truchip chromatin shearing kit with formaldehyde  (Covaris)


Bioz Verified Symbol Covaris is a verified supplier
Bioz Manufacturer Symbol Covaris manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Name:
    truChIP Chromatin Shearing Kit with Formaldehyde
    Description:
    The truChIP Chromatin Shearing Kit with Formaldehyde is designed and optimized for the efficient and reproducible shearing of chromatin from cultured mammalian cells suspension or adherent using the Covaris Adaptive Focused Acoustics AFA technology
    Catalog Number:
    520154
    Price:
    None
    Category:
    Reagent
    Applications:
    Chromatin shearing
    Quantity:
    1 0
    Buy from Supplier


    Structured Review

    Covaris truchip chromatin shearing kit with formaldehyde
    truChIP Chromatin Shearing Kit with Formaldehyde
    The truChIP Chromatin Shearing Kit with Formaldehyde is designed and optimized for the efficient and reproducible shearing of chromatin from cultured mammalian cells suspension or adherent using the Covaris Adaptive Focused Acoustics AFA technology
    https://www.bioz.com/result/truchip chromatin shearing kit with formaldehyde/product/Covaris
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    truchip chromatin shearing kit with formaldehyde - by Bioz Stars, 2021-03
    94/100 stars

    Images

    Related Articles

    ChIP-sequencing:

    Article Title: Genome-Wide Definition of Promoter and Enhancer Usage during Neural Induction of Human Embryonic Stem Cells
    Article Snippet: The significance of differential promoter expression was determined by a χ2 test. .. Chip-seq library preparation and sequencing Chromatin was prepared from pellets of 5 106 NESCs following the truChIP Chromatin Sheering Kit standard protocol (Covaris Inc.) and sonicated to obtain DNA fragments averaging 200 bp. .. 10 ng of DNA immunoprecipitated with anti-H3K4me1 and anti-H3K4me3 antibodies (Ab8895 and Ab8580, Abcam Plc.) or control input DNA were used to prepare the sequencing libraries, which were checked by capillary electrophoresis and sequenced in one lane of a single-strand 50 bp GAIIx Illumina Run ( and Methods).

    Sequencing:

    Article Title: Genome-Wide Definition of Promoter and Enhancer Usage during Neural Induction of Human Embryonic Stem Cells
    Article Snippet: The significance of differential promoter expression was determined by a χ2 test. .. Chip-seq library preparation and sequencing Chromatin was prepared from pellets of 5 106 NESCs following the truChIP Chromatin Sheering Kit standard protocol (Covaris Inc.) and sonicated to obtain DNA fragments averaging 200 bp. .. 10 ng of DNA immunoprecipitated with anti-H3K4me1 and anti-H3K4me3 antibodies (Ab8895 and Ab8580, Abcam Plc.) or control input DNA were used to prepare the sequencing libraries, which were checked by capillary electrophoresis and sequenced in one lane of a single-strand 50 bp GAIIx Illumina Run ( and Methods).

    Sonication:

    Article Title: Genome-Wide Definition of Promoter and Enhancer Usage during Neural Induction of Human Embryonic Stem Cells
    Article Snippet: The significance of differential promoter expression was determined by a χ2 test. .. Chip-seq library preparation and sequencing Chromatin was prepared from pellets of 5 106 NESCs following the truChIP Chromatin Sheering Kit standard protocol (Covaris Inc.) and sonicated to obtain DNA fragments averaging 200 bp. .. 10 ng of DNA immunoprecipitated with anti-H3K4me1 and anti-H3K4me3 antibodies (Ab8895 and Ab8580, Abcam Plc.) or control input DNA were used to prepare the sequencing libraries, which were checked by capillary electrophoresis and sequenced in one lane of a single-strand 50 bp GAIIx Illumina Run ( and Methods).

    Recombinant:

    Article Title: Directed RNase H Cleavage of Nascent Transcripts Causes Transcription Termination.
    Article Snippet: .. An attractive approach to reduce gene expression is via the use of antisense oligonucleotides (ASOs) that harness the RNase H1 mechanism. .. An attractive approach to reduce gene expression is via the use of antisense oligonucleotides (ASOs) that harness the RNase H1 mechanism.

    Staining:

    Article Title: Directed RNase H Cleavage of Nascent Transcripts Causes Transcription Termination.
    Article Snippet: .. An attractive approach to reduce gene expression is via the use of antisense oligonucleotides (ASOs) that harness the RNase H1 mechanism. .. An attractive approach to reduce gene expression is via the use of antisense oligonucleotides (ASOs) that harness the RNase H1 mechanism.

    Protease Inhibitor:

    Article Title: Directed RNase H Cleavage of Nascent Transcripts Causes Transcription Termination.
    Article Snippet: .. An attractive approach to reduce gene expression is via the use of antisense oligonucleotides (ASOs) that harness the RNase H1 mechanism. .. An attractive approach to reduce gene expression is via the use of antisense oligonucleotides (ASOs) that harness the RNase H1 mechanism.

    Multiplex Assay:

    Article Title: Directed RNase H Cleavage of Nascent Transcripts Causes Transcription Termination.
    Article Snippet: .. An attractive approach to reduce gene expression is via the use of antisense oligonucleotides (ASOs) that harness the RNase H1 mechanism. .. An attractive approach to reduce gene expression is via the use of antisense oligonucleotides (ASOs) that harness the RNase H1 mechanism.

    Chromatin Immunoprecipitation:

    Article Title: Directed RNase H Cleavage of Nascent Transcripts Causes Transcription Termination.
    Article Snippet: .. An attractive approach to reduce gene expression is via the use of antisense oligonucleotides (ASOs) that harness the RNase H1 mechanism. .. An attractive approach to reduce gene expression is via the use of antisense oligonucleotides (ASOs) that harness the RNase H1 mechanism.

    Article Title: EMT is associated with an epigenetic signature of ECM remodeling genes
    Article Snippet: .. Chromatin immunoprecipitation Chromatin was prepared using the truChIP™ Chromatin Shearing Kit (520154, Covaris, France) according to the manufacturer’s instructions. .. Each sample was submitted to a 8 min sonicated using the M220 Covaris sonicator.

    Article Title: The glycosyltransferase LARGE2 is repressed by Snail and ZEB1 in prostate cancer
    Article Snippet: The activity of firefly luciferase was normalized to that of Renilla luciferase. .. The ChIP assay was performed according to Millipore's EZ ChIP (#17-371) protocol, with the following specifications: the truChIP High Cell Chromatin Shearing Kit (Covaris) was used for crosslinking and to isolate nuclei; and DNA-protein complexes were sheared for 5 minutes in a Covaris S2 sonicator, as per the manufacturer's instruction. .. Promoter regions were detected by qPCR, using the following primer pairs: LARGE2 #1, 5′- GAGTGAGGCGAAGGCTTCAG -3′ and 5′- ACTGCGGGAGCTCGACACGA-3′; #2, 5′- CAGCTCTTGCATGTGGCCATC-3′ and 5′- GAGGAAGCTGAAGCTCTGAGACCAG -3′; and #3, 5′-TGGAGAAGAGAATCATCAGTCC-3′ and 5′-AGFTTCATTAGCCCATAGAGGC-3′.

    DC Protein Assay:

    Article Title: Directed RNase H Cleavage of Nascent Transcripts Causes Transcription Termination.
    Article Snippet: .. An attractive approach to reduce gene expression is via the use of antisense oligonucleotides (ASOs) that harness the RNase H1 mechanism. .. An attractive approach to reduce gene expression is via the use of antisense oligonucleotides (ASOs) that harness the RNase H1 mechanism.

    RNA Sequencing Assay:

    Article Title: Directed RNase H Cleavage of Nascent Transcripts Causes Transcription Termination.
    Article Snippet: .. An attractive approach to reduce gene expression is via the use of antisense oligonucleotides (ASOs) that harness the RNase H1 mechanism. .. An attractive approach to reduce gene expression is via the use of antisense oligonucleotides (ASOs) that harness the RNase H1 mechanism.

    Polyacrylamide Gel Electrophoresis:

    Article Title: Directed RNase H Cleavage of Nascent Transcripts Causes Transcription Termination.
    Article Snippet: .. An attractive approach to reduce gene expression is via the use of antisense oligonucleotides (ASOs) that harness the RNase H1 mechanism. .. An attractive approach to reduce gene expression is via the use of antisense oligonucleotides (ASOs) that harness the RNase H1 mechanism.

    Isolation:

    Article Title: STAT5 promotes accessibility and is required for BATF-mediated plasticity at the Il9 locus
    Article Snippet: Chromatin immunoprecipitation sequencing In vitro-cultured Th9 and Th17 cells were collected on day 5 without activation. .. Cells were crosslinked and chromatin was isolated by using the truChIP Chromatin Shearing Kit with Formaldehyde (Covaris). ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Covaris truchip chromatin shearing kit with formaldehyde
    Truchip Chromatin Shearing Kit With Formaldehyde, supplied by Covaris, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/truchip chromatin shearing kit with formaldehyde/product/Covaris
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    truchip chromatin shearing kit with formaldehyde - by Bioz Stars, 2021-03
    94/100 stars
      Buy from Supplier

    Image Search Results