6 fam labels  (Integrated DNA Technologies)


Bioz Verified Symbol Integrated DNA Technologies is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    Integrated DNA Technologies 6 fam labels
    Stalling the translocation of helicase motor stimulates cleavage (A) Schematic representation of target DNA (100 bp) with PAM (TTC in red) end-labelled with <t>6-FAM</t> at 5’ end of the non-target strand and biotinylated at 12 th nucleotide (Target I). A similar target DNA without biotin (Target II) is also represented. Indicated in red arrow are the prominent cleavage sites. (B) Target (I) (II) were incubated with streptavidin and Cascade/I-C to form interference complex. Cleavage was initiated by addition of Cas3 (0.2 and 0.5 μM) and 1 mM ATP/ADP/AMP-PNP. Prominent cleavages of the target (I) and (II) are indicated by a red arrow (approx. 60 nt and 40 nt). A 20% denaturing PAGE was used to assess the cleavage.
    6 Fam Labels, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 94/100, based on 27 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam labels/product/Integrated DNA Technologies
    Average 94 stars, based on 27 article reviews
    Price from $9.99 to $1999.99
    6 fam labels - by Bioz Stars, 2020-09
    94/100 stars

    Images

    1) Product Images from "Cas3 Mediated Target DNA Recognition and Cleavage is Independent of the Composition and Architecture of Cascade Surveillance Complex"

    Article Title: Cas3 Mediated Target DNA Recognition and Cleavage is Independent of the Composition and Architecture of Cascade Surveillance Complex

    Journal: bioRxiv

    doi: 10.1101/666776

    Stalling the translocation of helicase motor stimulates cleavage (A) Schematic representation of target DNA (100 bp) with PAM (TTC in red) end-labelled with 6-FAM at 5’ end of the non-target strand and biotinylated at 12 th nucleotide (Target I). A similar target DNA without biotin (Target II) is also represented. Indicated in red arrow are the prominent cleavage sites. (B) Target (I) (II) were incubated with streptavidin and Cascade/I-C to form interference complex. Cleavage was initiated by addition of Cas3 (0.2 and 0.5 μM) and 1 mM ATP/ADP/AMP-PNP. Prominent cleavages of the target (I) and (II) are indicated by a red arrow (approx. 60 nt and 40 nt). A 20% denaturing PAGE was used to assess the cleavage.
    Figure Legend Snippet: Stalling the translocation of helicase motor stimulates cleavage (A) Schematic representation of target DNA (100 bp) with PAM (TTC in red) end-labelled with 6-FAM at 5’ end of the non-target strand and biotinylated at 12 th nucleotide (Target I). A similar target DNA without biotin (Target II) is also represented. Indicated in red arrow are the prominent cleavage sites. (B) Target (I) (II) were incubated with streptavidin and Cascade/I-C to form interference complex. Cleavage was initiated by addition of Cas3 (0.2 and 0.5 μM) and 1 mM ATP/ADP/AMP-PNP. Prominent cleavages of the target (I) and (II) are indicated by a red arrow (approx. 60 nt and 40 nt). A 20% denaturing PAGE was used to assess the cleavage.

    Techniques Used: Translocation Assay, Incubation, Polyacrylamide Gel Electrophoresis

    Cascade and Cas3 form a stable complex during interference. (A) Schematic representation of 100 bp DNA substrates with biotin (black dot) at 5’ end of the nontarget strand (NTS), 6-FAM (fluorophore, green star) at 5 th nucleotide, Iowa Black ® FQ (quencher, brown dot) at 28 th nucleotide on target strand (TS) and PAM sequence TTC (depicted in red colour). (B) Substrate mentioned above was incubated with or without Cascade/I-C (1 μM) and increasing concentration of Cas3/I-C (0-5 μM). A significant decline in fluorescence intensity is evident when both Cascade/I-C and Cas3/I-C were present. There was no apparent quenching when dsDNA and ssDNA were used in the absence of Cascade/I-C (C) Fluorescence quenching was observed in the presence of ATP but not when ADP and AMP-PNP were used.
    Figure Legend Snippet: Cascade and Cas3 form a stable complex during interference. (A) Schematic representation of 100 bp DNA substrates with biotin (black dot) at 5’ end of the nontarget strand (NTS), 6-FAM (fluorophore, green star) at 5 th nucleotide, Iowa Black ® FQ (quencher, brown dot) at 28 th nucleotide on target strand (TS) and PAM sequence TTC (depicted in red colour). (B) Substrate mentioned above was incubated with or without Cascade/I-C (1 μM) and increasing concentration of Cas3/I-C (0-5 μM). A significant decline in fluorescence intensity is evident when both Cascade/I-C and Cas3/I-C were present. There was no apparent quenching when dsDNA and ssDNA were used in the absence of Cascade/I-C (C) Fluorescence quenching was observed in the presence of ATP but not when ADP and AMP-PNP were used.

    Techniques Used: Sequencing, Incubation, Concentration Assay, Fluorescence

    Roadblock in the translocation of Cas3/I-C stimulates cleavage (A) (D) A schematic representation of 60 nt 5’ 6-FAM labelled ssDNA with biotin at 12 th (Target A) and 20th nucleotide (Target B), respectively. (B) (E) ssDNA mentioned above was incubated with 200 nM of Cas3/I-C for several time points and anisotropy measurements were recorded. With time, the decrease in anisotropy values was observed for ssDNA with a biotin roadblock. (C) (F) ssDNA was pre-incubated with streptavidin before the addition of Cas3/I-C. Prominent DNA cleavage products were observed in the presence of ATP at ~40 nt in target A and ~50 nt in target B, indicated with a red arrow. In the presence of AMP-PNP higher Cas3 concentration was required for the cleavage. A 20% denaturing PAGE was used to study the cleavage pattern.
    Figure Legend Snippet: Roadblock in the translocation of Cas3/I-C stimulates cleavage (A) (D) A schematic representation of 60 nt 5’ 6-FAM labelled ssDNA with biotin at 12 th (Target A) and 20th nucleotide (Target B), respectively. (B) (E) ssDNA mentioned above was incubated with 200 nM of Cas3/I-C for several time points and anisotropy measurements were recorded. With time, the decrease in anisotropy values was observed for ssDNA with a biotin roadblock. (C) (F) ssDNA was pre-incubated with streptavidin before the addition of Cas3/I-C. Prominent DNA cleavage products were observed in the presence of ATP at ~40 nt in target A and ~50 nt in target B, indicated with a red arrow. In the presence of AMP-PNP higher Cas3 concentration was required for the cleavage. A 20% denaturing PAGE was used to study the cleavage pattern.

    Techniques Used: Translocation Assay, Incubation, Concentration Assay, Polyacrylamide Gel Electrophoresis

    Related Articles

    Next-Generation Sequencing:

    Article Title: CIS checkpoint deletion enhances the fitness of cord blood derived natural killer cells transduced with a chimeric antigen receptor
    Article Snippet: .. The potential Cas9 off-target cleavage sites identified by GuideSeq were then quantified in NK cells electroporated with RNP complexes targeting the CISH locus using rhAmpSeq technology, a multiplexed targeted enrichment approach for next generation sequencing (NGS). ..

    Chromogenic In Situ Hybridization:

    Article Title: CIS checkpoint deletion enhances the fitness of cord blood derived natural killer cells transduced with a chimeric antigen receptor
    Article Snippet: .. The potential Cas9 off-target cleavage sites identified by GuideSeq were then quantified in NK cells electroporated with RNP complexes targeting the CISH locus using rhAmpSeq technology, a multiplexed targeted enrichment approach for next generation sequencing (NGS). ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Integrated DNA Technologies 6 fam fluorophore label
    Ccr4–Not is inhibited by 3′ guanosines. a , Denaturing RNA gels showing deadenylation by recombinant S. pombe Ccr4–Not on 5′ <t>6-FAM-labeled</t> (green star) RNA substrates consisting of a 20mer non-poly(A) sequence (See Fig. 1a ) followed by 30 adenosines. Where indicated, the substrate contains three additional non-A nucleotides at the 3′ end. These gels are representative of identical experiments performed 3 times. Uncropped gel images are shown in Supplementary Data Set 1. b-d , Analysis of deadenylation on poly(A) substrates with different 3′ nucleotides. Disappearance of the intact substrate was quantified by densitometry of the fluorescently labeled, full-length RNA. Data points were normalized to time = 0, and are connected by straight lines for clarity. Assays were carried out in triplicate (n = 3 independent experiments), the data points shown represent the mean, and error bars represent standard deviation. Assays are shown for wild-type S. pombe Ccr4–Not ( b ), Ccr4-inactive Ccr4–Not ( c ) and Caf1-inactive Ccr4–Not ( d ).
    6 Fam Fluorophore Label, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 90/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam fluorophore label/product/Integrated DNA Technologies
    Average 90 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    6 fam fluorophore label - by Bioz Stars, 2020-09
    90/100 stars
      Buy from Supplier

    92
    Integrated DNA Technologies 6 fam label
    Oligomerization and substrate binding assays of hCtc1. ( A ) The oligomeric state of hCtc1(OB) was analyzed by SEC-MALS. The blue line corresponds to the Refractive Index (RI) of the hCtc1(OB) eluting from the SEC column. The red circles correspond to the molecular mass of hCtc1(OB) measured by multi-angle, light scattering (MALS: red). The data suggest that hCtc1(OB) is monomeric in solution. ( B ) Cross linking experiments of WT hCtc1(OB) using formaldehyde or glutaraldehyde also shows that this domain hCtc1 is monomeric in solution. ( C ) FP assays of hCtc1(OB) with 5′ <t>6-FAM</t> (Fluorescein) labeled, single-stranded telomeric DNA (two or three repeats) shows that this domain of hCtc1 is not involved in DNA binding. ( D ) ITC assay of hCtc1(OB) with the full length Stn1–Ten1 complex show no measurable interaction.
    6 Fam Label, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 92/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam label/product/Integrated DNA Technologies
    Average 92 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    6 fam label - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    80
    Integrated DNA Technologies 6 fam labelled oligonucleotides
    Stalling the translocation of helicase motor stimulates cleavage (A) Schematic representation of target DNA (100 bp) with PAM (TTC in red) end-labelled with <t>6-FAM</t> at 5’ end of the non-target strand and biotinylated at 12 th nucleotide (Target I). A similar target DNA without biotin (Target II) is also represented. Indicated in red arrow are the prominent cleavage sites. (B) Target (I) (II) were incubated with streptavidin and Cascade/I-C to form interference complex. Cleavage was initiated by addition of Cas3 (0.2 and 0.5 μM) and 1 mM ATP/ADP/AMP-PNP. Prominent cleavages of the target (I) and (II) are indicated by a red arrow (approx. 60 nt and 40 nt). A 20% denaturing PAGE was used to assess the cleavage.
    6 Fam Labelled Oligonucleotides, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 80/100, based on 0 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam labelled oligonucleotides/product/Integrated DNA Technologies
    Average 80 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    6 fam labelled oligonucleotides - by Bioz Stars, 2020-09
    80/100 stars
      Buy from Supplier

    Image Search Results


    Ccr4–Not is inhibited by 3′ guanosines. a , Denaturing RNA gels showing deadenylation by recombinant S. pombe Ccr4–Not on 5′ 6-FAM-labeled (green star) RNA substrates consisting of a 20mer non-poly(A) sequence (See Fig. 1a ) followed by 30 adenosines. Where indicated, the substrate contains three additional non-A nucleotides at the 3′ end. These gels are representative of identical experiments performed 3 times. Uncropped gel images are shown in Supplementary Data Set 1. b-d , Analysis of deadenylation on poly(A) substrates with different 3′ nucleotides. Disappearance of the intact substrate was quantified by densitometry of the fluorescently labeled, full-length RNA. Data points were normalized to time = 0, and are connected by straight lines for clarity. Assays were carried out in triplicate (n = 3 independent experiments), the data points shown represent the mean, and error bars represent standard deviation. Assays are shown for wild-type S. pombe Ccr4–Not ( b ), Ccr4-inactive Ccr4–Not ( c ) and Caf1-inactive Ccr4–Not ( d ).

    Journal: Nature structural & molecular biology

    Article Title: The intrinsic structure of poly(A) RNA determines the specificity of Pan2 and Caf1 deadenylases

    doi: 10.1038/s41594-019-0227-9

    Figure Lengend Snippet: Ccr4–Not is inhibited by 3′ guanosines. a , Denaturing RNA gels showing deadenylation by recombinant S. pombe Ccr4–Not on 5′ 6-FAM-labeled (green star) RNA substrates consisting of a 20mer non-poly(A) sequence (See Fig. 1a ) followed by 30 adenosines. Where indicated, the substrate contains three additional non-A nucleotides at the 3′ end. These gels are representative of identical experiments performed 3 times. Uncropped gel images are shown in Supplementary Data Set 1. b-d , Analysis of deadenylation on poly(A) substrates with different 3′ nucleotides. Disappearance of the intact substrate was quantified by densitometry of the fluorescently labeled, full-length RNA. Data points were normalized to time = 0, and are connected by straight lines for clarity. Assays were carried out in triplicate (n = 3 independent experiments), the data points shown represent the mean, and error bars represent standard deviation. Assays are shown for wild-type S. pombe Ccr4–Not ( b ), Ccr4-inactive Ccr4–Not ( c ) and Caf1-inactive Ccr4–Not ( d ).

    Article Snippet: 20mer-A30 (20mer: CAGCUCCGCAUCCCUUUCCC) with varied 3′ ends and intervening nucleotides were synthesized with a 5′ 6-FAM fluorophore label (Integrated DNA Technologies or, for 20mer-A14 DDA14 , Dharmacon).

    Techniques: Recombinant, Labeling, Sequencing, Standard Deviation

    Nucleotide base stacking is required for Pan2 and Caf1 deadenylase activity. Denaturing RNA gels showing deadenylation by ( a-d ) S. cerevisiae Pan2 UCH-Exo or ( e-h ) S. pombe Ccr4-inactive Ccr4–Not on 5′ 6-FAM-labeled (green star) RNAs consisting of a 20mer non-poly(A) sequence (see Fig. 1a ) followed by the indicated tail sequence. RNAs either had no additional nucleotides ( a , e ), two guanosines ( b , f ), two uracils ( c, g ), or two dihydrouracils (abbreviated D, panels d , h ) in the middle of the poly(A) tail. Red asterisks indicate the point of inhibition. Both Pan2 and Caf1 were strongly inhibited by guanosines and dihydrouracils interrupting a poly(A) tail. These gels are representative of identical experiments performed 2 times. Uncropped gel images are shown in Supplementary Data Set 1.

    Journal: Nature structural & molecular biology

    Article Title: The intrinsic structure of poly(A) RNA determines the specificity of Pan2 and Caf1 deadenylases

    doi: 10.1038/s41594-019-0227-9

    Figure Lengend Snippet: Nucleotide base stacking is required for Pan2 and Caf1 deadenylase activity. Denaturing RNA gels showing deadenylation by ( a-d ) S. cerevisiae Pan2 UCH-Exo or ( e-h ) S. pombe Ccr4-inactive Ccr4–Not on 5′ 6-FAM-labeled (green star) RNAs consisting of a 20mer non-poly(A) sequence (see Fig. 1a ) followed by the indicated tail sequence. RNAs either had no additional nucleotides ( a , e ), two guanosines ( b , f ), two uracils ( c, g ), or two dihydrouracils (abbreviated D, panels d , h ) in the middle of the poly(A) tail. Red asterisks indicate the point of inhibition. Both Pan2 and Caf1 were strongly inhibited by guanosines and dihydrouracils interrupting a poly(A) tail. These gels are representative of identical experiments performed 2 times. Uncropped gel images are shown in Supplementary Data Set 1.

    Article Snippet: 20mer-A30 (20mer: CAGCUCCGCAUCCCUUUCCC) with varied 3′ ends and intervening nucleotides were synthesized with a 5′ 6-FAM fluorophore label (Integrated DNA Technologies or, for 20mer-A14 DDA14 , Dharmacon).

    Techniques: Activity Assay, Labeling, Sequencing, Inhibition

    3′ guanosines inhibit the Pan2 exonuclease. a, Denaturing RNA gels showing deadenylation by recombinant S. cerevisiae Pan2–Pan3 on 5′ 6-FAM-labeled (green star) RNA substrates consisting of a 20mer non-poly(A) sequence (shown above) followed by a poly(A) tail of 30 adenosines. Where indicated, the substrate contains three additional non-A nucleotides at the 3′ end. These gels are representative of identical experiments performed 3 times. Uncropped gel images are shown in Supplementary Data Set 1. b-e, Analysis of deadenylation on poly(A) substrates with different 3′ nucleotides. Disappearance of the intact substrate was quantified by densitometry of the fluorescently labeled, full-length RNA. Data points were normalized to time = 0, and are connected by straight lines for clarity. Assays were carried out in triplicate (n = 3 independent experiments), the data points shown represent the mean, and error bars represent standard deviation. Assays are shown for full-length S. cerevisiae Pan2–Pan3 ( b, e ); H. sapiens PAN2–PAN3∆N278 ( c ); and S. cerevisiae Pan2 UCH-Exo (residues 461-1115) ( d ).

    Journal: Nature structural & molecular biology

    Article Title: The intrinsic structure of poly(A) RNA determines the specificity of Pan2 and Caf1 deadenylases

    doi: 10.1038/s41594-019-0227-9

    Figure Lengend Snippet: 3′ guanosines inhibit the Pan2 exonuclease. a, Denaturing RNA gels showing deadenylation by recombinant S. cerevisiae Pan2–Pan3 on 5′ 6-FAM-labeled (green star) RNA substrates consisting of a 20mer non-poly(A) sequence (shown above) followed by a poly(A) tail of 30 adenosines. Where indicated, the substrate contains three additional non-A nucleotides at the 3′ end. These gels are representative of identical experiments performed 3 times. Uncropped gel images are shown in Supplementary Data Set 1. b-e, Analysis of deadenylation on poly(A) substrates with different 3′ nucleotides. Disappearance of the intact substrate was quantified by densitometry of the fluorescently labeled, full-length RNA. Data points were normalized to time = 0, and are connected by straight lines for clarity. Assays were carried out in triplicate (n = 3 independent experiments), the data points shown represent the mean, and error bars represent standard deviation. Assays are shown for full-length S. cerevisiae Pan2–Pan3 ( b, e ); H. sapiens PAN2–PAN3∆N278 ( c ); and S. cerevisiae Pan2 UCH-Exo (residues 461-1115) ( d ).

    Article Snippet: 20mer-A30 (20mer: CAGCUCCGCAUCCCUUUCCC) with varied 3′ ends and intervening nucleotides were synthesized with a 5′ 6-FAM fluorophore label (Integrated DNA Technologies or, for 20mer-A14 DDA14 , Dharmacon).

    Techniques: Recombinant, Labeling, Sequencing, Standard Deviation

    Oligomerization and substrate binding assays of hCtc1. ( A ) The oligomeric state of hCtc1(OB) was analyzed by SEC-MALS. The blue line corresponds to the Refractive Index (RI) of the hCtc1(OB) eluting from the SEC column. The red circles correspond to the molecular mass of hCtc1(OB) measured by multi-angle, light scattering (MALS: red). The data suggest that hCtc1(OB) is monomeric in solution. ( B ) Cross linking experiments of WT hCtc1(OB) using formaldehyde or glutaraldehyde also shows that this domain hCtc1 is monomeric in solution. ( C ) FP assays of hCtc1(OB) with 5′ 6-FAM (Fluorescein) labeled, single-stranded telomeric DNA (two or three repeats) shows that this domain of hCtc1 is not involved in DNA binding. ( D ) ITC assay of hCtc1(OB) with the full length Stn1–Ten1 complex show no measurable interaction.

    Journal: Nucleic Acids Research

    Article Title: Structural and functional analysis of an OB-fold in human Ctc1 implicated in telomere maintenance and bone marrow syndromes

    doi: 10.1093/nar/gkx1213

    Figure Lengend Snippet: Oligomerization and substrate binding assays of hCtc1. ( A ) The oligomeric state of hCtc1(OB) was analyzed by SEC-MALS. The blue line corresponds to the Refractive Index (RI) of the hCtc1(OB) eluting from the SEC column. The red circles correspond to the molecular mass of hCtc1(OB) measured by multi-angle, light scattering (MALS: red). The data suggest that hCtc1(OB) is monomeric in solution. ( B ) Cross linking experiments of WT hCtc1(OB) using formaldehyde or glutaraldehyde also shows that this domain hCtc1 is monomeric in solution. ( C ) FP assays of hCtc1(OB) with 5′ 6-FAM (Fluorescein) labeled, single-stranded telomeric DNA (two or three repeats) shows that this domain of hCtc1 is not involved in DNA binding. ( D ) ITC assay of hCtc1(OB) with the full length Stn1–Ten1 complex show no measurable interaction.

    Article Snippet: The 12mer DNA probe (TTAGGGTTAGGG) and 18mer DNA probe (TTAGGGTTAGGGTTAGGG) was purchased with a 5′ 6-FAM label from Integrated DNA Technologies.

    Techniques: Binding Assay, Size-exclusion Chromatography, Labeling, Isothermal Titration Calorimetry

    Stalling the translocation of helicase motor stimulates cleavage (A) Schematic representation of target DNA (100 bp) with PAM (TTC in red) end-labelled with 6-FAM at 5’ end of the non-target strand and biotinylated at 12 th nucleotide (Target I). A similar target DNA without biotin (Target II) is also represented. Indicated in red arrow are the prominent cleavage sites. (B) Target (I) (II) were incubated with streptavidin and Cascade/I-C to form interference complex. Cleavage was initiated by addition of Cas3 (0.2 and 0.5 μM) and 1 mM ATP/ADP/AMP-PNP. Prominent cleavages of the target (I) and (II) are indicated by a red arrow (approx. 60 nt and 40 nt). A 20% denaturing PAGE was used to assess the cleavage.

    Journal: bioRxiv

    Article Title: Cas3 Mediated Target DNA Recognition and Cleavage is Independent of the Composition and Architecture of Cascade Surveillance Complex

    doi: 10.1101/666776

    Figure Lengend Snippet: Stalling the translocation of helicase motor stimulates cleavage (A) Schematic representation of target DNA (100 bp) with PAM (TTC in red) end-labelled with 6-FAM at 5’ end of the non-target strand and biotinylated at 12 th nucleotide (Target I). A similar target DNA without biotin (Target II) is also represented. Indicated in red arrow are the prominent cleavage sites. (B) Target (I) (II) were incubated with streptavidin and Cascade/I-C to form interference complex. Cleavage was initiated by addition of Cas3 (0.2 and 0.5 μM) and 1 mM ATP/ADP/AMP-PNP. Prominent cleavages of the target (I) and (II) are indicated by a red arrow (approx. 60 nt and 40 nt). A 20% denaturing PAGE was used to assess the cleavage.

    Article Snippet: Electrophoretic mobility shift assaySingle-stranded DNA constructs (Supplementary Table S1) with or without 6-FAM labels were purchased from Integrated DNA Technologies, Inc (IDT) and gel purified to remove truncated DNA fragments.

    Techniques: Translocation Assay, Incubation, Polyacrylamide Gel Electrophoresis

    Cascade and Cas3 form a stable complex during interference. (A) Schematic representation of 100 bp DNA substrates with biotin (black dot) at 5’ end of the nontarget strand (NTS), 6-FAM (fluorophore, green star) at 5 th nucleotide, Iowa Black ® FQ (quencher, brown dot) at 28 th nucleotide on target strand (TS) and PAM sequence TTC (depicted in red colour). (B) Substrate mentioned above was incubated with or without Cascade/I-C (1 μM) and increasing concentration of Cas3/I-C (0-5 μM). A significant decline in fluorescence intensity is evident when both Cascade/I-C and Cas3/I-C were present. There was no apparent quenching when dsDNA and ssDNA were used in the absence of Cascade/I-C (C) Fluorescence quenching was observed in the presence of ATP but not when ADP and AMP-PNP were used.

    Journal: bioRxiv

    Article Title: Cas3 Mediated Target DNA Recognition and Cleavage is Independent of the Composition and Architecture of Cascade Surveillance Complex

    doi: 10.1101/666776

    Figure Lengend Snippet: Cascade and Cas3 form a stable complex during interference. (A) Schematic representation of 100 bp DNA substrates with biotin (black dot) at 5’ end of the nontarget strand (NTS), 6-FAM (fluorophore, green star) at 5 th nucleotide, Iowa Black ® FQ (quencher, brown dot) at 28 th nucleotide on target strand (TS) and PAM sequence TTC (depicted in red colour). (B) Substrate mentioned above was incubated with or without Cascade/I-C (1 μM) and increasing concentration of Cas3/I-C (0-5 μM). A significant decline in fluorescence intensity is evident when both Cascade/I-C and Cas3/I-C were present. There was no apparent quenching when dsDNA and ssDNA were used in the absence of Cascade/I-C (C) Fluorescence quenching was observed in the presence of ATP but not when ADP and AMP-PNP were used.

    Article Snippet: Electrophoretic mobility shift assaySingle-stranded DNA constructs (Supplementary Table S1) with or without 6-FAM labels were purchased from Integrated DNA Technologies, Inc (IDT) and gel purified to remove truncated DNA fragments.

    Techniques: Sequencing, Incubation, Concentration Assay, Fluorescence

    Roadblock in the translocation of Cas3/I-C stimulates cleavage (A) (D) A schematic representation of 60 nt 5’ 6-FAM labelled ssDNA with biotin at 12 th (Target A) and 20th nucleotide (Target B), respectively. (B) (E) ssDNA mentioned above was incubated with 200 nM of Cas3/I-C for several time points and anisotropy measurements were recorded. With time, the decrease in anisotropy values was observed for ssDNA with a biotin roadblock. (C) (F) ssDNA was pre-incubated with streptavidin before the addition of Cas3/I-C. Prominent DNA cleavage products were observed in the presence of ATP at ~40 nt in target A and ~50 nt in target B, indicated with a red arrow. In the presence of AMP-PNP higher Cas3 concentration was required for the cleavage. A 20% denaturing PAGE was used to study the cleavage pattern.

    Journal: bioRxiv

    Article Title: Cas3 Mediated Target DNA Recognition and Cleavage is Independent of the Composition and Architecture of Cascade Surveillance Complex

    doi: 10.1101/666776

    Figure Lengend Snippet: Roadblock in the translocation of Cas3/I-C stimulates cleavage (A) (D) A schematic representation of 60 nt 5’ 6-FAM labelled ssDNA with biotin at 12 th (Target A) and 20th nucleotide (Target B), respectively. (B) (E) ssDNA mentioned above was incubated with 200 nM of Cas3/I-C for several time points and anisotropy measurements were recorded. With time, the decrease in anisotropy values was observed for ssDNA with a biotin roadblock. (C) (F) ssDNA was pre-incubated with streptavidin before the addition of Cas3/I-C. Prominent DNA cleavage products were observed in the presence of ATP at ~40 nt in target A and ~50 nt in target B, indicated with a red arrow. In the presence of AMP-PNP higher Cas3 concentration was required for the cleavage. A 20% denaturing PAGE was used to study the cleavage pattern.

    Article Snippet: Electrophoretic mobility shift assaySingle-stranded DNA constructs (Supplementary Table S1) with or without 6-FAM labels were purchased from Integrated DNA Technologies, Inc (IDT) and gel purified to remove truncated DNA fragments.

    Techniques: Translocation Assay, Incubation, Concentration Assay, Polyacrylamide Gel Electrophoresis

    Stalling the translocation of helicase motor stimulates cleavage (A) Schematic representation of target DNA (100 bp) with PAM (TTC in red) end-labelled with 6-FAM at 5’ end of the non-target strand and biotinylated at 12 th nucleotide (Target I). A similar target DNA without biotin (Target II) is also represented. Indicated in red arrow are the prominent cleavage sites. (B) Target (I) (II) were incubated with streptavidin and Cascade/I-C to form interference complex. Cleavage was initiated by addition of Cas3 (0.2 and 0.5 μM) and 1 mM ATP/ADP/AMP-PNP. Prominent cleavages of the target (I) and (II) are indicated by a red arrow (approx. 60 nt and 40 nt). A 20% denaturing PAGE was used to assess the cleavage.

    Journal: bioRxiv

    Article Title: Cas3 Mediated Target DNA Recognition and Cleavage is Independent of the Composition and Architecture of Cascade Surveillance Complex

    doi: 10.1101/666776

    Figure Lengend Snippet: Stalling the translocation of helicase motor stimulates cleavage (A) Schematic representation of target DNA (100 bp) with PAM (TTC in red) end-labelled with 6-FAM at 5’ end of the non-target strand and biotinylated at 12 th nucleotide (Target I). A similar target DNA without biotin (Target II) is also represented. Indicated in red arrow are the prominent cleavage sites. (B) Target (I) (II) were incubated with streptavidin and Cascade/I-C to form interference complex. Cleavage was initiated by addition of Cas3 (0.2 and 0.5 μM) and 1 mM ATP/ADP/AMP-PNP. Prominent cleavages of the target (I) and (II) are indicated by a red arrow (approx. 60 nt and 40 nt). A 20% denaturing PAGE was used to assess the cleavage.

    Article Snippet: 6-FAM labelled oligonucleotides were obtained from IDT.

    Techniques: Translocation Assay, Incubation, Polyacrylamide Gel Electrophoresis

    Cascade and Cas3 form a stable complex during interference. (A) Schematic representation of 100 bp DNA substrates with biotin (black dot) at 5’ end of the nontarget strand (NTS), 6-FAM (fluorophore, green star) at 5 th nucleotide, Iowa Black ® FQ (quencher, brown dot) at 28 th nucleotide on target strand (TS) and PAM sequence TTC (depicted in red colour). (B) Substrate mentioned above was incubated with or without Cascade/I-C (1 μM) and increasing concentration of Cas3/I-C (0-5 μM). A significant decline in fluorescence intensity is evident when both Cascade/I-C and Cas3/I-C were present. There was no apparent quenching when dsDNA and ssDNA were used in the absence of Cascade/I-C (C) Fluorescence quenching was observed in the presence of ATP but not when ADP and AMP-PNP were used.

    Journal: bioRxiv

    Article Title: Cas3 Mediated Target DNA Recognition and Cleavage is Independent of the Composition and Architecture of Cascade Surveillance Complex

    doi: 10.1101/666776

    Figure Lengend Snippet: Cascade and Cas3 form a stable complex during interference. (A) Schematic representation of 100 bp DNA substrates with biotin (black dot) at 5’ end of the nontarget strand (NTS), 6-FAM (fluorophore, green star) at 5 th nucleotide, Iowa Black ® FQ (quencher, brown dot) at 28 th nucleotide on target strand (TS) and PAM sequence TTC (depicted in red colour). (B) Substrate mentioned above was incubated with or without Cascade/I-C (1 μM) and increasing concentration of Cas3/I-C (0-5 μM). A significant decline in fluorescence intensity is evident when both Cascade/I-C and Cas3/I-C were present. There was no apparent quenching when dsDNA and ssDNA were used in the absence of Cascade/I-C (C) Fluorescence quenching was observed in the presence of ATP but not when ADP and AMP-PNP were used.

    Article Snippet: 6-FAM labelled oligonucleotides were obtained from IDT.

    Techniques: Sequencing, Incubation, Concentration Assay, Fluorescence

    Roadblock in the translocation of Cas3/I-C stimulates cleavage (A) (D) A schematic representation of 60 nt 5’ 6-FAM labelled ssDNA with biotin at 12 th (Target A) and 20th nucleotide (Target B), respectively. (B) (E) ssDNA mentioned above was incubated with 200 nM of Cas3/I-C for several time points and anisotropy measurements were recorded. With time, the decrease in anisotropy values was observed for ssDNA with a biotin roadblock. (C) (F) ssDNA was pre-incubated with streptavidin before the addition of Cas3/I-C. Prominent DNA cleavage products were observed in the presence of ATP at ~40 nt in target A and ~50 nt in target B, indicated with a red arrow. In the presence of AMP-PNP higher Cas3 concentration was required for the cleavage. A 20% denaturing PAGE was used to study the cleavage pattern.

    Journal: bioRxiv

    Article Title: Cas3 Mediated Target DNA Recognition and Cleavage is Independent of the Composition and Architecture of Cascade Surveillance Complex

    doi: 10.1101/666776

    Figure Lengend Snippet: Roadblock in the translocation of Cas3/I-C stimulates cleavage (A) (D) A schematic representation of 60 nt 5’ 6-FAM labelled ssDNA with biotin at 12 th (Target A) and 20th nucleotide (Target B), respectively. (B) (E) ssDNA mentioned above was incubated with 200 nM of Cas3/I-C for several time points and anisotropy measurements were recorded. With time, the decrease in anisotropy values was observed for ssDNA with a biotin roadblock. (C) (F) ssDNA was pre-incubated with streptavidin before the addition of Cas3/I-C. Prominent DNA cleavage products were observed in the presence of ATP at ~40 nt in target A and ~50 nt in target B, indicated with a red arrow. In the presence of AMP-PNP higher Cas3 concentration was required for the cleavage. A 20% denaturing PAGE was used to study the cleavage pattern.

    Article Snippet: 6-FAM labelled oligonucleotides were obtained from IDT.

    Techniques: Translocation Assay, Incubation, Concentration Assay, Polyacrylamide Gel Electrophoresis