5x hot firepol evagreen qpcr supermix kit  (Solis BioDyne)

Bioz Verified Symbol Solis BioDyne is a verified supplier
Bioz Manufacturer Symbol Solis BioDyne manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Solis BioDyne 5x hot firepol evagreen qpcr supermix kit
    5x Hot Firepol Evagreen Qpcr Supermix Kit, supplied by Solis BioDyne, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/5x hot firepol evagreen qpcr supermix kit/product/Solis BioDyne
    Average 96 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    5x hot firepol evagreen qpcr supermix kit - by Bioz Stars, 2024-07
    96/100 stars


    5x hot firepol evagreen qpcr supermix  (Solis BioDyne)

    Bioz Verified Symbol Solis BioDyne is a verified supplier
    Bioz Manufacturer Symbol Solis BioDyne manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Solis BioDyne 5x hot firepol evagreen qpcr supermix
    Overview of Methodological Details of Either qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) or Microarrays Used by the Contributing Teams
    5x Hot Firepol Evagreen Qpcr Supermix, supplied by Solis BioDyne, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/5x hot firepol evagreen qpcr supermix/product/Solis BioDyne
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    5x hot firepol evagreen qpcr supermix - by Bioz Stars, 2024-07
    86/100 stars


    1) Product Images from "RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay"

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay

    Journal: Radiation research

    doi: 10.1667/RADE-22-00206.1

    Overview of Methodological Details of Either qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) or Microarrays Used by the Contributing Teams
    Figure Legend Snippet: Overview of Methodological Details of Either qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) or Microarrays Used by the Contributing Teams

    Techniques Used: Reverse Transcription, Polymerase Chain Reaction, Microarray, Isolation, Lysis, Concentration Assay, Sequencing, Labeling, SYBR Green Assay, Multiplex Assay, TaqMan Assay, Real-time Polymerase Chain Reaction, Software, Extraction

    5x hot firepol evagreen qpcr supermix  (Solis BioDyne)

    Bioz Verified Symbol Solis BioDyne is a verified supplier
    Bioz Manufacturer Symbol Solis BioDyne manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Solis BioDyne 5x hot firepol evagreen qpcr supermix
    Overview of Methodological Details of Either qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) or Microarrays Used by the Contributing Teams
    5x Hot Firepol Evagreen Qpcr Supermix, supplied by Solis BioDyne, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/5x hot firepol evagreen qpcr supermix/product/Solis BioDyne
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    5x hot firepol evagreen qpcr supermix - by Bioz Stars, 2024-07
    86/100 stars


    1) Product Images from "RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay"

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay

    Journal: Radiation research

    doi: 10.1667/RADE-22-00206.1

    Overview of Methodological Details of Either qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) or Microarrays Used by the Contributing Teams
    Figure Legend Snippet: Overview of Methodological Details of Either qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) or Microarrays Used by the Contributing Teams

    Techniques Used: Reverse Transcription, Polymerase Chain Reaction, Microarray, Isolation, Lysis, Concentration Assay, Sequencing, Labeling, SYBR Green Assay, Multiplex Assay, TaqMan Assay, Real-time Polymerase Chain Reaction, Software, Extraction

    5x hot firepol evagreen qpcr supermix  (Solis BioDyne)

    Bioz Verified Symbol Solis BioDyne is a verified supplier
    Bioz Manufacturer Symbol Solis BioDyne manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Solis BioDyne 5x hot firepol evagreen qpcr supermix
    Overview of Methodological Details of Either qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) or Microarrays Used by the Contributing Teams
    5x Hot Firepol Evagreen Qpcr Supermix, supplied by Solis BioDyne, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/5x hot firepol evagreen qpcr supermix/product/Solis BioDyne
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    5x hot firepol evagreen qpcr supermix - by Bioz Stars, 2024-07
    86/100 stars


    1) Product Images from "RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay"

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay

    Journal: Radiation research

    doi: 10.1667/RADE-22-00206.1

    Overview of Methodological Details of Either qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) or Microarrays Used by the Contributing Teams
    Figure Legend Snippet: Overview of Methodological Details of Either qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) or Microarrays Used by the Contributing Teams

    Techniques Used: Reverse Transcription, Polymerase Chain Reaction, Microarray, Isolation, Lysis, Concentration Assay, Sequencing, Labeling, SYBR Green Assay, Multiplex Assay, TaqMan Assay, Real-time Polymerase Chain Reaction, Software, Extraction

    5x hot firepol evagreen qpcr supermix  (Solis BioDyne)

    Bioz Verified Symbol Solis BioDyne is a verified supplier
    Bioz Manufacturer Symbol Solis BioDyne manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Solis BioDyne 5x hot firepol evagreen qpcr supermix
    5x Hot Firepol Evagreen Qpcr Supermix, supplied by Solis BioDyne, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/5x hot firepol evagreen qpcr supermix/product/Solis BioDyne
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    5x hot firepol evagreen qpcr supermix - by Bioz Stars, 2024-07
    86/100 stars


    5x hot firepol evagreen qpcr supermix  (Solis BioDyne)

    Bioz Verified Symbol Solis BioDyne is a verified supplier
    Bioz Manufacturer Symbol Solis BioDyne manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Solis BioDyne 5x hot firepol evagreen qpcr supermix
    5x Hot Firepol Evagreen Qpcr Supermix, supplied by Solis BioDyne, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/5x hot firepol evagreen qpcr supermix/product/Solis BioDyne
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    5x hot firepol evagreen qpcr supermix - by Bioz Stars, 2024-07
    86/100 stars


    5x hot firepol evagreen qpcr supermix kit  (Solis BioDyne)

    Bioz Verified Symbol Solis BioDyne is a verified supplier
    Bioz Manufacturer Symbol Solis BioDyne manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Solis BioDyne 5x hot firepol evagreen qpcr supermix kit
    5x Hot Firepol Evagreen Qpcr Supermix Kit, supplied by Solis BioDyne, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/5x hot firepol evagreen qpcr supermix kit/product/Solis BioDyne
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    5x hot firepol evagreen qpcr supermix kit - by Bioz Stars, 2024-07
    86/100 stars


    5x hot firepol evagreen qpcr supermix kit  (Solis BioDyne)

    Bioz Verified Symbol Solis BioDyne is a verified supplier
    Bioz Manufacturer Symbol Solis BioDyne manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Solis BioDyne 5x hot firepol evagreen qpcr supermix kit
    5x Hot Firepol Evagreen Qpcr Supermix Kit, supplied by Solis BioDyne, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/5x hot firepol evagreen qpcr supermix kit/product/Solis BioDyne
    Average 96 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    5x hot firepol evagreen qpcr supermix kit - by Bioz Stars, 2024-07
    96/100 stars


    cdna amplification 5x hot firepol evagreen qrt pcr supermix  (Solis BioDyne)

    Bioz Verified Symbol Solis BioDyne is a verified supplier
    Bioz Manufacturer Symbol Solis BioDyne manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Solis BioDyne cdna amplification 5x hot firepol evagreen qrt pcr supermix
    Cdna Amplification 5x Hot Firepol Evagreen Qrt Pcr Supermix, supplied by Solis BioDyne, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cdna amplification 5x hot firepol evagreen qrt pcr supermix/product/Solis BioDyne
    Average 96 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    cdna amplification 5x hot firepol evagreen qrt pcr supermix - by Bioz Stars, 2024-07
    96/100 stars


    5x hot firepol evagreen qpcr supermix  (Solis BioDyne)

    Bioz Verified Symbol Solis BioDyne is a verified supplier
    Bioz Manufacturer Symbol Solis BioDyne manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Solis BioDyne 5x hot firepol evagreen qpcr supermix
    5x Hot Firepol Evagreen Qpcr Supermix, supplied by Solis BioDyne, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/5x hot firepol evagreen qpcr supermix/product/Solis BioDyne
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    5x hot firepol evagreen qpcr supermix - by Bioz Stars, 2024-07
    86/100 stars


    5x hot firepol evagreen qpcr mix plus  (Solis BioDyne)

    Bioz Verified Symbol Solis BioDyne is a verified supplier
    Bioz Manufacturer Symbol Solis BioDyne manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Solis BioDyne 5x hot firepol evagreen qpcr mix plus
    5x Hot Firepol Evagreen Qpcr Mix Plus, supplied by Solis BioDyne, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/5x hot firepol evagreen qpcr mix plus/product/Solis BioDyne
    Average 96 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    5x hot firepol evagreen qpcr mix plus - by Bioz Stars, 2024-07
    96/100 stars


    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96
    Solis BioDyne 5x hot firepol evagreen qpcr supermix kit
    5x Hot Firepol Evagreen Qpcr Supermix Kit, supplied by Solis BioDyne, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/5x hot firepol evagreen qpcr supermix kit/product/Solis BioDyne
    Average 96 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    5x hot firepol evagreen qpcr supermix kit - by Bioz Stars, 2024-07
    96/100 stars
      Buy from Supplier

    Solis BioDyne 5x hot firepol evagreen qpcr supermix
    Overview of Methodological Details of Either qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) or Microarrays Used by the Contributing Teams
    5x Hot Firepol Evagreen Qpcr Supermix, supplied by Solis BioDyne, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/5x hot firepol evagreen qpcr supermix/product/Solis BioDyne
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    5x hot firepol evagreen qpcr supermix - by Bioz Stars, 2024-07
    86/100 stars
      Buy from Supplier

    Solis BioDyne cdna amplification 5x hot firepol evagreen qrt pcr supermix
    Overview of Methodological Details of Either qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) or Microarrays Used by the Contributing Teams
    Cdna Amplification 5x Hot Firepol Evagreen Qrt Pcr Supermix, supplied by Solis BioDyne, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cdna amplification 5x hot firepol evagreen qrt pcr supermix/product/Solis BioDyne
    Average 96 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    cdna amplification 5x hot firepol evagreen qrt pcr supermix - by Bioz Stars, 2024-07
    96/100 stars
      Buy from Supplier

    Solis BioDyne 5x hot firepol evagreen qpcr mix plus
    Overview of Methodological Details of Either qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) or Microarrays Used by the Contributing Teams
    5x Hot Firepol Evagreen Qpcr Mix Plus, supplied by Solis BioDyne, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/5x hot firepol evagreen qpcr mix plus/product/Solis BioDyne
    Average 96 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    5x hot firepol evagreen qpcr mix plus - by Bioz Stars, 2024-07
    96/100 stars
      Buy from Supplier

    Image Search Results

    Overview of Methodological Details of Either qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) or Microarrays Used by the Contributing Teams

    Journal: Radiation research

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay

    doi: 10.1667/RADE-22-00206.1

    Figure Lengend Snippet: Overview of Methodological Details of Either qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) or Microarrays Used by the Contributing Teams

    Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop ™ qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

    Techniques: Reverse Transcription, Polymerase Chain Reaction, Microarray, Isolation, Lysis, Concentration Assay, Sequencing, Labeling, SYBR Green Assay, Multiplex Assay, TaqMan Assay, Real-time Polymerase Chain Reaction, Software, Extraction