotted over time (n = 6; mean ± SEM). Reporting of average tumor sizes was halted after the first mouse died in each respective group. * p
    Figure Legend Snippet: Therapeutic efficacy. a–c) After challenge with B16–F10 cells on day 0, mice were treated using CpG-CCNPs combined with a checkpoint blockade cocktail of anti-CTLA4 plus anti-PD1 (αCTLA4/αPD1), CpG-CCNPs alone, or the checkpoint blockade cocktail alone on days 1, 2, 4 and 7. Average tumor sizes (a), survival (b), and individual tumor growth kinetics (c) were plotted over time (n = 6; mean ± SEM). Reporting of average tumor sizes was halted after the first mouse died in each respective group. * p

    Techniques Used: Mouse Assay

    Preparation and characterization of CpG-CCNPs. a) CpG encapsulation into PLGA cores with increasing inputs, normalized by polymer weight (n = 3, mean ± SD). b) Size of CpG-NPs, B16–F10 membrane vesicles, and CpG-CCNPs (n = 3; mean ± SD). c) Surface zeta potential of CpG-NPs, B16–F10 membrane vesicles, and CpG-CCNPs (n = 3; mean ± SD). d) TEM image of CpG-CCNPs negatively stained with uranyl acetate. Scale bar = 100 nm. e) Size stability over time of CpG-CCNPs stored in 10% sucrose (n = 3; mean ± SD). f) Western blots for known melanoma-associated antigens MART1, TRP2, and gp100 on B16–F10 cells, B16–F10 membrane, and CpG-CCNPs.
    Figure Legend Snippet: Preparation and characterization of CpG-CCNPs. a) CpG encapsulation into PLGA cores with increasing inputs, normalized by polymer weight (n = 3, mean ± SD). b) Size of CpG-NPs, B16–F10 membrane vesicles, and CpG-CCNPs (n = 3; mean ± SD). c) Surface zeta potential of CpG-NPs, B16–F10 membrane vesicles, and CpG-CCNPs (n = 3; mean ± SD). d) TEM image of CpG-CCNPs negatively stained with uranyl acetate. Scale bar = 100 nm. e) Size stability over time of CpG-CCNPs stored in 10% sucrose (n = 3; mean ± SD). f) Western blots for known melanoma-associated antigens MART1, TRP2, and gp100 on B16–F10 cells, B16–F10 membrane, and CpG-CCNPs.

    Techniques Used: Transmission Electron Microscopy, Staining, Western Blot

    Delivery of antigen and adjuvant to immune cells. a) Uptake kinetics of dye-labeled CpG-CCNPs by BMDCs (n = 3; mean ± SD). b) Uptake kinetics of dye-conjugated CpG in free form or within CpG-CCNPs by BMDCs (n = 3; mean ± SD). c,d) Secretion of the pro-inflammatory cytokines IL-6 (c) and IL-12p40 (d) by BMDCs when incubated with either free CpG or CpG-CCNPs (n = 3; mean ± SD). e) Confocal microscopy colocalization of CpG and membrane proteins upon uptake of dual-labeled CpG-CCNPs by a BMDC. Green = CpG, red = membrane, blue = cell nucleus; scale bar = 10 µm. f) Uptake of dye-labeled CpG-CCNPs by different immune cell subsets in the draining lymph node after in vivo administration (n = 6; mean ± SD).
    Figure Legend Snippet: Delivery of antigen and adjuvant to immune cells. a) Uptake kinetics of dye-labeled CpG-CCNPs by BMDCs (n = 3; mean ± SD). b) Uptake kinetics of dye-conjugated CpG in free form or within CpG-CCNPs by BMDCs (n = 3; mean ± SD). c,d) Secretion of the pro-inflammatory cytokines IL-6 (c) and IL-12p40 (d) by BMDCs when incubated with either free CpG or CpG-CCNPs (n = 3; mean ± SD). e) Confocal microscopy colocalization of CpG and membrane proteins upon uptake of dual-labeled CpG-CCNPs by a BMDC. Green = CpG, red = membrane, blue = cell nucleus; scale bar = 10 µm. f) Uptake of dye-labeled CpG-CCNPs by different immune cell subsets in the draining lymph node after in vivo administration (n = 6; mean ± SD).

    Techniques Used: Labeling, Incubation, Confocal Microscopy, In Vivo

    Characterization of in vivo dendritic cell maturation. a–d) Analysis of dendritic cell maturation markers CD40 (a), CD80 (b), CD86 (c), and MHC-II (d) in the draining lymph nodes after administration with CpG-CCNPs and various control formulations, including whole cell lysate with free CpG (WC + fCpG), CCNPs with free CpG (CCNP + fCpG), CCNPs, CpG-NPs, and blank solution (n = 4; mean ± SD). e,f) Concentration of pro-inflammatory cytokines IL-6 (e) and IL-12p40 (f) secreted by immune cells isolated from the draining lymph nodes after vaccination with CpG-CCNPs or various control formulations (n = 4; mean ± SEM). * p
    Figure Legend Snippet: Characterization of in vivo dendritic cell maturation. a–d) Analysis of dendritic cell maturation markers CD40 (a), CD80 (b), CD86 (c), and MHC-II (d) in the draining lymph nodes after administration with CpG-CCNPs and various control formulations, including whole cell lysate with free CpG (WC + fCpG), CCNPs with free CpG (CCNP + fCpG), CCNPs, CpG-NPs, and blank solution (n = 4; mean ± SD). e,f) Concentration of pro-inflammatory cytokines IL-6 (e) and IL-12p40 (f) secreted by immune cells isolated from the draining lymph nodes after vaccination with CpG-CCNPs or various control formulations (n = 4; mean ± SEM). * p

    Techniques Used: In Vivo, Concentration Assay, Isolation

    Prophylactic efficacy. a–c) Mice immunized with CpG-CCNPs and various control formulations, including whole cell lysate with free CpG (WC + fCpG), CCNPs with free CpG (CCNP + fCpG), CCNPs, CpG-NPs, and blank solution, on days 0, 7, and 14 were challenged with B16–F10 cells on day 21. Average tumor sizes (a), survival (b), and individual tumor growth kinetics (c) were plotted over time (n = 7; mean ± SEM). Reporting of average tumor sizes was halted after the first mouse died in each respective group. * p
    Figure Legend Snippet: Prophylactic efficacy. a–c) Mice immunized with CpG-CCNPs and various control formulations, including whole cell lysate with free CpG (WC + fCpG), CCNPs with free CpG (CCNP + fCpG), CCNPs, CpG-NPs, and blank solution, on days 0, 7, and 14 were challenged with B16–F10 cells on day 21. Average tumor sizes (a), survival (b), and individual tumor growth kinetics (c) were plotted over time (n = 7; mean ± SEM). Reporting of average tumor sizes was halted after the first mouse died in each respective group. * p

    Techniques Used: Mouse Assay

    Schematic of CpG-CCNPs for anticancer vaccination. Membrane derived from cancer cells (purple), along with the associated tumor antigens (small colored spheres), is coated onto adjuvant-loaded nanoparticle cores (CpG-NPs) to yield a nanoparticulate anticancer vaccine (CpG-CCNPs). Upon delivery to antigen presenting cells (blue), the vaccine formulation enables activation of T cells (tan) with multiple specificities. After detecting the antigens present on the tumor, the T cells are capable of initiating cancer cell death (gray).
    Figure Legend Snippet: Schematic of CpG-CCNPs for anticancer vaccination. Membrane derived from cancer cells (purple), along with the associated tumor antigens (small colored spheres), is coated onto adjuvant-loaded nanoparticle cores (CpG-NPs) to yield a nanoparticulate anticancer vaccine (CpG-CCNPs). Upon delivery to antigen presenting cells (blue), the vaccine formulation enables activation of T cells (tan) with multiple specificities. After detecting the antigens present on the tumor, the T cells are capable of initiating cancer cell death (gray).

    Techniques Used: Derivative Assay, Activation Assay

    14) Product Images from "mRNA Deadenylation Is Coupled to Translation Rates by the Differential Activities of Ccr4-Not Nucleases"

    Article Title: mRNA Deadenylation Is Coupled to Translation Rates by the Differential Activities of Ccr4-Not Nucleases

    Journal: Molecular Cell

    doi: 10.1016/j.molcel.2018.05.033

    Shortening of Pab1-Bound Poly(A) Tails Is Catalyzed by Ccr4 (A) Deadenylation of a 23-mer-A30 RNA in the absence or presence of Pab1 by Ccr4-Not and variant complexes with mutations in the active site of Ccr4 (Ccr4-inactive), Caf1 (Caf1-inactive), or both Ccr4 and Caf1 (double-inactive). Densitometric analyses were performed on selected gels (bottom). (B) Global poly(A) tail length in wild-type (WT) S. cerevisiae and strains containing deletion of CCR4 or CAF1 . The red asterisk indicates incomplete deadenylation in the ccr4 Δ strain. Densitometric analyses were performed on selected gels (bottom). (C) Deadenylation of a 23-mer-A30 RNA by isolated Caf1 protein, Ccr4 (EEP nuclease domain), or the Caf1-Ccr4 heterodimer. (D) Coomassie-stained SDS-PAGE of pull-down assays showing binding of purified Ccr4 or Caf1 to immobilized GST-Pab1. Contaminant proteins are indicated with asterisks. .
    Figure Legend Snippet: Shortening of Pab1-Bound Poly(A) Tails Is Catalyzed by Ccr4 (A) Deadenylation of a 23-mer-A30 RNA in the absence or presence of Pab1 by Ccr4-Not and variant complexes with mutations in the active site of Ccr4 (Ccr4-inactive), Caf1 (Caf1-inactive), or both Ccr4 and Caf1 (double-inactive). Densitometric analyses were performed on selected gels (bottom). (B) Global poly(A) tail length in wild-type (WT) S. cerevisiae and strains containing deletion of CCR4 or CAF1 . The red asterisk indicates incomplete deadenylation in the ccr4 Δ strain. Densitometric analyses were performed on selected gels (bottom). (C) Deadenylation of a 23-mer-A30 RNA by isolated Caf1 protein, Ccr4 (EEP nuclease domain), or the Caf1-Ccr4 heterodimer. (D) Coomassie-stained SDS-PAGE of pull-down assays showing binding of purified Ccr4 or Caf1 to immobilized GST-Pab1. Contaminant proteins are indicated with asterisks. .

    Techniques Used: Variant Assay, Isolation, Staining, SDS Page, Binding Assay, Purification

    Pab1 Organization on the Poly(A) Tail (A) Deadenylation by Ccr4-inactive Ccr4-Not to map Pab1-binding site on A30 and 23-mer-A30 RNA substrates. Red asterisks indicate accumulated product poly(A) tail lengths. A and S4B. Models of Pab1 binding to each RNA are shown on the right. (C) Deadenylation by Ccr4-inactive Ccr4-Not on 20-mer-A60 RNA in the absence or presence of Pab1 (2:1 molar ratio to RNA). Densitometric analysis of the reaction with Pab1 shows that the protected RNA fragment is ∼50–55 adenosines. A model for Pab1-RNA binding is shown. .
    Figure Legend Snippet: Pab1 Organization on the Poly(A) Tail (A) Deadenylation by Ccr4-inactive Ccr4-Not to map Pab1-binding site on A30 and 23-mer-A30 RNA substrates. Red asterisks indicate accumulated product poly(A) tail lengths. A and S4B. Models of Pab1 binding to each RNA are shown on the right. (C) Deadenylation by Ccr4-inactive Ccr4-Not on 20-mer-A60 RNA in the absence or presence of Pab1 (2:1 molar ratio to RNA). Densitometric analysis of the reaction with Pab1 shows that the protected RNA fragment is ∼50–55 adenosines. A model for Pab1-RNA binding is shown. .

    Techniques Used: Binding Assay, RNA Binding Assay

    Pab1 Stimulates Stepwise Deadenylation by Ccr4-Not (A) Deadenylation by purified Ccr4-Not in the presence and absence of Pab1. The RNA substrate comprises 20 non-poly(A) nucleotides followed by a 60-adenosine poly(A) tail. RNA products (4-min time points) were resolved on a denaturing polyacrylamide gel. Pab1-bound substrates were prepared with two Pab1 molecules per RNA. (B) Coomassie-stained SDS-PAGE of pull-down assay showing binding of purified Ccr4-Not (red labels) to immobilized GST-Pab1. Purified proteins (before mixing), Input (proteins mixed before loading on resin), and Pull-down (proteins bound to resin after washing) are shown. The asterisk indicates a contaminant protein. (C) Deadenylation of 5′ fluorescently labeled 23-mer-A30 RNA substrate. Pab1-bound substrates were prepared with one Pab1 molecule per RNA. Poly(A) tail lengths are indicated, and RRM footprints are marked with red asterisks. (D) Deadenylation of 5′ fluorescently labeled 23-mer-A30 RNA substrates in the presence of Pab1 variants. The positions of footprints observed with wild-type Pab1 in (C) are indicated with red asterisks. .
    Figure Legend Snippet: Pab1 Stimulates Stepwise Deadenylation by Ccr4-Not (A) Deadenylation by purified Ccr4-Not in the presence and absence of Pab1. The RNA substrate comprises 20 non-poly(A) nucleotides followed by a 60-adenosine poly(A) tail. RNA products (4-min time points) were resolved on a denaturing polyacrylamide gel. Pab1-bound substrates were prepared with two Pab1 molecules per RNA. (B) Coomassie-stained SDS-PAGE of pull-down assay showing binding of purified Ccr4-Not (red labels) to immobilized GST-Pab1. Purified proteins (before mixing), Input (proteins mixed before loading on resin), and Pull-down (proteins bound to resin after washing) are shown. The asterisk indicates a contaminant protein. (C) Deadenylation of 5′ fluorescently labeled 23-mer-A30 RNA substrate. Pab1-bound substrates were prepared with one Pab1 molecule per RNA. Poly(A) tail lengths are indicated, and RRM footprints are marked with red asterisks. (D) Deadenylation of 5′ fluorescently labeled 23-mer-A30 RNA substrates in the presence of Pab1 variants. The positions of footprints observed with wild-type Pab1 in (C) are indicated with red asterisks. .

    Techniques Used: Purification, Staining, SDS Page, Pull Down Assay, Binding Assay, Labeling

    15) Product Images from "A virus-packageable CRISPR screen identifies host factors mediating interferon inhibition of HIV"

    Article Title: A virus-packageable CRISPR screen identifies host factors mediating interferon inhibition of HIV

    Journal: eLife

    doi: 10.7554/eLife.39823

    HIV-CRISPR Screening Identifies HIV Dependency Factors. ( A ) Negative MAGeCK Gene Scores across both ZAP-KO Screens ranked from most depleted genes on the X-axis. Only the top 25 hits are shown. ( B ) Left: THP-1 cells were stimulated overnight with IFNα and assayed for cell surface SIGLEC1/CD169 expression by flow cytometry. Right: Control (scrambled - gray) THP-1 cells andTHP-1 cells transduced with a SIGLEC1/CD169-targeting shRNA construct (dotted purple line) were assayed for cell surface SIGLEC1/CD169 expression after overnight IFNα treatment. ( C ) Infection of control (gray – wild type) and SIGLEC1/CD169 knockdown THP-1 (purple - CD169-KD) with and without IFNα (1000 U/mL u IFNα) and assayed by intracellular p24gag 2 days after infection ( D ) KO efficiency as determined by ICE analysis (CXCR4) or flow cytometry (TLR2). ( E ) Infection of control (gray – NTC), CXCR4-KO pools (orange) and TLR2-KO pools (green) were assayed for the % of cells expressing HIV p24gag 2 days post-infection by intracellular staining and flow cytometry. Left: wt HIV-1 LAI (n = 3). Right: HIV-1 LAI Δenv + VSV G (n = 3). ( F ) SEC62 knockdown after transduction with two LKO SEC62 shRNA constructs. Western blot of the sec62-targeting shRNA cell lines is shown together with two control (scrambled in gray) cell lines. Loading control = actin. ( G ) Infection of SEC62-KD (yellow) and control (scrambled in gray) with wt HIV-1 LAI (left panel) or HIV-1 LAI Δenv + VSV G (right panel). The % of cells expressing HIV p24gag 2 days post-infection is shown. ( H ) The mean fluorescence intensity (MFI) of CD4-APC (left panel) and CXCR4-APC (right panel) cell surface staining of control (scrambled in gray) and SEC62-KD (yellow) THP-1 cell pools.
    Figure Legend Snippet: HIV-CRISPR Screening Identifies HIV Dependency Factors. ( A ) Negative MAGeCK Gene Scores across both ZAP-KO Screens ranked from most depleted genes on the X-axis. Only the top 25 hits are shown. ( B ) Left: THP-1 cells were stimulated overnight with IFNα and assayed for cell surface SIGLEC1/CD169 expression by flow cytometry. Right: Control (scrambled - gray) THP-1 cells andTHP-1 cells transduced with a SIGLEC1/CD169-targeting shRNA construct (dotted purple line) were assayed for cell surface SIGLEC1/CD169 expression after overnight IFNα treatment. ( C ) Infection of control (gray – wild type) and SIGLEC1/CD169 knockdown THP-1 (purple - CD169-KD) with and without IFNα (1000 U/mL u IFNα) and assayed by intracellular p24gag 2 days after infection ( D ) KO efficiency as determined by ICE analysis (CXCR4) or flow cytometry (TLR2). ( E ) Infection of control (gray – NTC), CXCR4-KO pools (orange) and TLR2-KO pools (green) were assayed for the % of cells expressing HIV p24gag 2 days post-infection by intracellular staining and flow cytometry. Left: wt HIV-1 LAI (n = 3). Right: HIV-1 LAI Δenv + VSV G (n = 3). ( F ) SEC62 knockdown after transduction with two LKO SEC62 shRNA constructs. Western blot of the sec62-targeting shRNA cell lines is shown together with two control (scrambled in gray) cell lines. Loading control = actin. ( G ) Infection of SEC62-KD (yellow) and control (scrambled in gray) with wt HIV-1 LAI (left panel) or HIV-1 LAI Δenv + VSV G (right panel). The % of cells expressing HIV p24gag 2 days post-infection is shown. ( H ) The mean fluorescence intensity (MFI) of CD4-APC (left panel) and CXCR4-APC (right panel) cell surface staining of control (scrambled in gray) and SEC62-KD (yellow) THP-1 cell pools.

    Techniques Used: CRISPR, Expressing, Flow Cytometry, Cytometry, Transduction, shRNA, Construct, Infection, Staining, Western Blot, Fluorescence

    HIV-CRISPR Screen of an R5-tropic Clade 1 Isolate (HIV-1 Q23.BG505 ). ( A ) The PIKA HIV screen was performed in duplicate in ZAP-KO THP-1 cells with HIV-1 Q23.BG505 . Y-Axis: IFN induction as determined by Differential Expression (DE) Analysis of microarray data in THP-1 cells (IFN DE log 2 FC). X-Axis: MAGeCK Gene Scores for Top 50 Hits. Magenta: IFN pathway genes (IFNAR1, STAT1, STAT2, IRF9). Cyan: highly-IFN induced, high-scoring candidate Hits. White: non-IFN induced genes. High-scoring genes with no information on IFN induction in THP-1s are plotted as IFN DE log 2 FC = 0 but shown in Cyan with a gray outline. ( B ) Comparison of the top 30 gene hits from either the HIV-1 LAI screen (X-axis) or the HIV-1 Q23.BG505 screen (Y-axis). Magenta: IFN pathway genes. Cyan: highly-IFN induced, high-scoring genes for both viruses. Green: highly-IFN induced and high-scoring for HIV-1 Q23.BG505 . Dark Blue: highly-IFN induced and high-scoring for HIV-1 LAI . Gray outlines are genes that are not significantly upregulated by IFN. ( C ) Negative MAGeCK Gene Scores for the HIV-1 Q23.BG505 PIKA HIV screen. Only the top 25 hits are shown. Gray = NTCs; Orange = previously described or novel candidate HIV dependency factors.
    Figure Legend Snippet: HIV-CRISPR Screen of an R5-tropic Clade 1 Isolate (HIV-1 Q23.BG505 ). ( A ) The PIKA HIV screen was performed in duplicate in ZAP-KO THP-1 cells with HIV-1 Q23.BG505 . Y-Axis: IFN induction as determined by Differential Expression (DE) Analysis of microarray data in THP-1 cells (IFN DE log 2 FC). X-Axis: MAGeCK Gene Scores for Top 50 Hits. Magenta: IFN pathway genes (IFNAR1, STAT1, STAT2, IRF9). Cyan: highly-IFN induced, high-scoring candidate Hits. White: non-IFN induced genes. High-scoring genes with no information on IFN induction in THP-1s are plotted as IFN DE log 2 FC = 0 but shown in Cyan with a gray outline. ( B ) Comparison of the top 30 gene hits from either the HIV-1 LAI screen (X-axis) or the HIV-1 Q23.BG505 screen (Y-axis). Magenta: IFN pathway genes. Cyan: highly-IFN induced, high-scoring genes for both viruses. Green: highly-IFN induced and high-scoring for HIV-1 Q23.BG505 . Dark Blue: highly-IFN induced and high-scoring for HIV-1 LAI . Gray outlines are genes that are not significantly upregulated by IFN. ( C ) Negative MAGeCK Gene Scores for the HIV-1 Q23.BG505 PIKA HIV screen. Only the top 25 hits are shown. Gray = NTCs; Orange = previously described or novel candidate HIV dependency factors.

    Techniques Used: CRISPR, Expressing, Microarray

    16) Product Images from "Identification of the DNA-Binding Domains of Human Replication Protein A That Recognize G-Quadruplex DNA"

    Article Title: Identification of the DNA-Binding Domains of Human Replication Protein A That Recognize G-Quadruplex DNA

    Journal: Journal of Nucleic Acids

    doi: 10.4061/2011/896947

    Comparison and prediction of ssDNA-binding sites. (a) Superposition of RPA-D (cyan) of with Pot1 (magenta). Alpha carbons from residue ranges of RPA2 residues, 130–142, 74–83, and 101–107 were superimposed with Pot1 (OB-1), 84–96, 23–32, and 56–62, respectively, with an RMSD of 0.8 Å. Pot1 residues 6–145 and RPA residues 43–171 are indicated as ribbons. DNA bases 1-6 (5′-TTAGGG-3′) from the Pot1 crystal structure are shown in green. (b) Superposition of Stn1 (yellow) with Pot1 (magenta). Alpha carbons from residue ranges 152–155, 122–127, 110–115, and 87–94 of Stn1 were aligned with residues 84–89, 56–61, 45–50, and 25–32 of Pot1, respectively, with an RMSD of 1.9 Å. Aromatic residues involved in stacking interactions from all proteins are shown as sticks. The superpositions of PDB entries 1XJV, 1QUQ, and 3KF8 were performed using ccp4i (LSQMK) [ 11 ] and displayed with Pymol ( http://pymol.sourceforge.net/ ).
    Figure Legend Snippet: Comparison and prediction of ssDNA-binding sites. (a) Superposition of RPA-D (cyan) of with Pot1 (magenta). Alpha carbons from residue ranges of RPA2 residues, 130–142, 74–83, and 101–107 were superimposed with Pot1 (OB-1), 84–96, 23–32, and 56–62, respectively, with an RMSD of 0.8 Å. Pot1 residues 6–145 and RPA residues 43–171 are indicated as ribbons. DNA bases 1-6 (5′-TTAGGG-3′) from the Pot1 crystal structure are shown in green. (b) Superposition of Stn1 (yellow) with Pot1 (magenta). Alpha carbons from residue ranges 152–155, 122–127, 110–115, and 87–94 of Stn1 were aligned with residues 84–89, 56–61, 45–50, and 25–32 of Pot1, respectively, with an RMSD of 1.9 Å. Aromatic residues involved in stacking interactions from all proteins are shown as sticks. The superpositions of PDB entries 1XJV, 1QUQ, and 3KF8 were performed using ccp4i (LSQMK) [ 11 ] and displayed with Pymol ( http://pymol.sourceforge.net/ ).

    Techniques Used: Binding Assay, Recombinase Polymerase Amplification

    17) Product Images from "Structural Basis for Catalysis by Onconase"

    Article Title: Structural Basis for Catalysis by Onconase

    Journal:

    doi: 10.1016/j.jmb.2007.09.089

    pH– k cat / K M profile for the cleavage of 6-FAM–dArUdGdA–6-TAMRA by ONC. Assays were performed at 23 °C in 1.0 mM buffer containing NaCl (1.0 M). Determination of k cat / K M values was performed in triplicate. Data were fitted
    Figure Legend Snippet: pH– k cat / K M profile for the cleavage of 6-FAM–dArUdGdA–6-TAMRA by ONC. Assays were performed at 23 °C in 1.0 mM buffer containing NaCl (1.0 M). Determination of k cat / K M values was performed in triplicate. Data were fitted

    Techniques Used:

    Effect of Thr89 and Glu91 on the substrate specificity of ONC. Bars indicate the effect of replacing Thr89 or Glu91 on the value of k cat / K M for the cleavage of 6-FAM–dArUdGdA–6-TAMRA (UpG) and 6-FAM–dArUdAdA–6-TAMRA (UpA).
    Figure Legend Snippet: Effect of Thr89 and Glu91 on the substrate specificity of ONC. Bars indicate the effect of replacing Thr89 or Glu91 on the value of k cat / K M for the cleavage of 6-FAM–dArUdGdA–6-TAMRA (UpG) and 6-FAM–dArUdAdA–6-TAMRA (UpA).

    Techniques Used:

    18) Product Images from "The crystal structure of Staufen1 in complex with a physiological RNA sheds light on substrate selectivity"

    Article Title: The crystal structure of Staufen1 in complex with a physiological RNA sheds light on substrate selectivity

    Journal: Life Science Alliance

    doi: 10.26508/lsa.201800187

    dsRBDs 3 and 4 of hStau1 are sufficient for ARF1 SBS binding. (A) Schematic representation of the domain architecture of human (h) and Drosophila (d) Stau. Lines indicate regions predicted to be unstructured; boxes represent folded domains. The insertion in dsRBD2 is indicated by thinning of the box. Percentage identity between each dsRBD of dStau compared with hStau1 or hStau2 is indicated. (B) Secondary structure representation of the central part of bcd 3ʹUTR (as in Brunel Ehresmann [2004] ). The distal regions of stem-loops III, IV, and V, required for dStau binding, are highlighted in red. Loops within region III that mediate bcd mRNA homo-dimerization are indicated by gray arrows. (C) Predicted secondary structure of ARF1 3ʹUTR (as in Kim et al [2007] ). The 19 bp stem structure required for hStau1 binding (SBS, Stau-Binding Site) is highlighted in red; its sequence is shown on the right. (D, E) K d values determined by FA, using 5ʹ-fluorescein-labeled ARF1 SBS, either single (sense strand) or double stranded, and the recombinantly purified hStau1 constructs indicated in the schematics. The graphs show mean K d (bars), standard deviation (black lines), and K d values obtained in each independent experiment (black dots). Mean K d ± SD, in nM, and number of independent measurements (n) are indicated on the right. AS, antisense strand; S, sense strand; SSM, Stau-swapping motif; TBD, tubulin-binding domain.
    Figure Legend Snippet: dsRBDs 3 and 4 of hStau1 are sufficient for ARF1 SBS binding. (A) Schematic representation of the domain architecture of human (h) and Drosophila (d) Stau. Lines indicate regions predicted to be unstructured; boxes represent folded domains. The insertion in dsRBD2 is indicated by thinning of the box. Percentage identity between each dsRBD of dStau compared with hStau1 or hStau2 is indicated. (B) Secondary structure representation of the central part of bcd 3ʹUTR (as in Brunel Ehresmann [2004] ). The distal regions of stem-loops III, IV, and V, required for dStau binding, are highlighted in red. Loops within region III that mediate bcd mRNA homo-dimerization are indicated by gray arrows. (C) Predicted secondary structure of ARF1 3ʹUTR (as in Kim et al [2007] ). The 19 bp stem structure required for hStau1 binding (SBS, Stau-Binding Site) is highlighted in red; its sequence is shown on the right. (D, E) K d values determined by FA, using 5ʹ-fluorescein-labeled ARF1 SBS, either single (sense strand) or double stranded, and the recombinantly purified hStau1 constructs indicated in the schematics. The graphs show mean K d (bars), standard deviation (black lines), and K d values obtained in each independent experiment (black dots). Mean K d ± SD, in nM, and number of independent measurements (n) are indicated on the right. AS, antisense strand; S, sense strand; SSM, Stau-swapping motif; TBD, tubulin-binding domain.

    Techniques Used: Binding Assay, Sequencing, Labeling, Purification, Construct, Standard Deviation

    Residues in dsRBDs 3 and 4 make base-directed contacts with ARF1 SBS. (A) Schematic representation of ARF1 SBS. Dotted lines indicate contacts between residues in hStau1 dsRBD3 A (dark blue), dsRBD3 B (blue), or dsRBD4 (cyan), and the RNA. Red dots mark residues interacting with the RNA bases (colored in the scheme). (B–E) Detailed views of the base-directed interactions, with hydrogen bonds indicated as dotted lines. The view is down the RNA helix axis. Nucleotides of the ARF1 SBS sense and antisense strand are in black and gray, respectively. (F) K d values determined by FA using 5ʹ-fluorescein-labeled ARF1 SBS, either single or double stranded, or a dsRNA of the same length and of a random AU sequence (dsAU).
    Figure Legend Snippet: Residues in dsRBDs 3 and 4 make base-directed contacts with ARF1 SBS. (A) Schematic representation of ARF1 SBS. Dotted lines indicate contacts between residues in hStau1 dsRBD3 A (dark blue), dsRBD3 B (blue), or dsRBD4 (cyan), and the RNA. Red dots mark residues interacting with the RNA bases (colored in the scheme). (B–E) Detailed views of the base-directed interactions, with hydrogen bonds indicated as dotted lines. The view is down the RNA helix axis. Nucleotides of the ARF1 SBS sense and antisense strand are in black and gray, respectively. (F) K d values determined by FA using 5ʹ-fluorescein-labeled ARF1 SBS, either single or double stranded, or a dsRNA of the same length and of a random AU sequence (dsAU).

    Techniques Used: Labeling, Sequencing

    Quality of the electron density of ARF1 apo structure. Stereo view of the electron density of the 2Fo-DFc maps after refinement, contoured at 1σ. ARF1 SBS sense strand is black, the antisense strand gray (related to Fig 3 ).
    Figure Legend Snippet: Quality of the electron density of ARF1 apo structure. Stereo view of the electron density of the 2Fo-DFc maps after refinement, contoured at 1σ. ARF1 SBS sense strand is black, the antisense strand gray (related to Fig 3 ).

    Techniques Used:

    19) Product Images from "Intercellular transmission of the unfolded protein response promotes survival and drug resistance in cancer cells"

    Article Title: Intercellular transmission of the unfolded protein response promotes survival and drug resistance in cancer cells

    Journal: Science signaling

    doi: 10.1126/scisignal.aah7177

    Prostate cancer cells undergoing ER stress can transmit an ER stress response to recipient cells ( A ) Expression of the indicated mRNA (by RT-qPCR) in PC3 cells cultured for 1, 3, or 5 days in Veh CM or TERS CM ( n = 2 per condition). Gene expression was normalized to Veh CM day 1. RQ, relative quantification. Inset shows gel banding for unspliced ( XBP-1u ) and spliced ( XBP-1s ) XBP-1 . ( B ) Western blot analysis for GRP78 abundance in whole-cell lysates from PC3 cells cultured as described in (A). V, Veh CM; T, TERS CM. ( C ) RT-qPCR in DU145 cells as described in (A) treated with PC3 generated Veh CM or TERS CM ( n = 2 per condition). Gene expression was normalized to Veh CM day 1 condition to determine relative quantification. ( D ) RT-qPCR analysis for IL-6 expression in PC3 cells cultured with Veh CM or TERS CM as described in (A). Values are normalized to Veh CM day 1 ( n = 2 per condition). ( E ) Confocal microscopy for GRP78 in Veh CM– or TERS CM–treated PC3 cells for 48 hours. Scale bars, 25 µm. ( F ) Flow cytometry analysis of surface abundance of GRP78 (sGRP78) in Veh CM– or TERS CM–cultured, unpermeabilized PC3 cells. Data are means ± SEM; * P
    Figure Legend Snippet: Prostate cancer cells undergoing ER stress can transmit an ER stress response to recipient cells ( A ) Expression of the indicated mRNA (by RT-qPCR) in PC3 cells cultured for 1, 3, or 5 days in Veh CM or TERS CM ( n = 2 per condition). Gene expression was normalized to Veh CM day 1. RQ, relative quantification. Inset shows gel banding for unspliced ( XBP-1u ) and spliced ( XBP-1s ) XBP-1 . ( B ) Western blot analysis for GRP78 abundance in whole-cell lysates from PC3 cells cultured as described in (A). V, Veh CM; T, TERS CM. ( C ) RT-qPCR in DU145 cells as described in (A) treated with PC3 generated Veh CM or TERS CM ( n = 2 per condition). Gene expression was normalized to Veh CM day 1 condition to determine relative quantification. ( D ) RT-qPCR analysis for IL-6 expression in PC3 cells cultured with Veh CM or TERS CM as described in (A). Values are normalized to Veh CM day 1 ( n = 2 per condition). ( E ) Confocal microscopy for GRP78 in Veh CM– or TERS CM–treated PC3 cells for 48 hours. Scale bars, 25 µm. ( F ) Flow cytometry analysis of surface abundance of GRP78 (sGRP78) in Veh CM– or TERS CM–cultured, unpermeabilized PC3 cells. Data are means ± SEM; * P

    Techniques Used: Expressing, Quantitative RT-PCR, Cell Culture, Western Blot, Generated, Confocal Microscopy, Flow Cytometry, Cytometry

    20) Product Images from "The intrinsic structure of poly(A) RNA determines the specificity of Pan2 and Caf1 deadenylases"

    Article Title: The intrinsic structure of poly(A) RNA determines the specificity of Pan2 and Caf1 deadenylases

    Journal: Nature structural & molecular biology

    doi: 10.1038/s41594-019-0227-9

    Ccr4–Not is inhibited by 3′ guanosines. a , Denaturing RNA gels showing deadenylation by recombinant S. pombe Ccr4–Not on 5′ 6-FAM-labeled (green star) RNA substrates consisting of a 20mer non-poly(A) sequence (See Fig. 1a ) followed by 30 adenosines. Where indicated, the substrate contains three additional non-A nucleotides at the 3′ end. These gels are representative of identical experiments performed 3 times. Uncropped gel images are shown in Supplementary Data Set 1. b-d , Analysis of deadenylation on poly(A) substrates with different 3′ nucleotides. Disappearance of the intact substrate was quantified by densitometry of the fluorescently labeled, full-length RNA. Data points were normalized to time = 0, and are connected by straight lines for clarity. Assays were carried out in triplicate (n = 3 independent experiments), the data points shown represent the mean, and error bars represent standard deviation. Assays are shown for wild-type S. pombe Ccr4–Not ( b ), Ccr4-inactive Ccr4–Not ( c ) and Caf1-inactive Ccr4–Not ( d ).
    Figure Legend Snippet: Ccr4–Not is inhibited by 3′ guanosines. a , Denaturing RNA gels showing deadenylation by recombinant S. pombe Ccr4–Not on 5′ 6-FAM-labeled (green star) RNA substrates consisting of a 20mer non-poly(A) sequence (See Fig. 1a ) followed by 30 adenosines. Where indicated, the substrate contains three additional non-A nucleotides at the 3′ end. These gels are representative of identical experiments performed 3 times. Uncropped gel images are shown in Supplementary Data Set 1. b-d , Analysis of deadenylation on poly(A) substrates with different 3′ nucleotides. Disappearance of the intact substrate was quantified by densitometry of the fluorescently labeled, full-length RNA. Data points were normalized to time = 0, and are connected by straight lines for clarity. Assays were carried out in triplicate (n = 3 independent experiments), the data points shown represent the mean, and error bars represent standard deviation. Assays are shown for wild-type S. pombe Ccr4–Not ( b ), Ccr4-inactive Ccr4–Not ( c ) and Caf1-inactive Ccr4–Not ( d ).

    Techniques Used: Recombinant, Labeling, Sequencing, Standard Deviation

    Nucleotide base stacking is required for Pan2 and Caf1 deadenylase activity. Denaturing RNA gels showing deadenylation by ( a-d ) S. cerevisiae Pan2 UCH-Exo or ( e-h ) S. pombe Ccr4-inactive Ccr4–Not on 5′ 6-FAM-labeled (green star) RNAs consisting of a 20mer non-poly(A) sequence (see Fig. 1a ) followed by the indicated tail sequence. RNAs either had no additional nucleotides ( a , e ), two guanosines ( b , f ), two uracils ( c, g ), or two dihydrouracils (abbreviated D, panels d , h ) in the middle of the poly(A) tail. Red asterisks indicate the point of inhibition. Both Pan2 and Caf1 were strongly inhibited by guanosines and dihydrouracils interrupting a poly(A) tail. These gels are representative of identical experiments performed 2 times. Uncropped gel images are shown in Supplementary Data Set 1.
    Figure Legend Snippet: Nucleotide base stacking is required for Pan2 and Caf1 deadenylase activity. Denaturing RNA gels showing deadenylation by ( a-d ) S. cerevisiae Pan2 UCH-Exo or ( e-h ) S. pombe Ccr4-inactive Ccr4–Not on 5′ 6-FAM-labeled (green star) RNAs consisting of a 20mer non-poly(A) sequence (see Fig. 1a ) followed by the indicated tail sequence. RNAs either had no additional nucleotides ( a , e ), two guanosines ( b , f ), two uracils ( c, g ), or two dihydrouracils (abbreviated D, panels d , h ) in the middle of the poly(A) tail. Red asterisks indicate the point of inhibition. Both Pan2 and Caf1 were strongly inhibited by guanosines and dihydrouracils interrupting a poly(A) tail. These gels are representative of identical experiments performed 2 times. Uncropped gel images are shown in Supplementary Data Set 1.

    Techniques Used: Activity Assay, Labeling, Sequencing, Inhibition

    3′ guanosines inhibit the Pan2 exonuclease. a, Denaturing RNA gels showing deadenylation by recombinant S. cerevisiae Pan2–Pan3 on 5′ 6-FAM-labeled (green star) RNA substrates consisting of a 20mer non-poly(A) sequence (shown above) followed by a poly(A) tail of 30 adenosines. Where indicated, the substrate contains three additional non-A nucleotides at the 3′ end. These gels are representative of identical experiments performed 3 times. Uncropped gel images are shown in Supplementary Data Set 1. b-e, Analysis of deadenylation on poly(A) substrates with different 3′ nucleotides. Disappearance of the intact substrate was quantified by densitometry of the fluorescently labeled, full-length RNA. Data points were normalized to time = 0, and are connected by straight lines for clarity. Assays were carried out in triplicate (n = 3 independent experiments), the data points shown represent the mean, and error bars represent standard deviation. Assays are shown for full-length S. cerevisiae Pan2–Pan3 ( b, e ); H. sapiens PAN2–PAN3∆N278 ( c ); and S. cerevisiae Pan2 UCH-Exo (residues 461-1115) ( d ).
    Figure Legend Snippet: 3′ guanosines inhibit the Pan2 exonuclease. a, Denaturing RNA gels showing deadenylation by recombinant S. cerevisiae Pan2–Pan3 on 5′ 6-FAM-labeled (green star) RNA substrates consisting of a 20mer non-poly(A) sequence (shown above) followed by a poly(A) tail of 30 adenosines. Where indicated, the substrate contains three additional non-A nucleotides at the 3′ end. These gels are representative of identical experiments performed 3 times. Uncropped gel images are shown in Supplementary Data Set 1. b-e, Analysis of deadenylation on poly(A) substrates with different 3′ nucleotides. Disappearance of the intact substrate was quantified by densitometry of the fluorescently labeled, full-length RNA. Data points were normalized to time = 0, and are connected by straight lines for clarity. Assays were carried out in triplicate (n = 3 independent experiments), the data points shown represent the mean, and error bars represent standard deviation. Assays are shown for full-length S. cerevisiae Pan2–Pan3 ( b, e ); H. sapiens PAN2–PAN3∆N278 ( c ); and S. cerevisiae Pan2 UCH-Exo (residues 461-1115) ( d ).

    Techniques Used: Recombinant, Labeling, Sequencing, Standard Deviation

    21) Product Images from "Translational Physiology: Mixed lineage kinase-3 prevents cardiac dysfunction and structural remodeling with pressure overload"

    Article Title: Translational Physiology: Mixed lineage kinase-3 prevents cardiac dysfunction and structural remodeling with pressure overload

    Journal: American Journal of Physiology - Heart and Circulatory Physiology

    doi: 10.1152/ajpheart.00029.2018

    Mixed lineage kinase-3-deficient (MLK3 −/− ) mice develop increased pathological left ventricular (LV) hypertrophy after pressure overload. Wild-type (MLK3 +/+ ) and MLK3 −/− mice subjected to sham or 25-gauge transverse aortic constriction (TAC) surgery for 4 wk were evaluated for LV mass normalized to tibia length ( n = 5–11 per group). A : RNA expression of Nppa ( B ) and Nppb ( C ) were evaluated by quantitative PCR in LV tissues ( n = 5–10 per group). D : LV tissue sections were stained with wheat germ agglutinin and counterstained with DAPI. Cardiomyocyte area was quantified in the transverse plane ( n = 5–10 mice per group, 50 myocytes per mouse). Scale bars, 100 pixels in each image. Data were analyzed by two-way ANOVA. *** P
    Figure Legend Snippet: Mixed lineage kinase-3-deficient (MLK3 −/− ) mice develop increased pathological left ventricular (LV) hypertrophy after pressure overload. Wild-type (MLK3 +/+ ) and MLK3 −/− mice subjected to sham or 25-gauge transverse aortic constriction (TAC) surgery for 4 wk were evaluated for LV mass normalized to tibia length ( n = 5–11 per group). A : RNA expression of Nppa ( B ) and Nppb ( C ) were evaluated by quantitative PCR in LV tissues ( n = 5–10 per group). D : LV tissue sections were stained with wheat germ agglutinin and counterstained with DAPI. Cardiomyocyte area was quantified in the transverse plane ( n = 5–10 mice per group, 50 myocytes per mouse). Scale bars, 100 pixels in each image. Data were analyzed by two-way ANOVA. *** P

    Techniques Used: Mouse Assay, RNA Expression, Real-time Polymerase Chain Reaction, Staining

    Administration of mixed lineage kinase-3 (MLK3) inhibitor selectively impairs c-Jun NH 2 kinase (JNK) phosphorylation and promotes hypertrophy in cardiomyocytes. A : adult rat ventricular cardiomyocytes (ARVMs) were pretreated with vehicle (DMSO) or MLK3 kinase inhibitor URMC-099 (1 μM) for 60 min before stimulation with vehicle (H 2 O, labeled V), norepinephrine (NE, 1 μM, 20 min), phenylephrine (PE, 20 µM, 20 min), or hydrogen peroxide (H 2 O 2 , 100 µM, 60 min). Levels of phosphorylated (P-) and total forms of JNK, extracellular signal-regulated kinase (ERK), and p38 were evaluated by Western blotting. Representative blots are shown of n = 3–4 separate experiments. Densitometry of phosphorylated/total JNK is also shown. B : ARVMs were pretreated with DMSO vehicle (V) or URMC-099 (10 nM, 100 nM, or 1 μM) for 60 min. JNK phosphorylation was quantified and expressed relative to total JNK ( n = 4, 54 kDa). C : ARVMs were treated with vehicle (DMSO), URMC-099 (100 nM), or DMSO + PE (20 μM) for 48 h. Cells were then fixed and stained with phalloidin and DAPI. Cardiomyocyte (CM) size was quantified and expressed as fold change relative to vehicle-treated cells ( n = 4). For these experiments, each replicate represents an independent experiment from separate CM preparations; All data were analyzed by one-way ANOVA with Bonferroni’s posttest. D : proposed model of antiremodeling MLK3-MAP kinase kinase-4 (MKK4)/MKK7-JNK signaling cascade in the CM.
    Figure Legend Snippet: Administration of mixed lineage kinase-3 (MLK3) inhibitor selectively impairs c-Jun NH 2 kinase (JNK) phosphorylation and promotes hypertrophy in cardiomyocytes. A : adult rat ventricular cardiomyocytes (ARVMs) were pretreated with vehicle (DMSO) or MLK3 kinase inhibitor URMC-099 (1 μM) for 60 min before stimulation with vehicle (H 2 O, labeled V), norepinephrine (NE, 1 μM, 20 min), phenylephrine (PE, 20 µM, 20 min), or hydrogen peroxide (H 2 O 2 , 100 µM, 60 min). Levels of phosphorylated (P-) and total forms of JNK, extracellular signal-regulated kinase (ERK), and p38 were evaluated by Western blotting. Representative blots are shown of n = 3–4 separate experiments. Densitometry of phosphorylated/total JNK is also shown. B : ARVMs were pretreated with DMSO vehicle (V) or URMC-099 (10 nM, 100 nM, or 1 μM) for 60 min. JNK phosphorylation was quantified and expressed relative to total JNK ( n = 4, 54 kDa). C : ARVMs were treated with vehicle (DMSO), URMC-099 (100 nM), or DMSO + PE (20 μM) for 48 h. Cells were then fixed and stained with phalloidin and DAPI. Cardiomyocyte (CM) size was quantified and expressed as fold change relative to vehicle-treated cells ( n = 4). For these experiments, each replicate represents an independent experiment from separate CM preparations; All data were analyzed by one-way ANOVA with Bonferroni’s posttest. D : proposed model of antiremodeling MLK3-MAP kinase kinase-4 (MKK4)/MKK7-JNK signaling cascade in the CM.

    Techniques Used: Labeling, Western Blot, Staining

    22) Product Images from "The La protein counteracts cisplatin-induced cell death by stimulating protein synthesis of anti-apoptotic factor Bcl2"

    Article Title: The La protein counteracts cisplatin-induced cell death by stimulating protein synthesis of anti-apoptotic factor Bcl2

    Journal: Oncotarget

    doi: 10.18632/oncotarget.8819

    The RNA chaperone La assists structural changes of the Bcl2 translation start site in vitro A. The RNA chaperone domain (RCD) of La is mutated in LaΔRCD [ 21 ). RNA-binding motifs: LAM, RRM1, and RRM2. Scheme representing the RNA chaperone assay and the predicted structure of the Bcl2 RNA used as molecular beacon (Bcl2-MB). B. Differences in RNA chaperone activity given in relative fluorescence units (arbitrary units = AU) in the presence of 300 nM La wildtype protein (LaWT) compared to the molecular beacon (Bcl2-MB) alone or in presence of 300 nM recombinant La protein with mutated RNA chaperone domain (LaΔRCD). P value
    Figure Legend Snippet: The RNA chaperone La assists structural changes of the Bcl2 translation start site in vitro A. The RNA chaperone domain (RCD) of La is mutated in LaΔRCD [ 21 ). RNA-binding motifs: LAM, RRM1, and RRM2. Scheme representing the RNA chaperone assay and the predicted structure of the Bcl2 RNA used as molecular beacon (Bcl2-MB). B. Differences in RNA chaperone activity given in relative fluorescence units (arbitrary units = AU) in the presence of 300 nM La wildtype protein (LaWT) compared to the molecular beacon (Bcl2-MB) alone or in presence of 300 nM recombinant La protein with mutated RNA chaperone domain (LaΔRCD). P value

    Techniques Used: In Vitro, RNA Binding Assay, Laser Capture Microdissection, Activity Assay, Fluorescence, Recombinant

    Bcl2 protein expression is reduced by siRNA-mediated La depletion or transient expression of La dominant negative (LaDN) mutant in cells A. Scheme of LaDN mutant compared to La wildtype containing three RNA-binding motifs: LAM, RRM1, and RRM2. B. Fluorescence microscopic image of gfp or LaDN mutant expression in living SCC 22B cells. La depletion in SCC 22B cells by C-E. transient expression of La dominant negative (LaDN) mutant or F-H. La-specific siRNA (La siRNA), results in increased cisplatin-induced apoptosis (Annexin/PI-positive cells) after cisplatin treatment with 24 μM for 24 hours, reduced Bcl2 protein expression (GAPDH = loading control), and unchanged Bcl2 mRNA level as determined by RT-qPCR analysis and normalized to GAPDH mRNA. Con = control siRNA. P value
    Figure Legend Snippet: Bcl2 protein expression is reduced by siRNA-mediated La depletion or transient expression of La dominant negative (LaDN) mutant in cells A. Scheme of LaDN mutant compared to La wildtype containing three RNA-binding motifs: LAM, RRM1, and RRM2. B. Fluorescence microscopic image of gfp or LaDN mutant expression in living SCC 22B cells. La depletion in SCC 22B cells by C-E. transient expression of La dominant negative (LaDN) mutant or F-H. La-specific siRNA (La siRNA), results in increased cisplatin-induced apoptosis (Annexin/PI-positive cells) after cisplatin treatment with 24 μM for 24 hours, reduced Bcl2 protein expression (GAPDH = loading control), and unchanged Bcl2 mRNA level as determined by RT-qPCR analysis and normalized to GAPDH mRNA. Con = control siRNA. P value

    Techniques Used: Expressing, Dominant Negative Mutation, Mutagenesis, RNA Binding Assay, Laser Capture Microdissection, Fluorescence, Quantitative RT-PCR

    The La protein binds to a region of Bcl2 mRNA embedding the authentic translation start site A. Upper panel: RNA immuoprecipitation (RIP) applying a La-specific antibody followed by Bcl2-specific RT-PCR in three different cell lines (immunoblot (IB)). Lower panel: RIP followed by RT-qPCR analysis was performed in triplicates on RNA extracted from RIP pellets. Cell extracts for RIP experiments were prepared from HEK 293 cells stably transfected with gfp alone (control) or gfp-tagged La. None of the target mRNAs analyzed were detected in cells expressing gfp alone. Relative enrichment of target mRNA compared to GAPDH mRNA was calculated (n = 3). B. Scheme of Bcl2 RNA probes (FL, P1, P2) applied for RNA pull-down assays, and La-specific immunoblot (IB) following Bcl2 RNA pull down from SCC 22A and SCC 22B cell lysates. Data shown are representative of three independent experiments (n = 3). No RNA probe was added in the control (C). C. Binding affinity of La:Bcl2 RNA oligonucleotide interaction as determined by electrophoretic mobility shift assay (EMSA). The 5′FAM-labeled Bcl2 RNA oligonucleotide (25 nM) was incubated with increasing amounts of recombinant La protein in a range from 0 to 600 nM and separated by a native EMSA. D. The La:RNA complex formation is plotted against the La protein concentration. The dissociation constant (K D ) was determined as 50.5+/−5.9 nM (n = 3) in Prism 5 (GraphPad Software). E. Competitive fluorescence polarization assay using 5′FAM-labeled Bcl2 RNA oligonucleotides and different unlabeled competitor RNA oligonucleotides at 4-, 10-, 40-, or 80-fold excess. P value
    Figure Legend Snippet: The La protein binds to a region of Bcl2 mRNA embedding the authentic translation start site A. Upper panel: RNA immuoprecipitation (RIP) applying a La-specific antibody followed by Bcl2-specific RT-PCR in three different cell lines (immunoblot (IB)). Lower panel: RIP followed by RT-qPCR analysis was performed in triplicates on RNA extracted from RIP pellets. Cell extracts for RIP experiments were prepared from HEK 293 cells stably transfected with gfp alone (control) or gfp-tagged La. None of the target mRNAs analyzed were detected in cells expressing gfp alone. Relative enrichment of target mRNA compared to GAPDH mRNA was calculated (n = 3). B. Scheme of Bcl2 RNA probes (FL, P1, P2) applied for RNA pull-down assays, and La-specific immunoblot (IB) following Bcl2 RNA pull down from SCC 22A and SCC 22B cell lysates. Data shown are representative of three independent experiments (n = 3). No RNA probe was added in the control (C). C. Binding affinity of La:Bcl2 RNA oligonucleotide interaction as determined by electrophoretic mobility shift assay (EMSA). The 5′FAM-labeled Bcl2 RNA oligonucleotide (25 nM) was incubated with increasing amounts of recombinant La protein in a range from 0 to 600 nM and separated by a native EMSA. D. The La:RNA complex formation is plotted against the La protein concentration. The dissociation constant (K D ) was determined as 50.5+/−5.9 nM (n = 3) in Prism 5 (GraphPad Software). E. Competitive fluorescence polarization assay using 5′FAM-labeled Bcl2 RNA oligonucleotides and different unlabeled competitor RNA oligonucleotides at 4-, 10-, 40-, or 80-fold excess. P value

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR, Stable Transfection, Transfection, Expressing, Binding Assay, Electrophoretic Mobility Shift Assay, Labeling, Incubation, Recombinant, Protein Concentration, Software, Fluorescence

    23) Product Images from "Multidomain architecture of estrogen receptor reveals interfacial cross-talk between its DNA-binding and ligand-binding domains"

    Article Title: Multidomain architecture of estrogen receptor reveals interfacial cross-talk between its DNA-binding and ligand-binding domains

    Journal: Nature Communications

    doi: 10.1038/s41467-018-06034-2

    Overall architecture of the hERα homodimer revealed by data integration. a Fitting against experimental data. The fit of computationally generated conformations (dot) is simultaneously assessed against hydroxyl radical protein footprinting ( φ 2 ) and small-angle X-ray scattering ( χ 2 ). Lower χ 2 and φ 2 values are better in fitting. The best-fit ensemble structures lie at the bottom corner of the fit plot, below the red dashed line. b Ensemble of best-fit hERα structures. It contains both LBD monomers (light/dark green) and DBD monomers (light/dark blue). The C-terminal helix H12 of the LBD is in red, and ERE–DNA is in gray. The LBD–DBD connecting loops are shown as light green ribbons. The structure models (within the red circle) are within 3 Å Cα-RMSD of the best-fit structure. c A rotated view of the best-fit hERα structures. d Goodness of fit to measured SAXS data. Theoretical SAXS data were the ensemble average of the set of hERα structures above. The scattering intensity, log 10 I ( q ), is plotted as a function of the scattering angle ( q ). The goodness of fit χ 2 = 1.2. Inserted is the Guinier plot with a linear fit, yielding the radius of gyration R g = 38.0 ± 0.3 Å. The bottom graph shows residuals from subtraction between calculated and experimental profiles. A total of six scattering images were used and standard deviations were indicated. e Goodness of fit to footprinting data. Measured footprinting protection factors (logPF) are plotted against average accessible surface areas (SA) derived from the ensemble structures. Linear correlation coefficient is ρ = −0.95. A total of seven structures were used for ensemble calculations and standard deviations were indicated
    Figure Legend Snippet: Overall architecture of the hERα homodimer revealed by data integration. a Fitting against experimental data. The fit of computationally generated conformations (dot) is simultaneously assessed against hydroxyl radical protein footprinting ( φ 2 ) and small-angle X-ray scattering ( χ 2 ). Lower χ 2 and φ 2 values are better in fitting. The best-fit ensemble structures lie at the bottom corner of the fit plot, below the red dashed line. b Ensemble of best-fit hERα structures. It contains both LBD monomers (light/dark green) and DBD monomers (light/dark blue). The C-terminal helix H12 of the LBD is in red, and ERE–DNA is in gray. The LBD–DBD connecting loops are shown as light green ribbons. The structure models (within the red circle) are within 3 Å Cα-RMSD of the best-fit structure. c A rotated view of the best-fit hERα structures. d Goodness of fit to measured SAXS data. Theoretical SAXS data were the ensemble average of the set of hERα structures above. The scattering intensity, log 10 I ( q ), is plotted as a function of the scattering angle ( q ). The goodness of fit χ 2 = 1.2. Inserted is the Guinier plot with a linear fit, yielding the radius of gyration R g = 38.0 ± 0.3 Å. The bottom graph shows residuals from subtraction between calculated and experimental profiles. A total of six scattering images were used and standard deviations were indicated. e Goodness of fit to footprinting data. Measured footprinting protection factors (logPF) are plotted against average accessible surface areas (SA) derived from the ensemble structures. Linear correlation coefficient is ρ = −0.95. A total of seven structures were used for ensemble calculations and standard deviations were indicated

    Techniques Used: Generated, Protein Footprinting, Footprinting, Derivative Assay

    Contact residues between the DBD and LBD identified by footprinting. a Structural domains of hERα. Human ERα contains a DNA-binding domain (DBD; blue), a ligand-binding domain (LBD; green), and functions as a homodimer. b , c The crystal structures of DBD dimer ( b light/dark blue) in complex with ERE–DNA (gray) (1HCQ.pdb), and of LBD dimer ( c light/dark green) in complex with estradiol and a coactivator TIF2 peptide (1GWR.pdb). The C-terminal helix H12 of the LBD is highlighted (red). d Hydroxyl radical footprinting of hERα. High logPF values of six residues (red asterisks) indicate their involvement in domain contacts. Duplicates were performed and standard deviations were indicated. e Solvent accessibility surface area (SA) values of residue side chains calculated from the crystal structure of individual domains. f Correlation between logPF and SA values. Differentiation of the six contact residues (red dots) is shown from the rest of 14 residues (black dots). The latter have a Pearson’s correlation coefficient −0.77 ( p -value = 0.001). g , h Structural mapping of contact residues. Contact residues (red) are Y191/Y195/W200 on the surface of the DBD (blue blobs) and I326/W393/L409 on the LBD (green blobs)
    Figure Legend Snippet: Contact residues between the DBD and LBD identified by footprinting. a Structural domains of hERα. Human ERα contains a DNA-binding domain (DBD; blue), a ligand-binding domain (LBD; green), and functions as a homodimer. b , c The crystal structures of DBD dimer ( b light/dark blue) in complex with ERE–DNA (gray) (1HCQ.pdb), and of LBD dimer ( c light/dark green) in complex with estradiol and a coactivator TIF2 peptide (1GWR.pdb). The C-terminal helix H12 of the LBD is highlighted (red). d Hydroxyl radical footprinting of hERα. High logPF values of six residues (red asterisks) indicate their involvement in domain contacts. Duplicates were performed and standard deviations were indicated. e Solvent accessibility surface area (SA) values of residue side chains calculated from the crystal structure of individual domains. f Correlation between logPF and SA values. Differentiation of the six contact residues (red dots) is shown from the rest of 14 residues (black dots). The latter have a Pearson’s correlation coefficient −0.77 ( p -value = 0.001). g , h Structural mapping of contact residues. Contact residues (red) are Y191/Y195/W200 on the surface of the DBD (blue blobs) and I326/W393/L409 on the LBD (green blobs)

    Techniques Used: Footprinting, Binding Assay, Ligand Binding Assay

    24) Product Images from "Mutant Amyloid Precursor Protein Differentially Alters Adipose Biology under Obesogenic and Non-Obesogenic Conditions"

    Article Title: Mutant Amyloid Precursor Protein Differentially Alters Adipose Biology under Obesogenic and Non-Obesogenic Conditions

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0043193

    Adipokine mRNA in adipose depots. Both fat depots revealed an increase in leptin for mice fed the HF diet ( Figure 6A and B ). A significant increase in leptin was determined for CAA-HF mice compared to C-CD and CAA-CD in visceral fat. CAA-CD mice had less leptin expression in both fat pads compared to all other groups. C-HF mice had significantly less resistin expression in visceral fat compared to CAA-CD (p = 0.039; Figure 6D ), CAA-CD mice had significantly less adiponectin expression compared to C-CD and C-HF mice in subcutaneous fat (p = 0.005 and p = 0.014, respectively; Figure 6E ), and C-HF mice had significantly less adiponectin expression in visceral fat compared to C-CD (p = 0.020; Figure 6F ).
    Figure Legend Snippet: Adipokine mRNA in adipose depots. Both fat depots revealed an increase in leptin for mice fed the HF diet ( Figure 6A and B ). A significant increase in leptin was determined for CAA-HF mice compared to C-CD and CAA-CD in visceral fat. CAA-CD mice had less leptin expression in both fat pads compared to all other groups. C-HF mice had significantly less resistin expression in visceral fat compared to CAA-CD (p = 0.039; Figure 6D ), CAA-CD mice had significantly less adiponectin expression compared to C-CD and C-HF mice in subcutaneous fat (p = 0.005 and p = 0.014, respectively; Figure 6E ), and C-HF mice had significantly less adiponectin expression in visceral fat compared to C-CD (p = 0.020; Figure 6F ).

    Techniques Used: Mouse Assay, Cellular Antioxidant Activity Assay, Expressing

    25) Product Images from "Computational identification and validation of alternative splicing in ZSF1 rat RNA-seq data, a preclinical model for type 2 diabetic nephropathy"

    Article Title: Computational identification and validation of alternative splicing in ZSF1 rat RNA-seq data, a preclinical model for type 2 diabetic nephropathy

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-26035-x

    Differential splicing of Il-33 . ( A ) Gene structure (top left) and the skipped exon event at the 3′ end of Il-33 (bottom left). The gene-level TPM values and the corresponding read counts supporting exon inclusion and exclusion are shown on the right. ( B ) Expression values obtained by qRT-PCR. The expression values are 2 ΔCt normalized to the housekeeping gene Gusb. All the error bars indicate the 95% confidence intervals.
    Figure Legend Snippet: Differential splicing of Il-33 . ( A ) Gene structure (top left) and the skipped exon event at the 3′ end of Il-33 (bottom left). The gene-level TPM values and the corresponding read counts supporting exon inclusion and exclusion are shown on the right. ( B ) Expression values obtained by qRT-PCR. The expression values are 2 ΔCt normalized to the housekeeping gene Gusb. All the error bars indicate the 95% confidence intervals.

    Techniques Used: Expressing, Quantitative RT-PCR

    26) Product Images from "Targeted Enlargement of Aptamer Functionalized Gold Nanoparticles for Quantitative Protein Analysis"

    Article Title: Targeted Enlargement of Aptamer Functionalized Gold Nanoparticles for Quantitative Protein Analysis

    Journal: Proteomes

    doi: 10.3390/proteomes5010001

    Characterization of gold nanoparticles (AuNPs), aptamer-functionalized gold nanoparticles (Apt-AuNPs), and competitively protected Apt-AuNPs using a UV/Vis Spectrophotometer. The maximum absorbance was observed to be 525 nm for bare AuNPs (black curve) and the modification of AuNPs with DNA oligonucleotides led to a 4-nm red-shift in the absorbance spectra (red and blue curves).
    Figure Legend Snippet: Characterization of gold nanoparticles (AuNPs), aptamer-functionalized gold nanoparticles (Apt-AuNPs), and competitively protected Apt-AuNPs using a UV/Vis Spectrophotometer. The maximum absorbance was observed to be 525 nm for bare AuNPs (black curve) and the modification of AuNPs with DNA oligonucleotides led to a 4-nm red-shift in the absorbance spectra (red and blue curves).

    Techniques Used: Spectrophotometry, Modification

    27) Product Images from "A Suite of Therapeutically-Inspired Nucleic Acid Logic Systems for Conditional Generation of Single-Stranded and Double-Stranded Oligonucleotides"

    Article Title: A Suite of Therapeutically-Inspired Nucleic Acid Logic Systems for Conditional Generation of Single-Stranded and Double-Stranded Oligonucleotides

    Journal: Nanomaterials

    doi: 10.3390/nano9040615

    Multi-trigger systems can be composed in which each RNA/DNA hybrid contains a responsive DNA structural element. ( A ) A system comprising a 3-input AND gate and a NOT gate can be constructed by pairing sH ^CTGF.20/8 (activated by the connective tissue growth factor (CTGF) derived trigger) with aH ∨ KRAS (repressed by the Kirsten rat sarcoma proto-oncogene (KRAS) mRNA derived trigger). Co-incubation of the two hybrids results in no interaction. Both hybrids and the CTGF trigger are required for dsRNA release, while the presence of the KRAS trigger will inhibit strand exchange. ( B ) The multi-trigger system was assessed by 10% acrylamide non-denaturing PAGE. The fraction of DsiRNA released is indicated in the gel depicted, in the presence of indicated trigger combinations following 30 min incubation at 37 °C. The sH and aH hybrid were present at equimolar concentration, while the triggers were added at a 2-fold or 3-fold excess, as indicated. In samples when both triggers are present, they were added to premixed hybrids sequentially (KRAS followed by CTGF). The antisense hybrid and DsiRNA control in were assembled using a 5′-AlexaFluor546 labeled antisense RNA strand for the purpose of visualization and quantification.
    Figure Legend Snippet: Multi-trigger systems can be composed in which each RNA/DNA hybrid contains a responsive DNA structural element. ( A ) A system comprising a 3-input AND gate and a NOT gate can be constructed by pairing sH ^CTGF.20/8 (activated by the connective tissue growth factor (CTGF) derived trigger) with aH ∨ KRAS (repressed by the Kirsten rat sarcoma proto-oncogene (KRAS) mRNA derived trigger). Co-incubation of the two hybrids results in no interaction. Both hybrids and the CTGF trigger are required for dsRNA release, while the presence of the KRAS trigger will inhibit strand exchange. ( B ) The multi-trigger system was assessed by 10% acrylamide non-denaturing PAGE. The fraction of DsiRNA released is indicated in the gel depicted, in the presence of indicated trigger combinations following 30 min incubation at 37 °C. The sH and aH hybrid were present at equimolar concentration, while the triggers were added at a 2-fold or 3-fold excess, as indicated. In samples when both triggers are present, they were added to premixed hybrids sequentially (KRAS followed by CTGF). The antisense hybrid and DsiRNA control in were assembled using a 5′-AlexaFluor546 labeled antisense RNA strand for the purpose of visualization and quantification.

    Techniques Used: Construct, Derivative Assay, Incubation, Polyacrylamide Gel Electrophoresis, Concentration Assay, Labeling

    An RNA/DNA cognate pair system was designed to undergo conditional strand exchange by hybridizing to neighboring sites on an RNA trigger. ( A ) “Traditional” RNA/DNA hybrid pairs act as an 2-input AND gate. Hybridization between the single stranded toeholds of a sense hybrid ( sH ) and antisense hybrid ( aH ) initiates a thermodynamically driven strand exchange that generates a dsRNA duplex and DNA waste byproduct. ( B ) The “adjacent targeting” RNA/DNA hybrid system functions as a 3-input AND gate, requiring a hybrid pair as well as a specific RNA trigger sequence. The hybrid pair’s respective toeholds bind to regions of the trigger that are immediately upstream and downstream from one another. Anchoring the cognate hybrids in close proximity leads to initiation of the thermodynamically favorable strand exchange reaction and dsRNA release. ( C ) Five different cognate pairs of adjacent targeting hybrids were analyzed by 12% acrylamide non-denaturing PAGE for their ability to release a DsiRNA product. Each sense hybrid and the DsiRNA control assembly contained a 3′ 6-carboxyfluorescein (6-FAM) labeled sense RNA strand for visualization. The pairs of constructs differ in the number of DNA nucleotides inserted between the single-strand toehold and the RNA/DNA hybrid duplex. These inserted nucleotides were complementary between cognate hybrids, resulting in either 0, +1, +2, +3 or +4 DNA bp that can seed the strand exchange (colored orange). The presence or absence of each component is indicated above each lane. The samples in the gel depicted were all incubated for 180 min at 37 °C. ( D ) Analysis of the fraction of dsRNA released by hybrid pairs in the presence and absence of the RNA trigger following 30, 90 or 180 min incubations at 37 °C. Error bars indicate standard deviation of three replicate experiments. Indication of statistical significance between samples is reported in the supporting information.
    Figure Legend Snippet: An RNA/DNA cognate pair system was designed to undergo conditional strand exchange by hybridizing to neighboring sites on an RNA trigger. ( A ) “Traditional” RNA/DNA hybrid pairs act as an 2-input AND gate. Hybridization between the single stranded toeholds of a sense hybrid ( sH ) and antisense hybrid ( aH ) initiates a thermodynamically driven strand exchange that generates a dsRNA duplex and DNA waste byproduct. ( B ) The “adjacent targeting” RNA/DNA hybrid system functions as a 3-input AND gate, requiring a hybrid pair as well as a specific RNA trigger sequence. The hybrid pair’s respective toeholds bind to regions of the trigger that are immediately upstream and downstream from one another. Anchoring the cognate hybrids in close proximity leads to initiation of the thermodynamically favorable strand exchange reaction and dsRNA release. ( C ) Five different cognate pairs of adjacent targeting hybrids were analyzed by 12% acrylamide non-denaturing PAGE for their ability to release a DsiRNA product. Each sense hybrid and the DsiRNA control assembly contained a 3′ 6-carboxyfluorescein (6-FAM) labeled sense RNA strand for visualization. The pairs of constructs differ in the number of DNA nucleotides inserted between the single-strand toehold and the RNA/DNA hybrid duplex. These inserted nucleotides were complementary between cognate hybrids, resulting in either 0, +1, +2, +3 or +4 DNA bp that can seed the strand exchange (colored orange). The presence or absence of each component is indicated above each lane. The samples in the gel depicted were all incubated for 180 min at 37 °C. ( D ) Analysis of the fraction of dsRNA released by hybrid pairs in the presence and absence of the RNA trigger following 30, 90 or 180 min incubations at 37 °C. Error bars indicate standard deviation of three replicate experiments. Indication of statistical significance between samples is reported in the supporting information.

    Techniques Used: Activated Clotting Time Assay, Hybridization, Sequencing, Polyacrylamide Gel Electrophoresis, Labeling, Construct, Incubation, Standard Deviation

    Effects of DNA structural alteration on the degree of trigger-inducible dsRNA release. ( A ) Four different sense hybrids that are responsive to the connective tissue growth factor (CTGF) trigger were designed, each having different features within the structured DNA hairpin. The hairpins differed in the size of their loop or the length of their stem. Two different cognate antisense hybrids were designed and differ in the length of their single-stranded toehold. Sequence regions are indicated by lowercase letters and different colors to convey sequence identity or sequence complementarity. ( B , D ) DsiRNA release in the presence and absence of trigger was assessed by 10% acrylamide non-denaturing PAGE for each sense hybrid paired with a cognate antisense hybrid exhibiting either ( B ) a 12 nt toehold ( aH ^CTGF-cgnt.12 ) or ( D ) a 16 nt toehold ( aH ^CTGF-cgnt.16 ). Each sense hybrid and the DsiRNA control contained a 3′ 6-carboxyfluorescein (6-FAM) labeled sense RNA strand for visualization and quantification. Gels in both ( B ) and ( D ) depict samples that were incubated for 30 min at 37 °C. ( C , E ) Analysis of the fraction of dsRNA released by the four sense hybrids paired with ( C ) aH ^CTGF-cgnt.12 or ( E ) aH ^CTGF-cgnt.16 , in the presence and absence of the RNA trigger following 30, 90, or 180 min incubations at 37 °C. Error bars indicate standard deviation of three replicate experiments. Indication of statistical significance between samples is reported in the supporting information.
    Figure Legend Snippet: Effects of DNA structural alteration on the degree of trigger-inducible dsRNA release. ( A ) Four different sense hybrids that are responsive to the connective tissue growth factor (CTGF) trigger were designed, each having different features within the structured DNA hairpin. The hairpins differed in the size of their loop or the length of their stem. Two different cognate antisense hybrids were designed and differ in the length of their single-stranded toehold. Sequence regions are indicated by lowercase letters and different colors to convey sequence identity or sequence complementarity. ( B , D ) DsiRNA release in the presence and absence of trigger was assessed by 10% acrylamide non-denaturing PAGE for each sense hybrid paired with a cognate antisense hybrid exhibiting either ( B ) a 12 nt toehold ( aH ^CTGF-cgnt.12 ) or ( D ) a 16 nt toehold ( aH ^CTGF-cgnt.16 ). Each sense hybrid and the DsiRNA control contained a 3′ 6-carboxyfluorescein (6-FAM) labeled sense RNA strand for visualization and quantification. Gels in both ( B ) and ( D ) depict samples that were incubated for 30 min at 37 °C. ( C , E ) Analysis of the fraction of dsRNA released by the four sense hybrids paired with ( C ) aH ^CTGF-cgnt.12 or ( E ) aH ^CTGF-cgnt.16 , in the presence and absence of the RNA trigger following 30, 90, or 180 min incubations at 37 °C. Error bars indicate standard deviation of three replicate experiments. Indication of statistical significance between samples is reported in the supporting information.

    Techniques Used: Sequencing, Polyacrylamide Gel Electrophoresis, Labeling, Incubation, Standard Deviation

    Incorporation of a structured responsive element can generate a trigger-inducible RNA/DNA hybrid system. ( A ) The inducible hybrid system functions as a three-input AND gate. The sense hybrid sH ^CTGF.12/8 contains a responsive DNA hairpin composed of a 12 bp stem and an 8 nt loop, and is flanked by an extended 5′ single strand that acts as a diagnostic toehold. Trigger hybridization to the diagnostic toehold progresses through the hairpin stem and unzips the hairpin (sequence regions colored blue). This liberates a previously sequestered toehold within sH ^CTGF.12/8 which can then hybridize with the complementary toehold of the cognate antisense hybrid, aH ^CTGF-cgnt.12 . Hybridization of these exchange toeholds (sequence regions colored orange) initiates strand exchange and releases a dsRNA product. ( B ) The function of this conditional system was assessed by 8% acrylamide non-denaturing PAGE and total staining with ethidium bromide. DsiRNA release is observed when the sense and antisense hybrids are co-incubated in the presence of trigger (red box). Formation of the expected waste product is observed by comparison to a control assembly of the s’ and a’ DNA strands with the trigger molecule. All samples were incubated for 30 min at 37 °C. ( C ) Förster resonance energy transfer (FRET) analysis was performed as another method to verify conditional dsRNA formation. sH ^CTGF.12/8 was assembled using a 3′ 6-carboxyfluorescein (6-FAM) (ex/em 495/520 nm) labeled sense RNA strand. aH ^CTGF-cgnt.12 was assembled using a 5′-AlexaFluor546 (ex/em 555/570 nm) labeled antisense RNA strand. The hybrids were mixed and incubated at 37 °C for one hour in the presence or absence of the RNA trigger. Fluorescence emission spectra were recorded at t = 0 and t = 60 min using excitation at 475 nm.
    Figure Legend Snippet: Incorporation of a structured responsive element can generate a trigger-inducible RNA/DNA hybrid system. ( A ) The inducible hybrid system functions as a three-input AND gate. The sense hybrid sH ^CTGF.12/8 contains a responsive DNA hairpin composed of a 12 bp stem and an 8 nt loop, and is flanked by an extended 5′ single strand that acts as a diagnostic toehold. Trigger hybridization to the diagnostic toehold progresses through the hairpin stem and unzips the hairpin (sequence regions colored blue). This liberates a previously sequestered toehold within sH ^CTGF.12/8 which can then hybridize with the complementary toehold of the cognate antisense hybrid, aH ^CTGF-cgnt.12 . Hybridization of these exchange toeholds (sequence regions colored orange) initiates strand exchange and releases a dsRNA product. ( B ) The function of this conditional system was assessed by 8% acrylamide non-denaturing PAGE and total staining with ethidium bromide. DsiRNA release is observed when the sense and antisense hybrids are co-incubated in the presence of trigger (red box). Formation of the expected waste product is observed by comparison to a control assembly of the s’ and a’ DNA strands with the trigger molecule. All samples were incubated for 30 min at 37 °C. ( C ) Förster resonance energy transfer (FRET) analysis was performed as another method to verify conditional dsRNA formation. sH ^CTGF.12/8 was assembled using a 3′ 6-carboxyfluorescein (6-FAM) (ex/em 495/520 nm) labeled sense RNA strand. aH ^CTGF-cgnt.12 was assembled using a 5′-AlexaFluor546 (ex/em 555/570 nm) labeled antisense RNA strand. The hybrids were mixed and incubated at 37 °C for one hour in the presence or absence of the RNA trigger. Fluorescence emission spectra were recorded at t = 0 and t = 60 min using excitation at 475 nm.

    Techniques Used: Diagnostic Assay, Hybridization, Sequencing, Polyacrylamide Gel Electrophoresis, Staining, Incubation, Förster Resonance Energy Transfer, Labeling, Fluorescence

    28) Product Images from "Cyclic oligoadenylate signalling mediates Mycobacterium tuberculosis CRISPR defence"

    Article Title: Cyclic oligoadenylate signalling mediates Mycobacterium tuberculosis CRISPR defence

    Journal: bioRxiv

    doi: 10.1101/667758

    The CRISPR system of M. tuberculosis A. The CRISPR locus of M. tuberculosis includes genes encoding Cas6 (crRNA processing), Csm1-5 (type III-A interference complex), Csm6 (ancillary ribonuclease), Cas1 and Cas2 (Adaptation). Cas6 cleaves the CRISPR RNA at the base of a short hairpin to generate mature crRNA that is bound by the Csm complex. On target RNA binding, the Csm complex is expected to display three enzymatic activities: target RNA cleavage ( 1 ), DNA cleavage by the HD domain ( 2 ) and cOA production by the cyclase domain ( 3 ). B. Purified, recombinant CRISPR-associated proteins of M. tuberculosis . M: PageRuler Unstained (Thermo Scientific); 1: Csm1-5 interference complex; 2: Csm1-5, Csm1 D630A, D631A (Cy variant); 3: Csm1-5, Csm3 D35A (C3 variant); 4: Csm6; 5: Cas6.
    Figure Legend Snippet: The CRISPR system of M. tuberculosis A. The CRISPR locus of M. tuberculosis includes genes encoding Cas6 (crRNA processing), Csm1-5 (type III-A interference complex), Csm6 (ancillary ribonuclease), Cas1 and Cas2 (Adaptation). Cas6 cleaves the CRISPR RNA at the base of a short hairpin to generate mature crRNA that is bound by the Csm complex. On target RNA binding, the Csm complex is expected to display three enzymatic activities: target RNA cleavage ( 1 ), DNA cleavage by the HD domain ( 2 ) and cOA production by the cyclase domain ( 3 ). B. Purified, recombinant CRISPR-associated proteins of M. tuberculosis . M: PageRuler Unstained (Thermo Scientific); 1: Csm1-5 interference complex; 2: Csm1-5, Csm1 D630A, D631A (Cy variant); 3: Csm1-5, Csm3 D35A (C3 variant); 4: Csm6; 5: Cas6.

    Techniques Used: CRISPR, RNA Binding Assay, Purification, Recombinant, Variant Assay

    29) Product Images from "MiRNA-125a-5p: a regulator and predictor of gefitinib's effect on nasopharyngeal carcinoma"

    Article Title: MiRNA-125a-5p: a regulator and predictor of gefitinib's effect on nasopharyngeal carcinoma

    Journal: Cancer Cell International

    doi: 10.1186/1475-2867-14-24

    miR-125a-5p could mediate the anti-proliferation effect of gefitinib on NPC cells. (A) . Using oligo-miR-nc (FAM) as an example, a FAM reporter assay confirmed that the miRNA oligos used in this study were successfully transfected into HNE-1 and HK-1 cells. qRT-PCR revealed that the relative quantities of miR-125a-5p were decreased in cells transfected with oligo-miR-125a-5p inhibitor ( P
    Figure Legend Snippet: miR-125a-5p could mediate the anti-proliferation effect of gefitinib on NPC cells. (A) . Using oligo-miR-nc (FAM) as an example, a FAM reporter assay confirmed that the miRNA oligos used in this study were successfully transfected into HNE-1 and HK-1 cells. qRT-PCR revealed that the relative quantities of miR-125a-5p were decreased in cells transfected with oligo-miR-125a-5p inhibitor ( P

    Techniques Used: Reporter Assay, Transfection, Quantitative RT-PCR

    30) Product Images from "MiRNA-125a-5p: a regulator and predictor of gefitinib's effect on nasopharyngeal carcinoma"

    Article Title: MiRNA-125a-5p: a regulator and predictor of gefitinib's effect on nasopharyngeal carcinoma

    Journal: Cancer Cell International

    doi: 10.1186/1475-2867-14-24

    miR-125a-5p could mediate the anti-proliferation effect of gefitinib on NPC cells. (A) . Using oligo-miR-nc (FAM) as an example, a FAM reporter assay confirmed that the miRNA oligos used in this study were successfully transfected into HNE-1 and HK-1 cells. qRT-PCR revealed that the relative quantities of miR-125a-5p were decreased in cells transfected with oligo-miR-125a-5p inhibitor ( P
    Figure Legend Snippet: miR-125a-5p could mediate the anti-proliferation effect of gefitinib on NPC cells. (A) . Using oligo-miR-nc (FAM) as an example, a FAM reporter assay confirmed that the miRNA oligos used in this study were successfully transfected into HNE-1 and HK-1 cells. qRT-PCR revealed that the relative quantities of miR-125a-5p were decreased in cells transfected with oligo-miR-125a-5p inhibitor ( P

    Techniques Used: Reporter Assay, Transfection, Quantitative RT-PCR

    miR-125a-5p mediated the expression of p53 and Her2 proteins in NPC cells. Western blot analysis confirmed that p53 protein expression was lower in HNE-1 cells than in HK-1 cells. After transfection with oligo-miR-125a-5p mimic, p53 protein expression was increased in HNE-1 cells compared with the control group. Her2 protein expressions were decreased in both cell lines following transfection with oligo-miR-125a-5p mimic in HNE-1 and HK-1 cells. Her2 protein expressions in HK-1 cells were increased after transfection with oligo-miR-125a-5p inhibitor.
    Figure Legend Snippet: miR-125a-5p mediated the expression of p53 and Her2 proteins in NPC cells. Western blot analysis confirmed that p53 protein expression was lower in HNE-1 cells than in HK-1 cells. After transfection with oligo-miR-125a-5p mimic, p53 protein expression was increased in HNE-1 cells compared with the control group. Her2 protein expressions were decreased in both cell lines following transfection with oligo-miR-125a-5p mimic in HNE-1 and HK-1 cells. Her2 protein expressions in HK-1 cells were increased after transfection with oligo-miR-125a-5p inhibitor.

    Techniques Used: Expressing, Western Blot, Transfection

    31) Product Images from "Novel RNA chaperone domain of RNA-binding protein La is regulated by AKT phosphorylation"

    Article Title: Novel RNA chaperone domain of RNA-binding protein La is regulated by AKT phosphorylation

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gku1309

    The RNA chaperone activity of La is required to stimulated CCND1 IRES-mediated mRNA translation. ( A ) Predicted structure of the D1-AUG molecular beacon (MB-D1-AUG): a fluorescein group was linked to the 5′-end and a quencher to its 3′-end of the D1-AUG RNA. ( B ) Scheme of the RCA used to measure helix-destabilization activity of recombinant La protein. ( C ) The La protein is destabilizing the helical region of molecular beacon MB-D1-AUG leading to a spatial separation of the fluorescein and quencher group. 25 nM of MB-D1-AUG was incubated with 300 ng of La protein and fluorescence emission was measured after 20 min at 37°C, n = 8. ( D ) Scheme of the C-terminal region of La containing the RCD. In mutant LaΔRCD amino acids indicated in bold were changed to amino acids shown below. ( E ) EMSA analysis demonstrating similar RNA-binding activity of LaWT and mutant LaΔRCD. Standard EMSA were performed as detailed in Materials and Methods and described in legends to Figures 1 and 2 . ( F ) LaΔRCD1, LaΔRCD2, and LaΔRCD displayed strongly impaired RNA chaperone activity. 300 ng of recombinant LaWT or LaΔRCD mutants were incubated with 10 nM of D1-AUG-MB for 20 min at 37°C and fluorescence emission was recorded. Three independent protein preparations of LaWT and LaΔRCD mutants were analyzed in 3 or 4 independent experiments. RNA chaperone activity of LaWT was set as 100%. ( G ) LaWT but not LaΔRCD facilitated CCND1 IRES-mediated mRNA translation. Capped and polyadenylated bicistronic RNA without (empty) or with CCND1-IRES (IRES) was transfected into gfp-tagged LaWT or LaΔRCD expressing HEK 293 cells. Seven hours after transfection cap-dependent renilla (R) and CCND1-IRES-dependent firefly (F) luciferase activity was measured. Five independent experiments were analyzed ( n = 5). Two-tailed P -value was determined by paired t -test (GraphPad). P -value
    Figure Legend Snippet: The RNA chaperone activity of La is required to stimulated CCND1 IRES-mediated mRNA translation. ( A ) Predicted structure of the D1-AUG molecular beacon (MB-D1-AUG): a fluorescein group was linked to the 5′-end and a quencher to its 3′-end of the D1-AUG RNA. ( B ) Scheme of the RCA used to measure helix-destabilization activity of recombinant La protein. ( C ) The La protein is destabilizing the helical region of molecular beacon MB-D1-AUG leading to a spatial separation of the fluorescein and quencher group. 25 nM of MB-D1-AUG was incubated with 300 ng of La protein and fluorescence emission was measured after 20 min at 37°C, n = 8. ( D ) Scheme of the C-terminal region of La containing the RCD. In mutant LaΔRCD amino acids indicated in bold were changed to amino acids shown below. ( E ) EMSA analysis demonstrating similar RNA-binding activity of LaWT and mutant LaΔRCD. Standard EMSA were performed as detailed in Materials and Methods and described in legends to Figures 1 and 2 . ( F ) LaΔRCD1, LaΔRCD2, and LaΔRCD displayed strongly impaired RNA chaperone activity. 300 ng of recombinant LaWT or LaΔRCD mutants were incubated with 10 nM of D1-AUG-MB for 20 min at 37°C and fluorescence emission was recorded. Three independent protein preparations of LaWT and LaΔRCD mutants were analyzed in 3 or 4 independent experiments. RNA chaperone activity of LaWT was set as 100%. ( G ) LaWT but not LaΔRCD facilitated CCND1 IRES-mediated mRNA translation. Capped and polyadenylated bicistronic RNA without (empty) or with CCND1-IRES (IRES) was transfected into gfp-tagged LaWT or LaΔRCD expressing HEK 293 cells. Seven hours after transfection cap-dependent renilla (R) and CCND1-IRES-dependent firefly (F) luciferase activity was measured. Five independent experiments were analyzed ( n = 5). Two-tailed P -value was determined by paired t -test (GraphPad). P -value

    Techniques Used: Activity Assay, Recombinant, Incubation, Fluorescence, Mutagenesis, RNA Binding Assay, Transfection, Expressing, Luciferase, Two Tailed Test

    RRM1 and RRM2 are required for binding of D1-AUG RNA. ( A ) La protein mutants analyzed in RNA-binding studies. The scheme shows LaWT and its respective mutants; the black lines indicate the location of amino acid deletions. The LAM was deleted in LaΔ1, the RNP-2 consensus sequence was deleted in RRM1 and RRM2 for LaΔ2 and LaΔ4, respectively. The N-terminal region and the C-terminal region upstream and downstream of RRM1 and RRM2, respectively, are deleted in LaRRM1+2. For more details and purified proteins see Supplementary Figure S2. ( B ) ( C ) and ( D ) EMSAs were carried out with 40, 80, 160 and 320 nM recombinant La protein. Free D1-AUG RNA and La–RNPs are indicated. FP assays of all LaWT and mutant proteins were performed and are shown in Supplementary Figure S2. ( E ) Summary of D1-AUG RNA-binding studies using La protein mutants. The results of the RNA-binding studies by EMSA and FP show a high degree of similarity. The affinities determined by FP of LaΔ1, and LaRRM1+2 are similar to the K D of the LaWT protein. This is also represented by the EMSA studies.
    Figure Legend Snippet: RRM1 and RRM2 are required for binding of D1-AUG RNA. ( A ) La protein mutants analyzed in RNA-binding studies. The scheme shows LaWT and its respective mutants; the black lines indicate the location of amino acid deletions. The LAM was deleted in LaΔ1, the RNP-2 consensus sequence was deleted in RRM1 and RRM2 for LaΔ2 and LaΔ4, respectively. The N-terminal region and the C-terminal region upstream and downstream of RRM1 and RRM2, respectively, are deleted in LaRRM1+2. For more details and purified proteins see Supplementary Figure S2. ( B ) ( C ) and ( D ) EMSAs were carried out with 40, 80, 160 and 320 nM recombinant La protein. Free D1-AUG RNA and La–RNPs are indicated. FP assays of all LaWT and mutant proteins were performed and are shown in Supplementary Figure S2. ( E ) Summary of D1-AUG RNA-binding studies using La protein mutants. The results of the RNA-binding studies by EMSA and FP show a high degree of similarity. The affinities determined by FP of LaΔ1, and LaRRM1+2 are similar to the K D of the LaWT protein. This is also represented by the EMSA studies.

    Techniques Used: Binding Assay, RNA Binding Assay, Laser Capture Microdissection, Sequencing, Purification, Recombinant, Mutagenesis

    Binding of La protein requires a strong Kozak sequence. ( A ) Scheme of the synthetic RNA molecule D1-AUG spanning nucleotides −23 to +24 of the CCND1 mRNA. D1-mu2 represents a shorter version of D1-AUG with a single mutation in the translational start site. D1-mu3 represents a synthetic RNA molecule with mutation in the Kozak sequence surrounding the CCND1 start codon. ( B ) EMSA demonstrating binding of La to D1-AUG. Increasing concentration (10, 60, 200, 400, 800, 1600, 3000 nM) of recombinant La protein were titrated to a constant concentration of 10 nM D1-AUG RNA leading to the formation of La–ribonucleoprotein complex (La–RNP). ( C ) Supershift analysis demonstrating that La protein binds to D1-AUG RNA. αLa = anti-La antibody, IgG2 = control antibody. ( D ) The binding of La protein to D1-AUG RNA depends on a strong Kozak consensus sequence. Competitive EMSAs were performed to identify the role of the translational start site and its context. Competitive EMSA were performed using 10-, 50- and 100-fold excess amounts of unlabeled RNA and 10 nM [ 32 P]-labeled CCND1-AUG RNA. As negative binding and competition control served a reaction without La protein and competitor RNA, respectively. Cold D1-AUG RNA and mu2 RNA, but not mu3 RNA are out-competing binding of La to radiolabeled D1-AUG RNA.
    Figure Legend Snippet: Binding of La protein requires a strong Kozak sequence. ( A ) Scheme of the synthetic RNA molecule D1-AUG spanning nucleotides −23 to +24 of the CCND1 mRNA. D1-mu2 represents a shorter version of D1-AUG with a single mutation in the translational start site. D1-mu3 represents a synthetic RNA molecule with mutation in the Kozak sequence surrounding the CCND1 start codon. ( B ) EMSA demonstrating binding of La to D1-AUG. Increasing concentration (10, 60, 200, 400, 800, 1600, 3000 nM) of recombinant La protein were titrated to a constant concentration of 10 nM D1-AUG RNA leading to the formation of La–ribonucleoprotein complex (La–RNP). ( C ) Supershift analysis demonstrating that La protein binds to D1-AUG RNA. αLa = anti-La antibody, IgG2 = control antibody. ( D ) The binding of La protein to D1-AUG RNA depends on a strong Kozak consensus sequence. Competitive EMSAs were performed to identify the role of the translational start site and its context. Competitive EMSA were performed using 10-, 50- and 100-fold excess amounts of unlabeled RNA and 10 nM [ 32 P]-labeled CCND1-AUG RNA. As negative binding and competition control served a reaction without La protein and competitor RNA, respectively. Cold D1-AUG RNA and mu2 RNA, but not mu3 RNA are out-competing binding of La to radiolabeled D1-AUG RNA.

    Techniques Used: Binding Assay, Sequencing, Mutagenesis, Concentration Assay, Recombinant, Labeling

    32) Product Images from "Synthesis and Evaluation of a Rationally Designed Click-Based Library for G-Quadruplex Selective DNA Photocleavage"

    Article Title: Synthesis and Evaluation of a Rationally Designed Click-Based Library for G-Quadruplex Selective DNA Photocleavage

    Journal: Molecules

    doi: 10.3390/molecules200916446

    Photochemical cleavage of F21T by control compound 14 (black bars) compared with cleavage by TMPyP4 (gray bars) after 120 min of UVA irradiation.
    Figure Legend Snippet: Photochemical cleavage of F21T by control compound 14 (black bars) compared with cleavage by TMPyP4 (gray bars) after 120 min of UVA irradiation.

    Techniques Used: Irradiation

    Changes in T m upon formation of the DNA-compound complex ( A ) Average melt data for representative compounds incubated with FcMycT; ( B ) Average melt data for representative compounds incubated with F21T, Black, blue, green, and red bars represent positive control, benzophenone-incorporated, naphthalimide-incorporated, and anthraquinone-incorporated compounds respectively.
    Figure Legend Snippet: Changes in T m upon formation of the DNA-compound complex ( A ) Average melt data for representative compounds incubated with FcMycT; ( B ) Average melt data for representative compounds incubated with F21T, Black, blue, green, and red bars represent positive control, benzophenone-incorporated, naphthalimide-incorporated, and anthraquinone-incorporated compounds respectively.

    Techniques Used: Incubation, Positive Control

    ( A ) Effect of photoreactive group on the photochemical cleavage of G-quadruplex DNA by click-based compound library members. ( A ) Example polyacrylamide gel of photocleavage reactions of F21T after 30 min UV irradiation in the presence of 500 nM click-based compound library members 11a , b ; 12a – d ; and 13a , b ; ( B ) Quantification of G-quadruplex photochemical cleavage from gel electrophoresis analysis after irradiation and piperidine/heat treatment. Unless indicated, F21T was employed as the G-quadruplex substrate. Red, green, and blue bars correspond to compounds incorporating anthraquinone, naphthalimide, and benzophenone respectively. * FcMycT photocleavage data for comparison.
    Figure Legend Snippet: ( A ) Effect of photoreactive group on the photochemical cleavage of G-quadruplex DNA by click-based compound library members. ( A ) Example polyacrylamide gel of photocleavage reactions of F21T after 30 min UV irradiation in the presence of 500 nM click-based compound library members 11a , b ; 12a – d ; and 13a , b ; ( B ) Quantification of G-quadruplex photochemical cleavage from gel electrophoresis analysis after irradiation and piperidine/heat treatment. Unless indicated, F21T was employed as the G-quadruplex substrate. Red, green, and blue bars correspond to compounds incorporating anthraquinone, naphthalimide, and benzophenone respectively. * FcMycT photocleavage data for comparison.

    Techniques Used: Irradiation, Nucleic Acid Electrophoresis

    33) Product Images from "Nuclear F-actin and myosins drive relocalization of heterochromatic breaks"

    Article Title: Nuclear F-actin and myosins drive relocalization of heterochromatic breaks

    Journal: Nature

    doi: 10.1038/s41586-018-0242-8

    Actin nucleators and myosins promote heterochromatin repair and stability (a) Wb and qPCR analysis show RNAi depletion efficiency for Rad21 and Slmb as indicated. Tubulin is a loading control for Wb. (b) FISH analysis and quantification show the effect of indicated RNAi on the number of cells with ≥3 AACAC or 359bp satellites, reflecting disruption of homologous and/or sister pairing 75 . ** P =0.0472; **** P
    Figure Legend Snippet: Actin nucleators and myosins promote heterochromatin repair and stability (a) Wb and qPCR analysis show RNAi depletion efficiency for Rad21 and Slmb as indicated. Tubulin is a loading control for Wb. (b) FISH analysis and quantification show the effect of indicated RNAi on the number of cells with ≥3 AACAC or 359bp satellites, reflecting disruption of homologous and/or sister pairing 75 . ** P =0.0472; **** P

    Techniques Used: Western Blot, Real-time Polymerase Chain Reaction, Fluorescence In Situ Hybridization

    34) Product Images from "Antimicrobial nano-zinc oxide-2S albumin protein formulation significantly inhibits growth of “Candidatus Liberibacter asiaticus” in planta"

    Article Title: Antimicrobial nano-zinc oxide-2S albumin protein formulation significantly inhibits growth of “Candidatus Liberibacter asiaticus” in planta

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0204702

    (A) qPCR Amplification plot generated by known concentration of C Las genomic DNA to check efficiency and sensitivity of TaqMan-qPCR with HLBas-F/Rn-HLBp primer probe pair, Line-a = 12.5 ng, Line-b = 1.25 ng, Line-c = 0.125 ng, Line-d = 0.0125 ng, Line-e = 1.25 pg, Line-f = 0.125 pg and Line-g = 12.5 fg template DNA. (B) Sensitivity of the primer-probe combination (HLBas-F/Rn-HLBp specific) for C Las detection using TaqMan qPCR assay. The standard curve established between log of DNA concentrations vs. cycle threshold (Ct) obtained using 10-fold serial dilution of total genomic DNA of Mosambi plants infected with C Las (initial concentration 12.5 ng/μl, final concentration 12.5 fg/μl).
    Figure Legend Snippet: (A) qPCR Amplification plot generated by known concentration of C Las genomic DNA to check efficiency and sensitivity of TaqMan-qPCR with HLBas-F/Rn-HLBp primer probe pair, Line-a = 12.5 ng, Line-b = 1.25 ng, Line-c = 0.125 ng, Line-d = 0.0125 ng, Line-e = 1.25 pg, Line-f = 0.125 pg and Line-g = 12.5 fg template DNA. (B) Sensitivity of the primer-probe combination (HLBas-F/Rn-HLBp specific) for C Las detection using TaqMan qPCR assay. The standard curve established between log of DNA concentrations vs. cycle threshold (Ct) obtained using 10-fold serial dilution of total genomic DNA of Mosambi plants infected with C Las (initial concentration 12.5 ng/μl, final concentration 12.5 fg/μl).

    Techniques Used: Real-time Polymerase Chain Reaction, Amplification, Generated, Concentration Assay, Serial Dilution, Infection

    35) Product Images from "GPR21 KO mice demonstrate no resistance to high fat diet induced obesity or improved glucose tolerance"

    Article Title: GPR21 KO mice demonstrate no resistance to high fat diet induced obesity or improved glucose tolerance

    Journal: F1000Research

    doi: 10.12688/f1000research.7822.1

    ( A ) Rabgap1 mRNA expression levels were assessed using 2 Taqman probes in liver (top left panel) and BAT (top right panel) of GPR21 TAL 29 bp KO and their wildtype littermate mice. ( B ) Liver (bottom left panel) and BAT (bottom right panel) strbp mRNA expression levels were assessed in wildtype and Gpr21 TAL 29 bp KO mice.
    Figure Legend Snippet: ( A ) Rabgap1 mRNA expression levels were assessed using 2 Taqman probes in liver (top left panel) and BAT (top right panel) of GPR21 TAL 29 bp KO and their wildtype littermate mice. ( B ) Liver (bottom left panel) and BAT (bottom right panel) strbp mRNA expression levels were assessed in wildtype and Gpr21 TAL 29 bp KO mice.

    Techniques Used: Expressing, Mouse Assay

    ( A ) Mouse Gpr21 is located on Chromosome 2 within the intron of Rabgap1 gene between exon 13 and 14 on the positive strand according to UCSC GRCm38/mm10 assembly. Strpb gene is on the opposite strand in the same region. The blue arrow represents the positive strand while the green one the negative strand. The bars under the genes represent microarray probe sets from Affymetrix mouse array HT MG-430PM platform. There is no probe set covering Gpr21 gene. The closest probe set 1421125_PM is located at 2,866 bases upstream of Gpr21 . ( B ) The level of Rabgap1 transcript was shown as normalized expression intensity. RNA was prepared from BAT, liver, spleen and WAT of Deltagen Gpr21 KO mice and their WT littermate controls. Probe 1443535_PM, 1460486_PM and 1424188_PM allow detection of Rabgap1 mRNA expression levels.
    Figure Legend Snippet: ( A ) Mouse Gpr21 is located on Chromosome 2 within the intron of Rabgap1 gene between exon 13 and 14 on the positive strand according to UCSC GRCm38/mm10 assembly. Strpb gene is on the opposite strand in the same region. The blue arrow represents the positive strand while the green one the negative strand. The bars under the genes represent microarray probe sets from Affymetrix mouse array HT MG-430PM platform. There is no probe set covering Gpr21 gene. The closest probe set 1421125_PM is located at 2,866 bases upstream of Gpr21 . ( B ) The level of Rabgap1 transcript was shown as normalized expression intensity. RNA was prepared from BAT, liver, spleen and WAT of Deltagen Gpr21 KO mice and their WT littermate controls. Probe 1443535_PM, 1460486_PM and 1424188_PM allow detection of Rabgap1 mRNA expression levels.

    Techniques Used: Microarray, Expressing, Mouse Assay

    36) Product Images from "Structural characterization of recombinant IAV polymerase reveals a stable complex between viral PA-PB1 heterodimer and host RanBP5"

    Article Title: Structural characterization of recombinant IAV polymerase reveals a stable complex between viral PA-PB1 heterodimer and host RanBP5

    Journal: Scientific Reports

    doi: 10.1038/srep24727

    vRNA binding and specificity. ( a ) Binding titration of the truncated trimer PA-PB1-PB2(1-116) towards the 5′-vRNAp (blue triangle) and 3′-vRNAp (red square) sequences using fluorescence anisotropy at 300 mM NaCl. ( b ) Binding titration performed by filter binding assay against P 32 labelled 5′-vRNAp (blue triangle) and 3′-vRNAp (red square) using 300 mM NaCl. Bound RNA fraction is plotted as a function of polymerase concentration. ( c ) Binding titration of the truncated dimer PA-PB1(1-686) performed at 150 and 300 mM NaCl against the 5-′vRNAp (dark and light blue triangles), 3′-vRNAp (orange and dark red squares) and polyUC RNA (light and dark green circles) by fluorescence anisotropy. ( d ) Binding titration of different polymerases and polymerase-RanBP5 constructs against the 5′-vRNAp at 300 mM NaCl by fluorescence anisotropy. PA-PB1-PB2(116) and PA-PB1(1-686) are depicted by blue and orange triangles respectively, PA-PB1(1-686)-RanBP5 is depicted with purple triangles. For all anisotropy titrations ( a , c , d ) subtracted anisotropy is plotted as a function of protein concentration.
    Figure Legend Snippet: vRNA binding and specificity. ( a ) Binding titration of the truncated trimer PA-PB1-PB2(1-116) towards the 5′-vRNAp (blue triangle) and 3′-vRNAp (red square) sequences using fluorescence anisotropy at 300 mM NaCl. ( b ) Binding titration performed by filter binding assay against P 32 labelled 5′-vRNAp (blue triangle) and 3′-vRNAp (red square) using 300 mM NaCl. Bound RNA fraction is plotted as a function of polymerase concentration. ( c ) Binding titration of the truncated dimer PA-PB1(1-686) performed at 150 and 300 mM NaCl against the 5-′vRNAp (dark and light blue triangles), 3′-vRNAp (orange and dark red squares) and polyUC RNA (light and dark green circles) by fluorescence anisotropy. ( d ) Binding titration of different polymerases and polymerase-RanBP5 constructs against the 5′-vRNAp at 300 mM NaCl by fluorescence anisotropy. PA-PB1-PB2(116) and PA-PB1(1-686) are depicted by blue and orange triangles respectively, PA-PB1(1-686)-RanBP5 is depicted with purple triangles. For all anisotropy titrations ( a , c , d ) subtracted anisotropy is plotted as a function of protein concentration.

    Techniques Used: Binding Assay, Titration, Fluorescence, Filter-binding Assay, Concentration Assay, Construct, Protein Concentration

    37) Product Images from "The La protein counteracts cisplatin-induced cell death by stimulating protein synthesis of anti-apoptotic factor Bcl2"

    Article Title: The La protein counteracts cisplatin-induced cell death by stimulating protein synthesis of anti-apoptotic factor Bcl2

    Journal: Oncotarget

    doi: 10.18632/oncotarget.8819

    The RNA chaperone La assists structural changes of the Bcl2 translation start site in vitro A. The RNA chaperone domain (RCD) of La is mutated in LaΔRCD [ 21 ). RNA-binding motifs: LAM, RRM1, and RRM2. Scheme representing the RNA chaperone assay and the predicted structure of the Bcl2 RNA used as molecular beacon (Bcl2-MB). B. Differences in RNA chaperone activity given in relative fluorescence units (arbitrary units = AU) in the presence of 300 nM La wildtype protein (LaWT) compared to the molecular beacon (Bcl2-MB) alone or in presence of 300 nM recombinant La protein with mutated RNA chaperone domain (LaΔRCD). P value
    Figure Legend Snippet: The RNA chaperone La assists structural changes of the Bcl2 translation start site in vitro A. The RNA chaperone domain (RCD) of La is mutated in LaΔRCD [ 21 ). RNA-binding motifs: LAM, RRM1, and RRM2. Scheme representing the RNA chaperone assay and the predicted structure of the Bcl2 RNA used as molecular beacon (Bcl2-MB). B. Differences in RNA chaperone activity given in relative fluorescence units (arbitrary units = AU) in the presence of 300 nM La wildtype protein (LaWT) compared to the molecular beacon (Bcl2-MB) alone or in presence of 300 nM recombinant La protein with mutated RNA chaperone domain (LaΔRCD). P value

    Techniques Used: In Vitro, RNA Binding Assay, Laser Capture Microdissection, Activity Assay, Fluorescence, Recombinant

    Bcl2 protein expression is reduced by siRNA-mediated La depletion or transient expression of La dominant negative (LaDN) mutant in cells A. Scheme of LaDN mutant compared to La wildtype containing three RNA-binding motifs: LAM, RRM1, and RRM2. B. Fluorescence microscopic image of gfp or LaDN mutant expression in living SCC 22B cells. La depletion in SCC 22B cells by C-E. transient expression of La dominant negative (LaDN) mutant or F-H. La-specific siRNA (La siRNA), results in increased cisplatin-induced apoptosis (Annexin/PI-positive cells) after cisplatin treatment with 24 μM for 24 hours, reduced Bcl2 protein expression (GAPDH = loading control), and unchanged Bcl2 mRNA level as determined by RT-qPCR analysis and normalized to GAPDH mRNA. Con = control siRNA. P value
    Figure Legend Snippet: Bcl2 protein expression is reduced by siRNA-mediated La depletion or transient expression of La dominant negative (LaDN) mutant in cells A. Scheme of LaDN mutant compared to La wildtype containing three RNA-binding motifs: LAM, RRM1, and RRM2. B. Fluorescence microscopic image of gfp or LaDN mutant expression in living SCC 22B cells. La depletion in SCC 22B cells by C-E. transient expression of La dominant negative (LaDN) mutant or F-H. La-specific siRNA (La siRNA), results in increased cisplatin-induced apoptosis (Annexin/PI-positive cells) after cisplatin treatment with 24 μM for 24 hours, reduced Bcl2 protein expression (GAPDH = loading control), and unchanged Bcl2 mRNA level as determined by RT-qPCR analysis and normalized to GAPDH mRNA. Con = control siRNA. P value

    Techniques Used: Expressing, Dominant Negative Mutation, Mutagenesis, RNA Binding Assay, Laser Capture Microdissection, Fluorescence, Quantitative RT-PCR

    The La protein binds to a region of Bcl2 mRNA embedding the authentic translation start site A. Upper panel: RNA immuoprecipitation (RIP) applying a La-specific antibody followed by Bcl2-specific RT-PCR in three different cell lines (immunoblot (IB)). Lower panel: RIP followed by RT-qPCR analysis was performed in triplicates on RNA extracted from RIP pellets. Cell extracts for RIP experiments were prepared from HEK 293 cells stably transfected with gfp alone (control) or gfp-tagged La. None of the target mRNAs analyzed were detected in cells expressing gfp alone. Relative enrichment of target mRNA compared to GAPDH mRNA was calculated (n = 3). B. Scheme of Bcl2 RNA probes (FL, P1, P2) applied for RNA pull-down assays, and La-specific immunoblot (IB) following Bcl2 RNA pull down from SCC 22A and SCC 22B cell lysates. Data shown are representative of three independent experiments (n = 3). No RNA probe was added in the control (C). C. Binding affinity of La:Bcl2 RNA oligonucleotide interaction as determined by electrophoretic mobility shift assay (EMSA). The 5′FAM-labeled Bcl2 RNA oligonucleotide (25 nM) was incubated with increasing amounts of recombinant La protein in a range from 0 to 600 nM and separated by a native EMSA. D. The La:RNA complex formation is plotted against the La protein concentration. The dissociation constant (K D ) was determined as 50.5+/−5.9 nM (n = 3) in Prism 5 (GraphPad Software). E. Competitive fluorescence polarization assay using 5′FAM-labeled Bcl2 RNA oligonucleotides and different unlabeled competitor RNA oligonucleotides at 4-, 10-, 40-, or 80-fold excess. P value
    Figure Legend Snippet: The La protein binds to a region of Bcl2 mRNA embedding the authentic translation start site A. Upper panel: RNA immuoprecipitation (RIP) applying a La-specific antibody followed by Bcl2-specific RT-PCR in three different cell lines (immunoblot (IB)). Lower panel: RIP followed by RT-qPCR analysis was performed in triplicates on RNA extracted from RIP pellets. Cell extracts for RIP experiments were prepared from HEK 293 cells stably transfected with gfp alone (control) or gfp-tagged La. None of the target mRNAs analyzed were detected in cells expressing gfp alone. Relative enrichment of target mRNA compared to GAPDH mRNA was calculated (n = 3). B. Scheme of Bcl2 RNA probes (FL, P1, P2) applied for RNA pull-down assays, and La-specific immunoblot (IB) following Bcl2 RNA pull down from SCC 22A and SCC 22B cell lysates. Data shown are representative of three independent experiments (n = 3). No RNA probe was added in the control (C). C. Binding affinity of La:Bcl2 RNA oligonucleotide interaction as determined by electrophoretic mobility shift assay (EMSA). The 5′FAM-labeled Bcl2 RNA oligonucleotide (25 nM) was incubated with increasing amounts of recombinant La protein in a range from 0 to 600 nM and separated by a native EMSA. D. The La:RNA complex formation is plotted against the La protein concentration. The dissociation constant (K D ) was determined as 50.5+/−5.9 nM (n = 3) in Prism 5 (GraphPad Software). E. Competitive fluorescence polarization assay using 5′FAM-labeled Bcl2 RNA oligonucleotides and different unlabeled competitor RNA oligonucleotides at 4-, 10-, 40-, or 80-fold excess. P value

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR, Stable Transfection, Transfection, Expressing, Binding Assay, Electrophoretic Mobility Shift Assay, Labeling, Incubation, Recombinant, Protein Concentration, Software, Fluorescence

    38) Product Images from "The La protein counteracts cisplatin-induced cell death by stimulating protein synthesis of anti-apoptotic factor Bcl2"

    Article Title: The La protein counteracts cisplatin-induced cell death by stimulating protein synthesis of anti-apoptotic factor Bcl2

    Journal: Oncotarget

    doi: 10.18632/oncotarget.8819

    The RNA chaperone La assists structural changes of the Bcl2 translation start site in vitro A. The RNA chaperone domain (RCD) of La is mutated in LaΔRCD [ 21 ). RNA-binding motifs: LAM, RRM1, and RRM2. Scheme representing the RNA chaperone assay and the predicted structure of the Bcl2 RNA used as molecular beacon (Bcl2-MB). B. Differences in RNA chaperone activity given in relative fluorescence units (arbitrary units = AU) in the presence of 300 nM La wildtype protein (LaWT) compared to the molecular beacon (Bcl2-MB) alone or in presence of 300 nM recombinant La protein with mutated RNA chaperone domain (LaΔRCD). P value
    Figure Legend Snippet: The RNA chaperone La assists structural changes of the Bcl2 translation start site in vitro A. The RNA chaperone domain (RCD) of La is mutated in LaΔRCD [ 21 ). RNA-binding motifs: LAM, RRM1, and RRM2. Scheme representing the RNA chaperone assay and the predicted structure of the Bcl2 RNA used as molecular beacon (Bcl2-MB). B. Differences in RNA chaperone activity given in relative fluorescence units (arbitrary units = AU) in the presence of 300 nM La wildtype protein (LaWT) compared to the molecular beacon (Bcl2-MB) alone or in presence of 300 nM recombinant La protein with mutated RNA chaperone domain (LaΔRCD). P value

    Techniques Used: In Vitro, RNA Binding Assay, Laser Capture Microdissection, Activity Assay, Fluorescence, Recombinant

    Bcl2 protein expression is reduced by siRNA-mediated La depletion or transient expression of La dominant negative (LaDN) mutant in cells A. Scheme of LaDN mutant compared to La wildtype containing three RNA-binding motifs: LAM, RRM1, and RRM2. B. Fluorescence microscopic image of gfp or LaDN mutant expression in living SCC 22B cells. La depletion in SCC 22B cells by C-E. transient expression of La dominant negative (LaDN) mutant or F-H. La-specific siRNA (La siRNA), results in increased cisplatin-induced apoptosis (Annexin/PI-positive cells) after cisplatin treatment with 24 μM for 24 hours, reduced Bcl2 protein expression (GAPDH = loading control), and unchanged Bcl2 mRNA level as determined by RT-qPCR analysis and normalized to GAPDH mRNA. Con = control siRNA. P value
    Figure Legend Snippet: Bcl2 protein expression is reduced by siRNA-mediated La depletion or transient expression of La dominant negative (LaDN) mutant in cells A. Scheme of LaDN mutant compared to La wildtype containing three RNA-binding motifs: LAM, RRM1, and RRM2. B. Fluorescence microscopic image of gfp or LaDN mutant expression in living SCC 22B cells. La depletion in SCC 22B cells by C-E. transient expression of La dominant negative (LaDN) mutant or F-H. La-specific siRNA (La siRNA), results in increased cisplatin-induced apoptosis (Annexin/PI-positive cells) after cisplatin treatment with 24 μM for 24 hours, reduced Bcl2 protein expression (GAPDH = loading control), and unchanged Bcl2 mRNA level as determined by RT-qPCR analysis and normalized to GAPDH mRNA. Con = control siRNA. P value

    Techniques Used: Expressing, Dominant Negative Mutation, Mutagenesis, RNA Binding Assay, Laser Capture Microdissection, Fluorescence, Quantitative RT-PCR

    The La protein binds to a region of Bcl2 mRNA embedding the authentic translation start site A. Upper panel: RNA immuoprecipitation (RIP) applying a La-specific antibody followed by Bcl2-specific RT-PCR in three different cell lines (immunoblot (IB)). Lower panel: RIP followed by RT-qPCR analysis was performed in triplicates on RNA extracted from RIP pellets. Cell extracts for RIP experiments were prepared from HEK 293 cells stably transfected with gfp alone (control) or gfp-tagged La. None of the target mRNAs analyzed were detected in cells expressing gfp alone. Relative enrichment of target mRNA compared to GAPDH mRNA was calculated (n = 3). B. Scheme of Bcl2 RNA probes (FL, P1, P2) applied for RNA pull-down assays, and La-specific immunoblot (IB) following Bcl2 RNA pull down from SCC 22A and SCC 22B cell lysates. Data shown are representative of three independent experiments (n = 3). No RNA probe was added in the control (C). C. Binding affinity of La:Bcl2 RNA oligonucleotide interaction as determined by electrophoretic mobility shift assay (EMSA). The 5′FAM-labeled Bcl2 RNA oligonucleotide (25 nM) was incubated with increasing amounts of recombinant La protein in a range from 0 to 600 nM and separated by a native EMSA. D. The La:RNA complex formation is plotted against the La protein concentration. The dissociation constant (K D ) was determined as 50.5+/−5.9 nM (n = 3) in Prism 5 (GraphPad Software). E. Competitive fluorescence polarization assay using 5′FAM-labeled Bcl2 RNA oligonucleotides and different unlabeled competitor RNA oligonucleotides at 4-, 10-, 40-, or 80-fold excess. P value
    Figure Legend Snippet: The La protein binds to a region of Bcl2 mRNA embedding the authentic translation start site A. Upper panel: RNA immuoprecipitation (RIP) applying a La-specific antibody followed by Bcl2-specific RT-PCR in three different cell lines (immunoblot (IB)). Lower panel: RIP followed by RT-qPCR analysis was performed in triplicates on RNA extracted from RIP pellets. Cell extracts for RIP experiments were prepared from HEK 293 cells stably transfected with gfp alone (control) or gfp-tagged La. None of the target mRNAs analyzed were detected in cells expressing gfp alone. Relative enrichment of target mRNA compared to GAPDH mRNA was calculated (n = 3). B. Scheme of Bcl2 RNA probes (FL, P1, P2) applied for RNA pull-down assays, and La-specific immunoblot (IB) following Bcl2 RNA pull down from SCC 22A and SCC 22B cell lysates. Data shown are representative of three independent experiments (n = 3). No RNA probe was added in the control (C). C. Binding affinity of La:Bcl2 RNA oligonucleotide interaction as determined by electrophoretic mobility shift assay (EMSA). The 5′FAM-labeled Bcl2 RNA oligonucleotide (25 nM) was incubated with increasing amounts of recombinant La protein in a range from 0 to 600 nM and separated by a native EMSA. D. The La:RNA complex formation is plotted against the La protein concentration. The dissociation constant (K D ) was determined as 50.5+/−5.9 nM (n = 3) in Prism 5 (GraphPad Software). E. Competitive fluorescence polarization assay using 5′FAM-labeled Bcl2 RNA oligonucleotides and different unlabeled competitor RNA oligonucleotides at 4-, 10-, 40-, or 80-fold excess. P value

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR, Stable Transfection, Transfection, Expressing, Binding Assay, Electrophoretic Mobility Shift Assay, Labeling, Incubation, Recombinant, Protein Concentration, Software, Fluorescence

    39) Product Images from "HlyU Is a Positive Regulator of Hemolysin Expression in Vibrio anguillarum ▿"

    Article Title: HlyU Is a Positive Regulator of Hemolysin Expression in Vibrio anguillarum ▿

    Journal: Journal of Bacteriology

    doi: 10.1128/JB.01033-10

    Capillary electrophoresis of 6-FAM-labeled DNA fragments b (A) and f (B) from DNase protection assays in the presence (gray traces) and absence (black traces) of HlyU, demonstrating that HlyU binds to specific sequences in fragments b and f of the rtxACHBDE
    Figure Legend Snippet: Capillary electrophoresis of 6-FAM-labeled DNA fragments b (A) and f (B) from DNase protection assays in the presence (gray traces) and absence (black traces) of HlyU, demonstrating that HlyU binds to specific sequences in fragments b and f of the rtxACHBDE

    Techniques Used: Electrophoresis, Labeling

    40) Product Images from "HlyU Is a Positive Regulator of Hemolysin Expression in Vibrio anguillarum ▿"

    Article Title: HlyU Is a Positive Regulator of Hemolysin Expression in Vibrio anguillarum ▿

    Journal: Journal of Bacteriology

    doi: 10.1128/JB.01033-10

    DNase I protection assay.
    Figure Legend Snippet: DNase I protection assay.

    Techniques Used:

    Related Articles

    High Performance Liquid Chromatography:

    Article Title: Multiplex Real-Time PCR for Rapid Staphylococcal Cassette Chromosome mec Typing ▿
    Article Snippet: .. Molecular beacon probes were obtained from Biosearch Technologies (Novato, CA) and purified by high-performance liquid chromatography as described elsewhere ( ); oligonucleotide primers were obtained from Integrated DNA Technologies (Coralville, IA). ..

    Article Title: Pre-clinical Safety and Off-Target Studies to Support Translation of AAV-Mediated RNAi Therapy for FSHD
    Article Snippet: .. The DNA molecular beacons were synthesized (Integrated DNA Technologies), and each molecular beacon had a density close to 3 OD and was purified using high-performance liquid chromatography (HPLC). ..

    Synthesized:

    Article Title: The La protein counteracts cisplatin-induced cell death by stimulating protein synthesis of anti-apoptotic factor Bcl2
    Article Snippet: .. RNA chaperone assay The Bcl2 RNA molecular beacon Bcl2-MB was synthesized, 5′-end labeled with the fluorophore 6-carboxyfluorescin (FAM), and 3′end labeled with a quencher (Dabcyl) by Integrated DNA Technologies, Inc.: /56-FAM/CCCGUUGCUUUUCCUCUGGGAAGGAUGGCGCACGCUGGG/3Dab/. ..

    Article Title: Pre-clinical Safety and Off-Target Studies to Support Translation of AAV-Mediated RNAi Therapy for FSHD
    Article Snippet: .. The DNA molecular beacons were synthesized (Integrated DNA Technologies), and each molecular beacon had a density close to 3 OD and was purified using high-performance liquid chromatography (HPLC). ..

    Labeling:

    Article Title: The La protein counteracts cisplatin-induced cell death by stimulating protein synthesis of anti-apoptotic factor Bcl2
    Article Snippet: .. RNA chaperone assay The Bcl2 RNA molecular beacon Bcl2-MB was synthesized, 5′-end labeled with the fluorophore 6-carboxyfluorescin (FAM), and 3′end labeled with a quencher (Dabcyl) by Integrated DNA Technologies, Inc.: /56-FAM/CCCGUUGCUUUUCCUCUGGGAAGGAUGGCGCACGCUGGG/3Dab/. ..

    Purification:

    Article Title: Multiplex Real-Time PCR for Rapid Staphylococcal Cassette Chromosome mec Typing ▿
    Article Snippet: .. Molecular beacon probes were obtained from Biosearch Technologies (Novato, CA) and purified by high-performance liquid chromatography as described elsewhere ( ); oligonucleotide primers were obtained from Integrated DNA Technologies (Coralville, IA). ..

    Article Title: Pre-clinical Safety and Off-Target Studies to Support Translation of AAV-Mediated RNAi Therapy for FSHD
    Article Snippet: .. The DNA molecular beacons were synthesized (Integrated DNA Technologies), and each molecular beacon had a density close to 3 OD and was purified using high-performance liquid chromatography (HPLC). ..

    IA:

    Article Title: Multiplex Real-Time PCR for Rapid Staphylococcal Cassette Chromosome mec Typing ▿
    Article Snippet: .. Molecular beacon probes were obtained from Biosearch Technologies (Novato, CA) and purified by high-performance liquid chromatography as described elsewhere ( ); oligonucleotide primers were obtained from Integrated DNA Technologies (Coralville, IA). ..

    Article Title: Multiplex Real-Time PCR Assays that Measure the Abundance of Extremely Rare Mutations Associated with Cancer
    Article Snippet: .. Primers and molecular beacons SuperSelective primer sequences were examined with the aid of the Mfold web server [ ] and the OligoAnalyzer computer program (Integrated DNA Technologies, Coralville, IA) to ensure that under assay conditions they are unlikely to form internal hairpin structures, and are unlikely to form self-dimers or heterodimers with the conventional reverse primers. .. The primers were purchased from Integrated DNA Technologies; and the differently colored molecular beacon probes for detecting the amplicons were purchased from Biosearch Technologies (Petaluma, CA).

    Article Title: The Phenolic Glycolipid of Mycobacterium tuberculosis Differentially Modulates the Early Host Cytokine Response but Does Not in Itself Confer Hypervirulence
    Article Snippet: .. Molecular beacon probes were obtained from Biosearch Technologies (Novato, CA), and oligonucleotide primers were obtained from Integrated DNA Technologies (Coralville, IA). .. Molecular beacons ( ) and oligonucleotide primers were designed using the Beacon Designer 2.0 software (Premier Biosoft International, Palo Alto, CA) and mfold, the Zuker DNA folding program ( ).

    Article Title: Simultaneous visualization of the subfemtomolar expression of microRNA and microRNA target gene using HILO microscopy visualization of the subfemtomolar expression of microRNA and microRNA target gene using HILO microscopy †Electronic supplementary information (ESI) available: The LED device for the sample
    Article Snippet: .. The synthetic RNA (miR-10b-3p), and Cy5-Iowa Black RQ-Sp-labelled molecular beacon used in this work were purchased from Integrated DNA Technologies (Coralville, IA, USA). .. The Alexa Fluor 488-BHQ1-labelled molecular beacon for HOXD10 mRNA probing was purchased from IBA Lifesciences (Goettingen, Germany), and the 6FAM-BHQ1-labelled molecular beacon for the hybridization of the U6 housekeeping gene was obtained from Sigma-Aldrich.

    Sequencing:

    Article Title: Design and development of a field-deployable single-molecule detector (SMD) for the analysis of molecular markers †
    Article Snippet: .. Oligonucleotides used to probe for the bacterial genomes and generate molecular beacons (MBs) were purchased from Integrated DNA Technologies (Coralville, Iowa) with a custom sequence (5′- GCACG AAAGCCTGACGGAGCAACGCCGCGTGAGTGATGA CGTGC -3′, where the underlined section designates the complementary stem sections of the MB). .. The 5′ end was modified with a TYE 665 fluorescent dye and the 3′ end was modified with Iowa Black RQ-Sp quencher.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85
    Integrated DNA Technologies 6 fam durgdgda 6 tamra
    pH– k cat / K M profile for the cleavage of <t>6-FAM–dArUdGdA–6-TAMRA</t> by ONC. Assays were performed at 23 °C in 1.0 mM buffer containing NaCl (1.0 M). Determination of k cat / K M values was performed in triplicate. Data were fitted
    6 Fam Durgdgda 6 Tamra, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam durgdgda 6 tamra/product/Integrated DNA Technologies
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    6 fam durgdgda 6 tamra - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    85
    Integrated DNA Technologies 6 fam dargdgda 6 tamra
    pH– k cat / K M profile for the cleavage of <t>6-FAM–dArUdGdA–6-TAMRA</t> by ONC. Assays were performed at 23 °C in 1.0 mM buffer containing NaCl (1.0 M). Determination of k cat / K M values was performed in triplicate. Data were fitted
    6 Fam Dargdgda 6 Tamra, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam dargdgda 6 tamra/product/Integrated DNA Technologies
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    6 fam dargdgda 6 tamra - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    90
    Integrated DNA Technologies 6 fam fluorophore label
    Ccr4–Not is inhibited by 3′ guanosines. a , Denaturing RNA gels showing deadenylation by recombinant S. pombe Ccr4–Not on 5′ <t>6-FAM-labeled</t> (green star) RNA substrates consisting of a 20mer non-poly(A) sequence (See Fig. 1a ) followed by 30 adenosines. Where indicated, the substrate contains three additional non-A nucleotides at the 3′ end. These gels are representative of identical experiments performed 3 times. Uncropped gel images are shown in Supplementary Data Set 1. b-d , Analysis of deadenylation on poly(A) substrates with different 3′ nucleotides. Disappearance of the intact substrate was quantified by densitometry of the fluorescently labeled, full-length RNA. Data points were normalized to time = 0, and are connected by straight lines for clarity. Assays were carried out in triplicate (n = 3 independent experiments), the data points shown represent the mean, and error bars represent standard deviation. Assays are shown for wild-type S. pombe Ccr4–Not ( b ), Ccr4-inactive Ccr4–Not ( c ) and Caf1-inactive Ccr4–Not ( d ).
    6 Fam Fluorophore Label, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 90/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam fluorophore label/product/Integrated DNA Technologies
    Average 90 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    6 fam fluorophore label - by Bioz Stars, 2020-08
    90/100 stars
      Buy from Supplier

    92
    Integrated DNA Technologies 6 fam label
    Oligomerization and substrate binding assays of hCtc1. ( A ) The oligomeric state of hCtc1(OB) was analyzed by SEC-MALS. The blue line corresponds to the Refractive Index (RI) of the hCtc1(OB) eluting from the SEC column. The red circles correspond to the molecular mass of hCtc1(OB) measured by multi-angle, light scattering (MALS: red). The data suggest that hCtc1(OB) is monomeric in solution. ( B ) Cross linking experiments of WT hCtc1(OB) using formaldehyde or glutaraldehyde also shows that this domain hCtc1 is monomeric in solution. ( C ) FP assays of hCtc1(OB) with 5′ <t>6-FAM</t> (Fluorescein) labeled, single-stranded telomeric DNA (two or three repeats) shows that this domain of hCtc1 is not involved in DNA binding. ( D ) ITC assay of hCtc1(OB) with the full length Stn1–Ten1 complex show no measurable interaction.
    6 Fam Label, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 92/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam label/product/Integrated DNA Technologies
    Average 92 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    6 fam label - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    Image Search Results


    pH– k cat / K M profile for the cleavage of 6-FAM–dArUdGdA–6-TAMRA by ONC. Assays were performed at 23 °C in 1.0 mM buffer containing NaCl (1.0 M). Determination of k cat / K M values was performed in triplicate. Data were fitted

    Journal:

    Article Title: Structural Basis for Catalysis by Onconase

    doi: 10.1016/j.jmb.2007.09.089

    Figure Lengend Snippet: pH– k cat / K M profile for the cleavage of 6-FAM–dArUdGdA–6-TAMRA by ONC. Assays were performed at 23 °C in 1.0 mM buffer containing NaCl (1.0 M). Determination of k cat / K M values was performed in triplicate. Data were fitted

    Article Snippet: 6-Carboxyfluorescein–dArUdAdA–6-carboxytetramethylrhodamine (6-FAM–dArUdAdA–6-TAMRA), 6-FAM–dArUdGdA–6-TAMRA, 6-FAM–dUrGdGdA–6-TAMRA, and 6-FAM–dArGdGdA–6-TAMRA were from Integrated DNA Technologies (Coralville, IA).

    Techniques:

    Effect of Thr89 and Glu91 on the substrate specificity of ONC. Bars indicate the effect of replacing Thr89 or Glu91 on the value of k cat / K M for the cleavage of 6-FAM–dArUdGdA–6-TAMRA (UpG) and 6-FAM–dArUdAdA–6-TAMRA (UpA).

    Journal:

    Article Title: Structural Basis for Catalysis by Onconase

    doi: 10.1016/j.jmb.2007.09.089

    Figure Lengend Snippet: Effect of Thr89 and Glu91 on the substrate specificity of ONC. Bars indicate the effect of replacing Thr89 or Glu91 on the value of k cat / K M for the cleavage of 6-FAM–dArUdGdA–6-TAMRA (UpG) and 6-FAM–dArUdAdA–6-TAMRA (UpA).

    Article Snippet: 6-Carboxyfluorescein–dArUdAdA–6-carboxytetramethylrhodamine (6-FAM–dArUdAdA–6-TAMRA), 6-FAM–dArUdGdA–6-TAMRA, 6-FAM–dUrGdGdA–6-TAMRA, and 6-FAM–dArGdGdA–6-TAMRA were from Integrated DNA Technologies (Coralville, IA).

    Techniques:

    pH– k cat / K M profile for the cleavage of 6-FAM–dArUdGdA–6-TAMRA by ONC. Assays were performed at 23 °C in 1.0 mM buffer containing NaCl (1.0 M). Determination of k cat / K M values was performed in triplicate. Data were fitted

    Journal:

    Article Title: Structural Basis for Catalysis by Onconase

    doi: 10.1016/j.jmb.2007.09.089

    Figure Lengend Snippet: pH– k cat / K M profile for the cleavage of 6-FAM–dArUdGdA–6-TAMRA by ONC. Assays were performed at 23 °C in 1.0 mM buffer containing NaCl (1.0 M). Determination of k cat / K M values was performed in triplicate. Data were fitted

    Article Snippet: We also assessed the catalytic activity of wild-type ONC toward two novel ONC substrates, each containing a single cleavable guanosine–guanosine phosphodiester bond: 6-FAM–dUrGdGdA–6-TAMRA and 6-FAM–dArGdGdA–6-TAMRA.

    Techniques:

    Effect of Thr89 and Glu91 on the substrate specificity of ONC. Bars indicate the effect of replacing Thr89 or Glu91 on the value of k cat / K M for the cleavage of 6-FAM–dArUdGdA–6-TAMRA (UpG) and 6-FAM–dArUdAdA–6-TAMRA (UpA).

    Journal:

    Article Title: Structural Basis for Catalysis by Onconase

    doi: 10.1016/j.jmb.2007.09.089

    Figure Lengend Snippet: Effect of Thr89 and Glu91 on the substrate specificity of ONC. Bars indicate the effect of replacing Thr89 or Glu91 on the value of k cat / K M for the cleavage of 6-FAM–dArUdGdA–6-TAMRA (UpG) and 6-FAM–dArUdAdA–6-TAMRA (UpA).

    Article Snippet: We also assessed the catalytic activity of wild-type ONC toward two novel ONC substrates, each containing a single cleavable guanosine–guanosine phosphodiester bond: 6-FAM–dUrGdGdA–6-TAMRA and 6-FAM–dArGdGdA–6-TAMRA.

    Techniques:

    Ccr4–Not is inhibited by 3′ guanosines. a , Denaturing RNA gels showing deadenylation by recombinant S. pombe Ccr4–Not on 5′ 6-FAM-labeled (green star) RNA substrates consisting of a 20mer non-poly(A) sequence (See Fig. 1a ) followed by 30 adenosines. Where indicated, the substrate contains three additional non-A nucleotides at the 3′ end. These gels are representative of identical experiments performed 3 times. Uncropped gel images are shown in Supplementary Data Set 1. b-d , Analysis of deadenylation on poly(A) substrates with different 3′ nucleotides. Disappearance of the intact substrate was quantified by densitometry of the fluorescently labeled, full-length RNA. Data points were normalized to time = 0, and are connected by straight lines for clarity. Assays were carried out in triplicate (n = 3 independent experiments), the data points shown represent the mean, and error bars represent standard deviation. Assays are shown for wild-type S. pombe Ccr4–Not ( b ), Ccr4-inactive Ccr4–Not ( c ) and Caf1-inactive Ccr4–Not ( d ).

    Journal: Nature structural & molecular biology

    Article Title: The intrinsic structure of poly(A) RNA determines the specificity of Pan2 and Caf1 deadenylases

    doi: 10.1038/s41594-019-0227-9

    Figure Lengend Snippet: Ccr4–Not is inhibited by 3′ guanosines. a , Denaturing RNA gels showing deadenylation by recombinant S. pombe Ccr4–Not on 5′ 6-FAM-labeled (green star) RNA substrates consisting of a 20mer non-poly(A) sequence (See Fig. 1a ) followed by 30 adenosines. Where indicated, the substrate contains three additional non-A nucleotides at the 3′ end. These gels are representative of identical experiments performed 3 times. Uncropped gel images are shown in Supplementary Data Set 1. b-d , Analysis of deadenylation on poly(A) substrates with different 3′ nucleotides. Disappearance of the intact substrate was quantified by densitometry of the fluorescently labeled, full-length RNA. Data points were normalized to time = 0, and are connected by straight lines for clarity. Assays were carried out in triplicate (n = 3 independent experiments), the data points shown represent the mean, and error bars represent standard deviation. Assays are shown for wild-type S. pombe Ccr4–Not ( b ), Ccr4-inactive Ccr4–Not ( c ) and Caf1-inactive Ccr4–Not ( d ).

    Article Snippet: 20mer-A30 (20mer: CAGCUCCGCAUCCCUUUCCC) with varied 3′ ends and intervening nucleotides were synthesized with a 5′ 6-FAM fluorophore label (Integrated DNA Technologies or, for 20mer-A14 DDA14 , Dharmacon).

    Techniques: Recombinant, Labeling, Sequencing, Standard Deviation

    Nucleotide base stacking is required for Pan2 and Caf1 deadenylase activity. Denaturing RNA gels showing deadenylation by ( a-d ) S. cerevisiae Pan2 UCH-Exo or ( e-h ) S. pombe Ccr4-inactive Ccr4–Not on 5′ 6-FAM-labeled (green star) RNAs consisting of a 20mer non-poly(A) sequence (see Fig. 1a ) followed by the indicated tail sequence. RNAs either had no additional nucleotides ( a , e ), two guanosines ( b , f ), two uracils ( c, g ), or two dihydrouracils (abbreviated D, panels d , h ) in the middle of the poly(A) tail. Red asterisks indicate the point of inhibition. Both Pan2 and Caf1 were strongly inhibited by guanosines and dihydrouracils interrupting a poly(A) tail. These gels are representative of identical experiments performed 2 times. Uncropped gel images are shown in Supplementary Data Set 1.

    Journal: Nature structural & molecular biology

    Article Title: The intrinsic structure of poly(A) RNA determines the specificity of Pan2 and Caf1 deadenylases

    doi: 10.1038/s41594-019-0227-9

    Figure Lengend Snippet: Nucleotide base stacking is required for Pan2 and Caf1 deadenylase activity. Denaturing RNA gels showing deadenylation by ( a-d ) S. cerevisiae Pan2 UCH-Exo or ( e-h ) S. pombe Ccr4-inactive Ccr4–Not on 5′ 6-FAM-labeled (green star) RNAs consisting of a 20mer non-poly(A) sequence (see Fig. 1a ) followed by the indicated tail sequence. RNAs either had no additional nucleotides ( a , e ), two guanosines ( b , f ), two uracils ( c, g ), or two dihydrouracils (abbreviated D, panels d , h ) in the middle of the poly(A) tail. Red asterisks indicate the point of inhibition. Both Pan2 and Caf1 were strongly inhibited by guanosines and dihydrouracils interrupting a poly(A) tail. These gels are representative of identical experiments performed 2 times. Uncropped gel images are shown in Supplementary Data Set 1.

    Article Snippet: 20mer-A30 (20mer: CAGCUCCGCAUCCCUUUCCC) with varied 3′ ends and intervening nucleotides were synthesized with a 5′ 6-FAM fluorophore label (Integrated DNA Technologies or, for 20mer-A14 DDA14 , Dharmacon).

    Techniques: Activity Assay, Labeling, Sequencing, Inhibition

    3′ guanosines inhibit the Pan2 exonuclease. a, Denaturing RNA gels showing deadenylation by recombinant S. cerevisiae Pan2–Pan3 on 5′ 6-FAM-labeled (green star) RNA substrates consisting of a 20mer non-poly(A) sequence (shown above) followed by a poly(A) tail of 30 adenosines. Where indicated, the substrate contains three additional non-A nucleotides at the 3′ end. These gels are representative of identical experiments performed 3 times. Uncropped gel images are shown in Supplementary Data Set 1. b-e, Analysis of deadenylation on poly(A) substrates with different 3′ nucleotides. Disappearance of the intact substrate was quantified by densitometry of the fluorescently labeled, full-length RNA. Data points were normalized to time = 0, and are connected by straight lines for clarity. Assays were carried out in triplicate (n = 3 independent experiments), the data points shown represent the mean, and error bars represent standard deviation. Assays are shown for full-length S. cerevisiae Pan2–Pan3 ( b, e ); H. sapiens PAN2–PAN3∆N278 ( c ); and S. cerevisiae Pan2 UCH-Exo (residues 461-1115) ( d ).

    Journal: Nature structural & molecular biology

    Article Title: The intrinsic structure of poly(A) RNA determines the specificity of Pan2 and Caf1 deadenylases

    doi: 10.1038/s41594-019-0227-9

    Figure Lengend Snippet: 3′ guanosines inhibit the Pan2 exonuclease. a, Denaturing RNA gels showing deadenylation by recombinant S. cerevisiae Pan2–Pan3 on 5′ 6-FAM-labeled (green star) RNA substrates consisting of a 20mer non-poly(A) sequence (shown above) followed by a poly(A) tail of 30 adenosines. Where indicated, the substrate contains three additional non-A nucleotides at the 3′ end. These gels are representative of identical experiments performed 3 times. Uncropped gel images are shown in Supplementary Data Set 1. b-e, Analysis of deadenylation on poly(A) substrates with different 3′ nucleotides. Disappearance of the intact substrate was quantified by densitometry of the fluorescently labeled, full-length RNA. Data points were normalized to time = 0, and are connected by straight lines for clarity. Assays were carried out in triplicate (n = 3 independent experiments), the data points shown represent the mean, and error bars represent standard deviation. Assays are shown for full-length S. cerevisiae Pan2–Pan3 ( b, e ); H. sapiens PAN2–PAN3∆N278 ( c ); and S. cerevisiae Pan2 UCH-Exo (residues 461-1115) ( d ).

    Article Snippet: 20mer-A30 (20mer: CAGCUCCGCAUCCCUUUCCC) with varied 3′ ends and intervening nucleotides were synthesized with a 5′ 6-FAM fluorophore label (Integrated DNA Technologies or, for 20mer-A14 DDA14 , Dharmacon).

    Techniques: Recombinant, Labeling, Sequencing, Standard Deviation

    Oligomerization and substrate binding assays of hCtc1. ( A ) The oligomeric state of hCtc1(OB) was analyzed by SEC-MALS. The blue line corresponds to the Refractive Index (RI) of the hCtc1(OB) eluting from the SEC column. The red circles correspond to the molecular mass of hCtc1(OB) measured by multi-angle, light scattering (MALS: red). The data suggest that hCtc1(OB) is monomeric in solution. ( B ) Cross linking experiments of WT hCtc1(OB) using formaldehyde or glutaraldehyde also shows that this domain hCtc1 is monomeric in solution. ( C ) FP assays of hCtc1(OB) with 5′ 6-FAM (Fluorescein) labeled, single-stranded telomeric DNA (two or three repeats) shows that this domain of hCtc1 is not involved in DNA binding. ( D ) ITC assay of hCtc1(OB) with the full length Stn1–Ten1 complex show no measurable interaction.

    Journal: Nucleic Acids Research

    Article Title: Structural and functional analysis of an OB-fold in human Ctc1 implicated in telomere maintenance and bone marrow syndromes

    doi: 10.1093/nar/gkx1213

    Figure Lengend Snippet: Oligomerization and substrate binding assays of hCtc1. ( A ) The oligomeric state of hCtc1(OB) was analyzed by SEC-MALS. The blue line corresponds to the Refractive Index (RI) of the hCtc1(OB) eluting from the SEC column. The red circles correspond to the molecular mass of hCtc1(OB) measured by multi-angle, light scattering (MALS: red). The data suggest that hCtc1(OB) is monomeric in solution. ( B ) Cross linking experiments of WT hCtc1(OB) using formaldehyde or glutaraldehyde also shows that this domain hCtc1 is monomeric in solution. ( C ) FP assays of hCtc1(OB) with 5′ 6-FAM (Fluorescein) labeled, single-stranded telomeric DNA (two or three repeats) shows that this domain of hCtc1 is not involved in DNA binding. ( D ) ITC assay of hCtc1(OB) with the full length Stn1–Ten1 complex show no measurable interaction.

    Article Snippet: The 12mer DNA probe (TTAGGGTTAGGG) and 18mer DNA probe (TTAGGGTTAGGGTTAGGG) was purchased with a 5′ 6-FAM label from Integrated DNA Technologies.

    Techniques: Binding Assay, Size-exclusion Chromatography, Labeling, Isothermal Titration Calorimetry