mmp 3  (Integrated DNA Technologies)


Bioz Verified Symbol Integrated DNA Technologies is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    Integrated DNA Technologies mmp 3
    Relative mRNA expression of (A) IL-1β, (B) IL-6, (C) <t>MMP-3,</t> (D) MMP-13, and (E) TNF-α in control, ACS-treated, or APS-treated chondrocytes with or without IL 1β/TNF-α stimulation after a 48-h culture period. Different letters denote significant differences between groups, p
    Mmp 3, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 92/100, based on 1202 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mmp 3/product/Integrated DNA Technologies
    Average 92 stars, based on 1202 article reviews
    Price from $9.99 to $1999.99
    mmp 3 - by Bioz Stars, 2020-09
    92/100 stars

    Images

    1) Product Images from "The Effect of Autologous Protein Solution on the Inflammatory Cascade in Stimulated Equine Chondrocytes"

    Article Title: The Effect of Autologous Protein Solution on the Inflammatory Cascade in Stimulated Equine Chondrocytes

    Journal: Frontiers in Veterinary Science

    doi: 10.3389/fvets.2019.00064

    Relative mRNA expression of (A) IL-1β, (B) IL-6, (C) MMP-3, (D) MMP-13, and (E) TNF-α in control, ACS-treated, or APS-treated chondrocytes with or without IL 1β/TNF-α stimulation after a 48-h culture period. Different letters denote significant differences between groups, p
    Figure Legend Snippet: Relative mRNA expression of (A) IL-1β, (B) IL-6, (C) MMP-3, (D) MMP-13, and (E) TNF-α in control, ACS-treated, or APS-treated chondrocytes with or without IL 1β/TNF-α stimulation after a 48-h culture period. Different letters denote significant differences between groups, p

    Techniques Used: Expressing

    Supernatant concentrations of quantified cytokines (A) IL-1β, (B) IL-6, (C) MMP-3, (D) MMP13, and (E) TNF-α in control, ACS-treated, or APS-treated chondrocytes either with or without IL-1β/TNF-α stimulation after a 48 h culture period. Lines and p -values denote differences between unstimulated and stimulated chondrocytes only. Mean (±SD) for n = 6 horses shown. Different letters denote significant differences between all groups, p
    Figure Legend Snippet: Supernatant concentrations of quantified cytokines (A) IL-1β, (B) IL-6, (C) MMP-3, (D) MMP13, and (E) TNF-α in control, ACS-treated, or APS-treated chondrocytes either with or without IL-1β/TNF-α stimulation after a 48 h culture period. Lines and p -values denote differences between unstimulated and stimulated chondrocytes only. Mean (±SD) for n = 6 horses shown. Different letters denote significant differences between all groups, p

    Techniques Used:

    2) Product Images from "The intrinsic structure of poly(A) RNA determines the specificity of Pan2 and Caf1 deadenylases"

    Article Title: The intrinsic structure of poly(A) RNA determines the specificity of Pan2 and Caf1 deadenylases

    Journal: Nature structural & molecular biology

    doi: 10.1038/s41594-019-0227-9

    Ccr4–Not is inhibited by 3′ guanosines. a , Denaturing RNA gels showing deadenylation by recombinant S. pombe Ccr4–Not on 5′ 6-FAM-labeled (green star) RNA substrates consisting of a 20mer non-poly(A) sequence (See Fig. 1a ) followed by 30 adenosines. Where indicated, the substrate contains three additional non-A nucleotides at the 3′ end. These gels are representative of identical experiments performed 3 times. Uncropped gel images are shown in Supplementary Data Set 1. b-d , Analysis of deadenylation on poly(A) substrates with different 3′ nucleotides. Disappearance of the intact substrate was quantified by densitometry of the fluorescently labeled, full-length RNA. Data points were normalized to time = 0, and are connected by straight lines for clarity. Assays were carried out in triplicate (n = 3 independent experiments), the data points shown represent the mean, and error bars represent standard deviation. Assays are shown for wild-type S. pombe Ccr4–Not ( b ), Ccr4-inactive Ccr4–Not ( c ) and Caf1-inactive Ccr4–Not ( d ).
    Figure Legend Snippet: Ccr4–Not is inhibited by 3′ guanosines. a , Denaturing RNA gels showing deadenylation by recombinant S. pombe Ccr4–Not on 5′ 6-FAM-labeled (green star) RNA substrates consisting of a 20mer non-poly(A) sequence (See Fig. 1a ) followed by 30 adenosines. Where indicated, the substrate contains three additional non-A nucleotides at the 3′ end. These gels are representative of identical experiments performed 3 times. Uncropped gel images are shown in Supplementary Data Set 1. b-d , Analysis of deadenylation on poly(A) substrates with different 3′ nucleotides. Disappearance of the intact substrate was quantified by densitometry of the fluorescently labeled, full-length RNA. Data points were normalized to time = 0, and are connected by straight lines for clarity. Assays were carried out in triplicate (n = 3 independent experiments), the data points shown represent the mean, and error bars represent standard deviation. Assays are shown for wild-type S. pombe Ccr4–Not ( b ), Ccr4-inactive Ccr4–Not ( c ) and Caf1-inactive Ccr4–Not ( d ).

    Techniques Used: Recombinant, Labeling, Sequencing, Standard Deviation

    Nucleotide base stacking is required for Pan2 and Caf1 deadenylase activity. Denaturing RNA gels showing deadenylation by ( a-d ) S. cerevisiae Pan2 UCH-Exo or ( e-h ) S. pombe Ccr4-inactive Ccr4–Not on 5′ 6-FAM-labeled (green star) RNAs consisting of a 20mer non-poly(A) sequence (see Fig. 1a ) followed by the indicated tail sequence. RNAs either had no additional nucleotides ( a , e ), two guanosines ( b , f ), two uracils ( c, g ), or two dihydrouracils (abbreviated D, panels d , h ) in the middle of the poly(A) tail. Red asterisks indicate the point of inhibition. Both Pan2 and Caf1 were strongly inhibited by guanosines and dihydrouracils interrupting a poly(A) tail. These gels are representative of identical experiments performed 2 times. Uncropped gel images are shown in Supplementary Data Set 1.
    Figure Legend Snippet: Nucleotide base stacking is required for Pan2 and Caf1 deadenylase activity. Denaturing RNA gels showing deadenylation by ( a-d ) S. cerevisiae Pan2 UCH-Exo or ( e-h ) S. pombe Ccr4-inactive Ccr4–Not on 5′ 6-FAM-labeled (green star) RNAs consisting of a 20mer non-poly(A) sequence (see Fig. 1a ) followed by the indicated tail sequence. RNAs either had no additional nucleotides ( a , e ), two guanosines ( b , f ), two uracils ( c, g ), or two dihydrouracils (abbreviated D, panels d , h ) in the middle of the poly(A) tail. Red asterisks indicate the point of inhibition. Both Pan2 and Caf1 were strongly inhibited by guanosines and dihydrouracils interrupting a poly(A) tail. These gels are representative of identical experiments performed 2 times. Uncropped gel images are shown in Supplementary Data Set 1.

    Techniques Used: Activity Assay, Labeling, Sequencing, Inhibition

    3′ guanosines inhibit the Pan2 exonuclease. a, Denaturing RNA gels showing deadenylation by recombinant S. cerevisiae Pan2–Pan3 on 5′ 6-FAM-labeled (green star) RNA substrates consisting of a 20mer non-poly(A) sequence (shown above) followed by a poly(A) tail of 30 adenosines. Where indicated, the substrate contains three additional non-A nucleotides at the 3′ end. These gels are representative of identical experiments performed 3 times. Uncropped gel images are shown in Supplementary Data Set 1. b-e, Analysis of deadenylation on poly(A) substrates with different 3′ nucleotides. Disappearance of the intact substrate was quantified by densitometry of the fluorescently labeled, full-length RNA. Data points were normalized to time = 0, and are connected by straight lines for clarity. Assays were carried out in triplicate (n = 3 independent experiments), the data points shown represent the mean, and error bars represent standard deviation. Assays are shown for full-length S. cerevisiae Pan2–Pan3 ( b, e ); H. sapiens PAN2–PAN3∆N278 ( c ); and S. cerevisiae Pan2 UCH-Exo (residues 461-1115) ( d ).
    Figure Legend Snippet: 3′ guanosines inhibit the Pan2 exonuclease. a, Denaturing RNA gels showing deadenylation by recombinant S. cerevisiae Pan2–Pan3 on 5′ 6-FAM-labeled (green star) RNA substrates consisting of a 20mer non-poly(A) sequence (shown above) followed by a poly(A) tail of 30 adenosines. Where indicated, the substrate contains three additional non-A nucleotides at the 3′ end. These gels are representative of identical experiments performed 3 times. Uncropped gel images are shown in Supplementary Data Set 1. b-e, Analysis of deadenylation on poly(A) substrates with different 3′ nucleotides. Disappearance of the intact substrate was quantified by densitometry of the fluorescently labeled, full-length RNA. Data points were normalized to time = 0, and are connected by straight lines for clarity. Assays were carried out in triplicate (n = 3 independent experiments), the data points shown represent the mean, and error bars represent standard deviation. Assays are shown for full-length S. cerevisiae Pan2–Pan3 ( b, e ); H. sapiens PAN2–PAN3∆N278 ( c ); and S. cerevisiae Pan2 UCH-Exo (residues 461-1115) ( d ).

    Techniques Used: Recombinant, Labeling, Sequencing, Standard Deviation

    3) Product Images from "Homogeneous Polymerase Chain Reaction Nucleobase Quenching Assay to Detect the 1-kbp Deletion in CLN3 That Causes Batten Disease"

    Article Title: Homogeneous Polymerase Chain Reaction Nucleobase Quenching Assay to Detect the 1-kbp Deletion in CLN3 That Causes Batten Disease

    Journal: The Journal of molecular diagnostics : JMD

    doi:

    Strategy. A: The positions of the primers ( arrows ) and probe on the wild-type and mutant CLN3 gene are shown. The fluorophore on the probe is indicated with an asterisk ; not drawn to scale. B: The sequence of the probe is shown in between the complementary sequences of the wild-type and deletion alleles, with vertical lines connecting the base-paired residues. The –F on the 3′ end of the probe indicates the 6-FAM fluorophore and shows its position with respect to the G residues on the opposite strand. The probe is fully base-paired with the mutant sequence, but has three unmatched nucleotides at the 5′ end when annealed to a wild-type amplicon. The G residues that contribute to the quenching of the fluorescent signal are underlined in the normal and mutant sequences.
    Figure Legend Snippet: Strategy. A: The positions of the primers ( arrows ) and probe on the wild-type and mutant CLN3 gene are shown. The fluorophore on the probe is indicated with an asterisk ; not drawn to scale. B: The sequence of the probe is shown in between the complementary sequences of the wild-type and deletion alleles, with vertical lines connecting the base-paired residues. The –F on the 3′ end of the probe indicates the 6-FAM fluorophore and shows its position with respect to the G residues on the opposite strand. The probe is fully base-paired with the mutant sequence, but has three unmatched nucleotides at the 5′ end when annealed to a wild-type amplicon. The G residues that contribute to the quenching of the fluorescent signal are underlined in the normal and mutant sequences.

    Techniques Used: Mutagenesis, Sequencing, Amplification

    4) Product Images from "Chronic oral application of a periodontal pathogen results in brain inflammation, neurodegeneration and amyloid beta production in wild type mice"

    Article Title: Chronic oral application of a periodontal pathogen results in brain inflammation, neurodegeneration and amyloid beta production in wild type mice

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0204941

    Pg/gingipain is detected in the hippocampus of mice following oral application of Pg. (A) Immunofluorescence microscopy. Red: Pg, Blue: DAPI. (B) Images showing intra-, peri- and extra-cellularly localized Pg. (C) Number of Pg/gingipain detected per field (220μm X 160μm). N = 9 mice for experimental and N = 10 mice for control group. (D) Copy number of Pg 16S RNA genes detected in genomic DNA isolated from 5FFPE samples/mouse, N = 5 mice/group. Y- axis: number of Pg/gingipain per field for (C) and copy number of 16S rRNA genes from genomic DNA for (D). X-axis: C (control), E (experimental) group.
    Figure Legend Snippet: Pg/gingipain is detected in the hippocampus of mice following oral application of Pg. (A) Immunofluorescence microscopy. Red: Pg, Blue: DAPI. (B) Images showing intra-, peri- and extra-cellularly localized Pg. (C) Number of Pg/gingipain detected per field (220μm X 160μm). N = 9 mice for experimental and N = 10 mice for control group. (D) Copy number of Pg 16S RNA genes detected in genomic DNA isolated from 5FFPE samples/mouse, N = 5 mice/group. Y- axis: number of Pg/gingipain per field for (C) and copy number of 16S rRNA genes from genomic DNA for (D). X-axis: C (control), E (experimental) group.

    Techniques Used: Mouse Assay, Immunofluorescence, Microscopy, Isolation

    5) Product Images from "Identification of a periodontal pathogen and bihormonal cells in pancreatic islets of humans and a mouse model of periodontitis"

    Article Title: Identification of a periodontal pathogen and bihormonal cells in pancreatic islets of humans and a mouse model of periodontitis

    Journal: Scientific Reports

    doi: 10.1038/s41598-020-65828-x

    Human pancreatic islets are positive for Pg/gingipain. ( A ) 9 out of 32 FFPE samples from human subjects (age > 50 y) show the presence of Pg/gingipain in islets. Representative IF images. Scale bar represents 60μm. ( B ) 4 out of 13 frozen samples were positive for Pg 16S rRNA genes detected by qPCR. Y-axis: copies/5 FFPE slides. ***p
    Figure Legend Snippet: Human pancreatic islets are positive for Pg/gingipain. ( A ) 9 out of 32 FFPE samples from human subjects (age > 50 y) show the presence of Pg/gingipain in islets. Representative IF images. Scale bar represents 60μm. ( B ) 4 out of 13 frozen samples were positive for Pg 16S rRNA genes detected by qPCR. Y-axis: copies/5 FFPE slides. ***p

    Techniques Used: Formalin-fixed Paraffin-Embedded, Real-time Polymerase Chain Reaction

    6) Product Images from "Homogeneous Polymerase Chain Reaction Nucleobase Quenching Assay to Detect the 1-kbp Deletion in CLN3 That Causes Batten Disease"

    Article Title: Homogeneous Polymerase Chain Reaction Nucleobase Quenching Assay to Detect the 1-kbp Deletion in CLN3 That Causes Batten Disease

    Journal: The Journal of molecular diagnostics : JMD

    doi:

    Strategy. A: The positions of the primers ( arrows ) and probe on the wild-type and mutant CLN3 gene are shown. The fluorophore on the probe is indicated with an asterisk ; not drawn to scale. B: The sequence of the probe is shown in between the complementary sequences of the wild-type and deletion alleles, with vertical lines connecting the base-paired residues. The –F on the 3′ end of the probe indicates the 6-FAM fluorophore and shows its position with respect to the G residues on the opposite strand. The probe is fully base-paired with the mutant sequence, but has three unmatched nucleotides at the 5′ end when annealed to a wild-type amplicon. The G residues that contribute to the quenching of the fluorescent signal are underlined in the normal and mutant sequences.
    Figure Legend Snippet: Strategy. A: The positions of the primers ( arrows ) and probe on the wild-type and mutant CLN3 gene are shown. The fluorophore on the probe is indicated with an asterisk ; not drawn to scale. B: The sequence of the probe is shown in between the complementary sequences of the wild-type and deletion alleles, with vertical lines connecting the base-paired residues. The –F on the 3′ end of the probe indicates the 6-FAM fluorophore and shows its position with respect to the G residues on the opposite strand. The probe is fully base-paired with the mutant sequence, but has three unmatched nucleotides at the 5′ end when annealed to a wild-type amplicon. The G residues that contribute to the quenching of the fluorescent signal are underlined in the normal and mutant sequences.

    Techniques Used: Mutagenesis, Sequencing, Amplification

    7) Product Images from "Chronic oral application of a periodontal pathogen results in brain inflammation, neurodegeneration and amyloid beta production in wild type mice"

    Article Title: Chronic oral application of a periodontal pathogen results in brain inflammation, neurodegeneration and amyloid beta production in wild type mice

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0204941

    Pg/gingipain is detected in the hippocampus of mice following oral application of Pg. (A) Immunofluorescence microscopy. Red: Pg, Blue: DAPI. (B) Images showing intra-, peri- and extra-cellularly localized Pg. (C) Number of Pg/gingipain detected per field (220μm X 160μm). N = 9 mice for experimental and N = 10 mice for control group. (D) Copy number of Pg 16S RNA genes detected in genomic DNA isolated from 5FFPE samples/mouse, N = 5 mice/group. Y- axis: number of Pg/gingipain per field for (C) and copy number of 16S rRNA genes from genomic DNA for (D). X-axis: C (control), E (experimental) group.
    Figure Legend Snippet: Pg/gingipain is detected in the hippocampus of mice following oral application of Pg. (A) Immunofluorescence microscopy. Red: Pg, Blue: DAPI. (B) Images showing intra-, peri- and extra-cellularly localized Pg. (C) Number of Pg/gingipain detected per field (220μm X 160μm). N = 9 mice for experimental and N = 10 mice for control group. (D) Copy number of Pg 16S RNA genes detected in genomic DNA isolated from 5FFPE samples/mouse, N = 5 mice/group. Y- axis: number of Pg/gingipain per field for (C) and copy number of 16S rRNA genes from genomic DNA for (D). X-axis: C (control), E (experimental) group.

    Techniques Used: Mouse Assay, Immunofluorescence, Microscopy, Isolation

    8) Product Images from "The Effect of Autologous Protein Solution on the Inflammatory Cascade in Stimulated Equine Chondrocytes"

    Article Title: The Effect of Autologous Protein Solution on the Inflammatory Cascade in Stimulated Equine Chondrocytes

    Journal: Frontiers in Veterinary Science

    doi: 10.3389/fvets.2019.00064

    Relative mRNA expression of (A) IL-1β, (B) IL-6, (C) MMP-3, (D) MMP-13, and (E) TNF-α in control, ACS-treated, or APS-treated chondrocytes with or without IL 1β/TNF-α stimulation after a 48-h culture period. Different letters denote significant differences between groups, p
    Figure Legend Snippet: Relative mRNA expression of (A) IL-1β, (B) IL-6, (C) MMP-3, (D) MMP-13, and (E) TNF-α in control, ACS-treated, or APS-treated chondrocytes with or without IL 1β/TNF-α stimulation after a 48-h culture period. Different letters denote significant differences between groups, p

    Techniques Used: Expressing

    9) Product Images from "The intrinsic structure of poly(A) RNA determines the specificity of Pan2 and Caf1 deadenylases"

    Article Title: The intrinsic structure of poly(A) RNA determines the specificity of Pan2 and Caf1 deadenylases

    Journal: Nature structural & molecular biology

    doi: 10.1038/s41594-019-0227-9

    Ccr4–Not is inhibited by 3′ guanosines. a , Denaturing RNA gels showing deadenylation by recombinant S. pombe Ccr4–Not on 5′ 6-FAM-labeled (green star) RNA substrates consisting of a 20mer non-poly(A) sequence (See Fig. 1a ) followed by 30 adenosines. Where indicated, the substrate contains three additional non-A nucleotides at the 3′ end. These gels are representative of identical experiments performed 3 times. Uncropped gel images are shown in Supplementary Data Set 1. b-d , Analysis of deadenylation on poly(A) substrates with different 3′ nucleotides. Disappearance of the intact substrate was quantified by densitometry of the fluorescently labeled, full-length RNA. Data points were normalized to time = 0, and are connected by straight lines for clarity. Assays were carried out in triplicate (n = 3 independent experiments), the data points shown represent the mean, and error bars represent standard deviation. Assays are shown for wild-type S. pombe Ccr4–Not ( b ), Ccr4-inactive Ccr4–Not ( c ) and Caf1-inactive Ccr4–Not ( d ).
    Figure Legend Snippet: Ccr4–Not is inhibited by 3′ guanosines. a , Denaturing RNA gels showing deadenylation by recombinant S. pombe Ccr4–Not on 5′ 6-FAM-labeled (green star) RNA substrates consisting of a 20mer non-poly(A) sequence (See Fig. 1a ) followed by 30 adenosines. Where indicated, the substrate contains three additional non-A nucleotides at the 3′ end. These gels are representative of identical experiments performed 3 times. Uncropped gel images are shown in Supplementary Data Set 1. b-d , Analysis of deadenylation on poly(A) substrates with different 3′ nucleotides. Disappearance of the intact substrate was quantified by densitometry of the fluorescently labeled, full-length RNA. Data points were normalized to time = 0, and are connected by straight lines for clarity. Assays were carried out in triplicate (n = 3 independent experiments), the data points shown represent the mean, and error bars represent standard deviation. Assays are shown for wild-type S. pombe Ccr4–Not ( b ), Ccr4-inactive Ccr4–Not ( c ) and Caf1-inactive Ccr4–Not ( d ).

    Techniques Used: Recombinant, Labeling, Sequencing, Standard Deviation

    Nucleotide base stacking is required for Pan2 and Caf1 deadenylase activity. Denaturing RNA gels showing deadenylation by ( a-d ) S. cerevisiae Pan2 UCH-Exo or ( e-h ) S. pombe Ccr4-inactive Ccr4–Not on 5′ 6-FAM-labeled (green star) RNAs consisting of a 20mer non-poly(A) sequence (see Fig. 1a ) followed by the indicated tail sequence. RNAs either had no additional nucleotides ( a , e ), two guanosines ( b , f ), two uracils ( c, g ), or two dihydrouracils (abbreviated D, panels d , h ) in the middle of the poly(A) tail. Red asterisks indicate the point of inhibition. Both Pan2 and Caf1 were strongly inhibited by guanosines and dihydrouracils interrupting a poly(A) tail. These gels are representative of identical experiments performed 2 times. Uncropped gel images are shown in Supplementary Data Set 1.
    Figure Legend Snippet: Nucleotide base stacking is required for Pan2 and Caf1 deadenylase activity. Denaturing RNA gels showing deadenylation by ( a-d ) S. cerevisiae Pan2 UCH-Exo or ( e-h ) S. pombe Ccr4-inactive Ccr4–Not on 5′ 6-FAM-labeled (green star) RNAs consisting of a 20mer non-poly(A) sequence (see Fig. 1a ) followed by the indicated tail sequence. RNAs either had no additional nucleotides ( a , e ), two guanosines ( b , f ), two uracils ( c, g ), or two dihydrouracils (abbreviated D, panels d , h ) in the middle of the poly(A) tail. Red asterisks indicate the point of inhibition. Both Pan2 and Caf1 were strongly inhibited by guanosines and dihydrouracils interrupting a poly(A) tail. These gels are representative of identical experiments performed 2 times. Uncropped gel images are shown in Supplementary Data Set 1.

    Techniques Used: Activity Assay, Labeling, Sequencing, Inhibition

    3′ guanosines inhibit the Pan2 exonuclease. a, Denaturing RNA gels showing deadenylation by recombinant S. cerevisiae Pan2–Pan3 on 5′ 6-FAM-labeled (green star) RNA substrates consisting of a 20mer non-poly(A) sequence (shown above) followed by a poly(A) tail of 30 adenosines. Where indicated, the substrate contains three additional non-A nucleotides at the 3′ end. These gels are representative of identical experiments performed 3 times. Uncropped gel images are shown in Supplementary Data Set 1. b-e, Analysis of deadenylation on poly(A) substrates with different 3′ nucleotides. Disappearance of the intact substrate was quantified by densitometry of the fluorescently labeled, full-length RNA. Data points were normalized to time = 0, and are connected by straight lines for clarity. Assays were carried out in triplicate (n = 3 independent experiments), the data points shown represent the mean, and error bars represent standard deviation. Assays are shown for full-length S. cerevisiae Pan2–Pan3 ( b, e ); H. sapiens PAN2–PAN3∆N278 ( c ); and S. cerevisiae Pan2 UCH-Exo (residues 461-1115) ( d ).
    Figure Legend Snippet: 3′ guanosines inhibit the Pan2 exonuclease. a, Denaturing RNA gels showing deadenylation by recombinant S. cerevisiae Pan2–Pan3 on 5′ 6-FAM-labeled (green star) RNA substrates consisting of a 20mer non-poly(A) sequence (shown above) followed by a poly(A) tail of 30 adenosines. Where indicated, the substrate contains three additional non-A nucleotides at the 3′ end. These gels are representative of identical experiments performed 3 times. Uncropped gel images are shown in Supplementary Data Set 1. b-e, Analysis of deadenylation on poly(A) substrates with different 3′ nucleotides. Disappearance of the intact substrate was quantified by densitometry of the fluorescently labeled, full-length RNA. Data points were normalized to time = 0, and are connected by straight lines for clarity. Assays were carried out in triplicate (n = 3 independent experiments), the data points shown represent the mean, and error bars represent standard deviation. Assays are shown for full-length S. cerevisiae Pan2–Pan3 ( b, e ); H. sapiens PAN2–PAN3∆N278 ( c ); and S. cerevisiae Pan2 UCH-Exo (residues 461-1115) ( d ).

    Techniques Used: Recombinant, Labeling, Sequencing, Standard Deviation

    Related Articles

    Functional Assay:

    Article Title: Rapid cloning, expression, and functional characterization of paired αβ and γδ T-cell receptor chains from single-cell analysis
    Article Snippet: .. Recently, multi-cistronic 2A-based retroviral vectors have been widely used for TCR:CD3 structural and functional studies., , The entire sequence of TCRγ-2A-TCRδ along with an 25 bp overhang complementary to the ends of the linearized pMICherry vector were synthesized in two fragments of approximately 1 kb each as gBlock DNA fragments (Integrated DNA Technologies) with an internal 25 bp overlap in the 2A segment. .. By using Gibson Assembly Master Mix, we ligated the two gBlocks spanning the TCRγ-2A-TCRδ with the linearized vector in a three-way ligation.

    Sequencing:

    Article Title: Rapid cloning, expression, and functional characterization of paired αβ and γδ T-cell receptor chains from single-cell analysis
    Article Snippet: .. Recently, multi-cistronic 2A-based retroviral vectors have been widely used for TCR:CD3 structural and functional studies., , The entire sequence of TCRγ-2A-TCRδ along with an 25 bp overhang complementary to the ends of the linearized pMICherry vector were synthesized in two fragments of approximately 1 kb each as gBlock DNA fragments (Integrated DNA Technologies) with an internal 25 bp overlap in the 2A segment. .. By using Gibson Assembly Master Mix, we ligated the two gBlocks spanning the TCRγ-2A-TCRδ with the linearized vector in a three-way ligation.

    Article Title: Thermodynamic framework to assess low abundance DNA mutation detection by hybridization
    Article Snippet: .. Sample preparation and microarray experiments To obtain synthetic ssDNA mixtures, a PCR reaction was performed on the double-stranded sequence-verified gBlocks Gene Fragments (IDT, Leuven, Belgium) which we will refer to as gBlocks. .. The PCR reaction comprised of 0.4 μ M forward (5’- GTCCTGCACCAGTAATATGC -3’), 0.4 μ M reverse (5’- CTGGCGTCATAGCTGTTTCCTGTGTGAGTATTAACCTTATG TGTGACA -3’) primers (Eurogentec, Seraing, Belgium), 2 mM MgSO4, 0.2 mM of each dNTP, 2 U Platinum Taq DNA High-Fidelity Polymerase (Life Technologies, Ghent, Belgium), and 0.5 ng gBlocks DNA in a final volume of 50 μ l. The reverse primer has a phosphate modification at the 5’ end.

    Article Title: SplintQuant: a method for accurately quantifying circular RNA transcript abundance without reverse transcription bias
    Article Snippet: .. In vitro synthetic circular RNA constructs For in vitro circularization experiments, we ordered synthetic DNA fragments (gBlocks gene fragments, Integrated DNA Technologies) tagged at the 5′ end with the T7 RNA polymerase promoter sequence. .. The in vitro transcription reaction was performed using HiScribe T7 RNA polymerase kit (New England Biolabs), following manufacturer's instructions depending on the size of RNA product: 10× Reaction Buffer (2.0 µL); 100 mM rATP (1.5 µL); 100 mM rCTP (1.5 µL); 100 mM rGTP (0.6 µL); 50 mM GMP (6 µL); 100 mM rUTP (1.5 µL); DNA template (100 ng); T7 RNA Polymerase Mix (2 µL); nuclease-free water to 20 µL.

    Sample Prep:

    Article Title: Thermodynamic framework to assess low abundance DNA mutation detection by hybridization
    Article Snippet: .. Sample preparation and microarray experiments To obtain synthetic ssDNA mixtures, a PCR reaction was performed on the double-stranded sequence-verified gBlocks Gene Fragments (IDT, Leuven, Belgium) which we will refer to as gBlocks. .. The PCR reaction comprised of 0.4 μ M forward (5’- GTCCTGCACCAGTAATATGC -3’), 0.4 μ M reverse (5’- CTGGCGTCATAGCTGTTTCCTGTGTGAGTATTAACCTTATG TGTGACA -3’) primers (Eurogentec, Seraing, Belgium), 2 mM MgSO4, 0.2 mM of each dNTP, 2 U Platinum Taq DNA High-Fidelity Polymerase (Life Technologies, Ghent, Belgium), and 0.5 ng gBlocks DNA in a final volume of 50 μ l. The reverse primer has a phosphate modification at the 5’ end.

    In Vitro:

    Article Title: Maximizing transcription of nucleic acids with efficient T7 promoters
    Article Snippet: .. IVT for validationsOne ng of dsDNA template (gBlocks Gene Fragments, Integrated DNA Technologies) was in vitro transcribed in a 20 µl reaction using 1.5 µl T7 or T6 RNA polymerase mix and 7.5 mM each of GTP, ATP, CTP, and UTP from the HiScribe T7/SP6 RNA Synthesis Kit (NEB E2040S, E2070S). .. RNA was purified with 1.6 volumes RNAClean XP beads, followed by elution in 20 µL water.

    Article Title: SplintQuant: a method for accurately quantifying circular RNA transcript abundance without reverse transcription bias
    Article Snippet: .. In vitro synthetic circular RNA constructs For in vitro circularization experiments, we ordered synthetic DNA fragments (gBlocks gene fragments, Integrated DNA Technologies) tagged at the 5′ end with the T7 RNA polymerase promoter sequence. .. The in vitro transcription reaction was performed using HiScribe T7 RNA polymerase kit (New England Biolabs), following manufacturer's instructions depending on the size of RNA product: 10× Reaction Buffer (2.0 µL); 100 mM rATP (1.5 µL); 100 mM rCTP (1.5 µL); 100 mM rGTP (0.6 µL); 50 mM GMP (6 µL); 100 mM rUTP (1.5 µL); DNA template (100 ng); T7 RNA Polymerase Mix (2 µL); nuclease-free water to 20 µL.

    Synthesized:

    Article Title: Rapid cloning, expression, and functional characterization of paired αβ and γδ T-cell receptor chains from single-cell analysis
    Article Snippet: .. Recently, multi-cistronic 2A-based retroviral vectors have been widely used for TCR:CD3 structural and functional studies., , The entire sequence of TCRγ-2A-TCRδ along with an 25 bp overhang complementary to the ends of the linearized pMICherry vector were synthesized in two fragments of approximately 1 kb each as gBlock DNA fragments (Integrated DNA Technologies) with an internal 25 bp overlap in the 2A segment. .. By using Gibson Assembly Master Mix, we ligated the two gBlocks spanning the TCRγ-2A-TCRδ with the linearized vector in a three-way ligation.

    Construct:

    Article Title: Structural basis of the molecular ruler mechanism of a bacterial glycosyltransferase
    Article Snippet: .. PglH mutants were generated by using gBlocks gene fragments (Integrated DNA Technologies) and the resulting plasmids of all constructs were sequenced (Microsynth). .. PglH wild type and mutants were overexpressed in E. coli BL21-Gold (DE3) (Stratagene).

    Article Title: SplintQuant: a method for accurately quantifying circular RNA transcript abundance without reverse transcription bias
    Article Snippet: .. In vitro synthetic circular RNA constructs For in vitro circularization experiments, we ordered synthetic DNA fragments (gBlocks gene fragments, Integrated DNA Technologies) tagged at the 5′ end with the T7 RNA polymerase promoter sequence. .. The in vitro transcription reaction was performed using HiScribe T7 RNA polymerase kit (New England Biolabs), following manufacturer's instructions depending on the size of RNA product: 10× Reaction Buffer (2.0 µL); 100 mM rATP (1.5 µL); 100 mM rCTP (1.5 µL); 100 mM rGTP (0.6 µL); 50 mM GMP (6 µL); 100 mM rUTP (1.5 µL); DNA template (100 ng); T7 RNA Polymerase Mix (2 µL); nuclease-free water to 20 µL.

    Polymerase Chain Reaction:

    Article Title: Thermodynamic framework to assess low abundance DNA mutation detection by hybridization
    Article Snippet: .. Sample preparation and microarray experiments To obtain synthetic ssDNA mixtures, a PCR reaction was performed on the double-stranded sequence-verified gBlocks Gene Fragments (IDT, Leuven, Belgium) which we will refer to as gBlocks. .. The PCR reaction comprised of 0.4 μ M forward (5’- GTCCTGCACCAGTAATATGC -3’), 0.4 μ M reverse (5’- CTGGCGTCATAGCTGTTTCCTGTGTGAGTATTAACCTTATG TGTGACA -3’) primers (Eurogentec, Seraing, Belgium), 2 mM MgSO4, 0.2 mM of each dNTP, 2 U Platinum Taq DNA High-Fidelity Polymerase (Life Technologies, Ghent, Belgium), and 0.5 ng gBlocks DNA in a final volume of 50 μ l. The reverse primer has a phosphate modification at the 5’ end.

    Generated:

    Article Title: Structural basis of the molecular ruler mechanism of a bacterial glycosyltransferase
    Article Snippet: .. PglH mutants were generated by using gBlocks gene fragments (Integrated DNA Technologies) and the resulting plasmids of all constructs were sequenced (Microsynth). .. PglH wild type and mutants were overexpressed in E. coli BL21-Gold (DE3) (Stratagene).

    IA:

    Article Title: Rab1a rescues the toxicity of PRAF3
    Article Snippet: .. The nucleotides coding hRab1a, hRab3a, hRab8a and hARL6 were manufactured by gBlocks® (Integrated DNA Technologies, Coralville, IA) and sub-cloned into pDONR221 (Thermo Fisher Scientific, MA). .. For the yeast growth test, an entry vector harbouring the hPRAF3 gene was subjected to LR recombination with the pYES-DEST52 vector (Thermo Fisher Scientific, MA), whereas entry vectors harbouring Rabs and ARL6 were also subjected to LR recombination with pAG424-ccdB (Addgene #14151) to produce yeast expression vectors.

    Article Title: Rapid, Simple and Cost-Effective Molecular Method to Differentiate the Temperature Sensitive (ts+) MS-H Vaccine Strain and Wild-Type Mycoplasma synoviae Isolates
    Article Snippet: .. In order to test the sensitivity of the assays, 10 fold dilutions of gBlocks (Integrated DNA Technologies Inc., Coralville, IA) containing 200 ng of a 330 bp long fragment of the obg gene (from nt342 to nt672) were used ( ). ..

    Microarray:

    Article Title: Thermodynamic framework to assess low abundance DNA mutation detection by hybridization
    Article Snippet: .. Sample preparation and microarray experiments To obtain synthetic ssDNA mixtures, a PCR reaction was performed on the double-stranded sequence-verified gBlocks Gene Fragments (IDT, Leuven, Belgium) which we will refer to as gBlocks. .. The PCR reaction comprised of 0.4 μ M forward (5’- GTCCTGCACCAGTAATATGC -3’), 0.4 μ M reverse (5’- CTGGCGTCATAGCTGTTTCCTGTGTGAGTATTAACCTTATG TGTGACA -3’) primers (Eurogentec, Seraing, Belgium), 2 mM MgSO4, 0.2 mM of each dNTP, 2 U Platinum Taq DNA High-Fidelity Polymerase (Life Technologies, Ghent, Belgium), and 0.5 ng gBlocks DNA in a final volume of 50 μ l. The reverse primer has a phosphate modification at the 5’ end.

    Plasmid Preparation:

    Article Title: Rapid cloning, expression, and functional characterization of paired αβ and γδ T-cell receptor chains from single-cell analysis
    Article Snippet: .. Recently, multi-cistronic 2A-based retroviral vectors have been widely used for TCR:CD3 structural and functional studies., , The entire sequence of TCRγ-2A-TCRδ along with an 25 bp overhang complementary to the ends of the linearized pMICherry vector were synthesized in two fragments of approximately 1 kb each as gBlock DNA fragments (Integrated DNA Technologies) with an internal 25 bp overlap in the 2A segment. .. By using Gibson Assembly Master Mix, we ligated the two gBlocks spanning the TCRγ-2A-TCRδ with the linearized vector in a three-way ligation.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85
    Integrated DNA Technologies fitc nf ãŽâºb decoy sense odn
    Time course of quenching by Iowa Black <t>FQ-ODN</t> in the presence of Triton X-100. The fluorescence of <t>FITC-ODN</t> and its quenching by Iowa Black FQ-ODN was determined in the presence of 5 % TritonX-100. The time necessary for the completely hybridize is approximately
    Fitc Nf ãŽâºb Decoy Sense Odn, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fitc nf ãŽâºb decoy sense odn/product/Integrated DNA Technologies
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    fitc nf ãŽâºb decoy sense odn - by Bioz Stars, 2020-09
    85/100 stars
      Buy from Supplier

    85
    Integrated DNA Technologies reporter dye 6 carboxy fluorescein fam
    Time course of quenching by Iowa Black <t>FQ-ODN</t> in the presence of Triton X-100. The fluorescence of <t>FITC-ODN</t> and its quenching by Iowa Black FQ-ODN was determined in the presence of 5 % TritonX-100. The time necessary for the completely hybridize is approximately
    Reporter Dye 6 Carboxy Fluorescein Fam, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/reporter dye 6 carboxy fluorescein fam/product/Integrated DNA Technologies
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    reporter dye 6 carboxy fluorescein fam - by Bioz Stars, 2020-09
    85/100 stars
      Buy from Supplier

    88
    Integrated DNA Technologies 6 carboxy fluorescein fam
    Time course of quenching by Iowa Black <t>FQ-ODN</t> in the presence of Triton X-100. The fluorescence of <t>FITC-ODN</t> and its quenching by Iowa Black FQ-ODN was determined in the presence of 5 % TritonX-100. The time necessary for the completely hybridize is approximately
    6 Carboxy Fluorescein Fam, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 88/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 carboxy fluorescein fam/product/Integrated DNA Technologies
    Average 88 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    6 carboxy fluorescein fam - by Bioz Stars, 2020-09
    88/100 stars
      Buy from Supplier

    92
    Integrated DNA Technologies 6 fam fluorescein labelled
    Time course of quenching by Iowa Black <t>FQ-ODN</t> in the presence of Triton X-100. The fluorescence of <t>FITC-ODN</t> and its quenching by Iowa Black FQ-ODN was determined in the presence of 5 % TritonX-100. The time necessary for the completely hybridize is approximately
    6 Fam Fluorescein Labelled, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 92/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam fluorescein labelled/product/Integrated DNA Technologies
    Average 92 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    6 fam fluorescein labelled - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    Image Search Results


    Time course of quenching by Iowa Black FQ-ODN in the presence of Triton X-100. The fluorescence of FITC-ODN and its quenching by Iowa Black FQ-ODN was determined in the presence of 5 % TritonX-100. The time necessary for the completely hybridize is approximately

    Journal: Journal of controlled release : official journal of the Controlled Release Society

    Article Title: Encapsulation of NF-? B Decoy Oligonucleotides within Echogenic Liposomes and Ultrasound-Triggered Release

    doi: 10.1016/j.jconrel.2009.09.017

    Figure Lengend Snippet: Time course of quenching by Iowa Black FQ-ODN in the presence of Triton X-100. The fluorescence of FITC-ODN and its quenching by Iowa Black FQ-ODN was determined in the presence of 5 % TritonX-100. The time necessary for the completely hybridize is approximately

    Article Snippet: FITC-NF-κB decoy sense ODN (5′-AGT TGA GGG GAC TTT CCC AGG C/36-FAM/ - 3′) and Iowa BlackTM FQ labeled NF-κB decoy antisense ODN (5′ - /5IAbFQ/GCC TGG GAA AGT CCC CTC AAC T – 3′) from Integrated DNA Technologies, Inc. (Coralville, IA) were utilized.

    Techniques: Fluorescence

    Quenching of FITC-ODN fluorescence upon hybridization with Iowa Black FQ-ODN. The fluorescence of FITC-ODN alone at 0.05 μM was taken as 100 %.

    Journal: Journal of controlled release : official journal of the Controlled Release Society

    Article Title: Encapsulation of NF-? B Decoy Oligonucleotides within Echogenic Liposomes and Ultrasound-Triggered Release

    doi: 10.1016/j.jconrel.2009.09.017

    Figure Lengend Snippet: Quenching of FITC-ODN fluorescence upon hybridization with Iowa Black FQ-ODN. The fluorescence of FITC-ODN alone at 0.05 μM was taken as 100 %.

    Article Snippet: FITC-NF-κB decoy sense ODN (5′-AGT TGA GGG GAC TTT CCC AGG C/36-FAM/ - 3′) and Iowa BlackTM FQ labeled NF-κB decoy antisense ODN (5′ - /5IAbFQ/GCC TGG GAA AGT CCC CTC AAC T – 3′) from Integrated DNA Technologies, Inc. (Coralville, IA) were utilized.

    Techniques: Fluorescence, Hybridization

    Encapsulation and ultrasound-triggered release of FITC-ODN with two types of liposomal compositions demonstrating enhanced release of ODN from ELIP. Although both compositions released similar percentages of ODN upon ultrasound application, DOPE liposomes

    Journal: Journal of controlled release : official journal of the Controlled Release Society

    Article Title: Encapsulation of NF-? B Decoy Oligonucleotides within Echogenic Liposomes and Ultrasound-Triggered Release

    doi: 10.1016/j.jconrel.2009.09.017

    Figure Lengend Snippet: Encapsulation and ultrasound-triggered release of FITC-ODN with two types of liposomal compositions demonstrating enhanced release of ODN from ELIP. Although both compositions released similar percentages of ODN upon ultrasound application, DOPE liposomes

    Article Snippet: FITC-NF-κB decoy sense ODN (5′-AGT TGA GGG GAC TTT CCC AGG C/36-FAM/ - 3′) and Iowa BlackTM FQ labeled NF-κB decoy antisense ODN (5′ - /5IAbFQ/GCC TGG GAA AGT CCC CTC AAC T – 3′) from Integrated DNA Technologies, Inc. (Coralville, IA) were utilized.

    Techniques:

    Encapsulation and release efficiencies of FITC-ODN using two types of liposomal formulation. There is no significant difference between data for preparations containing FITC-ODN only and those in which FITC-ODN was combined with untagged double-stranded

    Journal: Journal of controlled release : official journal of the Controlled Release Society

    Article Title: Encapsulation of NF-? B Decoy Oligonucleotides within Echogenic Liposomes and Ultrasound-Triggered Release

    doi: 10.1016/j.jconrel.2009.09.017

    Figure Lengend Snippet: Encapsulation and release efficiencies of FITC-ODN using two types of liposomal formulation. There is no significant difference between data for preparations containing FITC-ODN only and those in which FITC-ODN was combined with untagged double-stranded

    Article Snippet: FITC-NF-κB decoy sense ODN (5′-AGT TGA GGG GAC TTT CCC AGG C/36-FAM/ - 3′) and Iowa BlackTM FQ labeled NF-κB decoy antisense ODN (5′ - /5IAbFQ/GCC TGG GAA AGT CCC CTC AAC T – 3′) from Integrated DNA Technologies, Inc. (Coralville, IA) were utilized.

    Techniques:

    Concentration dependence of FITC-ODN fluorescence (6 mm diameter cuvette). FITC-ODN fluorescence is linear up to 8 μM. Above 8 μM, the relationship becomes nonlinear, and intensity begins to decrease at high concentration starts self-quenching.

    Journal: Journal of controlled release : official journal of the Controlled Release Society

    Article Title: Encapsulation of NF-? B Decoy Oligonucleotides within Echogenic Liposomes and Ultrasound-Triggered Release

    doi: 10.1016/j.jconrel.2009.09.017

    Figure Lengend Snippet: Concentration dependence of FITC-ODN fluorescence (6 mm diameter cuvette). FITC-ODN fluorescence is linear up to 8 μM. Above 8 μM, the relationship becomes nonlinear, and intensity begins to decrease at high concentration starts self-quenching.

    Article Snippet: FITC-NF-κB decoy sense ODN (5′-AGT TGA GGG GAC TTT CCC AGG C/36-FAM/ - 3′) and Iowa BlackTM FQ labeled NF-κB decoy antisense ODN (5′ - /5IAbFQ/GCC TGG GAA AGT CCC CTC AAC T – 3′) from Integrated DNA Technologies, Inc. (Coralville, IA) were utilized.

    Techniques: Concentration Assay, Fluorescence