6 fam label  (Integrated DNA Technologies)


Bioz Verified Symbol Integrated DNA Technologies is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 84

    Structured Review

    Integrated DNA Technologies 6 fam label
    IP-FM analysis of naRNA4- and HU-mediated DNA condensation using syn- cr DNA. ( A ) An expected secondary structure of syn- cr DNA. The DNA was synthesized and labeled with <t>6-FAM</t> at 5′. ( B ) Fluorescence polarization and HU binding to syn- cr DNA. Different concentrations of HU protein (0–640 nM) were added to 1 nM 6-FAM–syn- cr DNA. After incubation at room temperature for 10 min, fluorescence polarization (in units of mP) was obtained and plotted as a function of HU concentration. Data analysis was carried out with Prism 7. Error bars show SD of triplicate experiments. The determined K d is 7.9 nM. ( C ) Typical FM images. The components in different assays are in the margins. The fluorescent images were processed by ImageJ. The images are representative of three experiments. (Scale bar: 1 μm.)
    6 Fam Label, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 84/100, based on 70 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam label/product/Integrated DNA Technologies
    Average 84 stars, based on 70 article reviews
    Price from $9.99 to $1999.99
    6 fam label - by Bioz Stars, 2020-01
    84/100 stars

    Images

    1) Product Images from "DNA–RNA interactions are critical for chromosome condensation in Escherichia coli"

    Article Title: DNA–RNA interactions are critical for chromosome condensation in Escherichia coli

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.1711285114

    IP-FM analysis of naRNA4- and HU-mediated DNA condensation using syn- cr DNA. ( A ) An expected secondary structure of syn- cr DNA. The DNA was synthesized and labeled with 6-FAM at 5′. ( B ) Fluorescence polarization and HU binding to syn- cr DNA. Different concentrations of HU protein (0–640 nM) were added to 1 nM 6-FAM–syn- cr DNA. After incubation at room temperature for 10 min, fluorescence polarization (in units of mP) was obtained and plotted as a function of HU concentration. Data analysis was carried out with Prism 7. Error bars show SD of triplicate experiments. The determined K d is 7.9 nM. ( C ) Typical FM images. The components in different assays are in the margins. The fluorescent images were processed by ImageJ. The images are representative of three experiments. (Scale bar: 1 μm.)
    Figure Legend Snippet: IP-FM analysis of naRNA4- and HU-mediated DNA condensation using syn- cr DNA. ( A ) An expected secondary structure of syn- cr DNA. The DNA was synthesized and labeled with 6-FAM at 5′. ( B ) Fluorescence polarization and HU binding to syn- cr DNA. Different concentrations of HU protein (0–640 nM) were added to 1 nM 6-FAM–syn- cr DNA. After incubation at room temperature for 10 min, fluorescence polarization (in units of mP) was obtained and plotted as a function of HU concentration. Data analysis was carried out with Prism 7. Error bars show SD of triplicate experiments. The determined K d is 7.9 nM. ( C ) Typical FM images. The components in different assays are in the margins. The fluorescent images were processed by ImageJ. The images are representative of three experiments. (Scale bar: 1 μm.)

    Techniques Used: Synthesized, Labeling, Fluorescence, Binding Assay, Incubation, Concentration Assay

    Confirmation of a chaperone role of HU in naRNA4/HU-mediated DNA condensation. ( A ) IP-Western blot analysis of HU in condensation complexes. M, Molecular weight protein markers. Different concentrations of HU (5, 10, 20, and 40 ng, lanes 1–4, respectively) were loaded as positive controls. S (lanes 5, 7, and 9) and E (lanes 6, 8, and 10) represent the supernatants and eluates from the beads, respectively. The components of the assays are labeled at the top. ( B ) IP/IP-PCR analysis of plasmid DNA in condensation complexes. The reaction mixtures of condensation assays were incubated with anti-HU antibody, resulting in supernatants (S) and eluates (E). Supernatants (S) were further incubated with S9.6 antibody, resulting in supernatants (S/S) and eluates (S/E). DNA was extracted and purified from the solutions and analyzed by 1.5% agarose gel after PCR using pSA508-targeted primers. ( C ) IP/IP FM analysis of Cy-3–naRNA4 and 6-FAM–syn- cr DNA in condensation complexes. The components are in the left margins. Beads were washed with buffer three times before imaging. Images were processed by ImageJ. The images are representative of triplicate experiments. n/a, not applicable. (Scale bar: 1 μm.) ( D ). Among them are the formation of kissing DNA–RNA loops, parallel DNA–RNA heteroduplexes, Watson/Crick base pairing between some parts of the DNA and naRNA4 hairpin stems and hook-like connections between cruciform DNA loops and single-stranded naRNA4 loops. We are currently investigating the possible presence of any of these complexes in the DNA condensates.
    Figure Legend Snippet: Confirmation of a chaperone role of HU in naRNA4/HU-mediated DNA condensation. ( A ) IP-Western blot analysis of HU in condensation complexes. M, Molecular weight protein markers. Different concentrations of HU (5, 10, 20, and 40 ng, lanes 1–4, respectively) were loaded as positive controls. S (lanes 5, 7, and 9) and E (lanes 6, 8, and 10) represent the supernatants and eluates from the beads, respectively. The components of the assays are labeled at the top. ( B ) IP/IP-PCR analysis of plasmid DNA in condensation complexes. The reaction mixtures of condensation assays were incubated with anti-HU antibody, resulting in supernatants (S) and eluates (E). Supernatants (S) were further incubated with S9.6 antibody, resulting in supernatants (S/S) and eluates (S/E). DNA was extracted and purified from the solutions and analyzed by 1.5% agarose gel after PCR using pSA508-targeted primers. ( C ) IP/IP FM analysis of Cy-3–naRNA4 and 6-FAM–syn- cr DNA in condensation complexes. The components are in the left margins. Beads were washed with buffer three times before imaging. Images were processed by ImageJ. The images are representative of triplicate experiments. n/a, not applicable. (Scale bar: 1 μm.) ( D ). Among them are the formation of kissing DNA–RNA loops, parallel DNA–RNA heteroduplexes, Watson/Crick base pairing between some parts of the DNA and naRNA4 hairpin stems and hook-like connections between cruciform DNA loops and single-stranded naRNA4 loops. We are currently investigating the possible presence of any of these complexes in the DNA condensates.

    Techniques Used: Western Blot, Molecular Weight, Labeling, Polymerase Chain Reaction, Plasmid Preparation, Incubation, Purification, Agarose Gel Electrophoresis, Imaging

    Flowchart of IP in combination with PCR ( A ) and IP in combination with FM ( B ). ( A ) In an IPP assay, Cy-3–labeled RNA (naRNA4 or its variants) was mixed with HU and plasmid DNA. Following condensation, the solution was incubated with S9.6 antibody-coated beads. After collecting the supernatant (S), the beads were then washed with buffer. Eluate (E) from beads was collected. DNA was extracted from both S and E by the phenol and ethanol method. PCR was carried out using specific primers targeted to plasmid DNA. Finally, the amplification products were separated by agarose gel and examined. ( B ) In IPFM assay, Cy-3–labeled RNA (naRNA4 or its variants) was mixed with HU and DNA (either plasmid DNA or 6-FAM–labeled cruciform DNA). Following condensation, the solution was incubated with S9.6 antibody-coated silica beads. The supernatant was discarded. The beads washed with buffer were then delivered to FM for imaging.
    Figure Legend Snippet: Flowchart of IP in combination with PCR ( A ) and IP in combination with FM ( B ). ( A ) In an IPP assay, Cy-3–labeled RNA (naRNA4 or its variants) was mixed with HU and plasmid DNA. Following condensation, the solution was incubated with S9.6 antibody-coated beads. After collecting the supernatant (S), the beads were then washed with buffer. Eluate (E) from beads was collected. DNA was extracted from both S and E by the phenol and ethanol method. PCR was carried out using specific primers targeted to plasmid DNA. Finally, the amplification products were separated by agarose gel and examined. ( B ) In IPFM assay, Cy-3–labeled RNA (naRNA4 or its variants) was mixed with HU and DNA (either plasmid DNA or 6-FAM–labeled cruciform DNA). Following condensation, the solution was incubated with S9.6 antibody-coated silica beads. The supernatant was discarded. The beads washed with buffer were then delivered to FM for imaging.

    Techniques Used: Polymerase Chain Reaction, Labeling, Plasmid Preparation, Incubation, Amplification, Agarose Gel Electrophoresis, Imaging

    2) Product Images from "Structural Basis for Catalysis by Onconase"

    Article Title: Structural Basis for Catalysis by Onconase

    Journal:

    doi: 10.1016/j.jmb.2007.09.089

    pH– k cat / K M profile for the cleavage of 6-FAM–dArUdGdA–6-TAMRA by ONC. Assays were performed at 23 °C in 1.0 mM buffer containing NaCl (1.0 M). Determination of k cat / K M values was performed in triplicate. Data were fitted
    Figure Legend Snippet: pH– k cat / K M profile for the cleavage of 6-FAM–dArUdGdA–6-TAMRA by ONC. Assays were performed at 23 °C in 1.0 mM buffer containing NaCl (1.0 M). Determination of k cat / K M values was performed in triplicate. Data were fitted

    Techniques Used:

    Effect of Thr89 and Glu91 on the substrate specificity of ONC. Bars indicate the effect of replacing Thr89 or Glu91 on the value of k cat / K M for the cleavage of 6-FAM–dArUdGdA–6-TAMRA (UpG) and 6-FAM–dArUdAdA–6-TAMRA (UpA).
    Figure Legend Snippet: Effect of Thr89 and Glu91 on the substrate specificity of ONC. Bars indicate the effect of replacing Thr89 or Glu91 on the value of k cat / K M for the cleavage of 6-FAM–dArUdGdA–6-TAMRA (UpG) and 6-FAM–dArUdAdA–6-TAMRA (UpA).

    Techniques Used:

    3) Product Images from "Structural Basis for Catalysis by Onconase"

    Article Title: Structural Basis for Catalysis by Onconase

    Journal:

    doi: 10.1016/j.jmb.2007.09.089

    pH– k cat / K M profile for the cleavage of 6-FAM–dArUdGdA–6-TAMRA by ONC. Assays were performed at 23 °C in 1.0 mM buffer containing NaCl (1.0 M). Determination of k cat / K M values was performed in triplicate. Data were fitted
    Figure Legend Snippet: pH– k cat / K M profile for the cleavage of 6-FAM–dArUdGdA–6-TAMRA by ONC. Assays were performed at 23 °C in 1.0 mM buffer containing NaCl (1.0 M). Determination of k cat / K M values was performed in triplicate. Data were fitted

    Techniques Used:

    Effect of Thr89 and Glu91 on the substrate specificity of ONC. Bars indicate the effect of replacing Thr89 or Glu91 on the value of k cat / K M for the cleavage of 6-FAM–dArUdGdA–6-TAMRA (UpG) and 6-FAM–dArUdAdA–6-TAMRA (UpA).
    Figure Legend Snippet: Effect of Thr89 and Glu91 on the substrate specificity of ONC. Bars indicate the effect of replacing Thr89 or Glu91 on the value of k cat / K M for the cleavage of 6-FAM–dArUdGdA–6-TAMRA (UpG) and 6-FAM–dArUdAdA–6-TAMRA (UpA).

    Techniques Used:

    4) Product Images from "Structural Basis for Catalysis by Onconase"

    Article Title: Structural Basis for Catalysis by Onconase

    Journal:

    doi: 10.1016/j.jmb.2007.09.089

    pH– k cat / K M profile for the cleavage of 6-FAM–dArUdGdA–6-TAMRA by ONC. Assays were performed at 23 °C in 1.0 mM buffer containing NaCl (1.0 M). Determination of k cat / K M values was performed in triplicate. Data were fitted
    Figure Legend Snippet: pH– k cat / K M profile for the cleavage of 6-FAM–dArUdGdA–6-TAMRA by ONC. Assays were performed at 23 °C in 1.0 mM buffer containing NaCl (1.0 M). Determination of k cat / K M values was performed in triplicate. Data were fitted

    Techniques Used:

    Effect of Thr89 and Glu91 on the substrate specificity of ONC. Bars indicate the effect of replacing Thr89 or Glu91 on the value of k cat / K M for the cleavage of 6-FAM–dArUdGdA–6-TAMRA (UpG) and 6-FAM–dArUdAdA–6-TAMRA (UpA).
    Figure Legend Snippet: Effect of Thr89 and Glu91 on the substrate specificity of ONC. Bars indicate the effect of replacing Thr89 or Glu91 on the value of k cat / K M for the cleavage of 6-FAM–dArUdGdA–6-TAMRA (UpG) and 6-FAM–dArUdAdA–6-TAMRA (UpA).

    Techniques Used:

    5) Product Images from "mRNA Deadenylation Is Coupled to Translation Rates by the Differential Activities of Ccr4-Not Nucleases"

    Article Title: mRNA Deadenylation Is Coupled to Translation Rates by the Differential Activities of Ccr4-Not Nucleases

    Journal: Molecular Cell

    doi: 10.1016/j.molcel.2018.05.033

    Ccr4-Not Releases Pab1 from Short Poly(A) Tails (A) Fluorescence polarization assay showing interaction of Pab1 with 5′ 6-FAM-labeled A22, 10-mer-A12, and A12 RNAs. Error bars are standard error (n = 3 for A12; n = 5 for A22 and 10-mer-A12). K D s are represented as the mean ± standard error. (B) Deadenylation of A30 and 23-mer-A30 RNAs by Ccr4-Not analyzed by both denaturing PAGE (upper gels) and native PAGE (lower gels). Samples were collected from the same reaction at the indicated time points after addition of Ccr4-Not to allow a direct comparison between RNA product sizes and Pab1 binding, respectively. Pab1-bound substrate was prepared with one Pab1 molecule per RNA. Upper right panel is reproduced from Figure 1 C for comparison. (C) Representative SwitchSENSE sensograms showing the dissociation of Pab1 from the indicated RNA sequences. Rate constants and half-lives for dissociation with standard error are shown for measurements performed in triplicate. See also Figures S4–S6 .
    Figure Legend Snippet: Ccr4-Not Releases Pab1 from Short Poly(A) Tails (A) Fluorescence polarization assay showing interaction of Pab1 with 5′ 6-FAM-labeled A22, 10-mer-A12, and A12 RNAs. Error bars are standard error (n = 3 for A12; n = 5 for A22 and 10-mer-A12). K D s are represented as the mean ± standard error. (B) Deadenylation of A30 and 23-mer-A30 RNAs by Ccr4-Not analyzed by both denaturing PAGE (upper gels) and native PAGE (lower gels). Samples were collected from the same reaction at the indicated time points after addition of Ccr4-Not to allow a direct comparison between RNA product sizes and Pab1 binding, respectively. Pab1-bound substrate was prepared with one Pab1 molecule per RNA. Upper right panel is reproduced from Figure 1 C for comparison. (C) Representative SwitchSENSE sensograms showing the dissociation of Pab1 from the indicated RNA sequences. Rate constants and half-lives for dissociation with standard error are shown for measurements performed in triplicate. See also Figures S4–S6 .

    Techniques Used: Fluorescence, Labeling, Polyacrylamide Gel Electrophoresis, Clear Native PAGE, Binding Assay

    6) Product Images from "Structural and functional analysis of an OB-fold in human Ctc1 implicated in telomere maintenance and bone marrow syndromes"

    Article Title: Structural and functional analysis of an OB-fold in human Ctc1 implicated in telomere maintenance and bone marrow syndromes

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkx1213

    Oligomerization and substrate binding assays of hCtc1. ( A ) The oligomeric state of hCtc1(OB) was analyzed by SEC-MALS. The blue line corresponds to the Refractive Index (RI) of the hCtc1(OB) eluting from the SEC column. The red circles correspond to the molecular mass of hCtc1(OB) measured by multi-angle, light scattering (MALS: red). The data suggest that hCtc1(OB) is monomeric in solution. ( B ) Cross linking experiments of WT hCtc1(OB) using formaldehyde or glutaraldehyde also shows that this domain hCtc1 is monomeric in solution. ( C ) FP assays of hCtc1(OB) with 5′ 6-FAM (Fluorescein) labeled, single-stranded telomeric DNA (two or three repeats) shows that this domain of hCtc1 is not involved in DNA binding. ( D ) ITC assay of hCtc1(OB) with the full length Stn1–Ten1 complex show no measurable interaction.
    Figure Legend Snippet: Oligomerization and substrate binding assays of hCtc1. ( A ) The oligomeric state of hCtc1(OB) was analyzed by SEC-MALS. The blue line corresponds to the Refractive Index (RI) of the hCtc1(OB) eluting from the SEC column. The red circles correspond to the molecular mass of hCtc1(OB) measured by multi-angle, light scattering (MALS: red). The data suggest that hCtc1(OB) is monomeric in solution. ( B ) Cross linking experiments of WT hCtc1(OB) using formaldehyde or glutaraldehyde also shows that this domain hCtc1 is monomeric in solution. ( C ) FP assays of hCtc1(OB) with 5′ 6-FAM (Fluorescein) labeled, single-stranded telomeric DNA (two or three repeats) shows that this domain of hCtc1 is not involved in DNA binding. ( D ) ITC assay of hCtc1(OB) with the full length Stn1–Ten1 complex show no measurable interaction.

    Techniques Used: Binding Assay, Size-exclusion Chromatography, Labeling, Isothermal Titration Calorimetry

    7) Product Images from "Direct Promoter Repression by BCL11A Controls the Fetal to Adult Hemoglobin Switch"

    Article Title: Direct Promoter Repression by BCL11A Controls the Fetal to Adult Hemoglobin Switch

    Journal: Cell

    doi: 10.1016/j.cell.2018.03.016

    BCL11A binds DNA in a sequence-specific manner through its C-terminal ZnF cluster (A) Heatmaps depict results of clustering PBM enrichment (E) scores (rows) and BCL11 proteins (either BCL11A or BCL11B) (columns) for all 8-mers bound (PBM E > 0.40) by at least one protein. Replicates are denoted by R1 and R2. Logos generated from clusters of 8-mers depict binding specificities by the various proteins and match the motifs (information content on y-axis, nucleotide position on x-axis) derived by the Seed-and-Wobble algorithm. (B,C) Boxplots depicting PBM E-scores of all 8-mers containing TGACCA (B) or TNCGGCCA (C). Each plot illustrates the respective motif preference for the different BCL11 proteins. The middle line of each box represents the median E-score value, the upper and lower whiskers portray the min(max(x), Q_3 + 1.5* IQR) and the max(min(x), Q_1-1.5*IQR), respectively, and points beyond the whiskers represent outliers. (D,E) Fluorescence polarization curves for ZnF456 (D) and ZnF23 (E) upon binding a 6-FAM-labelled 10-basepair double-stranded oligonucleotide containing the 456 motif (blue), the 23 motif (red), a scrambled control sequence (black), or with the addition of 1mM EDTA (grey). The curves were fit to a single-site binding model (hyperbola). (F,G) Octet curves for ZnF456 (F) and ZnF23 (G) upon binding the 456 motif (blue), the 23 motif (red), or a scrambled control sequence (black). The calculated affinity of ZnF456 binding its preferred motif was 31.9 ± 6.8 nM. The calculated affinity of ZnF23 binding to the 23 motif was 2079 ± 245.8 nM and indeterminate for binding the 456 motif.
    Figure Legend Snippet: BCL11A binds DNA in a sequence-specific manner through its C-terminal ZnF cluster (A) Heatmaps depict results of clustering PBM enrichment (E) scores (rows) and BCL11 proteins (either BCL11A or BCL11B) (columns) for all 8-mers bound (PBM E > 0.40) by at least one protein. Replicates are denoted by R1 and R2. Logos generated from clusters of 8-mers depict binding specificities by the various proteins and match the motifs (information content on y-axis, nucleotide position on x-axis) derived by the Seed-and-Wobble algorithm. (B,C) Boxplots depicting PBM E-scores of all 8-mers containing TGACCA (B) or TNCGGCCA (C). Each plot illustrates the respective motif preference for the different BCL11 proteins. The middle line of each box represents the median E-score value, the upper and lower whiskers portray the min(max(x), Q_3 + 1.5* IQR) and the max(min(x), Q_1-1.5*IQR), respectively, and points beyond the whiskers represent outliers. (D,E) Fluorescence polarization curves for ZnF456 (D) and ZnF23 (E) upon binding a 6-FAM-labelled 10-basepair double-stranded oligonucleotide containing the 456 motif (blue), the 23 motif (red), a scrambled control sequence (black), or with the addition of 1mM EDTA (grey). The curves were fit to a single-site binding model (hyperbola). (F,G) Octet curves for ZnF456 (F) and ZnF23 (G) upon binding the 456 motif (blue), the 23 motif (red), or a scrambled control sequence (black). The calculated affinity of ZnF456 binding its preferred motif was 31.9 ± 6.8 nM. The calculated affinity of ZnF23 binding to the 23 motif was 2079 ± 245.8 nM and indeterminate for binding the 456 motif.

    Techniques Used: Sequencing, Generated, Binding Assay, Derivative Assay, Fluorescence

    8) Product Images from "RNA-binding proteins distinguish between similar sequence motifs to promote targeted deadenylation by Ccr4-Not"

    Article Title: RNA-binding proteins distinguish between similar sequence motifs to promote targeted deadenylation by Ccr4-Not

    Journal: eLife

    doi: 10.7554/eLife.40670

    Acceleration of deadenylation by Puf3 and Zfs1. ( A ) Coomassie-stained SDS-PAGE of pull-down assay showing binding of Ccr4-Not (subunits labelled in red) to immobilized MBP-Puf3 and MBP-Zfs1. ( B ) Schematic diagram of RNA substrates showing 5ʹ 6-FAM fluorescent label, position of Pumilio-response element (PRE; blue), AU-rich element (ARE; red), and 30-adenosine poly(A) tail. ( C ) Electrophoretic mobility shift assay (EMSA) showing the protein-RNA complexes used as substrates for deadenylation assays. Puf3 or Zfs1 (250 nM) was incubated with labelled RNA (200 nM) for 15 min at room temperature before resolving on a native polyacrylamide gel. ( D ) Control deadenylation assay with Puf3-target RNA showing that MBP alone does not have an effect on the deadenylation activity of Ccr4-Not. M is marker for RNA with and without a poly(A) 30 tail. ( E ) Average rates of Ccr4-Not-mediated deadenylation in the presence of Puf3 or Zfs1. Reaction rates were calculated by densitometric analysis of denaturing polyacrylamide gels. The most abundant RNA size decreased linearly with time, and average reaction rates in number of adenosines removed/min were determined by linear regression on triplicate measurements. Each experiment is presented as a single data point, and the mean of each triplicate experiment is plotted as a horizontal line. Statistical significance was calculated by one-way ANOVA in GraphPad Prism. *p=0.04; ***p=0.001. ( F ) Fully-deadenylated and non-deadenylated RNA exist simultaneously in reactions with Ccr4-Not and Puf3 or Zfs1. Experiments were performed as in Figure 1 with shorter time increments.
    Figure Legend Snippet: Acceleration of deadenylation by Puf3 and Zfs1. ( A ) Coomassie-stained SDS-PAGE of pull-down assay showing binding of Ccr4-Not (subunits labelled in red) to immobilized MBP-Puf3 and MBP-Zfs1. ( B ) Schematic diagram of RNA substrates showing 5ʹ 6-FAM fluorescent label, position of Pumilio-response element (PRE; blue), AU-rich element (ARE; red), and 30-adenosine poly(A) tail. ( C ) Electrophoretic mobility shift assay (EMSA) showing the protein-RNA complexes used as substrates for deadenylation assays. Puf3 or Zfs1 (250 nM) was incubated with labelled RNA (200 nM) for 15 min at room temperature before resolving on a native polyacrylamide gel. ( D ) Control deadenylation assay with Puf3-target RNA showing that MBP alone does not have an effect on the deadenylation activity of Ccr4-Not. M is marker for RNA with and without a poly(A) 30 tail. ( E ) Average rates of Ccr4-Not-mediated deadenylation in the presence of Puf3 or Zfs1. Reaction rates were calculated by densitometric analysis of denaturing polyacrylamide gels. The most abundant RNA size decreased linearly with time, and average reaction rates in number of adenosines removed/min were determined by linear regression on triplicate measurements. Each experiment is presented as a single data point, and the mean of each triplicate experiment is plotted as a horizontal line. Statistical significance was calculated by one-way ANOVA in GraphPad Prism. *p=0.04; ***p=0.001. ( F ) Fully-deadenylated and non-deadenylated RNA exist simultaneously in reactions with Ccr4-Not and Puf3 or Zfs1. Experiments were performed as in Figure 1 with shorter time increments.

    Techniques Used: Staining, SDS Page, Pull Down Assay, Binding Assay, Electrophoretic Mobility Shift Assay, Incubation, Activity Assay, Marker

    9) Product Images from "Structural Basis for Catalysis by Onconase"

    Article Title: Structural Basis for Catalysis by Onconase

    Journal:

    doi: 10.1016/j.jmb.2007.09.089

    pH– k cat / K M profile for the cleavage of 6-FAM–dArUdGdA–6-TAMRA by ONC. Assays were performed at 23 °C in 1.0 mM buffer containing NaCl (1.0 M). Determination of k cat / K M values was performed in triplicate. Data were fitted
    Figure Legend Snippet: pH– k cat / K M profile for the cleavage of 6-FAM–dArUdGdA–6-TAMRA by ONC. Assays were performed at 23 °C in 1.0 mM buffer containing NaCl (1.0 M). Determination of k cat / K M values was performed in triplicate. Data were fitted

    Techniques Used:

    Effect of Thr89 and Glu91 on the substrate specificity of ONC. Bars indicate the effect of replacing Thr89 or Glu91 on the value of k cat / K M for the cleavage of 6-FAM–dArUdGdA–6-TAMRA (UpG) and 6-FAM–dArUdAdA–6-TAMRA (UpA).
    Figure Legend Snippet: Effect of Thr89 and Glu91 on the substrate specificity of ONC. Bars indicate the effect of replacing Thr89 or Glu91 on the value of k cat / K M for the cleavage of 6-FAM–dArUdGdA–6-TAMRA (UpG) and 6-FAM–dArUdAdA–6-TAMRA (UpA).

    Techniques Used:

    10) Product Images from "Endonuclease Activity Inhibition of the NS1 Protein of Parvovirus B19 as a Novel Target for Antiviral Drug Development"

    Article Title: Endonuclease Activity Inhibition of the NS1 Protein of Parvovirus B19 as a Novel Target for Antiviral Drug Development

    Journal: Antimicrobial Agents and Chemotherapy

    doi: 10.1128/AAC.01879-18

    Establishment of a 6-carboxyfluorescein (FAM)-based in vitro nicking assay. (A) Diagram of the FAM-labeled oligonucleotides. The sequences of Ori20 are shown with FAM and the Iowa Black FQ quencher (Q) at the 5′ and 3′ ends, respectively. After incubation with NS1N, Ori20 is cleaved into two shorter oligonucleotides, and then a FAM-linked short oligonucleotide of 9 nt is released for fluorescence detection. (B) FAM Ori20 Q -based nicking assay. FAM Ori20 Q (200 nM) was incubated with 2 µM NS1N protein in the nicking buffer. The fluorescence intensity of each sample was detected on a microplate reader. FAM Ori20 Q without NS1N and FAM Ori20 without a quencher were used as controls. (C) Optimization of the probe concentration. Various concentrations of the FAM Ori20 Q probe were used in the nicking assay. Fluorescence intensity was determined with or without NS1N, as indicated. The fold changes in fluorescence intensity in the presence of NS1N from the fluorescence intensity with no NS1N are shown.
    Figure Legend Snippet: Establishment of a 6-carboxyfluorescein (FAM)-based in vitro nicking assay. (A) Diagram of the FAM-labeled oligonucleotides. The sequences of Ori20 are shown with FAM and the Iowa Black FQ quencher (Q) at the 5′ and 3′ ends, respectively. After incubation with NS1N, Ori20 is cleaved into two shorter oligonucleotides, and then a FAM-linked short oligonucleotide of 9 nt is released for fluorescence detection. (B) FAM Ori20 Q -based nicking assay. FAM Ori20 Q (200 nM) was incubated with 2 µM NS1N protein in the nicking buffer. The fluorescence intensity of each sample was detected on a microplate reader. FAM Ori20 Q without NS1N and FAM Ori20 without a quencher were used as controls. (C) Optimization of the probe concentration. Various concentrations of the FAM Ori20 Q probe were used in the nicking assay. Fluorescence intensity was determined with or without NS1N, as indicated. The fold changes in fluorescence intensity in the presence of NS1N from the fluorescence intensity with no NS1N are shown.

    Techniques Used: In Vitro, Labeling, Incubation, Fluorescence, Concentration Assay

    11) Product Images from "Architecture and RNA binding of the human negative elongation factor"

    Article Title: Architecture and RNA binding of the human negative elongation factor

    Journal: eLife

    doi: 10.7554/eLife.14981

    NELF-B association with ssRNA, ssDNA and TAR RNA stem loop. ( A ) Binding of NELF-B (light red) or NELF-BE (1–138) (red) to the 60% GC RNA as determined by fluorescence anisotropy. NELF-AC (dark red) ( Figure 5A ) binding to the same RNA is shown as a reference. Error bars reflect the standard deviation from three experimental replicates. Data were fit with a single site binding model. Apparent Kd values are reported in Table 3 . ( B ) Binding of NELF-B (cyan) or NELF-BE (1–138) (sky blue) to the 60% GC DNA as determined by fluorescence anisotropy. NELF-AC (dark blue) ( Figure 5A ) binding is shown as a reference. Error bars reflect the standard deviation from three experimental replicates. Data were fit with a single site binding model. Apparent Kd values are reported in Table 3 . ( C ) 2D structure of TAR RNA stem loop region used for fluorescence anisotropy experiments presented in ( D ). Dots indicate hydrogen bonds between bases. Lines represent the phosphate backbone. RNA was labeled with a 5’ FAM label. ( D ) Binding of the NELF tetramer (dark purple), NELF ∆RRM (orchid), NELF-ABC (thistle), NELF-BE (1–138) (medium purple), and NELF-AC (light purple) to the TAR RNA stem loop. Data were fit with a single site binding model. Apparent Kd values are reported in Table 3 . DOI: http://dx.doi.org/10.7554/eLife.14981.019
    Figure Legend Snippet: NELF-B association with ssRNA, ssDNA and TAR RNA stem loop. ( A ) Binding of NELF-B (light red) or NELF-BE (1–138) (red) to the 60% GC RNA as determined by fluorescence anisotropy. NELF-AC (dark red) ( Figure 5A ) binding to the same RNA is shown as a reference. Error bars reflect the standard deviation from three experimental replicates. Data were fit with a single site binding model. Apparent Kd values are reported in Table 3 . ( B ) Binding of NELF-B (cyan) or NELF-BE (1–138) (sky blue) to the 60% GC DNA as determined by fluorescence anisotropy. NELF-AC (dark blue) ( Figure 5A ) binding is shown as a reference. Error bars reflect the standard deviation from three experimental replicates. Data were fit with a single site binding model. Apparent Kd values are reported in Table 3 . ( C ) 2D structure of TAR RNA stem loop region used for fluorescence anisotropy experiments presented in ( D ). Dots indicate hydrogen bonds between bases. Lines represent the phosphate backbone. RNA was labeled with a 5’ FAM label. ( D ) Binding of the NELF tetramer (dark purple), NELF ∆RRM (orchid), NELF-ABC (thistle), NELF-BE (1–138) (medium purple), and NELF-AC (light purple) to the TAR RNA stem loop. Data were fit with a single site binding model. Apparent Kd values are reported in Table 3 . DOI: http://dx.doi.org/10.7554/eLife.14981.019

    Techniques Used: Binding Assay, Fluorescence, Standard Deviation, Labeling

    12) Product Images from "Genome-wide binding and mechanistic analyses of Smchd1-mediated epigenetic regulation"

    Article Title: Genome-wide binding and mechanistic analyses of Smchd1-mediated epigenetic regulation

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.1504232112

    ( A ) Distribution profiles for the Smchd1 hinge domain R1867G mutant with unmethylated 20-mer dsDNA (annealed with ssDNA containing the Ctcf consensus sequence in sense and antisense orientations) containing either one or two 5′ 6-FAM molecules.
    Figure Legend Snippet: ( A ) Distribution profiles for the Smchd1 hinge domain R1867G mutant with unmethylated 20-mer dsDNA (annealed with ssDNA containing the Ctcf consensus sequence in sense and antisense orientations) containing either one or two 5′ 6-FAM molecules.

    Techniques Used: Mutagenesis, Sequencing

    13) Product Images from "Populated Intermediates in the Thermal Unfolding of the Human Telomeric Quadruplex"

    Article Title: Populated Intermediates in the Thermal Unfolding of the Human Telomeric Quadruplex

    Journal: Journal of the American Chemical Society

    doi: 10.1021/ja307543z

    Thermal melting of 6-Fam-Tel22-Tamra in 25 mM KCl assessed by changes in FRET efficiency. Panel A shows the family of emission spectra collected as a function of temperature between 5 °C and 95 °C. The arrows show the direction of the
    Figure Legend Snippet: Thermal melting of 6-Fam-Tel22-Tamra in 25 mM KCl assessed by changes in FRET efficiency. Panel A shows the family of emission spectra collected as a function of temperature between 5 °C and 95 °C. The arrows show the direction of the

    Techniques Used:

    14) Product Images from "Homogeneous Polymerase Chain Reaction Nucleobase Quenching Assay to Detect the 1-kbp Deletion in CLN3 That Causes Batten Disease"

    Article Title: Homogeneous Polymerase Chain Reaction Nucleobase Quenching Assay to Detect the 1-kbp Deletion in CLN3 That Causes Batten Disease

    Journal: The Journal of molecular diagnostics : JMD

    doi:

    Strategy. A: The positions of the primers ( arrows ) and probe on the wild-type and mutant CLN3 gene are shown. The fluorophore on the probe is indicated with an asterisk ; not drawn to scale. B: The sequence of the probe is shown in between the complementary sequences of the wild-type and deletion alleles, with vertical lines connecting the base-paired residues. The –F on the 3′ end of the probe indicates the 6-FAM fluorophore and shows its position with respect to the G residues on the opposite strand. The probe is fully base-paired with the mutant sequence, but has three unmatched nucleotides at the 5′ end when annealed to a wild-type amplicon. The G residues that contribute to the quenching of the fluorescent signal are underlined in the normal and mutant sequences.
    Figure Legend Snippet: Strategy. A: The positions of the primers ( arrows ) and probe on the wild-type and mutant CLN3 gene are shown. The fluorophore on the probe is indicated with an asterisk ; not drawn to scale. B: The sequence of the probe is shown in between the complementary sequences of the wild-type and deletion alleles, with vertical lines connecting the base-paired residues. The –F on the 3′ end of the probe indicates the 6-FAM fluorophore and shows its position with respect to the G residues on the opposite strand. The probe is fully base-paired with the mutant sequence, but has three unmatched nucleotides at the 5′ end when annealed to a wild-type amplicon. The G residues that contribute to the quenching of the fluorescent signal are underlined in the normal and mutant sequences.

    Techniques Used: Mutagenesis, Sequencing, Amplification

    15) Product Images from "Homogeneous Polymerase Chain Reaction Nucleobase Quenching Assay to Detect the 1-kbp Deletion in CLN3 That Causes Batten Disease"

    Article Title: Homogeneous Polymerase Chain Reaction Nucleobase Quenching Assay to Detect the 1-kbp Deletion in CLN3 That Causes Batten Disease

    Journal: The Journal of molecular diagnostics : JMD

    doi:

    Strategy. A: The positions of the primers ( arrows ) and probe on the wild-type and mutant CLN3 gene are shown. The fluorophore on the probe is indicated with an asterisk ; not drawn to scale. B: The sequence of the probe is shown in between the complementary sequences of the wild-type and deletion alleles, with vertical lines connecting the base-paired residues. The –F on the 3′ end of the probe indicates the 6-FAM fluorophore and shows its position with respect to the G residues on the opposite strand. The probe is fully base-paired with the mutant sequence, but has three unmatched nucleotides at the 5′ end when annealed to a wild-type amplicon. The G residues that contribute to the quenching of the fluorescent signal are underlined in the normal and mutant sequences.
    Figure Legend Snippet: Strategy. A: The positions of the primers ( arrows ) and probe on the wild-type and mutant CLN3 gene are shown. The fluorophore on the probe is indicated with an asterisk ; not drawn to scale. B: The sequence of the probe is shown in between the complementary sequences of the wild-type and deletion alleles, with vertical lines connecting the base-paired residues. The –F on the 3′ end of the probe indicates the 6-FAM fluorophore and shows its position with respect to the G residues on the opposite strand. The probe is fully base-paired with the mutant sequence, but has three unmatched nucleotides at the 5′ end when annealed to a wild-type amplicon. The G residues that contribute to the quenching of the fluorescent signal are underlined in the normal and mutant sequences.

    Techniques Used: Mutagenesis, Sequencing, Amplification

    Related Articles

    Negative Control:

    Article Title:
    Article Snippet: As a negative control, the Str probe did not hybridize with the S. aureus isolate (data not shown). .. The FISH probes were labeled with either the green fluorescent probe Cy3 or 6-carboxy-fluorescine (FAM) (Integrated DNA Technologies Inc., Coralville, Iowa).

    FP Assay:

    Article Title:
    Article Snippet: Paragraph title: Non-radioactive electrophoretic mobility shift assay (EMSA) and fluorescence polarization (FP) assay ... The Bcl2_WT RNA oligonucleotide was synthesized and 5′-end labeled with the fluorophore 6-carboxyfluorescin (FAM) by Integrated DNA Technologies, Inc.: 5′-/56FAM/CCCGUUGCUUUUCCUCUGGGAAGGAUGGCGCACGCUGGG.

    Binding Assay:

    Article Title:
    Article Snippet: Non-radioactive electrophoretic mobility shift assay (EMSA) and fluorescence polarization (FP) assay The binding affinity of wildtype recombinant La protein to the Bcl2_WT RNA was determined by native EMSA and FP assay, as described recently [ ]. .. The Bcl2_WT RNA oligonucleotide was synthesized and 5′-end labeled with the fluorophore 6-carboxyfluorescin (FAM) by Integrated DNA Technologies, Inc.: 5′-/56FAM/CCCGUUGCUUUUCCUCUGGGAAGGAUGGCGCACGCUGGG.

    Fluorescence:

    Article Title:
    Article Snippet: Paragraph title: Fluorescence in situ hybridization ... The FISH probes were labeled with either the green fluorescent probe Cy3 or 6-carboxy-fluorescine (FAM) (Integrated DNA Technologies Inc., Coralville, Iowa).

    Article Title:
    Article Snippet: Paragraph title: Non-radioactive electrophoretic mobility shift assay (EMSA) and fluorescence polarization (FP) assay ... The Bcl2_WT RNA oligonucleotide was synthesized and 5′-end labeled with the fluorophore 6-carboxyfluorescin (FAM) by Integrated DNA Technologies, Inc.: 5′-/56FAM/CCCGUUGCUUUUCCUCUGGGAAGGAUGGCGCACGCUGGG.

    Synthesized:

    Article Title:
    Article Snippet: .. RNA chaperone assay The Bcl2 RNA molecular beacon Bcl2-MB was synthesized, 5′-end labeled with the fluorophore 6-carboxyfluorescin (FAM), and 3′end labeled with a quencher (Dabcyl) by Integrated DNA Technologies, Inc.: /56-FAM/CCCGUUGCUUUUCCUCUGGGAAGGAUGGCGCACGCUGGG/3Dab/. ..

    Article Title:
    Article Snippet: .. The Bcl2_WT RNA oligonucleotide was synthesized and 5′-end labeled with the fluorophore 6-carboxyfluorescin (FAM) by Integrated DNA Technologies, Inc.: 5′-/56FAM/CCCGUUGCUUUUCCUCUGGGAAGGAUGGCGCACGCUGGG. .. La binding curves were established at 25 nM Bcl2_WT RNA oligonucleotide and increasing concentrations (0, 20, 40, 60, 100, 200, 300, 400, 500, and 600 nM) of recombinant His-tagged La protein.

    Isolation:

    Article Title:
    Article Snippet: The Str genus FISH probe hybridized with the isolated strain Enterococcus faecalis (data not shown). .. The FISH probes were labeled with either the green fluorescent probe Cy3 or 6-carboxy-fluorescine (FAM) (Integrated DNA Technologies Inc., Coralville, Iowa).

    Labeling:

    Article Title:
    Article Snippet: .. RNA chaperone assay The Bcl2 RNA molecular beacon Bcl2-MB was synthesized, 5′-end labeled with the fluorophore 6-carboxyfluorescin (FAM), and 3′end labeled with a quencher (Dabcyl) by Integrated DNA Technologies, Inc.: /56-FAM/CCCGUUGCUUUUCCUCUGGGAAGGAUGGCGCACGCUGGG/3Dab/. ..

    Article Title:
    Article Snippet: .. The FISH probes were labeled with either the green fluorescent probe Cy3 or 6-carboxy-fluorescine (FAM) (Integrated DNA Technologies Inc., Coralville, Iowa). .. The eubacterial probe Eub338 5′-GCTGCCTCCCGTAGGAGT-3′ conjugated with Cy5 (red) was used as a general bacterial stain [ ].

    Article Title:
    Article Snippet: .. The Bcl2_WT RNA oligonucleotide was synthesized and 5′-end labeled with the fluorophore 6-carboxyfluorescin (FAM) by Integrated DNA Technologies, Inc.: 5′-/56FAM/CCCGUUGCUUUUCCUCUGGGAAGGAUGGCGCACGCUGGG. .. La binding curves were established at 25 nM Bcl2_WT RNA oligonucleotide and increasing concentrations (0, 20, 40, 60, 100, 200, 300, 400, 500, and 600 nM) of recombinant His-tagged La protein.

    Digital PCR:

    Article Title:
    Article Snippet: Paragraph title: Droplet digital polymerase chain reaction ... The three test probe assays, IC2, IC1, and SNRPN exon 1, were created using unique sequences that do not overlap and tagged with 6‐carboxfluorescein (FAM) (Integrated DNA Technologies, Coralville, IA) (Figure , Table ).

    Concentration Assay:

    Article Title:
    Article Snippet: The three test probe assays, IC2, IC1, and SNRPN exon 1, were created using unique sequences that do not overlap and tagged with 6‐carboxfluorescein (FAM) (Integrated DNA Technologies, Coralville, IA) (Figure , Table ). .. The GABRβ3 assay was purchased as a 20X premix of primers and HEX‐3IABkFQ probe and used at 1X concentration.

    Article Title:
    Article Snippet: The sample was dehydrated in a graded series of ethanol (50%, 80%, and 100%) for 3 min at each concentration. .. The FISH probes were labeled with either the green fluorescent probe Cy3 or 6-carboxy-fluorescine (FAM) (Integrated DNA Technologies Inc., Coralville, Iowa).

    other:

    Article Title:
    Article Snippet: A single probe with only a single fluorescent label is less expensive than two dual-labeled probes used for 5′ nuclease assays, and also less expensive than the two labeled probes used for fluorescence resonance energy transfer assays., In contrast to Crockett and Wittwer we used 6-FAM (6-carboxyfluorescein) instead of fluorescein (fluorescein isothiocyanate) because the excitation and emission wavelengths are very similar, the 6-FAM fluorescence is quenched by G residues, and 6-FAM-labeled oligos are less expensive because they do not require additional purification before use (Integrated DNA Technologies, personal communication).

    Article Title:
    Article Snippet: SsoAdvanced Universal Probes Supermix (Bio-Rad 172-5280) and high-performance liquid chromatography (HPLC)-purified 6-FAM/ZEN/Iowa Black-labeled probes (Integrated DNA Technologies) were used to measure the titer of the AAV viruses.

    Article Title:
    Article Snippet: 23-mer-A30, A30 and 20-mer-A10 RNAs ( ) were synthesized with a 5′ 6-FAM fluorophore label (Integrated DNA Technologies).

    Article Title:
    Article Snippet: Primer sequences were forward primer 5′GCCTGGTAGTGAAGCTGAGCGT-3′, reverse primer 5′CGGTGAATGTAGGCATGTTGTCC-3′, and probe 6-carboxyfluorescein (FAM)-AGCCAGCGGCCCGCAAATG-MGB-3′ (Integrated DNA Technologies, Coralville, IA).

    Article Title:
    Article Snippet: RNase 1 substrate 6-FAM-dArUdAdA-6-TAMRA was from Integrated DNA Technologies (Coralville, IA).

    Article Title:
    Article Snippet: Semiquantitative PCR was performed using 5′ end fluorescein (6-FAM)-labeled forward primers (Integrated DNA Technologies, Coralville, IA, USA) on 10 ng cDNA prepared as described above.

    Article Title:
    Article Snippet: Electrophoretic mobility shift assays (EMSA) were performed as previously described , with purified AgrAC and a gr P2 promoter, and a 16-bp duplex DNA probe with a 3′ 6-fluorescein (P2-FAM) (Integrated DNA Technologies, Coralville, IA).

    Article Title:
    Article Snippet: All oligonucleotides except for the FRET derivative 6-Fam-Tel22-Tamra were obtained in desalted, lyophilized form from Integrated DNA Technologies, Inc., Coralville, IA.

    Article Title:
    Article Snippet: The flaB and β-actin probes were labeled on the 5′ end with 6-carboxyfluorescein (FAM) and MAX, respectively (Integrated DNA Technologies, Coralville, IA).

    Article Title:
    Article Snippet: Deamination assay A3B and A3A proteins were reacted with 600 nM 5′ 6-carboxyfluorescein (FAM)-labelled ssDNA substrates (synthesized by Integrated DNA Technologies, Supplementary Table S1) in deamination buffer (25 mM HEPES, pH 6.5, 100 mM NaCl, 0.1% Triton X-100, 1 mM DTT and 0.1 μg/ml RNase).

    Article Title:
    Article Snippet: The forward primer for the amplification of each marker was end-labeled with 6-FAM (Fluorescein) (Integrated DNA Technologies, Leuven, Belgium).

    Article Title:
    Article Snippet: The forward primer (pcDNA.F) was labeled on the 5′ end with 6-FAM (fluorescein) by the manufacturer (Integrated DNA Technologies, Coralville, IA, USA).

    Article Title:
    Article Snippet: Semiquantitative PCR was performed using 5′ end fluorescein (6- FAM)-labeled forward primers (Integrated DNA Technologies, Coralville, IA) on 10 ng cDNA prepared as described above.

    Article Title:
    Article Snippet: The 6-FAM (Fluorescein)-labelled methylated and unmethylated RNA oligos were purchased from Integrated DNA Technologies (Skokie, IL 60076).

    Article Title:
    Article Snippet: The internal fluorogenic probe was labelled with the 6-FAM reporter dye (Integrated DNA Technologies, Coralville, IA, USA).

    Article Title:
    Article Snippet: We also assessed the catalytic activity of wild-type ONC toward two novel ONC substrates, each containing a single cleavable guanosine–guanosine phosphodiester bond: 6-FAM–dUrGdGdA–6-TAMRA and 6-FAM–dArGdGdA–6-TAMRA.

    Article Title:
    Article Snippet: PCR amplification took place in triplicate using a standard 2 μL of diluted template, 0.025 units/μL of Taq Hot Start Polymerase (Promega Corporation, Madison, WI, USA), and the universal bacterial primers 8F (5′-AGAGTTTGATCMTGGCTCAG-3′) and 519R (5′-ACCGCGGCTGCTGGCAC-3′), the forward primer labeled with a 5′ 6-FAM fluorophore (Integrated DNA Technologies, Coralville, IA, USA).

    Article Title:
    Article Snippet: Fluorescein (FAM)-labeled oligonucleotides were synthesized with 6-carboxyfluorescein (FAM) at the 5′ end and Iowa Black FQ quencher at the 3′ end at Integrated DNA Technologies, Inc. (Coralville, IA).

    Article Title:
    Article Snippet: Ten nM of double-stranded, 6-FAM-labeled DNA (Integrated DNA Technologies) was incubated with indicated amounts of protein in 100 mM NaCl, 20 mM Tris-HCl pH 7.4, and 5% glycerol.

    Article Title:
    Article Snippet: Forward primers were marked with 6′FAM (Fluorescein) (Integrated DNA Technologies, San Diego, CA, USA).

    Article Title:
    Article Snippet: The 5′ and 3′ ends of the primer were chemically linked to a Black Hole Quencher® -1 and 6-carboxyfluorescein (FAM-1™) flourophore, respectively (Integrated DNA Technology® , Toronto, ON).

    Article Title:
    Article Snippet: The primers used for quantitative PCR were: TM-B4189-204F (5′-ACC GCC AGT AAC GGA CCA T-3′) and TM-B4189-313R (5′-CTA ATG CGT CAT CCG GAG AAC-3′), and 5′-/5(6)-FAM/CCA TCG TGC TTA CGC TAC CTA TTC GCT GTA/36-TAMTph/-3′ (Integrated DNA Technologies) was used as a probe [5(6)-FAM=5′6-carboxyfluorescein; 36TAMpH=3′TAMRA].

    Article Title:
    Article Snippet: Visualize and quantify the binding of hnRNPK to RNA The 6-FAM (Fluorescein)-labelled methylated and unmethylated RNA oligos were purchased from Integrated DNA Technologies (Skokie, IL 60076).

    Article Title:
    Article Snippet: The syn- cr DNA with 6-FAM label at the 5′ end was supplied by Integrated DNA Technologies. naRNA4 and its variants were obtained by in vitro transcription assay as described previously with modifications ( ).

    Article Title:
    Article Snippet: Briefly, increasing concentrations of His-ZnF23 or His-ZnF456 (0-3 μM) were titrated into a total of 20 μL assay buffer (10 mM Tris pH 8.0, 150 mM NaCl) containing 10 nM 6-FAM-labelled double-stranded oligonucleotide (Integrated DNA Technologies), whose sequences are listed in .

    Article Title:
    Article Snippet: The fluorogenic substrate 6-FAM-mAmArCmAmA-Dabcyl was synthesized by Integrated DNA Technologies (Coralville, IA).

    Article Title:
    Article Snippet: Levels of Acvr2b exon 5 skipping were determined by qPCR using FAM-labelled primers spanning exons 5–6 (Mm.PT.58.32079450.g, Integrated DNA Technologies, Leuven, Belgium) and normalized to a cyclophilin B housekeeping gene (Applied Biosystems, Warrington, UK).

    Article Title:
    Article Snippet: The primer was 5′-end labeled with either a JOE (6-carboxy-4′,5′-dichloro-2′,7′-dimethoxyfluorescein) NHS ester or a 6-carboxyfluorescein (FAM) fluorophore (Integrated DNA Technologies).

    Article Title:
    Article Snippet: FLA of PCR products Mu phage DNA or in vitro strand transfer products were used as templates in PCR reactions with a common Mu R-end primer labeled at its 5' end with fluorescent agent 6-FAM (Integrated DNA Technologies, Coralville, Iowa, USA) and a second primer annealing to different sites of the Mu or E. coli genome (see Additional file ).

    Article Title:
    Article Snippet: High-performance liquid chromatography (HPLC)-purified fluorescein (5′-6-carboxyfluorescein [FAM])-labeled DNA substrates were obtained from Integrated DNA Technologies Inc. (IDT).

    Article Title:
    Article Snippet: Deadenylation Activity Assays RNAs with indicated sequences included a 3′ tail of 30 adenosines and a 5′ 6-FAM fluorophore label (Integrated DNA Technologies; IDT).

    Article Title:
    Article Snippet: Analysis of DNA binding by p53 and TAp73 To analyze DNA binding by p53 and p73 using fluorescence anisotropy/polarization, aliquots of stock solutions of GST-p53 (2.5 μM) or GST-TAp73α (2.0 μM) (SignalChem) were added to HPLC-purified 6-carboxyfluorescein (6-FAM)-labeled DNA duplex (5'-/56-FAM/ CGCGCCTGCAAGTCCTGACTTGTCCGCGGC-3'; Integrated DNA Technologies) containing the p53 binding sites in the PUMA promoter at 4 nM in a 500-μL reaction volume at room temperature in a buffer containing 100 mM NaCl, 10 mM tris-HCl, PH7.5, 10% (vol/vol) glycerol, 5 mM DTT, and 0.2 mg/mL bovine serum albumin.

    Article Title:
    Article Snippet: The RNA was then phenol/chloroform/isoamyl alcohol extracted to remove enzyme, then ligated to 5′ 6-FAM U6 84–94 (Integrated DNA Technologies) with T4 RNA ligase 2 at 37 °C for 2 h using a DNA splint that was complementary to the entire RNA product.

    Article Title:
    Article Snippet: Oligodeoxyribonucleotides with a 6-carboxyfluorescein (FAM) label at the 3′-end were from Integrated DNA Technology.

    Article Title:
    Article Snippet: If bands were visualised in the expected size-range, primers were re-ordered with a 5′ fluorescent 6-FAM dye (Integrated DNA Technologies, Coralville, IA, USA) and the PCRs were repeated with these.

    Article Title:
    Article Snippet: The 12mer DNA probe (TTAGGGTTAGGG) and 18mer DNA probe (TTAGGGTTAGGGTTAGGG) was purchased with a 5′ 6-FAM label from Integrated DNA Technologies.

    Article Title:
    Article Snippet: The adjuvant uptake study was conducted similarly, instead employing CpG-CCNPs synthesized with CpG containing a 5' 6-FAM modification (Integrated DNA Technologies).

    Article Title:
    Article Snippet: The β-actin levels were measured using the following primers: Left primer 5′-GTC TTC CCC TCC ATC GTG-3′; Right primer 5′-CAT GTC GTC CCA GTT GGT G-3′; probe (5′6-FAM) CAT CCT CAC CCT GAA GTA CC-(3′ Iowa Black® FQ) (Integrated DNA Technologies).

    Article Title:
    Article Snippet: Sequence of the common reverse primer is LAI5393 GAGTAACGCCTATTCTGCTATGTCGA and that of the fluorogenic reporter probe is LAI5236 56-FAM (6-carboxyfluorescein)-ACATTTTCC/ZEN/TAGGATTTGGCTCCATGGCTTAG3IABkFQ (Integrated DNA Technologies).

    Article Title:
    Article Snippet: RNA production RNA oligonucleotides containing S. cerevisiae U6 nucleotides 95–112 with one, three, or six additional 3′ uridine nucleotides and containing a 5′ 6-carboxyfluorescein (6-FAM) moiety and a 2′,3′-cis -diol or phosphate were purchased from Integrated DNA Technologies.

    Article Title:
    Article Snippet: Custom primer probe sequences labelled with 6-carboxyfluorescein (FAM) were ordered from Integrated DNA Technologies (IDT, Coralville, IA).

    Article Title:
    Article Snippet: 5′-6-FAM labeled ssRNA TAR19 (rArUrCrUrGrArGrCrCrUrGrGrGrArGrCrUrCrA) (Integrated DNA Technologies) ( ) was dissolved in water to 100 μM.

    Article Title:
    Article Snippet: Dual-labeled fluorescent probe 6-FAM-UUA UCA AAU UCU UAU UUG CCC CAU UUU UUU GGU UUA-BHQ-1 was custom synthesized by Integrated DNA Technologies.

    Article Title:
    Article Snippet: All the probes were double-quenched and contained Iowa Black FQ (IBFQ) quencher at the 3′-end and 6-FAM fluorescent dye at the 5′-end (Integrated DNA Technologies).

    Article Title:
    Article Snippet: Store aliquots at −80 °C) Generic substrate: 5’-(6-FAM)-CCUAU UCUAU AGUGU CACCU AAAUG CUAGA GCU modC(2’-O-Me)-3’ Blocked substrate: 5’-(6-FAM)-CCUAU UCUAU AGUGU CACCU AAAUG CUAGA GCU modC(2’-O-Me, 3’-PO4 )-3’ Note: Both substrates were ordered from the Integrated DNA Technologies at 100 nmole scale, purified by RNase-free HPLC.

    Article Title:
    Article Snippet: To confirm that protein function was not compromised upon labeling, RNase A was assayed for ribonucleolytic activity by using a fluorogenic substrate, 6-FAM–dArUdGdA–6-TAMRA (Integrated DNA Technologies, Coralville, IA) ( ).

    Article Title:
    Article Snippet: The probe was generated by PCR with HPLC purified primers Footprint-up-FAM (5′-(6-FAM)- ACGCCGAAGGCTTCCTCCAAG -3′) and Footprint-down (5′- GTCCTGCAACTCGGCCGGTAT -3′) from Integrated DNA Technologies, Inc. PA1226 and PA1413 proteins were incubated with 500 ng of fluorescently labeled probe for 10 min at room temperature in EMSA buffer ( ).

    Article Title:
    Article Snippet: The probe was labeled with 6-carboxyfluorescein (FAM) reporter dye at the 5′ end, ZEN (Integrated DNA Technologies [IDT], Coralville, IA) internal quencher, and IBFQ (Iowa black fluorescein quencher; IDT).

    Article Title:
    Article Snippet: In control experiments, regular R5V3 probe without LNA was produced in an asymmetric PCR using V3F-FAM 5′ 6-FAM™ -AATCTGTAGAAATTAATTGTACAAGAC 3′ (Integrated DNA Technologies, Coralville, USA) as excess primer.

    Article Title:
    Article Snippet: Puf3-target-A30 and Zfs1-target-A30 RNA were synthesized with a 5ʹ 6-FAM fluorophore label (Integrated DNA Technologies).

    Article Title:
    Article Snippet: 5’-/6-FAM labeled ssDNA, ssRNA and dsDNA were obtained from Integrated DNA Technologies and dissolved in water to 100 µM.

    Article Title:
    Article Snippet: DNA probes for gel mobility shift analyses were generated by standard polymerase chain reaction using primers with a 5′ 6-FAM (fluorescein) tag (Integrated DNA Technologies).

    Article Title:
    Article Snippet: It was synthesized with a 3′ 6-fluorescein (FAM) to facilitate detection (Integrated DNA Technologies, USA).

    Article Title:
    Article Snippet: In vitro binding assays Ten nM of double-stranded, 6-FAM-labeled DNA (Integrated DNA Technologies) was incubated with indicated amounts of protein in 100 mM NaCl, 20 mM Tris-HCl pH 7.4, and 5% glycerol.

    Article Title:
    Article Snippet: 6-carboxyfluorescein (FAM) dye-labeled aptamer (5’-GGGGCACGTTTATCCGTCCCTCCTAGTGGCGTGCCCC- 3’) was synthesized by Integrated DNA Technologies.

    Article Title:
    Article Snippet: The EMSA was performed with 6-FAM fluorescence-labeled and HPLC-purified oligonucleotides (Integrated DNA Technologies) dissolved in 10 mM Tris⋅HCl (pH 8.5).

    Article Title:
    Article Snippet: Equal amounts of RNA were used for a one-step quantitative reverse transcription-PCR (qRT-PCR) using the SuperScript III Platinum one-step qRT-PCR kit with ROX (Life Technologies) with commercially available 6-carboxyfluorescein (FAM) reporter dye primers (Integrated DNA Technologies) specific for the genes MX1 , ISG15 , OAS1 , CCL5 , CCL20 , and IFNB1 .

    Electrophoretic Mobility Shift Assay:

    Article Title:
    Article Snippet: Paragraph title: Non-radioactive electrophoretic mobility shift assay (EMSA) and fluorescence polarization (FP) assay ... The Bcl2_WT RNA oligonucleotide was synthesized and 5′-end labeled with the fluorophore 6-carboxyfluorescin (FAM) by Integrated DNA Technologies, Inc.: 5′-/56FAM/CCCGUUGCUUUUCCUCUGGGAAGGAUGGCGCACGCUGGG.

    IA:

    Article Title:
    Article Snippet: .. The three test probe assays, IC2, IC1, and SNRPN exon 1, were created using unique sequences that do not overlap and tagged with 6‐carboxfluorescein (FAM) (Integrated DNA Technologies, Coralville, IA) (Figure , Table ). .. All assays were run in a duplexed reaction consisting of one test probe and primers and the 6‐carboxy‐2, 4, 4, 5, 7, 7 hexachlorofluorescein succinimidyl ester (HEX)‐3IABkFQ‐tagged GABRβ3 assay (Unique assay ID: dHsaCP2500276; Bio‐Rad Laboratories, Hercules, CA).

    Staining:

    Article Title:
    Article Snippet: The FISH probes were labeled with either the green fluorescent probe Cy3 or 6-carboxy-fluorescine (FAM) (Integrated DNA Technologies Inc., Coralville, Iowa). .. The eubacterial probe Eub338 5′-GCTGCCTCCCGTAGGAGT-3′ conjugated with Cy5 (red) was used as a general bacterial stain [ ].

    Recombinant:

    Article Title:
    Article Snippet: Non-radioactive electrophoretic mobility shift assay (EMSA) and fluorescence polarization (FP) assay The binding affinity of wildtype recombinant La protein to the Bcl2_WT RNA was determined by native EMSA and FP assay, as described recently [ ]. .. The Bcl2_WT RNA oligonucleotide was synthesized and 5′-end labeled with the fluorophore 6-carboxyfluorescin (FAM) by Integrated DNA Technologies, Inc.: 5′-/56FAM/CCCGUUGCUUUUCCUCUGGGAAGGAUGGCGCACGCUGGG.

    Fluorescence In Situ Hybridization:

    Article Title:
    Article Snippet: .. The FISH probes were labeled with either the green fluorescent probe Cy3 or 6-carboxy-fluorescine (FAM) (Integrated DNA Technologies Inc., Coralville, Iowa). .. The eubacterial probe Eub338 5′-GCTGCCTCCCGTAGGAGT-3′ conjugated with Cy5 (red) was used as a general bacterial stain [ ].

    In Situ Hybridization:

    Article Title:
    Article Snippet: Paragraph title: Fluorescence in situ hybridization ... The FISH probes were labeled with either the green fluorescent probe Cy3 or 6-carboxy-fluorescine (FAM) (Integrated DNA Technologies Inc., Coralville, Iowa).

    Software:

    Article Title:
    Article Snippet: The Bcl2_WT RNA oligonucleotide was synthesized and 5′-end labeled with the fluorophore 6-carboxyfluorescin (FAM) by Integrated DNA Technologies, Inc.: 5′-/56FAM/CCCGUUGCUUUUCCUCUGGGAAGGAUGGCGCACGCUGGG. .. The Bcl2_WT RNA oligonucleotide was synthesized and 5′-end labeled with the fluorophore 6-carboxyfluorescin (FAM) by Integrated DNA Technologies, Inc.: 5′-/56FAM/CCCGUUGCUUUUCCUCUGGGAAGGAUGGCGCACGCUGGG.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 70
    Integrated DNA Technologies fitc nf ãŽâºb decoy sense odn
    Time course of quenching by Iowa Black <t>FQ-ODN</t> in the presence of Triton X-100. The fluorescence of <t>FITC-ODN</t> and its quenching by Iowa Black FQ-ODN was determined in the presence of 5 % TritonX-100. The time necessary for the completely hybridize is approximately
    Fitc Nf ãŽâºb Decoy Sense Odn, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 70/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fitc nf ãŽâºb decoy sense odn/product/Integrated DNA Technologies
    Average 70 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    fitc nf ãŽâºb decoy sense odn - by Bioz Stars, 2020-01
    70/100 stars
      Buy from Supplier

    84
    Integrated DNA Technologies 6 fam label
    IP-FM analysis of naRNA4- and HU-mediated DNA condensation using syn- cr DNA. ( A ) An expected secondary structure of syn- cr DNA. The DNA was synthesized and labeled with <t>6-FAM</t> at 5′. ( B ) Fluorescence polarization and HU binding to syn- cr DNA. Different concentrations of HU protein (0–640 nM) were added to 1 nM 6-FAM–syn- cr DNA. After incubation at room temperature for 10 min, fluorescence polarization (in units of mP) was obtained and plotted as a function of HU concentration. Data analysis was carried out with Prism 7. Error bars show SD of triplicate experiments. The determined K d is 7.9 nM. ( C ) Typical FM images. The components in different assays are in the margins. The fluorescent images were processed by ImageJ. The images are representative of three experiments. (Scale bar: 1 μm.)
    6 Fam Label, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 84/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam label/product/Integrated DNA Technologies
    Average 84 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    6 fam label - by Bioz Stars, 2020-01
    84/100 stars
      Buy from Supplier

    94
    Integrated DNA Technologies 6 carboxyfluorescein
    An RNA/DNA cognate pair system was designed to undergo conditional strand exchange by hybridizing to neighboring sites on an RNA trigger. ( A ) “Traditional” RNA/DNA hybrid pairs act as an 2-input AND gate. Hybridization between the single stranded toeholds of a sense hybrid ( sH ) and antisense hybrid ( aH ) initiates a thermodynamically driven strand exchange that generates a dsRNA duplex and DNA waste byproduct. ( B ) The “adjacent targeting” RNA/DNA hybrid system functions as a 3-input AND gate, requiring a hybrid pair as well as a specific RNA trigger sequence. The hybrid pair’s respective toeholds bind to regions of the trigger that are immediately upstream and downstream from one another. Anchoring the cognate hybrids in close proximity leads to initiation of the thermodynamically favorable strand exchange reaction and dsRNA release. ( C ) Five different cognate pairs of adjacent targeting hybrids were analyzed by 12% acrylamide non-denaturing PAGE for their ability to release a DsiRNA product. Each sense hybrid and the DsiRNA control assembly contained a 3′ <t>6-carboxyfluorescein</t> (6-FAM) labeled sense RNA strand for visualization. The pairs of constructs differ in the number of DNA nucleotides inserted between the single-strand toehold and the RNA/DNA hybrid duplex. These inserted nucleotides were complementary between cognate hybrids, resulting in either 0, +1, +2, +3 or +4 DNA bp that can seed the strand exchange (colored orange). The presence or absence of each component is indicated above each lane. The samples in the gel depicted were all incubated for 180 min at 37 °C. ( D ) Analysis of the fraction of dsRNA released by hybrid pairs in the presence and absence of the RNA trigger following 30, 90 or 180 min incubations at 37 °C. Error bars indicate standard deviation of three replicate experiments. Indication of statistical significance between samples is reported in the supporting information.
    6 Carboxyfluorescein, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 94/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 carboxyfluorescein/product/Integrated DNA Technologies
    Average 94 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    6 carboxyfluorescein - by Bioz Stars, 2020-01
    94/100 stars
      Buy from Supplier

    Image Search Results


    Time course of quenching by Iowa Black FQ-ODN in the presence of Triton X-100. The fluorescence of FITC-ODN and its quenching by Iowa Black FQ-ODN was determined in the presence of 5 % TritonX-100. The time necessary for the completely hybridize is approximately

    Journal: Journal of controlled release : official journal of the Controlled Release Society

    Article Title: Encapsulation of NF-? B Decoy Oligonucleotides within Echogenic Liposomes and Ultrasound-Triggered Release

    doi: 10.1016/j.jconrel.2009.09.017

    Figure Lengend Snippet: Time course of quenching by Iowa Black FQ-ODN in the presence of Triton X-100. The fluorescence of FITC-ODN and its quenching by Iowa Black FQ-ODN was determined in the presence of 5 % TritonX-100. The time necessary for the completely hybridize is approximately

    Article Snippet: FITC-NF-κB decoy sense ODN (5′-AGT TGA GGG GAC TTT CCC AGG C/36-FAM/ - 3′) and Iowa BlackTM FQ labeled NF-κB decoy antisense ODN (5′ - /5IAbFQ/GCC TGG GAA AGT CCC CTC AAC T – 3′) from Integrated DNA Technologies, Inc. (Coralville, IA) were utilized.

    Techniques: Fluorescence

    Quenching of FITC-ODN fluorescence upon hybridization with Iowa Black FQ-ODN. The fluorescence of FITC-ODN alone at 0.05 μM was taken as 100 %.

    Journal: Journal of controlled release : official journal of the Controlled Release Society

    Article Title: Encapsulation of NF-? B Decoy Oligonucleotides within Echogenic Liposomes and Ultrasound-Triggered Release

    doi: 10.1016/j.jconrel.2009.09.017

    Figure Lengend Snippet: Quenching of FITC-ODN fluorescence upon hybridization with Iowa Black FQ-ODN. The fluorescence of FITC-ODN alone at 0.05 μM was taken as 100 %.

    Article Snippet: FITC-NF-κB decoy sense ODN (5′-AGT TGA GGG GAC TTT CCC AGG C/36-FAM/ - 3′) and Iowa BlackTM FQ labeled NF-κB decoy antisense ODN (5′ - /5IAbFQ/GCC TGG GAA AGT CCC CTC AAC T – 3′) from Integrated DNA Technologies, Inc. (Coralville, IA) were utilized.

    Techniques: Fluorescence, Hybridization

    Encapsulation and ultrasound-triggered release of FITC-ODN with two types of liposomal compositions demonstrating enhanced release of ODN from ELIP. Although both compositions released similar percentages of ODN upon ultrasound application, DOPE liposomes

    Journal: Journal of controlled release : official journal of the Controlled Release Society

    Article Title: Encapsulation of NF-? B Decoy Oligonucleotides within Echogenic Liposomes and Ultrasound-Triggered Release

    doi: 10.1016/j.jconrel.2009.09.017

    Figure Lengend Snippet: Encapsulation and ultrasound-triggered release of FITC-ODN with two types of liposomal compositions demonstrating enhanced release of ODN from ELIP. Although both compositions released similar percentages of ODN upon ultrasound application, DOPE liposomes

    Article Snippet: FITC-NF-κB decoy sense ODN (5′-AGT TGA GGG GAC TTT CCC AGG C/36-FAM/ - 3′) and Iowa BlackTM FQ labeled NF-κB decoy antisense ODN (5′ - /5IAbFQ/GCC TGG GAA AGT CCC CTC AAC T – 3′) from Integrated DNA Technologies, Inc. (Coralville, IA) were utilized.

    Techniques:

    Encapsulation and release efficiencies of FITC-ODN using two types of liposomal formulation. There is no significant difference between data for preparations containing FITC-ODN only and those in which FITC-ODN was combined with untagged double-stranded

    Journal: Journal of controlled release : official journal of the Controlled Release Society

    Article Title: Encapsulation of NF-? B Decoy Oligonucleotides within Echogenic Liposomes and Ultrasound-Triggered Release

    doi: 10.1016/j.jconrel.2009.09.017

    Figure Lengend Snippet: Encapsulation and release efficiencies of FITC-ODN using two types of liposomal formulation. There is no significant difference between data for preparations containing FITC-ODN only and those in which FITC-ODN was combined with untagged double-stranded

    Article Snippet: FITC-NF-κB decoy sense ODN (5′-AGT TGA GGG GAC TTT CCC AGG C/36-FAM/ - 3′) and Iowa BlackTM FQ labeled NF-κB decoy antisense ODN (5′ - /5IAbFQ/GCC TGG GAA AGT CCC CTC AAC T – 3′) from Integrated DNA Technologies, Inc. (Coralville, IA) were utilized.

    Techniques:

    Concentration dependence of FITC-ODN fluorescence (6 mm diameter cuvette). FITC-ODN fluorescence is linear up to 8 μM. Above 8 μM, the relationship becomes nonlinear, and intensity begins to decrease at high concentration starts self-quenching.

    Journal: Journal of controlled release : official journal of the Controlled Release Society

    Article Title: Encapsulation of NF-? B Decoy Oligonucleotides within Echogenic Liposomes and Ultrasound-Triggered Release

    doi: 10.1016/j.jconrel.2009.09.017

    Figure Lengend Snippet: Concentration dependence of FITC-ODN fluorescence (6 mm diameter cuvette). FITC-ODN fluorescence is linear up to 8 μM. Above 8 μM, the relationship becomes nonlinear, and intensity begins to decrease at high concentration starts self-quenching.

    Article Snippet: FITC-NF-κB decoy sense ODN (5′-AGT TGA GGG GAC TTT CCC AGG C/36-FAM/ - 3′) and Iowa BlackTM FQ labeled NF-κB decoy antisense ODN (5′ - /5IAbFQ/GCC TGG GAA AGT CCC CTC AAC T – 3′) from Integrated DNA Technologies, Inc. (Coralville, IA) were utilized.

    Techniques: Concentration Assay, Fluorescence

    IP-FM analysis of naRNA4- and HU-mediated DNA condensation using syn- cr DNA. ( A ) An expected secondary structure of syn- cr DNA. The DNA was synthesized and labeled with 6-FAM at 5′. ( B ) Fluorescence polarization and HU binding to syn- cr DNA. Different concentrations of HU protein (0–640 nM) were added to 1 nM 6-FAM–syn- cr DNA. After incubation at room temperature for 10 min, fluorescence polarization (in units of mP) was obtained and plotted as a function of HU concentration. Data analysis was carried out with Prism 7. Error bars show SD of triplicate experiments. The determined K d is 7.9 nM. ( C ) Typical FM images. The components in different assays are in the margins. The fluorescent images were processed by ImageJ. The images are representative of three experiments. (Scale bar: 1 μm.)

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: DNA–RNA interactions are critical for chromosome condensation in Escherichia coli

    doi: 10.1073/pnas.1711285114

    Figure Lengend Snippet: IP-FM analysis of naRNA4- and HU-mediated DNA condensation using syn- cr DNA. ( A ) An expected secondary structure of syn- cr DNA. The DNA was synthesized and labeled with 6-FAM at 5′. ( B ) Fluorescence polarization and HU binding to syn- cr DNA. Different concentrations of HU protein (0–640 nM) were added to 1 nM 6-FAM–syn- cr DNA. After incubation at room temperature for 10 min, fluorescence polarization (in units of mP) was obtained and plotted as a function of HU concentration. Data analysis was carried out with Prism 7. Error bars show SD of triplicate experiments. The determined K d is 7.9 nM. ( C ) Typical FM images. The components in different assays are in the margins. The fluorescent images were processed by ImageJ. The images are representative of three experiments. (Scale bar: 1 μm.)

    Article Snippet: The syn- cr DNA with 6-FAM label at the 5′ end was supplied by Integrated DNA Technologies. naRNA4 and its variants were obtained by in vitro transcription assay as described previously with modifications ( ).

    Techniques: Synthesized, Labeling, Fluorescence, Binding Assay, Incubation, Concentration Assay

    Confirmation of a chaperone role of HU in naRNA4/HU-mediated DNA condensation. ( A ) IP-Western blot analysis of HU in condensation complexes. M, Molecular weight protein markers. Different concentrations of HU (5, 10, 20, and 40 ng, lanes 1–4, respectively) were loaded as positive controls. S (lanes 5, 7, and 9) and E (lanes 6, 8, and 10) represent the supernatants and eluates from the beads, respectively. The components of the assays are labeled at the top. ( B ) IP/IP-PCR analysis of plasmid DNA in condensation complexes. The reaction mixtures of condensation assays were incubated with anti-HU antibody, resulting in supernatants (S) and eluates (E). Supernatants (S) were further incubated with S9.6 antibody, resulting in supernatants (S/S) and eluates (S/E). DNA was extracted and purified from the solutions and analyzed by 1.5% agarose gel after PCR using pSA508-targeted primers. ( C ) IP/IP FM analysis of Cy-3–naRNA4 and 6-FAM–syn- cr DNA in condensation complexes. The components are in the left margins. Beads were washed with buffer three times before imaging. Images were processed by ImageJ. The images are representative of triplicate experiments. n/a, not applicable. (Scale bar: 1 μm.) ( D ). Among them are the formation of kissing DNA–RNA loops, parallel DNA–RNA heteroduplexes, Watson/Crick base pairing between some parts of the DNA and naRNA4 hairpin stems and hook-like connections between cruciform DNA loops and single-stranded naRNA4 loops. We are currently investigating the possible presence of any of these complexes in the DNA condensates.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: DNA–RNA interactions are critical for chromosome condensation in Escherichia coli

    doi: 10.1073/pnas.1711285114

    Figure Lengend Snippet: Confirmation of a chaperone role of HU in naRNA4/HU-mediated DNA condensation. ( A ) IP-Western blot analysis of HU in condensation complexes. M, Molecular weight protein markers. Different concentrations of HU (5, 10, 20, and 40 ng, lanes 1–4, respectively) were loaded as positive controls. S (lanes 5, 7, and 9) and E (lanes 6, 8, and 10) represent the supernatants and eluates from the beads, respectively. The components of the assays are labeled at the top. ( B ) IP/IP-PCR analysis of plasmid DNA in condensation complexes. The reaction mixtures of condensation assays were incubated with anti-HU antibody, resulting in supernatants (S) and eluates (E). Supernatants (S) were further incubated with S9.6 antibody, resulting in supernatants (S/S) and eluates (S/E). DNA was extracted and purified from the solutions and analyzed by 1.5% agarose gel after PCR using pSA508-targeted primers. ( C ) IP/IP FM analysis of Cy-3–naRNA4 and 6-FAM–syn- cr DNA in condensation complexes. The components are in the left margins. Beads were washed with buffer three times before imaging. Images were processed by ImageJ. The images are representative of triplicate experiments. n/a, not applicable. (Scale bar: 1 μm.) ( D ). Among them are the formation of kissing DNA–RNA loops, parallel DNA–RNA heteroduplexes, Watson/Crick base pairing between some parts of the DNA and naRNA4 hairpin stems and hook-like connections between cruciform DNA loops and single-stranded naRNA4 loops. We are currently investigating the possible presence of any of these complexes in the DNA condensates.

    Article Snippet: The syn- cr DNA with 6-FAM label at the 5′ end was supplied by Integrated DNA Technologies. naRNA4 and its variants were obtained by in vitro transcription assay as described previously with modifications ( ).

    Techniques: Western Blot, Molecular Weight, Labeling, Polymerase Chain Reaction, Plasmid Preparation, Incubation, Purification, Agarose Gel Electrophoresis, Imaging

    Flowchart of IP in combination with PCR ( A ) and IP in combination with FM ( B ). ( A ) In an IPP assay, Cy-3–labeled RNA (naRNA4 or its variants) was mixed with HU and plasmid DNA. Following condensation, the solution was incubated with S9.6 antibody-coated beads. After collecting the supernatant (S), the beads were then washed with buffer. Eluate (E) from beads was collected. DNA was extracted from both S and E by the phenol and ethanol method. PCR was carried out using specific primers targeted to plasmid DNA. Finally, the amplification products were separated by agarose gel and examined. ( B ) In IPFM assay, Cy-3–labeled RNA (naRNA4 or its variants) was mixed with HU and DNA (either plasmid DNA or 6-FAM–labeled cruciform DNA). Following condensation, the solution was incubated with S9.6 antibody-coated silica beads. The supernatant was discarded. The beads washed with buffer were then delivered to FM for imaging.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: DNA–RNA interactions are critical for chromosome condensation in Escherichia coli

    doi: 10.1073/pnas.1711285114

    Figure Lengend Snippet: Flowchart of IP in combination with PCR ( A ) and IP in combination with FM ( B ). ( A ) In an IPP assay, Cy-3–labeled RNA (naRNA4 or its variants) was mixed with HU and plasmid DNA. Following condensation, the solution was incubated with S9.6 antibody-coated beads. After collecting the supernatant (S), the beads were then washed with buffer. Eluate (E) from beads was collected. DNA was extracted from both S and E by the phenol and ethanol method. PCR was carried out using specific primers targeted to plasmid DNA. Finally, the amplification products were separated by agarose gel and examined. ( B ) In IPFM assay, Cy-3–labeled RNA (naRNA4 or its variants) was mixed with HU and DNA (either plasmid DNA or 6-FAM–labeled cruciform DNA). Following condensation, the solution was incubated with S9.6 antibody-coated silica beads. The supernatant was discarded. The beads washed with buffer were then delivered to FM for imaging.

    Article Snippet: The syn- cr DNA with 6-FAM label at the 5′ end was supplied by Integrated DNA Technologies. naRNA4 and its variants were obtained by in vitro transcription assay as described previously with modifications ( ).

    Techniques: Polymerase Chain Reaction, Labeling, Plasmid Preparation, Incubation, Amplification, Agarose Gel Electrophoresis, Imaging

    An RNA/DNA cognate pair system was designed to undergo conditional strand exchange by hybridizing to neighboring sites on an RNA trigger. ( A ) “Traditional” RNA/DNA hybrid pairs act as an 2-input AND gate. Hybridization between the single stranded toeholds of a sense hybrid ( sH ) and antisense hybrid ( aH ) initiates a thermodynamically driven strand exchange that generates a dsRNA duplex and DNA waste byproduct. ( B ) The “adjacent targeting” RNA/DNA hybrid system functions as a 3-input AND gate, requiring a hybrid pair as well as a specific RNA trigger sequence. The hybrid pair’s respective toeholds bind to regions of the trigger that are immediately upstream and downstream from one another. Anchoring the cognate hybrids in close proximity leads to initiation of the thermodynamically favorable strand exchange reaction and dsRNA release. ( C ) Five different cognate pairs of adjacent targeting hybrids were analyzed by 12% acrylamide non-denaturing PAGE for their ability to release a DsiRNA product. Each sense hybrid and the DsiRNA control assembly contained a 3′ 6-carboxyfluorescein (6-FAM) labeled sense RNA strand for visualization. The pairs of constructs differ in the number of DNA nucleotides inserted between the single-strand toehold and the RNA/DNA hybrid duplex. These inserted nucleotides were complementary between cognate hybrids, resulting in either 0, +1, +2, +3 or +4 DNA bp that can seed the strand exchange (colored orange). The presence or absence of each component is indicated above each lane. The samples in the gel depicted were all incubated for 180 min at 37 °C. ( D ) Analysis of the fraction of dsRNA released by hybrid pairs in the presence and absence of the RNA trigger following 30, 90 or 180 min incubations at 37 °C. Error bars indicate standard deviation of three replicate experiments. Indication of statistical significance between samples is reported in the supporting information.

    Journal: Nanomaterials

    Article Title: A Suite of Therapeutically-Inspired Nucleic Acid Logic Systems for Conditional Generation of Single-Stranded and Double-Stranded Oligonucleotides

    doi: 10.3390/nano9040615

    Figure Lengend Snippet: An RNA/DNA cognate pair system was designed to undergo conditional strand exchange by hybridizing to neighboring sites on an RNA trigger. ( A ) “Traditional” RNA/DNA hybrid pairs act as an 2-input AND gate. Hybridization between the single stranded toeholds of a sense hybrid ( sH ) and antisense hybrid ( aH ) initiates a thermodynamically driven strand exchange that generates a dsRNA duplex and DNA waste byproduct. ( B ) The “adjacent targeting” RNA/DNA hybrid system functions as a 3-input AND gate, requiring a hybrid pair as well as a specific RNA trigger sequence. The hybrid pair’s respective toeholds bind to regions of the trigger that are immediately upstream and downstream from one another. Anchoring the cognate hybrids in close proximity leads to initiation of the thermodynamically favorable strand exchange reaction and dsRNA release. ( C ) Five different cognate pairs of adjacent targeting hybrids were analyzed by 12% acrylamide non-denaturing PAGE for their ability to release a DsiRNA product. Each sense hybrid and the DsiRNA control assembly contained a 3′ 6-carboxyfluorescein (6-FAM) labeled sense RNA strand for visualization. The pairs of constructs differ in the number of DNA nucleotides inserted between the single-strand toehold and the RNA/DNA hybrid duplex. These inserted nucleotides were complementary between cognate hybrids, resulting in either 0, +1, +2, +3 or +4 DNA bp that can seed the strand exchange (colored orange). The presence or absence of each component is indicated above each lane. The samples in the gel depicted were all incubated for 180 min at 37 °C. ( D ) Analysis of the fraction of dsRNA released by hybrid pairs in the presence and absence of the RNA trigger following 30, 90 or 180 min incubations at 37 °C. Error bars indicate standard deviation of three replicate experiments. Indication of statistical significance between samples is reported in the supporting information.

    Article Snippet: All AlexaFluor546, AlexaFluor488 and 6-carboxyfluorescein (6-FAM) fluorescently labeled oligonucleotides were purchased from IDT.

    Techniques: Activated Clotting Time Assay, Hybridization, Sequencing, Polyacrylamide Gel Electrophoresis, Labeling, Construct, Incubation, Standard Deviation

    Effects of DNA structural alteration on the degree of trigger-inducible dsRNA release. ( A ) Four different sense hybrids that are responsive to the connective tissue growth factor (CTGF) trigger were designed, each having different features within the structured DNA hairpin. The hairpins differed in the size of their loop or the length of their stem. Two different cognate antisense hybrids were designed and differ in the length of their single-stranded toehold. Sequence regions are indicated by lowercase letters and different colors to convey sequence identity or sequence complementarity. ( B , D ) DsiRNA release in the presence and absence of trigger was assessed by 10% acrylamide non-denaturing PAGE for each sense hybrid paired with a cognate antisense hybrid exhibiting either ( B ) a 12 nt toehold ( aH ^CTGF-cgnt.12 ) or ( D ) a 16 nt toehold ( aH ^CTGF-cgnt.16 ). Each sense hybrid and the DsiRNA control contained a 3′ 6-carboxyfluorescein (6-FAM) labeled sense RNA strand for visualization and quantification. Gels in both ( B ) and ( D ) depict samples that were incubated for 30 min at 37 °C. ( C , E ) Analysis of the fraction of dsRNA released by the four sense hybrids paired with ( C ) aH ^CTGF-cgnt.12 or ( E ) aH ^CTGF-cgnt.16 , in the presence and absence of the RNA trigger following 30, 90, or 180 min incubations at 37 °C. Error bars indicate standard deviation of three replicate experiments. Indication of statistical significance between samples is reported in the supporting information.

    Journal: Nanomaterials

    Article Title: A Suite of Therapeutically-Inspired Nucleic Acid Logic Systems for Conditional Generation of Single-Stranded and Double-Stranded Oligonucleotides

    doi: 10.3390/nano9040615

    Figure Lengend Snippet: Effects of DNA structural alteration on the degree of trigger-inducible dsRNA release. ( A ) Four different sense hybrids that are responsive to the connective tissue growth factor (CTGF) trigger were designed, each having different features within the structured DNA hairpin. The hairpins differed in the size of their loop or the length of their stem. Two different cognate antisense hybrids were designed and differ in the length of their single-stranded toehold. Sequence regions are indicated by lowercase letters and different colors to convey sequence identity or sequence complementarity. ( B , D ) DsiRNA release in the presence and absence of trigger was assessed by 10% acrylamide non-denaturing PAGE for each sense hybrid paired with a cognate antisense hybrid exhibiting either ( B ) a 12 nt toehold ( aH ^CTGF-cgnt.12 ) or ( D ) a 16 nt toehold ( aH ^CTGF-cgnt.16 ). Each sense hybrid and the DsiRNA control contained a 3′ 6-carboxyfluorescein (6-FAM) labeled sense RNA strand for visualization and quantification. Gels in both ( B ) and ( D ) depict samples that were incubated for 30 min at 37 °C. ( C , E ) Analysis of the fraction of dsRNA released by the four sense hybrids paired with ( C ) aH ^CTGF-cgnt.12 or ( E ) aH ^CTGF-cgnt.16 , in the presence and absence of the RNA trigger following 30, 90, or 180 min incubations at 37 °C. Error bars indicate standard deviation of three replicate experiments. Indication of statistical significance between samples is reported in the supporting information.

    Article Snippet: All AlexaFluor546, AlexaFluor488 and 6-carboxyfluorescein (6-FAM) fluorescently labeled oligonucleotides were purchased from IDT.

    Techniques: Sequencing, Polyacrylamide Gel Electrophoresis, Labeling, Incubation, Standard Deviation

    Incorporation of a structured responsive element can generate a trigger-inducible RNA/DNA hybrid system. ( A ) The inducible hybrid system functions as a three-input AND gate. The sense hybrid sH ^CTGF.12/8 contains a responsive DNA hairpin composed of a 12 bp stem and an 8 nt loop, and is flanked by an extended 5′ single strand that acts as a diagnostic toehold. Trigger hybridization to the diagnostic toehold progresses through the hairpin stem and unzips the hairpin (sequence regions colored blue). This liberates a previously sequestered toehold within sH ^CTGF.12/8 which can then hybridize with the complementary toehold of the cognate antisense hybrid, aH ^CTGF-cgnt.12 . Hybridization of these exchange toeholds (sequence regions colored orange) initiates strand exchange and releases a dsRNA product. ( B ) The function of this conditional system was assessed by 8% acrylamide non-denaturing PAGE and total staining with ethidium bromide. DsiRNA release is observed when the sense and antisense hybrids are co-incubated in the presence of trigger (red box). Formation of the expected waste product is observed by comparison to a control assembly of the s’ and a’ DNA strands with the trigger molecule. All samples were incubated for 30 min at 37 °C. ( C ) Förster resonance energy transfer (FRET) analysis was performed as another method to verify conditional dsRNA formation. sH ^CTGF.12/8 was assembled using a 3′ 6-carboxyfluorescein (6-FAM) (ex/em 495/520 nm) labeled sense RNA strand. aH ^CTGF-cgnt.12 was assembled using a 5′-AlexaFluor546 (ex/em 555/570 nm) labeled antisense RNA strand. The hybrids were mixed and incubated at 37 °C for one hour in the presence or absence of the RNA trigger. Fluorescence emission spectra were recorded at t = 0 and t = 60 min using excitation at 475 nm.

    Journal: Nanomaterials

    Article Title: A Suite of Therapeutically-Inspired Nucleic Acid Logic Systems for Conditional Generation of Single-Stranded and Double-Stranded Oligonucleotides

    doi: 10.3390/nano9040615

    Figure Lengend Snippet: Incorporation of a structured responsive element can generate a trigger-inducible RNA/DNA hybrid system. ( A ) The inducible hybrid system functions as a three-input AND gate. The sense hybrid sH ^CTGF.12/8 contains a responsive DNA hairpin composed of a 12 bp stem and an 8 nt loop, and is flanked by an extended 5′ single strand that acts as a diagnostic toehold. Trigger hybridization to the diagnostic toehold progresses through the hairpin stem and unzips the hairpin (sequence regions colored blue). This liberates a previously sequestered toehold within sH ^CTGF.12/8 which can then hybridize with the complementary toehold of the cognate antisense hybrid, aH ^CTGF-cgnt.12 . Hybridization of these exchange toeholds (sequence regions colored orange) initiates strand exchange and releases a dsRNA product. ( B ) The function of this conditional system was assessed by 8% acrylamide non-denaturing PAGE and total staining with ethidium bromide. DsiRNA release is observed when the sense and antisense hybrids are co-incubated in the presence of trigger (red box). Formation of the expected waste product is observed by comparison to a control assembly of the s’ and a’ DNA strands with the trigger molecule. All samples were incubated for 30 min at 37 °C. ( C ) Förster resonance energy transfer (FRET) analysis was performed as another method to verify conditional dsRNA formation. sH ^CTGF.12/8 was assembled using a 3′ 6-carboxyfluorescein (6-FAM) (ex/em 495/520 nm) labeled sense RNA strand. aH ^CTGF-cgnt.12 was assembled using a 5′-AlexaFluor546 (ex/em 555/570 nm) labeled antisense RNA strand. The hybrids were mixed and incubated at 37 °C for one hour in the presence or absence of the RNA trigger. Fluorescence emission spectra were recorded at t = 0 and t = 60 min using excitation at 475 nm.

    Article Snippet: All AlexaFluor546, AlexaFluor488 and 6-carboxyfluorescein (6-FAM) fluorescently labeled oligonucleotides were purchased from IDT.

    Techniques: Diagnostic Assay, Hybridization, Sequencing, Polyacrylamide Gel Electrophoresis, Staining, Incubation, Förster Resonance Energy Transfer, Labeling, Fluorescence

    Moderate-throughput solution assay for integrase joining activity . Panel A. Principles of a solution assay to measure integrase joining activity by fluorescence. Labeling and symbols are as in Figure 1. FAM stands for carboxyfluorescein labeled DNA, a circle with B denotes a biotin modified 3' end in the target oligodeoxynucleotide. Panel B. Comparison of HIV-1 and ASV IN joining activities in Mg ++ and Mn ++ . The dashed lines with squares show the activity of ASV IN and the solid lines with triangles show the activity of HIV-1 IN expressed as RFUs versus time. Filled and open symbols represent activity in Mn ++ and Mg ++ , respectively. The inset shows results from the same experiment, after 40 min. and up to 180 min. incubation. Panel C. Comparison of the joining activity of ASV IN with the recessed versus the blunt-ended donor oligodeoxynucleotides in the presence of Mg ++ (recessed donor oligodeoxynucleotide, dashed line with filled squares; blunt-ended donor oligodeoxynucleotide, solid line with filled circles).

    Journal: AIDS Research and Therapy

    Article Title: Comparison of metal-dependent catalysis by HIV-1 and ASV integrase proteins using a new and rapid, moderate throughput assay for joining activity in solution

    doi: 10.1186/1742-6405-6-14

    Figure Lengend Snippet: Moderate-throughput solution assay for integrase joining activity . Panel A. Principles of a solution assay to measure integrase joining activity by fluorescence. Labeling and symbols are as in Figure 1. FAM stands for carboxyfluorescein labeled DNA, a circle with B denotes a biotin modified 3' end in the target oligodeoxynucleotide. Panel B. Comparison of HIV-1 and ASV IN joining activities in Mg ++ and Mn ++ . The dashed lines with squares show the activity of ASV IN and the solid lines with triangles show the activity of HIV-1 IN expressed as RFUs versus time. Filled and open symbols represent activity in Mn ++ and Mg ++ , respectively. The inset shows results from the same experiment, after 40 min. and up to 180 min. incubation. Panel C. Comparison of the joining activity of ASV IN with the recessed versus the blunt-ended donor oligodeoxynucleotides in the presence of Mg ++ (recessed donor oligodeoxynucleotide, dashed line with filled squares; blunt-ended donor oligodeoxynucleotide, solid line with filled circles).

    Article Snippet: DNA substrates Viral DNA (donor) oligodeoxynucleotides with a covalently attached 6-carboxyfluorescein (6-FAM) were purchased from Integrated DNA Technologies (Coralville, IA), and purified by Tris-borate urea denaturing polyacrylamide gel electrophoresis.

    Techniques: Activity Assay, Fluorescence, Labeling, Modification, Incubation

    Joining activity confirmed with gel electrophoresis . Left, sequences of the donor oligodeoxynucleotides used in the joining assay. The location of carboxyfluorescein (FAM), 5' radioactive 32 P, and 3' biotin are shown. The -A substrate removes only the A of the conserved CA dinucleotide while the -CA substrate removes both residues. Right, lanes 1 through 3 show HIV-1 IN joining activity on its substrate after 0, 60, 120 min of incubation, respectively. Lanes 4 through 6, 7 through 9, and 10 through 12, show ASV IN joining activity after 0, 15, 30 min of incubation.

    Journal: AIDS Research and Therapy

    Article Title: Comparison of metal-dependent catalysis by HIV-1 and ASV integrase proteins using a new and rapid, moderate throughput assay for joining activity in solution

    doi: 10.1186/1742-6405-6-14

    Figure Lengend Snippet: Joining activity confirmed with gel electrophoresis . Left, sequences of the donor oligodeoxynucleotides used in the joining assay. The location of carboxyfluorescein (FAM), 5' radioactive 32 P, and 3' biotin are shown. The -A substrate removes only the A of the conserved CA dinucleotide while the -CA substrate removes both residues. Right, lanes 1 through 3 show HIV-1 IN joining activity on its substrate after 0, 60, 120 min of incubation, respectively. Lanes 4 through 6, 7 through 9, and 10 through 12, show ASV IN joining activity after 0, 15, 30 min of incubation.

    Article Snippet: DNA substrates Viral DNA (donor) oligodeoxynucleotides with a covalently attached 6-carboxyfluorescein (6-FAM) were purchased from Integrated DNA Technologies (Coralville, IA), and purified by Tris-borate urea denaturing polyacrylamide gel electrophoresis.

    Techniques: Activity Assay, Nucleic Acid Electrophoresis, Incubation