Structured Review

5 PRIME 5 prime portion
Schematic diagram of strand-specific library synthesis mechanism . mRNAs are fragmented by heat and magnesium (1) and primed for cDNA synthesis by an adapter-containing oligonucleotide (2,3) . Size selection and cleanup removes unincorperated oligonucleotides and small cDNA fragments (4) . Transient duplex breathing at the terminus of the RNA-cDNA hybrid (5) facilitates interaction with the single-stranded portion of the <t>5-prime</t> capturing adapter (6) and E. coli DNA Polymerase I catalyses its incorporation into a complete library molecule (7) .
5 Prime Portion, supplied by 5 PRIME, used in various techniques. Bioz Stars score: 88/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/5 prime portion/product/5 PRIME
Average 88 stars, based on 2 article reviews
Price from $9.99 to $1999.99
5 prime portion - by Bioz Stars, 2020-08
88/100 stars

Images

1) Product Images from "BrAD-seq: Breath Adapter Directional sequencing: a streamlined, ultra-simple and fast library preparation protocol for strand specific mRNA library construction"

Article Title: BrAD-seq: Breath Adapter Directional sequencing: a streamlined, ultra-simple and fast library preparation protocol for strand specific mRNA library construction

Journal: Frontiers in Plant Science

doi: 10.3389/fpls.2015.00366

Schematic diagram of strand-specific library synthesis mechanism . mRNAs are fragmented by heat and magnesium (1) and primed for cDNA synthesis by an adapter-containing oligonucleotide (2,3) . Size selection and cleanup removes unincorperated oligonucleotides and small cDNA fragments (4) . Transient duplex breathing at the terminus of the RNA-cDNA hybrid (5) facilitates interaction with the single-stranded portion of the 5-prime capturing adapter (6) and E. coli DNA Polymerase I catalyses its incorporation into a complete library molecule (7) .
Figure Legend Snippet: Schematic diagram of strand-specific library synthesis mechanism . mRNAs are fragmented by heat and magnesium (1) and primed for cDNA synthesis by an adapter-containing oligonucleotide (2,3) . Size selection and cleanup removes unincorperated oligonucleotides and small cDNA fragments (4) . Transient duplex breathing at the terminus of the RNA-cDNA hybrid (5) facilitates interaction with the single-stranded portion of the 5-prime capturing adapter (6) and E. coli DNA Polymerase I catalyses its incorporation into a complete library molecule (7) .

Techniques Used: Selection

2) Product Images from "Molecular epidemiology of Newcastle disease virus isolates from vaccinated commercial poultry farms in non-epidemic areas of Japan"

Article Title: Molecular epidemiology of Newcastle disease virus isolates from vaccinated commercial poultry farms in non-epidemic areas of Japan

Journal: Virology Journal

doi: 10.1186/1743-422X-10-330

Phylogenetic tree of the 5-prime end of L-gene sequences (5629–6333 nt). The evolutionary history was inferred using the Neighbor-Joining method. The bootstrap consensus tree inferred from 1000 replicates is taken to represent the evolutionary history of the taxa analyzed [ 40 ]. Branches corresponding to partitions reproduced in less than 50% bootstrap replicates are collapsed. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) are shown next to the branches. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the Maximum Composite Likelihood [ 41 ] method and are in the units of the number of base substitutions per site. All positions containing gaps and missing data were eliminated from the dataset (Complete deletion option). Strains used in this study are marked with •.
Figure Legend Snippet: Phylogenetic tree of the 5-prime end of L-gene sequences (5629–6333 nt). The evolutionary history was inferred using the Neighbor-Joining method. The bootstrap consensus tree inferred from 1000 replicates is taken to represent the evolutionary history of the taxa analyzed [ 40 ]. Branches corresponding to partitions reproduced in less than 50% bootstrap replicates are collapsed. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) are shown next to the branches. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the Maximum Composite Likelihood [ 41 ] method and are in the units of the number of base substitutions per site. All positions containing gaps and missing data were eliminated from the dataset (Complete deletion option). Strains used in this study are marked with •.

Techniques Used:

Related Articles

Multiplex Assay:

Article Title: Comparative Analysis of Salivary Bacterial Microbiome Diversity in Edentulous Infants and Their Mothers or Primary Care Givers Using Pyrosequencing
Article Snippet: .. Fusion primers contained: 1) a directional GS FLX Titanium ‘Primer A’ sequence ( CGTATCGCCTCCCTCGCGCCATCAG ; forward primers) or ‘Primer B’ sequence ( CTATGCGCCTTGCCAGCCCGCTCAG ; reverse primers) at the 5-prime portion of the oligonucleotide; 2) a Multiplex Identifier (MID) that was unique to each sample; and 3) a Eubacterial-specific sequence for the V4–V6 region of the 16S rDNA gene, at the 3-prime end. ..

Amplification:

Article Title: Detection of arbuscular mycorrhizal fungi associated with pecan (Caryaillinoinensis) trees by molecular and morphological approaches
Article Snippet: .. Amplicon Fusion Primers contain a directional 454 GS FLX Titanium Primer A or B sequence (in bold letters) which includes a four-base library ‘key’ sequence (underlined) at the 5-prime portion of the oligonucleotide, in addition to the template-specific sequence at the 3-primer end. .. A Multiplex Identifier (MID) sequence or ‘barcoding’ was added to the reverse primer (in brackets) between the B primer and the template-specific sequences in order to sequence multiple samples in a single run.

Ligation:

Article Title: BrAD-seq: Breath Adapter Directional sequencing: a streamlined, ultra-simple and fast library preparation protocol for strand specific mRNA library construction
Article Snippet: .. These include, the ligation of a known sequence to the 5-prime portion of mRNA molecules prior to cDNA synthesis (Lister et al., ), removal of the template RNA strand followed by randomly primed 2nd strand synthesis (Armour et al., ), labeling of first or second strand cDNA molecules with dUTP for enzymatic degradation prior to enrichment (Parkhomchuk et al., ) and the use of terminal transferases to add defined nucleotides to the cDNA molecules (Zhu et al., ; Tang et al., ), with each method having advantages and shortcomings (Levin et al., ). .. Our method for directional NGS library construction considerably simplifies and accelerates the library construction process.

Labeling:

Article Title: BrAD-seq: Breath Adapter Directional sequencing: a streamlined, ultra-simple and fast library preparation protocol for strand specific mRNA library construction
Article Snippet: .. These include, the ligation of a known sequence to the 5-prime portion of mRNA molecules prior to cDNA synthesis (Lister et al., ), removal of the template RNA strand followed by randomly primed 2nd strand synthesis (Armour et al., ), labeling of first or second strand cDNA molecules with dUTP for enzymatic degradation prior to enrichment (Parkhomchuk et al., ) and the use of terminal transferases to add defined nucleotides to the cDNA molecules (Zhu et al., ; Tang et al., ), with each method having advantages and shortcomings (Levin et al., ). .. Our method for directional NGS library construction considerably simplifies and accelerates the library construction process.

Mouse Assay:

Article Title: V-ATPases and osteoclasts: ambiguous future of V-ATPases inhibitors in osteoporosis
Article Snippet: .. For example, deletion of the 5-prime portion of the Tcirg1 gene (subunit a3) in mice caused hypocalcemia and osteopetrorickets phenotype combined with decreased bone formation . .. Atp6v0d2 -deficient mice had enhanced bone formation and osteopetrosis , , .

Article Title: V-ATPases and osteoclasts: ambiguous future of V-ATPases inhibitors in osteoporosis
Article Snippet: .. Deletion of the 5-prime portion of Tcirg1 gene in mice causes hypocalcemia and osteopetrorickets phenotype with high bone mass . .. Transgenic mice carrying a dominant missense mutation (R740S) in Tcirg1 gene also exhibit high bone density without affected osteoblast parameters .

Article Title: V-ATPases and osteoclasts: ambiguous future of V-ATPases inhibitors in osteoporosis
Article Snippet: .. Deletion of the 5-prime portion of Tcirg1 gene in mice causes hypocalcemia and osteopetrorickets phenotype with high bone mass . .. Transgenic mice carrying a dominant missense mutation (R740S) in Tcirg1 gene also exhibit high bone density without affected osteoblast parameters .

Article Title: V-ATPases and osteoclasts: ambiguous future of V-ATPases inhibitors in osteoporosis
Article Snippet: .. For example, deletion of the 5-prime portion of the Tcirg1 gene (subunit a3) in mice caused hypocalcemia and osteopetrorickets phenotype combined with decreased bone formation . .. Atp6v0d2 -deficient mice had enhanced bone formation and osteopetrosis , , .

Sequencing:

Article Title: BrAD-seq: Breath Adapter Directional sequencing: a streamlined, ultra-simple and fast library preparation protocol for strand specific mRNA library construction
Article Snippet: .. These include, the ligation of a known sequence to the 5-prime portion of mRNA molecules prior to cDNA synthesis (Lister et al., ), removal of the template RNA strand followed by randomly primed 2nd strand synthesis (Armour et al., ), labeling of first or second strand cDNA molecules with dUTP for enzymatic degradation prior to enrichment (Parkhomchuk et al., ) and the use of terminal transferases to add defined nucleotides to the cDNA molecules (Zhu et al., ; Tang et al., ), with each method having advantages and shortcomings (Levin et al., ). .. Our method for directional NGS library construction considerably simplifies and accelerates the library construction process.

Article Title: Detection of arbuscular mycorrhizal fungi associated with pecan (Caryaillinoinensis) trees by molecular and morphological approaches
Article Snippet: .. Amplicon Fusion Primers contain a directional 454 GS FLX Titanium Primer A or B sequence (in bold letters) which includes a four-base library ‘key’ sequence (underlined) at the 5-prime portion of the oligonucleotide, in addition to the template-specific sequence at the 3-primer end. .. A Multiplex Identifier (MID) sequence or ‘barcoding’ was added to the reverse primer (in brackets) between the B primer and the template-specific sequences in order to sequence multiple samples in a single run.

Article Title: Comparative Analysis of Salivary Bacterial Microbiome Diversity in Edentulous Infants and Their Mothers or Primary Care Givers Using Pyrosequencing
Article Snippet: .. Fusion primers contained: 1) a directional GS FLX Titanium ‘Primer A’ sequence ( CGTATCGCCTCCCTCGCGCCATCAG ; forward primers) or ‘Primer B’ sequence ( CTATGCGCCTTGCCAGCCCGCTCAG ; reverse primers) at the 5-prime portion of the oligonucleotide; 2) a Multiplex Identifier (MID) that was unique to each sample; and 3) a Eubacterial-specific sequence for the V4–V6 region of the 16S rDNA gene, at the 3-prime end. ..

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 88
    5 PRIME 5 prime portion
    Schematic diagram of strand-specific library synthesis mechanism . mRNAs are fragmented by heat and magnesium (1) and primed for cDNA synthesis by an adapter-containing oligonucleotide (2,3) . Size selection and cleanup removes unincorperated oligonucleotides and small cDNA fragments (4) . Transient duplex breathing at the terminus of the RNA-cDNA hybrid (5) facilitates interaction with the single-stranded portion of the <t>5-prime</t> capturing adapter (6) and E. coli DNA Polymerase I catalyses its incorporation into a complete library molecule (7) .
    5 Prime Portion, supplied by 5 PRIME, used in various techniques. Bioz Stars score: 88/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/5 prime portion/product/5 PRIME
    Average 88 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    5 prime portion - by Bioz Stars, 2020-08
    88/100 stars
      Buy from Supplier

    85
    5 PRIME 3 prime portion
    Phylogenetic tree of the <t>3-prime</t> end of NP-gene sequences (1–622 nt). The evolutionary history was inferred using the Neighbor-Joining method. The bootstrap consensus tree inferred from 1000 replicates is taken to represent the evolutionary history of the taxa analyzed [ 40 ]. Branches corresponding to partitions reproduced in less than 50% bootstrap replicates are collapsed. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) are shown next to the branches. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the Maximum Composite Likelihood [ 41 ] method and are in the units of the number of base substitutions per site. All positions containing gaps and missing data were eliminated from the dataset (Complete deletion option). Strains used in this study are marked with •.
    3 Prime Portion, supplied by 5 PRIME, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/3 prime portion/product/5 PRIME
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    3 prime portion - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    80
    5 PRIME fr3 region
    PCR analyses of somatic mutations in the mAb10 V H gene. A , ethidium bromide staining of DNA PCR amplified using the V H 4.18/V 2–1 FR1-CDR1 and HBL-3 <t>FR3</t> primers and genomic DNA extracted from autologous PMN (left lane) or the mAb10-producing B cell hybridoma (right lane). B , ethidium bromide staining of the DNA PCR amplified using the mAb10V H CDR1 and HBL-3 primers and genomic DNA extracted from autologous PMN (left lane) or the mAb10-producing B cell hybridoma (right lane).
    Fr3 Region, supplied by 5 PRIME, used in various techniques. Bioz Stars score: 80/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fr3 region/product/5 PRIME
    Average 80 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    fr3 region - by Bioz Stars, 2020-08
    80/100 stars
      Buy from Supplier

    Image Search Results


    Schematic diagram of strand-specific library synthesis mechanism . mRNAs are fragmented by heat and magnesium (1) and primed for cDNA synthesis by an adapter-containing oligonucleotide (2,3) . Size selection and cleanup removes unincorperated oligonucleotides and small cDNA fragments (4) . Transient duplex breathing at the terminus of the RNA-cDNA hybrid (5) facilitates interaction with the single-stranded portion of the 5-prime capturing adapter (6) and E. coli DNA Polymerase I catalyses its incorporation into a complete library molecule (7) .

    Journal: Frontiers in Plant Science

    Article Title: BrAD-seq: Breath Adapter Directional sequencing: a streamlined, ultra-simple and fast library preparation protocol for strand specific mRNA library construction

    doi: 10.3389/fpls.2015.00366

    Figure Lengend Snippet: Schematic diagram of strand-specific library synthesis mechanism . mRNAs are fragmented by heat and magnesium (1) and primed for cDNA synthesis by an adapter-containing oligonucleotide (2,3) . Size selection and cleanup removes unincorperated oligonucleotides and small cDNA fragments (4) . Transient duplex breathing at the terminus of the RNA-cDNA hybrid (5) facilitates interaction with the single-stranded portion of the 5-prime capturing adapter (6) and E. coli DNA Polymerase I catalyses its incorporation into a complete library molecule (7) .

    Article Snippet: These include, the ligation of a known sequence to the 5-prime portion of mRNA molecules prior to cDNA synthesis (Lister et al., ), removal of the template RNA strand followed by randomly primed 2nd strand synthesis (Armour et al., ), labeling of first or second strand cDNA molecules with dUTP for enzymatic degradation prior to enrichment (Parkhomchuk et al., ) and the use of terminal transferases to add defined nucleotides to the cDNA molecules (Zhu et al., ; Tang et al., ), with each method having advantages and shortcomings (Levin et al., ).

    Techniques: Selection

    Phylogenetic tree of the 5-prime end of L-gene sequences (5629–6333 nt). The evolutionary history was inferred using the Neighbor-Joining method. The bootstrap consensus tree inferred from 1000 replicates is taken to represent the evolutionary history of the taxa analyzed [ 40 ]. Branches corresponding to partitions reproduced in less than 50% bootstrap replicates are collapsed. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) are shown next to the branches. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the Maximum Composite Likelihood [ 41 ] method and are in the units of the number of base substitutions per site. All positions containing gaps and missing data were eliminated from the dataset (Complete deletion option). Strains used in this study are marked with •.

    Journal: Virology Journal

    Article Title: Molecular epidemiology of Newcastle disease virus isolates from vaccinated commercial poultry farms in non-epidemic areas of Japan

    doi: 10.1186/1743-422X-10-330

    Figure Lengend Snippet: Phylogenetic tree of the 5-prime end of L-gene sequences (5629–6333 nt). The evolutionary history was inferred using the Neighbor-Joining method. The bootstrap consensus tree inferred from 1000 replicates is taken to represent the evolutionary history of the taxa analyzed [ 40 ]. Branches corresponding to partitions reproduced in less than 50% bootstrap replicates are collapsed. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) are shown next to the branches. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the Maximum Composite Likelihood [ 41 ] method and are in the units of the number of base substitutions per site. All positions containing gaps and missing data were eliminated from the dataset (Complete deletion option). Strains used in this study are marked with •.

    Article Snippet: Phylogenetic analysis using the 3-prime portion of NP-gene and 5-prime portion of L-gene yielded the same tree topology and phylogenetic groupings (Figures and ).

    Techniques:

    Phylogenetic tree of the 3-prime end of NP-gene sequences (1–622 nt). The evolutionary history was inferred using the Neighbor-Joining method. The bootstrap consensus tree inferred from 1000 replicates is taken to represent the evolutionary history of the taxa analyzed [ 40 ]. Branches corresponding to partitions reproduced in less than 50% bootstrap replicates are collapsed. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) are shown next to the branches. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the Maximum Composite Likelihood [ 41 ] method and are in the units of the number of base substitutions per site. All positions containing gaps and missing data were eliminated from the dataset (Complete deletion option). Strains used in this study are marked with •.

    Journal: Virology Journal

    Article Title: Molecular epidemiology of Newcastle disease virus isolates from vaccinated commercial poultry farms in non-epidemic areas of Japan

    doi: 10.1186/1743-422X-10-330

    Figure Lengend Snippet: Phylogenetic tree of the 3-prime end of NP-gene sequences (1–622 nt). The evolutionary history was inferred using the Neighbor-Joining method. The bootstrap consensus tree inferred from 1000 replicates is taken to represent the evolutionary history of the taxa analyzed [ 40 ]. Branches corresponding to partitions reproduced in less than 50% bootstrap replicates are collapsed. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) are shown next to the branches. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the Maximum Composite Likelihood [ 41 ] method and are in the units of the number of base substitutions per site. All positions containing gaps and missing data were eliminated from the dataset (Complete deletion option). Strains used in this study are marked with •.

    Article Snippet: Phylogenetic analysis using the 3-prime portion of NP-gene and 5-prime portion of L-gene yielded the same tree topology and phylogenetic groupings (Figures and ).

    Techniques:

    PCR analyses of somatic mutations in the mAb10 V H gene. A , ethidium bromide staining of DNA PCR amplified using the V H 4.18/V 2–1 FR1-CDR1 and HBL-3 FR3 primers and genomic DNA extracted from autologous PMN (left lane) or the mAb10-producing B cell hybridoma (right lane). B , ethidium bromide staining of the DNA PCR amplified using the mAb10V H CDR1 and HBL-3 primers and genomic DNA extracted from autologous PMN (left lane) or the mAb10-producing B cell hybridoma (right lane).

    Journal: Journal of immunology (Baltimore, Md. : 1950)

    Article Title: Structural Analysis of the VH-D-JH Segments of Human Polyreactive IgG mAb

    doi:

    Figure Lengend Snippet: PCR analyses of somatic mutations in the mAb10 V H gene. A , ethidium bromide staining of DNA PCR amplified using the V H 4.18/V 2–1 FR1-CDR1 and HBL-3 FR3 primers and genomic DNA extracted from autologous PMN (left lane) or the mAb10-producing B cell hybridoma (right lane). B , ethidium bromide staining of the DNA PCR amplified using the mAb10V H CDR1 and HBL-3 primers and genomic DNA extracted from autologous PMN (left lane) or the mAb10-producing B cell hybridoma (right lane).

    Article Snippet: We also synthesized the antisense 12.3-3 primer, the sequence of which was identical with the reverse complement of a 5prime;-portion of the FR3 region of mAb 426.12-3F1.4 VH sequence, but differed in four nucleotides from the reverse complement of the corresponding VH 4.11 sequence.

    Techniques: Polymerase Chain Reaction, Staining, Amplification