t gondii ptg gfp strain  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 91

    Structured Review

    ATCC t gondii ptg gfp strain
    <t>Toxoplasma</t> infection induced the expression of alternative complement components and anaphylatoxin receptors in the brain. (A) Experimental scheme. C57BL/6J mice were divided into three groups: without infection (n=3), T. <t>gondii</t> infection (n=6), and T. gondii infection plus drug treatment (Sulfadiazine and pyrimethamine) (n=3). Infection groups received oral inoculation of T. gondii (Fukaya, three cysts) on day 0 at the age of 5 weeks, and one group received drug treatment daily from day 1 for 2 weeks until sacrifice. (B) Body weight change after Toxoplasma inoculation. Data are presented as means ± SEM values relative to body weight at day 0. Filled circle: without infection; filled square: infection; filled triangle: infected with drug treatment. (C) T. gondii gDNA levels were quantified by qPCR. Values were normalized to mouse β-actin ( Actb ). Data are presented as Means ± SEM. (D) mRNA levels for complement components (properdin: Cfp , factor B: Cfb , factor H: Cfh , C4b-binding protein: C4bp , C1q: C1qa , C3: C3 , C3aR: C3ar1 , and C5aR1: C5ar1 ) in the cortex. Data are presented as means ± SEM. * p < 0.05, ** p < 0.01 *** p < 0.001 (Dunnett’s test vs. control). The representative outcome of two independent experiments are presented.
    T Gondii Ptg Gfp Strain, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t gondii ptg gfp strain/product/ATCC
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    t gondii ptg gfp strain - by Bioz Stars, 2024-05
    91/100 stars

    Images

    1) Product Images from "Toxoplasma Infection Induces Sustained Up-Regulation of Complement Factor B and C5a Receptor in the Mouse Brain via Microglial Activation: Implication for the Alternative Complement Pathway Activation and Anaphylatoxin Signaling in Cerebral Toxoplasmosis"

    Article Title: Toxoplasma Infection Induces Sustained Up-Regulation of Complement Factor B and C5a Receptor in the Mouse Brain via Microglial Activation: Implication for the Alternative Complement Pathway Activation and Anaphylatoxin Signaling in Cerebral Toxoplasmosis

    Journal: Frontiers in Immunology

    doi: 10.3389/fimmu.2020.603924

    Toxoplasma infection induced the expression of alternative complement components and anaphylatoxin receptors in the brain. (A) Experimental scheme. C57BL/6J mice were divided into three groups: without infection (n=3), T. gondii infection (n=6), and T. gondii infection plus drug treatment (Sulfadiazine and pyrimethamine) (n=3). Infection groups received oral inoculation of T. gondii (Fukaya, three cysts) on day 0 at the age of 5 weeks, and one group received drug treatment daily from day 1 for 2 weeks until sacrifice. (B) Body weight change after Toxoplasma inoculation. Data are presented as means ± SEM values relative to body weight at day 0. Filled circle: without infection; filled square: infection; filled triangle: infected with drug treatment. (C) T. gondii gDNA levels were quantified by qPCR. Values were normalized to mouse β-actin ( Actb ). Data are presented as Means ± SEM. (D) mRNA levels for complement components (properdin: Cfp , factor B: Cfb , factor H: Cfh , C4b-binding protein: C4bp , C1q: C1qa , C3: C3 , C3aR: C3ar1 , and C5aR1: C5ar1 ) in the cortex. Data are presented as means ± SEM. * p < 0.05, ** p < 0.01 *** p < 0.001 (Dunnett’s test vs. control). The representative outcome of two independent experiments are presented.
    Figure Legend Snippet: Toxoplasma infection induced the expression of alternative complement components and anaphylatoxin receptors in the brain. (A) Experimental scheme. C57BL/6J mice were divided into three groups: without infection (n=3), T. gondii infection (n=6), and T. gondii infection plus drug treatment (Sulfadiazine and pyrimethamine) (n=3). Infection groups received oral inoculation of T. gondii (Fukaya, three cysts) on day 0 at the age of 5 weeks, and one group received drug treatment daily from day 1 for 2 weeks until sacrifice. (B) Body weight change after Toxoplasma inoculation. Data are presented as means ± SEM values relative to body weight at day 0. Filled circle: without infection; filled square: infection; filled triangle: infected with drug treatment. (C) T. gondii gDNA levels were quantified by qPCR. Values were normalized to mouse β-actin ( Actb ). Data are presented as Means ± SEM. (D) mRNA levels for complement components (properdin: Cfp , factor B: Cfb , factor H: Cfh , C4b-binding protein: C4bp , C1q: C1qa , C3: C3 , C3aR: C3ar1 , and C5aR1: C5ar1 ) in the cortex. Data are presented as means ± SEM. * p < 0.05, ** p < 0.01 *** p < 0.001 (Dunnett’s test vs. control). The representative outcome of two independent experiments are presented.

    Techniques Used: Infection, Expressing, Binding Assay

    mRNAs for factor B and anaphylatoxin receptors are persistently upregulated after Toxoplasma infection. (A) C57BL/6J were divided into two groups: with (n=4) or without infection (n=4). The infection group received oral inoculation of T. gondii (Fukaya, three cysts) at the age of 5 weeks. (B) Body weight was measured before inoculation and from week 6 to week 8 until sacrifice. Body weight change from week 6 to week 8. Data are presented as means ± SEM. (C) T. gondii gDNA levels were quantified by qPCR. Values were normalized to mouse β-actin ( Actb ). Data are presented as means ± SEM. (D) mRNA levels for complement components (properdin: Cfp , factor B: Cfb , factor H: Cfh , C4b-binding protein: C4bp , C1q: C1qa , C3: C3 , C3aR: C3ar1 , and C5aR1: C5ar1 ) in the cortex. Data are presented as means ± SEM. *** p < 0.001 (Student’s t-test vs. control). The representative outcome of two independent experiments are presented.
    Figure Legend Snippet: mRNAs for factor B and anaphylatoxin receptors are persistently upregulated after Toxoplasma infection. (A) C57BL/6J were divided into two groups: with (n=4) or without infection (n=4). The infection group received oral inoculation of T. gondii (Fukaya, three cysts) at the age of 5 weeks. (B) Body weight was measured before inoculation and from week 6 to week 8 until sacrifice. Body weight change from week 6 to week 8. Data are presented as means ± SEM. (C) T. gondii gDNA levels were quantified by qPCR. Values were normalized to mouse β-actin ( Actb ). Data are presented as means ± SEM. (D) mRNA levels for complement components (properdin: Cfp , factor B: Cfb , factor H: Cfh , C4b-binding protein: C4bp , C1q: C1qa , C3: C3 , C3aR: C3ar1 , and C5aR1: C5ar1 ) in the cortex. Data are presented as means ± SEM. *** p < 0.001 (Student’s t-test vs. control). The representative outcome of two independent experiments are presented.

    Techniques Used: Infection, Binding Assay

    C5a increased in the cerebral cortex after Toxoplasma infection. One month after infection, C5a protein levels in the cortical tissue lysates were measured by ELISA. Data are normalized by total protein and presented as means ± SEM (n=4). ** p < 0.01 (Student’s t-test vs. control). The representative outcome of two independent experiments are presented.
    Figure Legend Snippet: C5a increased in the cerebral cortex after Toxoplasma infection. One month after infection, C5a protein levels in the cortical tissue lysates were measured by ELISA. Data are normalized by total protein and presented as means ± SEM (n=4). ** p < 0.01 (Student’s t-test vs. control). The representative outcome of two independent experiments are presented.

    Techniques Used: Infection, Enzyme-linked Immunosorbent Assay

    Toxoplasma infection induced the upregulation of alternative complement pathway components and anaphylatoxin C5aR1. (A) Primary mixed glial cells prepared from the cortex of postnatal days 1–2 C57BL/6J mice. Astrocytes and microglia were detected by immunofluorescence microscopy, using Glial Fibrillary Acidic Protein (GFAP, green) and CD11b (red) as marker proteins. Cultures were pre-treated either in the presence or absence of minocycline (20 µM) for 5 days prior to T. gondii infection (upper panel). Without minocycline pre-treatment, glial culture contained significantly more CD11b positive microglia (lower panel). (B) mRNA levels of complement components ( Cfp , Cfb , Cfh , C4bp , C1qa , C3 , C3ar1 , and C5ar1 ) in glial cells with or without T. gondii infection in the presence or absence of anti- Toxoplasma drug pyrimethamine (2 µM). Means ± SEM. * p < 0.05, ** p < 0.01 *** p < 0.001 (Tukey’s test).
    Figure Legend Snippet: Toxoplasma infection induced the upregulation of alternative complement pathway components and anaphylatoxin C5aR1. (A) Primary mixed glial cells prepared from the cortex of postnatal days 1–2 C57BL/6J mice. Astrocytes and microglia were detected by immunofluorescence microscopy, using Glial Fibrillary Acidic Protein (GFAP, green) and CD11b (red) as marker proteins. Cultures were pre-treated either in the presence or absence of minocycline (20 µM) for 5 days prior to T. gondii infection (upper panel). Without minocycline pre-treatment, glial culture contained significantly more CD11b positive microglia (lower panel). (B) mRNA levels of complement components ( Cfp , Cfb , Cfh , C4bp , C1qa , C3 , C3ar1 , and C5ar1 ) in glial cells with or without T. gondii infection in the presence or absence of anti- Toxoplasma drug pyrimethamine (2 µM). Means ± SEM. * p < 0.05, ** p < 0.01 *** p < 0.001 (Tukey’s test).

    Techniques Used: Infection, Immunofluorescence, Microscopy, Marker

    t gondii ptg gfp strain  (ATCC)


    Bioz Verified Symbol ATCC is a verified supplier
    Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 91

    Structured Review

    ATCC t gondii ptg gfp strain
    <t>Toxoplasma</t> infection induced the expression of alternative complement components and anaphylatoxin receptors in the brain. (A) Experimental scheme. C57BL/6J mice were divided into three groups: without infection (n=3), T. <t>gondii</t> infection (n=6), and T. gondii infection plus drug treatment (Sulfadiazine and pyrimethamine) (n=3). Infection groups received oral inoculation of T. gondii (Fukaya, three cysts) on day 0 at the age of 5 weeks, and one group received drug treatment daily from day 1 for 2 weeks until sacrifice. (B) Body weight change after Toxoplasma inoculation. Data are presented as means ± SEM values relative to body weight at day 0. Filled circle: without infection; filled square: infection; filled triangle: infected with drug treatment. (C) T. gondii gDNA levels were quantified by qPCR. Values were normalized to mouse β-actin ( Actb ). Data are presented as Means ± SEM. (D) mRNA levels for complement components (properdin: Cfp , factor B: Cfb , factor H: Cfh , C4b-binding protein: C4bp , C1q: C1qa , C3: C3 , C3aR: C3ar1 , and C5aR1: C5ar1 ) in the cortex. Data are presented as means ± SEM. * p < 0.05, ** p < 0.01 *** p < 0.001 (Dunnett’s test vs. control). The representative outcome of two independent experiments are presented.
    T Gondii Ptg Gfp Strain, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t gondii ptg gfp strain/product/ATCC
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    t gondii ptg gfp strain - by Bioz Stars, 2024-05
    91/100 stars

    Images

    1) Product Images from "Toxoplasma Infection Induces Sustained Up-Regulation of Complement Factor B and C5a Receptor in the Mouse Brain via Microglial Activation: Implication for the Alternative Complement Pathway Activation and Anaphylatoxin Signaling in Cerebral Toxoplasmosis"

    Article Title: Toxoplasma Infection Induces Sustained Up-Regulation of Complement Factor B and C5a Receptor in the Mouse Brain via Microglial Activation: Implication for the Alternative Complement Pathway Activation and Anaphylatoxin Signaling in Cerebral Toxoplasmosis

    Journal: Frontiers in Immunology

    doi: 10.3389/fimmu.2020.603924

    Toxoplasma infection induced the expression of alternative complement components and anaphylatoxin receptors in the brain. (A) Experimental scheme. C57BL/6J mice were divided into three groups: without infection (n=3), T. gondii infection (n=6), and T. gondii infection plus drug treatment (Sulfadiazine and pyrimethamine) (n=3). Infection groups received oral inoculation of T. gondii (Fukaya, three cysts) on day 0 at the age of 5 weeks, and one group received drug treatment daily from day 1 for 2 weeks until sacrifice. (B) Body weight change after Toxoplasma inoculation. Data are presented as means ± SEM values relative to body weight at day 0. Filled circle: without infection; filled square: infection; filled triangle: infected with drug treatment. (C) T. gondii gDNA levels were quantified by qPCR. Values were normalized to mouse β-actin ( Actb ). Data are presented as Means ± SEM. (D) mRNA levels for complement components (properdin: Cfp , factor B: Cfb , factor H: Cfh , C4b-binding protein: C4bp , C1q: C1qa , C3: C3 , C3aR: C3ar1 , and C5aR1: C5ar1 ) in the cortex. Data are presented as means ± SEM. * p < 0.05, ** p < 0.01 *** p < 0.001 (Dunnett’s test vs. control). The representative outcome of two independent experiments are presented.
    Figure Legend Snippet: Toxoplasma infection induced the expression of alternative complement components and anaphylatoxin receptors in the brain. (A) Experimental scheme. C57BL/6J mice were divided into three groups: without infection (n=3), T. gondii infection (n=6), and T. gondii infection plus drug treatment (Sulfadiazine and pyrimethamine) (n=3). Infection groups received oral inoculation of T. gondii (Fukaya, three cysts) on day 0 at the age of 5 weeks, and one group received drug treatment daily from day 1 for 2 weeks until sacrifice. (B) Body weight change after Toxoplasma inoculation. Data are presented as means ± SEM values relative to body weight at day 0. Filled circle: without infection; filled square: infection; filled triangle: infected with drug treatment. (C) T. gondii gDNA levels were quantified by qPCR. Values were normalized to mouse β-actin ( Actb ). Data are presented as Means ± SEM. (D) mRNA levels for complement components (properdin: Cfp , factor B: Cfb , factor H: Cfh , C4b-binding protein: C4bp , C1q: C1qa , C3: C3 , C3aR: C3ar1 , and C5aR1: C5ar1 ) in the cortex. Data are presented as means ± SEM. * p < 0.05, ** p < 0.01 *** p < 0.001 (Dunnett’s test vs. control). The representative outcome of two independent experiments are presented.

    Techniques Used: Infection, Expressing, Binding Assay

    mRNAs for factor B and anaphylatoxin receptors are persistently upregulated after Toxoplasma infection. (A) C57BL/6J were divided into two groups: with (n=4) or without infection (n=4). The infection group received oral inoculation of T. gondii (Fukaya, three cysts) at the age of 5 weeks. (B) Body weight was measured before inoculation and from week 6 to week 8 until sacrifice. Body weight change from week 6 to week 8. Data are presented as means ± SEM. (C) T. gondii gDNA levels were quantified by qPCR. Values were normalized to mouse β-actin ( Actb ). Data are presented as means ± SEM. (D) mRNA levels for complement components (properdin: Cfp , factor B: Cfb , factor H: Cfh , C4b-binding protein: C4bp , C1q: C1qa , C3: C3 , C3aR: C3ar1 , and C5aR1: C5ar1 ) in the cortex. Data are presented as means ± SEM. *** p < 0.001 (Student’s t-test vs. control). The representative outcome of two independent experiments are presented.
    Figure Legend Snippet: mRNAs for factor B and anaphylatoxin receptors are persistently upregulated after Toxoplasma infection. (A) C57BL/6J were divided into two groups: with (n=4) or without infection (n=4). The infection group received oral inoculation of T. gondii (Fukaya, three cysts) at the age of 5 weeks. (B) Body weight was measured before inoculation and from week 6 to week 8 until sacrifice. Body weight change from week 6 to week 8. Data are presented as means ± SEM. (C) T. gondii gDNA levels were quantified by qPCR. Values were normalized to mouse β-actin ( Actb ). Data are presented as means ± SEM. (D) mRNA levels for complement components (properdin: Cfp , factor B: Cfb , factor H: Cfh , C4b-binding protein: C4bp , C1q: C1qa , C3: C3 , C3aR: C3ar1 , and C5aR1: C5ar1 ) in the cortex. Data are presented as means ± SEM. *** p < 0.001 (Student’s t-test vs. control). The representative outcome of two independent experiments are presented.

    Techniques Used: Infection, Binding Assay

    C5a increased in the cerebral cortex after Toxoplasma infection. One month after infection, C5a protein levels in the cortical tissue lysates were measured by ELISA. Data are normalized by total protein and presented as means ± SEM (n=4). ** p < 0.01 (Student’s t-test vs. control). The representative outcome of two independent experiments are presented.
    Figure Legend Snippet: C5a increased in the cerebral cortex after Toxoplasma infection. One month after infection, C5a protein levels in the cortical tissue lysates were measured by ELISA. Data are normalized by total protein and presented as means ± SEM (n=4). ** p < 0.01 (Student’s t-test vs. control). The representative outcome of two independent experiments are presented.

    Techniques Used: Infection, Enzyme-linked Immunosorbent Assay

    Toxoplasma infection induced the upregulation of alternative complement pathway components and anaphylatoxin C5aR1. (A) Primary mixed glial cells prepared from the cortex of postnatal days 1–2 C57BL/6J mice. Astrocytes and microglia were detected by immunofluorescence microscopy, using Glial Fibrillary Acidic Protein (GFAP, green) and CD11b (red) as marker proteins. Cultures were pre-treated either in the presence or absence of minocycline (20 µM) for 5 days prior to T. gondii infection (upper panel). Without minocycline pre-treatment, glial culture contained significantly more CD11b positive microglia (lower panel). (B) mRNA levels of complement components ( Cfp , Cfb , Cfh , C4bp , C1qa , C3 , C3ar1 , and C5ar1 ) in glial cells with or without T. gondii infection in the presence or absence of anti- Toxoplasma drug pyrimethamine (2 µM). Means ± SEM. * p < 0.05, ** p < 0.01 *** p < 0.001 (Tukey’s test).
    Figure Legend Snippet: Toxoplasma infection induced the upregulation of alternative complement pathway components and anaphylatoxin C5aR1. (A) Primary mixed glial cells prepared from the cortex of postnatal days 1–2 C57BL/6J mice. Astrocytes and microglia were detected by immunofluorescence microscopy, using Glial Fibrillary Acidic Protein (GFAP, green) and CD11b (red) as marker proteins. Cultures were pre-treated either in the presence or absence of minocycline (20 µM) for 5 days prior to T. gondii infection (upper panel). Without minocycline pre-treatment, glial culture contained significantly more CD11b positive microglia (lower panel). (B) mRNA levels of complement components ( Cfp , Cfb , Cfh , C4bp , C1qa , C3 , C3ar1 , and C5ar1 ) in glial cells with or without T. gondii infection in the presence or absence of anti- Toxoplasma drug pyrimethamine (2 µM). Means ± SEM. * p < 0.05, ** p < 0.01 *** p < 0.001 (Tukey’s test).

    Techniques Used: Infection, Immunofluorescence, Microscopy, Marker

    me49 strain  (ATCC)


    Bioz Verified Symbol ATCC is a verified supplier
    Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 91

    Structured Review

    ATCC me49 strain
    Distribution of Toxoplasma gondii in the human cerebral organoids. (A) Schematic representation of the life cycle of T. gondii . (B) 3D images of a cerebral organoid infected with T. gondii (green). (C – F) Representative fluorescence images of cerebral organoids infected with 2 strains of T. gondii : <t>ME49</t> (top) and RH (bottom) infected cerebral organoids are shown stained for (C) TUJ1, a neuronal marker; (D) GFAP, an astrocyte marker; (E) O1, an oligodendrocyte marker; and (F) SOX2, a radial glial cell marker. Scale bars, as indicated.
    Me49 Strain, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/me49 strain/product/ATCC
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    me49 strain - by Bioz Stars, 2024-05
    91/100 stars

    Images

    1) Product Images from "Modelling Toxoplasma gondii infection in human cerebral organoids"

    Article Title: Modelling Toxoplasma gondii infection in human cerebral organoids

    Journal: Emerging Microbes & Infections

    doi: 10.1080/22221751.2020.1812435

    Distribution of Toxoplasma gondii in the human cerebral organoids. (A) Schematic representation of the life cycle of T. gondii . (B) 3D images of a cerebral organoid infected with T. gondii (green). (C – F) Representative fluorescence images of cerebral organoids infected with 2 strains of T. gondii : ME49 (top) and RH (bottom) infected cerebral organoids are shown stained for (C) TUJ1, a neuronal marker; (D) GFAP, an astrocyte marker; (E) O1, an oligodendrocyte marker; and (F) SOX2, a radial glial cell marker. Scale bars, as indicated.
    Figure Legend Snippet: Distribution of Toxoplasma gondii in the human cerebral organoids. (A) Schematic representation of the life cycle of T. gondii . (B) 3D images of a cerebral organoid infected with T. gondii (green). (C – F) Representative fluorescence images of cerebral organoids infected with 2 strains of T. gondii : ME49 (top) and RH (bottom) infected cerebral organoids are shown stained for (C) TUJ1, a neuronal marker; (D) GFAP, an astrocyte marker; (E) O1, an oligodendrocyte marker; and (F) SOX2, a radial glial cell marker. Scale bars, as indicated.

    Techniques Used: Infection, Fluorescence, Staining, Marker

    . T. gondii cyst formation in human cerebral organoids. Representative fluorescence image of cyst-like structures in an organoid infected with (A) ME49 and (B) RH. Images of transmission electron microscopy of (C–D) ME49- and (E) RH-infected cerebral organoids. Scale as indicated with the bar. PVM, parasitophorous vacuole membrane; Nu, nucleus; Rh, rhoptry; Co, conoid; Mt, mitochondrion; Dg, dense granule; and Am, amylopectin.
    Figure Legend Snippet: . T. gondii cyst formation in human cerebral organoids. Representative fluorescence image of cyst-like structures in an organoid infected with (A) ME49 and (B) RH. Images of transmission electron microscopy of (C–D) ME49- and (E) RH-infected cerebral organoids. Scale as indicated with the bar. PVM, parasitophorous vacuole membrane; Nu, nucleus; Rh, rhoptry; Co, conoid; Mt, mitochondrion; Dg, dense granule; and Am, amylopectin.

    Techniques Used: Fluorescence, Infection, Transmission Assay, Electron Microscopy

    Virulence of T. gondii in the infected cerebral organoids . (A) Schematic representation of the experimental design: T. gondii isolated from infected cerebral organoids was injected into mice. The levels of T. gondii P30 protein were measured by ELISA ( n = 5, biologically independent mice) 2 months postinfection. (B) ME49 and (C) RH antibody titre presented as the optical density of ELISA . * p < 0.05. Quantitative data are expressed as the mean ± S.E.M. of at least 3 independent experiments.
    Figure Legend Snippet: Virulence of T. gondii in the infected cerebral organoids . (A) Schematic representation of the experimental design: T. gondii isolated from infected cerebral organoids was injected into mice. The levels of T. gondii P30 protein were measured by ELISA ( n = 5, biologically independent mice) 2 months postinfection. (B) ME49 and (C) RH antibody titre presented as the optical density of ELISA . * p < 0.05. Quantitative data are expressed as the mean ± S.E.M. of at least 3 independent experiments.

    Techniques Used: Infection, Isolation, Injection, Enzyme-linked Immunosorbent Assay

    Transcriptome analysis of ME49 post-infection. (A) Differentially expressed genes of ME49 post-infection. Noninfectious ME49 was used as a control (|fc| ≥ 2, raw p -value < 0.05). A heat map was generated using Cluster grammer ( http://amp.pharm.mssm.edu/clustergrammer/ ). (B) Volume plot showing differential expression of ME49 genes between 0 and 72 h post-infection (|fc| ≥ 2, raw p -value < 0.05). The top 5 gene names are indicated. (C) KEGG pathway analysis was performed using the differentially expressed genes (DEGs) of ME49 (|fc| ≥ 2, raw p -value < 0.05). (D) Gene Ontology (GO) annotation of T. gondii postinfection of cerebral organoids; p -value < 0.01. MF, molecular function; BP, biological process; and CC, cellular component.
    Figure Legend Snippet: Transcriptome analysis of ME49 post-infection. (A) Differentially expressed genes of ME49 post-infection. Noninfectious ME49 was used as a control (|fc| ≥ 2, raw p -value < 0.05). A heat map was generated using Cluster grammer ( http://amp.pharm.mssm.edu/clustergrammer/ ). (B) Volume plot showing differential expression of ME49 genes between 0 and 72 h post-infection (|fc| ≥ 2, raw p -value < 0.05). The top 5 gene names are indicated. (C) KEGG pathway analysis was performed using the differentially expressed genes (DEGs) of ME49 (|fc| ≥ 2, raw p -value < 0.05). (D) Gene Ontology (GO) annotation of T. gondii postinfection of cerebral organoids; p -value < 0.01. MF, molecular function; BP, biological process; and CC, cellular component.

    Techniques Used: Infection, Generated, Expressing

    . Transcriptome analysis of T. gondii -infected cerebral organoids. Heat map showing differentially expressed genes (DEGs) of (A) ME49- and (B) RH-infected cerebral organoids 72 h post-infection (|fc| ≥ 2, raw p -value < 0.05). Noninfected cerebral organoids were used as controls ( n = 3, biologically independent samples). A heat map was generated using Cluster grammer ( http://amp.pharm.mssm.edu/clustergrammer/ ). Gene Ontology analysis of DEGs in the (C) ME49- and (D) RH-infected organoids. Top five Gene Ontology terms ( p -value < 0.005). Volume plot showing the top five genes (marked as red dots) in the (E) ME49- and (F) RH-infected organoids. Significantly upregulated and downregulated genes (|fc| ≥ 2, raw p -value < 0.05) are marked in blue. Noninfected organoids were used as controls. (G) Transcriptome data were analyzed using ingenuity pathway analysis (IPA) software ( p -value < 0.05).
    Figure Legend Snippet: . Transcriptome analysis of T. gondii -infected cerebral organoids. Heat map showing differentially expressed genes (DEGs) of (A) ME49- and (B) RH-infected cerebral organoids 72 h post-infection (|fc| ≥ 2, raw p -value < 0.05). Noninfected cerebral organoids were used as controls ( n = 3, biologically independent samples). A heat map was generated using Cluster grammer ( http://amp.pharm.mssm.edu/clustergrammer/ ). Gene Ontology analysis of DEGs in the (C) ME49- and (D) RH-infected organoids. Top five Gene Ontology terms ( p -value < 0.005). Volume plot showing the top five genes (marked as red dots) in the (E) ME49- and (F) RH-infected organoids. Significantly upregulated and downregulated genes (|fc| ≥ 2, raw p -value < 0.05) are marked in blue. Noninfected organoids were used as controls. (G) Transcriptome data were analyzed using ingenuity pathway analysis (IPA) software ( p -value < 0.05).

    Techniques Used: Infection, Generated, Software

    type ii t gondii strain ptg gfp  (ATCC)


    Bioz Verified Symbol ATCC is a verified supplier
    Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 91

    Structured Review

    ATCC type ii t gondii strain ptg gfp
    Type Ii T Gondii Strain Ptg Gfp, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/type ii t gondii strain ptg gfp/product/ATCC
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    type ii t gondii strain ptg gfp - by Bioz Stars, 2024-05
    91/100 stars

    Images

    type ii genetic lineage  (ATCC)


    Bioz Verified Symbol ATCC is a verified supplier
    Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 91

    Structured Review

    ATCC type ii genetic lineage
    Type Ii Genetic Lineage, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/type ii genetic lineage/product/ATCC
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    type ii genetic lineage - by Bioz Stars, 2024-05
    91/100 stars

    Images

    e faecium atcc 19434 ggattagataccctggtagtcc tcgttgcgggacttaacccaac  (ATCC)


    Bioz Verified Symbol ATCC is a verified supplier
    Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 91

    Structured Review

    ATCC e faecium atcc 19434 ggattagataccctggtagtcc tcgttgcgggacttaacccaac
    E Faecium Atcc 19434 Ggattagataccctggtagtcc Tcgttgcgggacttaacccaac, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e faecium atcc 19434 ggattagataccctggtagtcc tcgttgcgggacttaacccaac/product/ATCC
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    e faecium atcc 19434 ggattagataccctggtagtcc tcgttgcgggacttaacccaac - by Bioz Stars, 2024-05
    91/100 stars

    Images

    strain gfp ptg  (ATCC)


    Bioz Verified Symbol ATCC is a verified supplier
    Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 91

    Structured Review

    ATCC strain gfp ptg
    Strain Gfp Ptg, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/strain gfp ptg/product/ATCC
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    strain gfp ptg - by Bioz Stars, 2024-05
    91/100 stars

    Images

    strain gfp ptg  (ATCC)


    Bioz Verified Symbol ATCC is a verified supplier
    Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 91

    Structured Review

    ATCC strain gfp ptg
    Strain Gfp Ptg, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/strain gfp ptg/product/ATCC
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    strain gfp ptg - by Bioz Stars, 2024-05
    91/100 stars

    Images

    ptg strain parasites expressing gfp  (ATCC)


    Bioz Verified Symbol ATCC is a verified supplier
    Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 91

    Structured Review

    ATCC ptg strain parasites expressing gfp
    Ptg Strain Parasites Expressing Gfp, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ptg strain parasites expressing gfp/product/ATCC
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    ptg strain parasites expressing gfp - by Bioz Stars, 2024-05
    91/100 stars

    Images

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 91
    ATCC t gondii ptg gfp strain
    <t>Toxoplasma</t> infection induced the expression of alternative complement components and anaphylatoxin receptors in the brain. (A) Experimental scheme. C57BL/6J mice were divided into three groups: without infection (n=3), T. <t>gondii</t> infection (n=6), and T. gondii infection plus drug treatment (Sulfadiazine and pyrimethamine) (n=3). Infection groups received oral inoculation of T. gondii (Fukaya, three cysts) on day 0 at the age of 5 weeks, and one group received drug treatment daily from day 1 for 2 weeks until sacrifice. (B) Body weight change after Toxoplasma inoculation. Data are presented as means ± SEM values relative to body weight at day 0. Filled circle: without infection; filled square: infection; filled triangle: infected with drug treatment. (C) T. gondii gDNA levels were quantified by qPCR. Values were normalized to mouse β-actin ( Actb ). Data are presented as Means ± SEM. (D) mRNA levels for complement components (properdin: Cfp , factor B: Cfb , factor H: Cfh , C4b-binding protein: C4bp , C1q: C1qa , C3: C3 , C3aR: C3ar1 , and C5aR1: C5ar1 ) in the cortex. Data are presented as means ± SEM. * p < 0.05, ** p < 0.01 *** p < 0.001 (Dunnett’s test vs. control). The representative outcome of two independent experiments are presented.
    T Gondii Ptg Gfp Strain, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t gondii ptg gfp strain/product/ATCC
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    t gondii ptg gfp strain - by Bioz Stars, 2024-05
    91/100 stars
      Buy from Supplier

    91
    ATCC me49 strain
    Distribution of Toxoplasma gondii in the human cerebral organoids. (A) Schematic representation of the life cycle of T. gondii . (B) 3D images of a cerebral organoid infected with T. gondii (green). (C – F) Representative fluorescence images of cerebral organoids infected with 2 strains of T. gondii : <t>ME49</t> (top) and RH (bottom) infected cerebral organoids are shown stained for (C) TUJ1, a neuronal marker; (D) GFAP, an astrocyte marker; (E) O1, an oligodendrocyte marker; and (F) SOX2, a radial glial cell marker. Scale bars, as indicated.
    Me49 Strain, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/me49 strain/product/ATCC
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    me49 strain - by Bioz Stars, 2024-05
    91/100 stars
      Buy from Supplier

    91
    ATCC type ii t gondii strain ptg gfp
    Distribution of Toxoplasma gondii in the human cerebral organoids. (A) Schematic representation of the life cycle of T. gondii . (B) 3D images of a cerebral organoid infected with T. gondii (green). (C – F) Representative fluorescence images of cerebral organoids infected with 2 strains of T. gondii : <t>ME49</t> (top) and RH (bottom) infected cerebral organoids are shown stained for (C) TUJ1, a neuronal marker; (D) GFAP, an astrocyte marker; (E) O1, an oligodendrocyte marker; and (F) SOX2, a radial glial cell marker. Scale bars, as indicated.
    Type Ii T Gondii Strain Ptg Gfp, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/type ii t gondii strain ptg gfp/product/ATCC
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    type ii t gondii strain ptg gfp - by Bioz Stars, 2024-05
    91/100 stars
      Buy from Supplier

    91
    ATCC type ii genetic lineage
    Distribution of Toxoplasma gondii in the human cerebral organoids. (A) Schematic representation of the life cycle of T. gondii . (B) 3D images of a cerebral organoid infected with T. gondii (green). (C – F) Representative fluorescence images of cerebral organoids infected with 2 strains of T. gondii : <t>ME49</t> (top) and RH (bottom) infected cerebral organoids are shown stained for (C) TUJ1, a neuronal marker; (D) GFAP, an astrocyte marker; (E) O1, an oligodendrocyte marker; and (F) SOX2, a radial glial cell marker. Scale bars, as indicated.
    Type Ii Genetic Lineage, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/type ii genetic lineage/product/ATCC
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    type ii genetic lineage - by Bioz Stars, 2024-05
    91/100 stars
      Buy from Supplier

    91
    ATCC e faecium atcc 19434 ggattagataccctggtagtcc tcgttgcgggacttaacccaac
    Distribution of Toxoplasma gondii in the human cerebral organoids. (A) Schematic representation of the life cycle of T. gondii . (B) 3D images of a cerebral organoid infected with T. gondii (green). (C – F) Representative fluorescence images of cerebral organoids infected with 2 strains of T. gondii : <t>ME49</t> (top) and RH (bottom) infected cerebral organoids are shown stained for (C) TUJ1, a neuronal marker; (D) GFAP, an astrocyte marker; (E) O1, an oligodendrocyte marker; and (F) SOX2, a radial glial cell marker. Scale bars, as indicated.
    E Faecium Atcc 19434 Ggattagataccctggtagtcc Tcgttgcgggacttaacccaac, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e faecium atcc 19434 ggattagataccctggtagtcc tcgttgcgggacttaacccaac/product/ATCC
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    e faecium atcc 19434 ggattagataccctggtagtcc tcgttgcgggacttaacccaac - by Bioz Stars, 2024-05
    91/100 stars
      Buy from Supplier

    91
    ATCC strain gfp ptg
    Distribution of Toxoplasma gondii in the human cerebral organoids. (A) Schematic representation of the life cycle of T. gondii . (B) 3D images of a cerebral organoid infected with T. gondii (green). (C – F) Representative fluorescence images of cerebral organoids infected with 2 strains of T. gondii : <t>ME49</t> (top) and RH (bottom) infected cerebral organoids are shown stained for (C) TUJ1, a neuronal marker; (D) GFAP, an astrocyte marker; (E) O1, an oligodendrocyte marker; and (F) SOX2, a radial glial cell marker. Scale bars, as indicated.
    Strain Gfp Ptg, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/strain gfp ptg/product/ATCC
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    strain gfp ptg - by Bioz Stars, 2024-05
    91/100 stars
      Buy from Supplier

    91
    ATCC ptg strain parasites expressing gfp
    Distribution of Toxoplasma gondii in the human cerebral organoids. (A) Schematic representation of the life cycle of T. gondii . (B) 3D images of a cerebral organoid infected with T. gondii (green). (C – F) Representative fluorescence images of cerebral organoids infected with 2 strains of T. gondii : <t>ME49</t> (top) and RH (bottom) infected cerebral organoids are shown stained for (C) TUJ1, a neuronal marker; (D) GFAP, an astrocyte marker; (E) O1, an oligodendrocyte marker; and (F) SOX2, a radial glial cell marker. Scale bars, as indicated.
    Ptg Strain Parasites Expressing Gfp, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ptg strain parasites expressing gfp/product/ATCC
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    ptg strain parasites expressing gfp - by Bioz Stars, 2024-05
    91/100 stars
      Buy from Supplier

    Image Search Results


    Toxoplasma infection induced the expression of alternative complement components and anaphylatoxin receptors in the brain. (A) Experimental scheme. C57BL/6J mice were divided into three groups: without infection (n=3), T. gondii infection (n=6), and T. gondii infection plus drug treatment (Sulfadiazine and pyrimethamine) (n=3). Infection groups received oral inoculation of T. gondii (Fukaya, three cysts) on day 0 at the age of 5 weeks, and one group received drug treatment daily from day 1 for 2 weeks until sacrifice. (B) Body weight change after Toxoplasma inoculation. Data are presented as means ± SEM values relative to body weight at day 0. Filled circle: without infection; filled square: infection; filled triangle: infected with drug treatment. (C) T. gondii gDNA levels were quantified by qPCR. Values were normalized to mouse β-actin ( Actb ). Data are presented as Means ± SEM. (D) mRNA levels for complement components (properdin: Cfp , factor B: Cfb , factor H: Cfh , C4b-binding protein: C4bp , C1q: C1qa , C3: C3 , C3aR: C3ar1 , and C5aR1: C5ar1 ) in the cortex. Data are presented as means ± SEM. * p < 0.05, ** p < 0.01 *** p < 0.001 (Dunnett’s test vs. control). The representative outcome of two independent experiments are presented.

    Journal: Frontiers in Immunology

    Article Title: Toxoplasma Infection Induces Sustained Up-Regulation of Complement Factor B and C5a Receptor in the Mouse Brain via Microglial Activation: Implication for the Alternative Complement Pathway Activation and Anaphylatoxin Signaling in Cerebral Toxoplasmosis

    doi: 10.3389/fimmu.2020.603924

    Figure Lengend Snippet: Toxoplasma infection induced the expression of alternative complement components and anaphylatoxin receptors in the brain. (A) Experimental scheme. C57BL/6J mice were divided into three groups: without infection (n=3), T. gondii infection (n=6), and T. gondii infection plus drug treatment (Sulfadiazine and pyrimethamine) (n=3). Infection groups received oral inoculation of T. gondii (Fukaya, three cysts) on day 0 at the age of 5 weeks, and one group received drug treatment daily from day 1 for 2 weeks until sacrifice. (B) Body weight change after Toxoplasma inoculation. Data are presented as means ± SEM values relative to body weight at day 0. Filled circle: without infection; filled square: infection; filled triangle: infected with drug treatment. (C) T. gondii gDNA levels were quantified by qPCR. Values were normalized to mouse β-actin ( Actb ). Data are presented as Means ± SEM. (D) mRNA levels for complement components (properdin: Cfp , factor B: Cfb , factor H: Cfh , C4b-binding protein: C4bp , C1q: C1qa , C3: C3 , C3aR: C3ar1 , and C5aR1: C5ar1 ) in the cortex. Data are presented as means ± SEM. * p < 0.05, ** p < 0.01 *** p < 0.001 (Dunnett’s test vs. control). The representative outcome of two independent experiments are presented.

    Article Snippet: T. gondii PTG-GFP strain (type II) (ATCC 50941, ATCC, VA, USA) was amplified in Vero cells and tachyzoites were isolated for in vitro assays as described previously ( ).

    Techniques: Infection, Expressing, Binding Assay

    mRNAs for factor B and anaphylatoxin receptors are persistently upregulated after Toxoplasma infection. (A) C57BL/6J were divided into two groups: with (n=4) or without infection (n=4). The infection group received oral inoculation of T. gondii (Fukaya, three cysts) at the age of 5 weeks. (B) Body weight was measured before inoculation and from week 6 to week 8 until sacrifice. Body weight change from week 6 to week 8. Data are presented as means ± SEM. (C) T. gondii gDNA levels were quantified by qPCR. Values were normalized to mouse β-actin ( Actb ). Data are presented as means ± SEM. (D) mRNA levels for complement components (properdin: Cfp , factor B: Cfb , factor H: Cfh , C4b-binding protein: C4bp , C1q: C1qa , C3: C3 , C3aR: C3ar1 , and C5aR1: C5ar1 ) in the cortex. Data are presented as means ± SEM. *** p < 0.001 (Student’s t-test vs. control). The representative outcome of two independent experiments are presented.

    Journal: Frontiers in Immunology

    Article Title: Toxoplasma Infection Induces Sustained Up-Regulation of Complement Factor B and C5a Receptor in the Mouse Brain via Microglial Activation: Implication for the Alternative Complement Pathway Activation and Anaphylatoxin Signaling in Cerebral Toxoplasmosis

    doi: 10.3389/fimmu.2020.603924

    Figure Lengend Snippet: mRNAs for factor B and anaphylatoxin receptors are persistently upregulated after Toxoplasma infection. (A) C57BL/6J were divided into two groups: with (n=4) or without infection (n=4). The infection group received oral inoculation of T. gondii (Fukaya, three cysts) at the age of 5 weeks. (B) Body weight was measured before inoculation and from week 6 to week 8 until sacrifice. Body weight change from week 6 to week 8. Data are presented as means ± SEM. (C) T. gondii gDNA levels were quantified by qPCR. Values were normalized to mouse β-actin ( Actb ). Data are presented as means ± SEM. (D) mRNA levels for complement components (properdin: Cfp , factor B: Cfb , factor H: Cfh , C4b-binding protein: C4bp , C1q: C1qa , C3: C3 , C3aR: C3ar1 , and C5aR1: C5ar1 ) in the cortex. Data are presented as means ± SEM. *** p < 0.001 (Student’s t-test vs. control). The representative outcome of two independent experiments are presented.

    Article Snippet: T. gondii PTG-GFP strain (type II) (ATCC 50941, ATCC, VA, USA) was amplified in Vero cells and tachyzoites were isolated for in vitro assays as described previously ( ).

    Techniques: Infection, Binding Assay

    C5a increased in the cerebral cortex after Toxoplasma infection. One month after infection, C5a protein levels in the cortical tissue lysates were measured by ELISA. Data are normalized by total protein and presented as means ± SEM (n=4). ** p < 0.01 (Student’s t-test vs. control). The representative outcome of two independent experiments are presented.

    Journal: Frontiers in Immunology

    Article Title: Toxoplasma Infection Induces Sustained Up-Regulation of Complement Factor B and C5a Receptor in the Mouse Brain via Microglial Activation: Implication for the Alternative Complement Pathway Activation and Anaphylatoxin Signaling in Cerebral Toxoplasmosis

    doi: 10.3389/fimmu.2020.603924

    Figure Lengend Snippet: C5a increased in the cerebral cortex after Toxoplasma infection. One month after infection, C5a protein levels in the cortical tissue lysates were measured by ELISA. Data are normalized by total protein and presented as means ± SEM (n=4). ** p < 0.01 (Student’s t-test vs. control). The representative outcome of two independent experiments are presented.

    Article Snippet: T. gondii PTG-GFP strain (type II) (ATCC 50941, ATCC, VA, USA) was amplified in Vero cells and tachyzoites were isolated for in vitro assays as described previously ( ).

    Techniques: Infection, Enzyme-linked Immunosorbent Assay

    Toxoplasma infection induced the upregulation of alternative complement pathway components and anaphylatoxin C5aR1. (A) Primary mixed glial cells prepared from the cortex of postnatal days 1–2 C57BL/6J mice. Astrocytes and microglia were detected by immunofluorescence microscopy, using Glial Fibrillary Acidic Protein (GFAP, green) and CD11b (red) as marker proteins. Cultures were pre-treated either in the presence or absence of minocycline (20 µM) for 5 days prior to T. gondii infection (upper panel). Without minocycline pre-treatment, glial culture contained significantly more CD11b positive microglia (lower panel). (B) mRNA levels of complement components ( Cfp , Cfb , Cfh , C4bp , C1qa , C3 , C3ar1 , and C5ar1 ) in glial cells with or without T. gondii infection in the presence or absence of anti- Toxoplasma drug pyrimethamine (2 µM). Means ± SEM. * p < 0.05, ** p < 0.01 *** p < 0.001 (Tukey’s test).

    Journal: Frontiers in Immunology

    Article Title: Toxoplasma Infection Induces Sustained Up-Regulation of Complement Factor B and C5a Receptor in the Mouse Brain via Microglial Activation: Implication for the Alternative Complement Pathway Activation and Anaphylatoxin Signaling in Cerebral Toxoplasmosis

    doi: 10.3389/fimmu.2020.603924

    Figure Lengend Snippet: Toxoplasma infection induced the upregulation of alternative complement pathway components and anaphylatoxin C5aR1. (A) Primary mixed glial cells prepared from the cortex of postnatal days 1–2 C57BL/6J mice. Astrocytes and microglia were detected by immunofluorescence microscopy, using Glial Fibrillary Acidic Protein (GFAP, green) and CD11b (red) as marker proteins. Cultures were pre-treated either in the presence or absence of minocycline (20 µM) for 5 days prior to T. gondii infection (upper panel). Without minocycline pre-treatment, glial culture contained significantly more CD11b positive microglia (lower panel). (B) mRNA levels of complement components ( Cfp , Cfb , Cfh , C4bp , C1qa , C3 , C3ar1 , and C5ar1 ) in glial cells with or without T. gondii infection in the presence or absence of anti- Toxoplasma drug pyrimethamine (2 µM). Means ± SEM. * p < 0.05, ** p < 0.01 *** p < 0.001 (Tukey’s test).

    Article Snippet: T. gondii PTG-GFP strain (type II) (ATCC 50941, ATCC, VA, USA) was amplified in Vero cells and tachyzoites were isolated for in vitro assays as described previously ( ).

    Techniques: Infection, Immunofluorescence, Microscopy, Marker

    Distribution of Toxoplasma gondii in the human cerebral organoids. (A) Schematic representation of the life cycle of T. gondii . (B) 3D images of a cerebral organoid infected with T. gondii (green). (C – F) Representative fluorescence images of cerebral organoids infected with 2 strains of T. gondii : ME49 (top) and RH (bottom) infected cerebral organoids are shown stained for (C) TUJ1, a neuronal marker; (D) GFAP, an astrocyte marker; (E) O1, an oligodendrocyte marker; and (F) SOX2, a radial glial cell marker. Scale bars, as indicated.

    Journal: Emerging Microbes & Infections

    Article Title: Modelling Toxoplasma gondii infection in human cerebral organoids

    doi: 10.1080/22221751.2020.1812435

    Figure Lengend Snippet: Distribution of Toxoplasma gondii in the human cerebral organoids. (A) Schematic representation of the life cycle of T. gondii . (B) 3D images of a cerebral organoid infected with T. gondii (green). (C – F) Representative fluorescence images of cerebral organoids infected with 2 strains of T. gondii : ME49 (top) and RH (bottom) infected cerebral organoids are shown stained for (C) TUJ1, a neuronal marker; (D) GFAP, an astrocyte marker; (E) O1, an oligodendrocyte marker; and (F) SOX2, a radial glial cell marker. Scale bars, as indicated.

    Article Snippet: Tachyzoites of the T. gondii PTG-GFP 5 S65 T, haplogroup 2, ME49 strain (50941, ATCC, Manassas, VA, USA) and those of the T. gondii RH-GFP strain were maintained in vitro using Vero cells (CCL-81, ATCC) cultured in DMEM (Gibco) supplemented with 10% FBS (Gibco) at 37°C in a humidified incubator with an atmosphere of 5% CO 2 .

    Techniques: Infection, Fluorescence, Staining, Marker

    . T. gondii cyst formation in human cerebral organoids. Representative fluorescence image of cyst-like structures in an organoid infected with (A) ME49 and (B) RH. Images of transmission electron microscopy of (C–D) ME49- and (E) RH-infected cerebral organoids. Scale as indicated with the bar. PVM, parasitophorous vacuole membrane; Nu, nucleus; Rh, rhoptry; Co, conoid; Mt, mitochondrion; Dg, dense granule; and Am, amylopectin.

    Journal: Emerging Microbes & Infections

    Article Title: Modelling Toxoplasma gondii infection in human cerebral organoids

    doi: 10.1080/22221751.2020.1812435

    Figure Lengend Snippet: . T. gondii cyst formation in human cerebral organoids. Representative fluorescence image of cyst-like structures in an organoid infected with (A) ME49 and (B) RH. Images of transmission electron microscopy of (C–D) ME49- and (E) RH-infected cerebral organoids. Scale as indicated with the bar. PVM, parasitophorous vacuole membrane; Nu, nucleus; Rh, rhoptry; Co, conoid; Mt, mitochondrion; Dg, dense granule; and Am, amylopectin.

    Article Snippet: Tachyzoites of the T. gondii PTG-GFP 5 S65 T, haplogroup 2, ME49 strain (50941, ATCC, Manassas, VA, USA) and those of the T. gondii RH-GFP strain were maintained in vitro using Vero cells (CCL-81, ATCC) cultured in DMEM (Gibco) supplemented with 10% FBS (Gibco) at 37°C in a humidified incubator with an atmosphere of 5% CO 2 .

    Techniques: Fluorescence, Infection, Transmission Assay, Electron Microscopy

    Virulence of T. gondii in the infected cerebral organoids . (A) Schematic representation of the experimental design: T. gondii isolated from infected cerebral organoids was injected into mice. The levels of T. gondii P30 protein were measured by ELISA ( n = 5, biologically independent mice) 2 months postinfection. (B) ME49 and (C) RH antibody titre presented as the optical density of ELISA . * p < 0.05. Quantitative data are expressed as the mean ± S.E.M. of at least 3 independent experiments.

    Journal: Emerging Microbes & Infections

    Article Title: Modelling Toxoplasma gondii infection in human cerebral organoids

    doi: 10.1080/22221751.2020.1812435

    Figure Lengend Snippet: Virulence of T. gondii in the infected cerebral organoids . (A) Schematic representation of the experimental design: T. gondii isolated from infected cerebral organoids was injected into mice. The levels of T. gondii P30 protein were measured by ELISA ( n = 5, biologically independent mice) 2 months postinfection. (B) ME49 and (C) RH antibody titre presented as the optical density of ELISA . * p < 0.05. Quantitative data are expressed as the mean ± S.E.M. of at least 3 independent experiments.

    Article Snippet: Tachyzoites of the T. gondii PTG-GFP 5 S65 T, haplogroup 2, ME49 strain (50941, ATCC, Manassas, VA, USA) and those of the T. gondii RH-GFP strain were maintained in vitro using Vero cells (CCL-81, ATCC) cultured in DMEM (Gibco) supplemented with 10% FBS (Gibco) at 37°C in a humidified incubator with an atmosphere of 5% CO 2 .

    Techniques: Infection, Isolation, Injection, Enzyme-linked Immunosorbent Assay

    Transcriptome analysis of ME49 post-infection. (A) Differentially expressed genes of ME49 post-infection. Noninfectious ME49 was used as a control (|fc| ≥ 2, raw p -value < 0.05). A heat map was generated using Cluster grammer ( http://amp.pharm.mssm.edu/clustergrammer/ ). (B) Volume plot showing differential expression of ME49 genes between 0 and 72 h post-infection (|fc| ≥ 2, raw p -value < 0.05). The top 5 gene names are indicated. (C) KEGG pathway analysis was performed using the differentially expressed genes (DEGs) of ME49 (|fc| ≥ 2, raw p -value < 0.05). (D) Gene Ontology (GO) annotation of T. gondii postinfection of cerebral organoids; p -value < 0.01. MF, molecular function; BP, biological process; and CC, cellular component.

    Journal: Emerging Microbes & Infections

    Article Title: Modelling Toxoplasma gondii infection in human cerebral organoids

    doi: 10.1080/22221751.2020.1812435

    Figure Lengend Snippet: Transcriptome analysis of ME49 post-infection. (A) Differentially expressed genes of ME49 post-infection. Noninfectious ME49 was used as a control (|fc| ≥ 2, raw p -value < 0.05). A heat map was generated using Cluster grammer ( http://amp.pharm.mssm.edu/clustergrammer/ ). (B) Volume plot showing differential expression of ME49 genes between 0 and 72 h post-infection (|fc| ≥ 2, raw p -value < 0.05). The top 5 gene names are indicated. (C) KEGG pathway analysis was performed using the differentially expressed genes (DEGs) of ME49 (|fc| ≥ 2, raw p -value < 0.05). (D) Gene Ontology (GO) annotation of T. gondii postinfection of cerebral organoids; p -value < 0.01. MF, molecular function; BP, biological process; and CC, cellular component.

    Article Snippet: Tachyzoites of the T. gondii PTG-GFP 5 S65 T, haplogroup 2, ME49 strain (50941, ATCC, Manassas, VA, USA) and those of the T. gondii RH-GFP strain were maintained in vitro using Vero cells (CCL-81, ATCC) cultured in DMEM (Gibco) supplemented with 10% FBS (Gibco) at 37°C in a humidified incubator with an atmosphere of 5% CO 2 .

    Techniques: Infection, Generated, Expressing

    . Transcriptome analysis of T. gondii -infected cerebral organoids. Heat map showing differentially expressed genes (DEGs) of (A) ME49- and (B) RH-infected cerebral organoids 72 h post-infection (|fc| ≥ 2, raw p -value < 0.05). Noninfected cerebral organoids were used as controls ( n = 3, biologically independent samples). A heat map was generated using Cluster grammer ( http://amp.pharm.mssm.edu/clustergrammer/ ). Gene Ontology analysis of DEGs in the (C) ME49- and (D) RH-infected organoids. Top five Gene Ontology terms ( p -value < 0.005). Volume plot showing the top five genes (marked as red dots) in the (E) ME49- and (F) RH-infected organoids. Significantly upregulated and downregulated genes (|fc| ≥ 2, raw p -value < 0.05) are marked in blue. Noninfected organoids were used as controls. (G) Transcriptome data were analyzed using ingenuity pathway analysis (IPA) software ( p -value < 0.05).

    Journal: Emerging Microbes & Infections

    Article Title: Modelling Toxoplasma gondii infection in human cerebral organoids

    doi: 10.1080/22221751.2020.1812435

    Figure Lengend Snippet: . Transcriptome analysis of T. gondii -infected cerebral organoids. Heat map showing differentially expressed genes (DEGs) of (A) ME49- and (B) RH-infected cerebral organoids 72 h post-infection (|fc| ≥ 2, raw p -value < 0.05). Noninfected cerebral organoids were used as controls ( n = 3, biologically independent samples). A heat map was generated using Cluster grammer ( http://amp.pharm.mssm.edu/clustergrammer/ ). Gene Ontology analysis of DEGs in the (C) ME49- and (D) RH-infected organoids. Top five Gene Ontology terms ( p -value < 0.005). Volume plot showing the top five genes (marked as red dots) in the (E) ME49- and (F) RH-infected organoids. Significantly upregulated and downregulated genes (|fc| ≥ 2, raw p -value < 0.05) are marked in blue. Noninfected organoids were used as controls. (G) Transcriptome data were analyzed using ingenuity pathway analysis (IPA) software ( p -value < 0.05).

    Article Snippet: Tachyzoites of the T. gondii PTG-GFP 5 S65 T, haplogroup 2, ME49 strain (50941, ATCC, Manassas, VA, USA) and those of the T. gondii RH-GFP strain were maintained in vitro using Vero cells (CCL-81, ATCC) cultured in DMEM (Gibco) supplemented with 10% FBS (Gibco) at 37°C in a humidified incubator with an atmosphere of 5% CO 2 .

    Techniques: Infection, Generated, Software