5 dna adenylation kit  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Name:
    5’ DNA Adenylation Kit
    Description:
    5 DNA Adenylation Kit 50 rxns
    Catalog Number:
    e2610l
    Price:
    466
    Size:
    50 rxns
    Category:
    RNA Ligases
    Buy from Supplier


    Structured Review

    New England Biolabs 5 dna adenylation kit
    5’ DNA Adenylation Kit
    5 DNA Adenylation Kit 50 rxns
    https://www.bioz.com/result/5 dna adenylation kit/product/New England Biolabs
    Average 94 stars, based on 15 article reviews
    Price from $9.99 to $1999.99
    5 dna adenylation kit - by Bioz Stars, 2020-08
    94/100 stars

    Images

    1) Product Images from "Structure-function analysis of Methanobacterium thermoautotrophicum RNA ligase - engineering a thermostable ATP independent enzyme"

    Article Title: Structure-function analysis of Methanobacterium thermoautotrophicum RNA ligase - engineering a thermostable ATP independent enzyme

    Journal: BMC Molecular Biology

    doi: 10.1186/1471-2199-13-24

    Activity of the MthRnl and the K246A, K246Q and K97A mutants in different steps of the ligation reaction. (A) pH-dependence of self-adenylation activity of enzymes (step 1) in reactions with radioactive ATP. The reactions were carried out as described in the Methods and the products were resolved by an SDS-PAGE. Autoradiographs of the gels are shown. (B) pH-dependence of adenylation of 5’-phosphorylated, 3’-amino-blocked ssDNA (pDNA17-NH 2 ) (step 2) with wild type and the mutants of MthRnl under reaction conditions described in the Methods. The reaction products were separated by 15% urea-PAGE and visualized with SYBR Gold stain. (C) pH-dependence of deadenylation/hydrolysis of 5’ pre-adenylated DNA (AppDNA17-NH 2 ) with wild type and the mutants of MthRnl under reaction conditions described in the Methods. The products were analyzed on 15% urea-PAGE and stained with SYBR Gold. Enzymes used in each step of ligation reactions are indicated on the left. Position of DNA donor substrates and products are indicated on the right. The pH of the buffer is indicated at the bottom. The control (c) indicates the reaction without enzyme.
    Figure Legend Snippet: Activity of the MthRnl and the K246A, K246Q and K97A mutants in different steps of the ligation reaction. (A) pH-dependence of self-adenylation activity of enzymes (step 1) in reactions with radioactive ATP. The reactions were carried out as described in the Methods and the products were resolved by an SDS-PAGE. Autoradiographs of the gels are shown. (B) pH-dependence of adenylation of 5’-phosphorylated, 3’-amino-blocked ssDNA (pDNA17-NH 2 ) (step 2) with wild type and the mutants of MthRnl under reaction conditions described in the Methods. The reaction products were separated by 15% urea-PAGE and visualized with SYBR Gold stain. (C) pH-dependence of deadenylation/hydrolysis of 5’ pre-adenylated DNA (AppDNA17-NH 2 ) with wild type and the mutants of MthRnl under reaction conditions described in the Methods. The products were analyzed on 15% urea-PAGE and stained with SYBR Gold. Enzymes used in each step of ligation reactions are indicated on the left. Position of DNA donor substrates and products are indicated on the right. The pH of the buffer is indicated at the bottom. The control (c) indicates the reaction without enzyme.

    Techniques Used: Activity Assay, Ligation, SDS Page, Polyacrylamide Gel Electrophoresis, Staining

    Related Articles

    Isolation:

    Article Title: Cold adaptation of tRNA nucleotidyltransferases: A tradeoff in activity, stability and fidelity
    Article Snippet: .. A pre-adenylated 3′-blocked oligonucleotide (NEB #E2610) was ligated to the 3′-end of the isolated RNA using truncated T4-RNA-Ligase 2 (NEB #M0242) according to the supplier's instructions, and the reaction was stopped after 2 h by incubation at 65°C for 10 min. Ligation products were reverse transcribed using RevertAid (Thermo Scientific) as instructed, using 32 P-5’-labeled primer complementary to the adapter. cDNA was separated from RT-primers on a 10% denaturing PAA gel. .. The 3′-end of the isolated cDNA was ligated to a pre-adenylated 3′-blocked oligonucleotide using 5’-App-DNA/RNA-Ligase (NEB) at reaction conditions for ssDNA ligation according to the supplier (10 mM Bis-Tris-Propane-HCl, pH 7.5, 10 mM MgCl2 , 1 mM DTT and 5 mM MnCl2 ).

    Incubation:

    Article Title: Cold adaptation of tRNA nucleotidyltransferases: A tradeoff in activity, stability and fidelity
    Article Snippet: .. A pre-adenylated 3′-blocked oligonucleotide (NEB #E2610) was ligated to the 3′-end of the isolated RNA using truncated T4-RNA-Ligase 2 (NEB #M0242) according to the supplier's instructions, and the reaction was stopped after 2 h by incubation at 65°C for 10 min. Ligation products were reverse transcribed using RevertAid (Thermo Scientific) as instructed, using 32 P-5’-labeled primer complementary to the adapter. cDNA was separated from RT-primers on a 10% denaturing PAA gel. .. The 3′-end of the isolated cDNA was ligated to a pre-adenylated 3′-blocked oligonucleotide using 5’-App-DNA/RNA-Ligase (NEB) at reaction conditions for ssDNA ligation according to the supplier (10 mM Bis-Tris-Propane-HCl, pH 7.5, 10 mM MgCl2 , 1 mM DTT and 5 mM MnCl2 ).

    Purification:

    Article Title: Polyanions provide selective control of APC/C interactions with the activator subunit
    Article Snippet: .. A 3′ DNA adapter (CTATAGTGTCACCTAAATTAATACGACTCACTATAGGG) that contains 5′ phosphate and 3′ spacers was first 5′-adenylated using a 5′-adenylation kit (NEB #E2610-S) at 65 °C for 1 h, then ligated to purified RNA species using T4 RNA Ligase 2 Truncated (NEB #M0242S) at 25 °C for 1 h. The ligation reaction was separated on a 10% TBE-urea polyacrylamide gel, and ligated products were gel purified. .. Next, a 5′ RNA adapter (GCAATTAACCCTCACTAAAGGAGTCGT) lacking 5′ phosphate was ligated with T4 RNA Ligase 1 (NEB #M0204S).

    Article Title: hiCLIP reveals the in vivo atlas of mRNA secondary structures recognized by Staufen 1
    Article Snippet: .. They were pre-adenylated using 5′ DNA Adenylation Kit (NEB: E2610) and purified by PAGE with the following protocol. .. 200 μL of pre-adenylation mix (10 μl 100 μM non adenylated Adaptor A or B, 20 μl 10× 5′ DNA Adenylation Reaction Buffer, 20 μl 1mM ATP, 20 μl Mth RNA ligase, and 130 μl Water) was prepared and incubated at 65°C for 1 hour.

    Polyacrylamide Gel Electrophoresis:

    Article Title: hiCLIP reveals the in vivo atlas of mRNA secondary structures recognized by Staufen 1
    Article Snippet: .. They were pre-adenylated using 5′ DNA Adenylation Kit (NEB: E2610) and purified by PAGE with the following protocol. .. 200 μL of pre-adenylation mix (10 μl 100 μM non adenylated Adaptor A or B, 20 μl 10× 5′ DNA Adenylation Reaction Buffer, 20 μl 1mM ATP, 20 μl Mth RNA ligase, and 130 μl Water) was prepared and incubated at 65°C for 1 hour.

    Ligation:

    Article Title: Polyanions provide selective control of APC/C interactions with the activator subunit
    Article Snippet: .. A 3′ DNA adapter (CTATAGTGTCACCTAAATTAATACGACTCACTATAGGG) that contains 5′ phosphate and 3′ spacers was first 5′-adenylated using a 5′-adenylation kit (NEB #E2610-S) at 65 °C for 1 h, then ligated to purified RNA species using T4 RNA Ligase 2 Truncated (NEB #M0242S) at 25 °C for 1 h. The ligation reaction was separated on a 10% TBE-urea polyacrylamide gel, and ligated products were gel purified. .. Next, a 5′ RNA adapter (GCAATTAACCCTCACTAAAGGAGTCGT) lacking 5′ phosphate was ligated with T4 RNA Ligase 1 (NEB #M0204S).

    Article Title: Cold adaptation of tRNA nucleotidyltransferases: A tradeoff in activity, stability and fidelity
    Article Snippet: .. A pre-adenylated 3′-blocked oligonucleotide (NEB #E2610) was ligated to the 3′-end of the isolated RNA using truncated T4-RNA-Ligase 2 (NEB #M0242) according to the supplier's instructions, and the reaction was stopped after 2 h by incubation at 65°C for 10 min. Ligation products were reverse transcribed using RevertAid (Thermo Scientific) as instructed, using 32 P-5’-labeled primer complementary to the adapter. cDNA was separated from RT-primers on a 10% denaturing PAA gel. .. The 3′-end of the isolated cDNA was ligated to a pre-adenylated 3′-blocked oligonucleotide using 5’-App-DNA/RNA-Ligase (NEB) at reaction conditions for ssDNA ligation according to the supplier (10 mM Bis-Tris-Propane-HCl, pH 7.5, 10 mM MgCl2 , 1 mM DTT and 5 mM MnCl2 ).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    New England Biolabs 5 dna adenylation kit
    Activity of the MthRnl and the K246A, K246Q and K97A mutants in different steps of the ligation reaction. (A) pH-dependence of <t>self-adenylation</t> activity of enzymes (step 1) in reactions with radioactive ATP. The reactions were carried out as described in the Methods and the products were resolved by an SDS-PAGE. Autoradiographs of the gels are shown. (B) pH-dependence of adenylation of 5’-phosphorylated, 3’-amino-blocked ssDNA (pDNA17-NH 2 ) (step 2) with wild type and the mutants of MthRnl under reaction conditions described in the Methods. The reaction products were separated by 15% urea-PAGE and visualized with SYBR Gold stain. (C) pH-dependence of deadenylation/hydrolysis of 5’ pre-adenylated <t>DNA</t> (AppDNA17-NH 2 ) with wild type and the mutants of MthRnl under reaction conditions described in the Methods. The products were analyzed on 15% urea-PAGE and stained with SYBR Gold. Enzymes used in each step of ligation reactions are indicated on the left. Position of DNA donor substrates and products are indicated on the right. The pH of the buffer is indicated at the bottom. The control (c) indicates the reaction without enzyme.
    5 Dna Adenylation Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 15 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/5 dna adenylation kit/product/New England Biolabs
    Average 94 stars, based on 15 article reviews
    Price from $9.99 to $1999.99
    5 dna adenylation kit - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    Image Search Results


    Activity of the MthRnl and the K246A, K246Q and K97A mutants in different steps of the ligation reaction. (A) pH-dependence of self-adenylation activity of enzymes (step 1) in reactions with radioactive ATP. The reactions were carried out as described in the Methods and the products were resolved by an SDS-PAGE. Autoradiographs of the gels are shown. (B) pH-dependence of adenylation of 5’-phosphorylated, 3’-amino-blocked ssDNA (pDNA17-NH 2 ) (step 2) with wild type and the mutants of MthRnl under reaction conditions described in the Methods. The reaction products were separated by 15% urea-PAGE and visualized with SYBR Gold stain. (C) pH-dependence of deadenylation/hydrolysis of 5’ pre-adenylated DNA (AppDNA17-NH 2 ) with wild type and the mutants of MthRnl under reaction conditions described in the Methods. The products were analyzed on 15% urea-PAGE and stained with SYBR Gold. Enzymes used in each step of ligation reactions are indicated on the left. Position of DNA donor substrates and products are indicated on the right. The pH of the buffer is indicated at the bottom. The control (c) indicates the reaction without enzyme.

    Journal: BMC Molecular Biology

    Article Title: Structure-function analysis of Methanobacterium thermoautotrophicum RNA ligase - engineering a thermostable ATP independent enzyme

    doi: 10.1186/1471-2199-13-24

    Figure Lengend Snippet: Activity of the MthRnl and the K246A, K246Q and K97A mutants in different steps of the ligation reaction. (A) pH-dependence of self-adenylation activity of enzymes (step 1) in reactions with radioactive ATP. The reactions were carried out as described in the Methods and the products were resolved by an SDS-PAGE. Autoradiographs of the gels are shown. (B) pH-dependence of adenylation of 5’-phosphorylated, 3’-amino-blocked ssDNA (pDNA17-NH 2 ) (step 2) with wild type and the mutants of MthRnl under reaction conditions described in the Methods. The reaction products were separated by 15% urea-PAGE and visualized with SYBR Gold stain. (C) pH-dependence of deadenylation/hydrolysis of 5’ pre-adenylated DNA (AppDNA17-NH 2 ) with wild type and the mutants of MthRnl under reaction conditions described in the Methods. The products were analyzed on 15% urea-PAGE and stained with SYBR Gold. Enzymes used in each step of ligation reactions are indicated on the left. Position of DNA donor substrates and products are indicated on the right. The pH of the buffer is indicated at the bottom. The control (c) indicates the reaction without enzyme.

    Article Snippet: Preparative adenylation of DNA and RNA linkers (donor substrates) were performed using 5’-DNA Adenylation kit (NEB) [ ] Table .

    Techniques: Activity Assay, Ligation, SDS Page, Polyacrylamide Gel Electrophoresis, Staining