5 dna adenylation kit  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 91

    Structured Review

    New England Biolabs 5 dna adenylation kit
    5 Dna Adenylation Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 91/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/5 dna adenylation kit/product/New England Biolabs
    Average 91 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    5 dna adenylation kit - by Bioz Stars, 2020-01
    91/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: Increased Hematopoietic Extracellular RNAs and Vesicles in the Lung during Allergic Airway Responses
    Article Snippet: 3′ adapters were adenylated enzymatically using the 5′ DNA Adenylation Kit (New England Biolabs) for 80min at 65oC. .. The library was amplified by qPCR using Phusion High-Fidelity DNA Polymerase (New England Biolabs).

    Article Title: Polyadenylation and degradation of structurally abnormal mitochondrial tRNAs in human cells
    Article Snippet: Library preparation for targeted next-generation sequencing Illumina TruSeq truncated reverse primer 5′ Phos-NNAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC-Amino 3′ was first adenylated using a 5′ DNA Adenylation Kit (New England Biolabs). .. Amplification of the selected cDNAs was performed using a 2-step PCR approach.

    Article Title: Polyadenylation and degradation of structurally abnormal mitochondrial tRNAs in human cells
    Article Snippet: Illumina TruSeq truncated reverse primer 5′ Phos-NNAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC-Amino 3′ was first adenylated using a 5′ DNA Adenylation Kit (New England Biolabs). .. Amplification of the selected cDNAs was performed using a 2-step PCR approach.

    Synthesized:

    Article Title: Bias in Ligation-Based Small RNA Sequencing Library Construction Is Determined by Adaptor and RNA Structure
    Article Snippet: Custom RNA and DNA oligonucleotides were synthesized by Integrated DNA Technologies (IDT, Corralville, IA). .. DNA adaptors were adenylated using a 5’-DNA Adenylation Kit (New England Biolabs, NEB, Ipswich, MA) according to the instructions provided by the manufacturer.

    Article Title: Structural bias in T4 RNA ligase-mediated 3?-adapter ligation
    Article Snippet: Adenylation of DNA oligos The DNA adapters were synthesized by Integrated DNA Technologies (Iowa, USA) with a phosphorylated 5′-end and a blocking amino group at the 3′-end. .. The adapters were adenylated using a 5′-DNA Adenylation Kit (New England Biolabs) as described previously ( ).

    Autoradiography:

    Article Title: 3′READS+, a sensitive and accurate method for 3′ end sequencing of polyadenylated RNA
    Article Snippet: In protocol A, a 5′ adenylated 3′ adapter made by the 5′ DNA Adenylation Kit (NEB) was ligated to A30 using T4 RNA ligase II (truncated KQ version, NEB) with or without 15% polyethylene glycol (PEG) 8000 (NEB) at 22°C for 1 h. The reaction was then incubated in the same tube with a 5′ adapter, 1 mM ATP and T4 RNA ligase I at 22°C for 1 h. In protocol B, A30 was ligated to the 5′ adapter with T4 RNA ligase I (NEB) at 22°C for 1 h, in the presence of ATP. .. The RNAs in the reactions were then purified by phenol-chloroform extraction, precipitated in ethanol, and examined by gel electrophoresis and by autoradiography as described above.

    Blocking Assay:

    Article Title: Structural bias in T4 RNA ligase-mediated 3?-adapter ligation
    Article Snippet: Adenylation of DNA oligos The DNA adapters were synthesized by Integrated DNA Technologies (Iowa, USA) with a phosphorylated 5′-end and a blocking amino group at the 3′-end. .. The adapters were adenylated using a 5′-DNA Adenylation Kit (New England Biolabs) as described previously ( ).

    Real-time Polymerase Chain Reaction:

    Article Title: Increased Hematopoietic Extracellular RNAs and Vesicles in the Lung during Allergic Airway Responses
    Article Snippet: 3′ adapters were adenylated enzymatically using the 5′ DNA Adenylation Kit (New England Biolabs) for 80min at 65oC. .. The library was amplified by qPCR using Phusion High-Fidelity DNA Polymerase (New England Biolabs).

    IA:

    Article Title: Bias in Ligation-Based Small RNA Sequencing Library Construction Is Determined by Adaptor and RNA Structure
    Article Snippet: Custom RNA and DNA oligonucleotides were synthesized by Integrated DNA Technologies (IDT, Corralville, IA). .. DNA adaptors were adenylated using a 5’-DNA Adenylation Kit (New England Biolabs, NEB, Ipswich, MA) according to the instructions provided by the manufacturer.

    Incubation:

    Article Title: Structural bias in T4 RNA ligase-mediated 3?-adapter ligation
    Article Snippet: The adapters were adenylated using a 5′-DNA Adenylation Kit (New England Biolabs) as described previously ( ). .. The adenylation reactions were stopped by adding 1 µg of proteinase K (New England Biolabs) per µl of adenylation reaction and incubated at 37°C for 30 min. DNA was further purified by two extractions with phenol/chloroform/IAA followed by ethanol precipitation.

    Article Title: 3′READS+, a sensitive and accurate method for 3′ end sequencing of polyadenylated RNA
    Article Snippet: .. In protocol A, a 5′ adenylated 3′ adapter made by the 5′ DNA Adenylation Kit (NEB) was ligated to A30 using T4 RNA ligase II (truncated KQ version, NEB) with or without 15% polyethylene glycol (PEG) 8000 (NEB) at 22°C for 1 h. The reaction was then incubated in the same tube with a 5′ adapter, 1 mM ATP and T4 RNA ligase I at 22°C for 1 h. In protocol B, A30 was ligated to the 5′ adapter with T4 RNA ligase I (NEB) at 22°C for 1 h, in the presence of ATP. .. The RNA was then captured using oligo(dT)25 magnetic beads (NEB) and eluted with H2 O at 70°C for 2 min, followed by ligation to the 5′ adenylated 3′ adapter by the T4 RNA ligase I in the presence of 15% PEG 8000.

    Modification:

    Article Title: Increased Hematopoietic Extracellular RNAs and Vesicles in the Lung during Allergic Airway Responses
    Article Snippet: Five random nucleotides were also added to the 3′ end of the 5′ oligoribonculeotide adaptor with the resulting modified adaptor sequence: rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCrGrArCrGrArUrCrNrNrNrNrN (where “rN” are random nucleotides). .. 3′ adapters were adenylated enzymatically using the 5′ DNA Adenylation Kit (New England Biolabs) for 80min at 65oC.

    Ligation:

    Article Title: Increased Hematopoietic Extracellular RNAs and Vesicles in the Lung during Allergic Airway Responses
    Article Snippet: 3′ adapters were adenylated enzymatically using the 5′ DNA Adenylation Kit (New England Biolabs) for 80min at 65oC. .. A mix of calibrators 1, 2, 3, 4 and 7 were used at a final combined concentration of 0.025nM in the 3′ ligation reaction.

    Article Title: 3′READS+, a sensitive and accurate method for 3′ end sequencing of polyadenylated RNA
    Article Snippet: Paragraph title: Adapter ligation assays ... In protocol A, a 5′ adenylated 3′ adapter made by the 5′ DNA Adenylation Kit (NEB) was ligated to A30 using T4 RNA ligase II (truncated KQ version, NEB) with or without 15% polyethylene glycol (PEG) 8000 (NEB) at 22°C for 1 h. The reaction was then incubated in the same tube with a 5′ adapter, 1 mM ATP and T4 RNA ligase I at 22°C for 1 h. In protocol B, A30 was ligated to the 5′ adapter with T4 RNA ligase I (NEB) at 22°C for 1 h, in the presence of ATP.

    Article Title: Selective Export into Extracellular Vesicles and Function of tRNA Fragments during T Cell Activation
    Article Snippet: Briefly, to reduce ligation bias, 5 random nucleotides were added into the 3′ end of 5′-adaptor and the 5′end of 3′-adaptors during the oligo synthesis. .. Barcoded 3′-adaptors were adenylated by 5′DNA adenylation kit (NEB).

    Article Title: Efficient synthesis of stably adenylated DNA and RNA adapters for microRNA capture using T4 RNA ligase 1
    Article Snippet: .. Alternatively, adapter pre-adenylation was performed using the 5′ DNA Adenylation Kit (New England Biolabs, Ipswich, MA) according to the manufacturer protocol. microRNA-Adapter Ligation. microRNA was ligated to the pre-adenylated dA adapters using T4 RNA ligase 2 truncated K227Q (New England Biolabs, Ipswich, MA) according to the previously described protocol . .. Pancreatic total RNA was commercially purchased from Life Technologies.

    Generated:

    Article Title: Polyadenylation and degradation of structurally abnormal mitochondrial tRNAs in human cells
    Article Snippet: Library preparation for targeted next-generation sequencing Illumina TruSeq truncated reverse primer 5′ Phos-NNAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC-Amino 3′ was first adenylated using a 5′ DNA Adenylation Kit (New England Biolabs). .. The adenylated oligo (5 pmol) was ligated to total RNA (500 ng) using truncated T4 RNA Ligase 2 (200 U, New England Biolabs) in a 10 μl reaction. cDNA was generated using a primer complementary to the ligated reverse primer, with Superscipt II RNA reverse transcriptase (400 U, ThermoFisher Scientific) in a 22 μl reaction.

    Article Title: Polyadenylation and degradation of structurally abnormal mitochondrial tRNAs in human cells
    Article Snippet: Illumina TruSeq truncated reverse primer 5′ Phos-NNAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC-Amino 3′ was first adenylated using a 5′ DNA Adenylation Kit (New England Biolabs). .. The adenylated oligo (5 pmol) was ligated to total RNA (500 ng) using truncated T4 RNA Ligase 2 (200 U, New England Biolabs) in a 10 μl reaction. cDNA was generated using a primer complementary to the ligated reverse primer, with Superscipt II RNA reverse transcriptase (400 U, ThermoFisher Scientific) in a 22 μl reaction.

    Sequencing:

    Article Title: Bias in Ligation-Based Small RNA Sequencing Library Construction Is Determined by Adaptor and RNA Structure
    Article Snippet: Paragraph title: Oligonucleotides, library preparation and sequencing ... DNA adaptors were adenylated using a 5’-DNA Adenylation Kit (New England Biolabs, NEB, Ipswich, MA) according to the instructions provided by the manufacturer.

    Article Title: Increased Hematopoietic Extracellular RNAs and Vesicles in the Lung during Allergic Airway Responses
    Article Snippet: Five random nucleotides were also added to the 3′ end of the 5′ oligoribonculeotide adaptor with the resulting modified adaptor sequence: rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCrGrArCrGrArUrCrNrNrNrNrN (where “rN” are random nucleotides). .. 3′ adapters were adenylated enzymatically using the 5′ DNA Adenylation Kit (New England Biolabs) for 80min at 65oC.

    Article Title: Polyadenylation and degradation of structurally abnormal mitochondrial tRNAs in human cells
    Article Snippet: Library preparation for targeted next-generation sequencing Illumina TruSeq truncated reverse primer 5′ Phos-NNAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC-Amino 3′ was first adenylated using a 5′ DNA Adenylation Kit (New England Biolabs). .. Primers were designed for human mitochondrial tRNAs (GenBank entry NC_012920) and the truncated Illumina TruSeq forward adapter sequence 5′ ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3′ was added to the 5′ end of each of the specific primers (see ).

    Article Title: Crimean-Congo Hemorrhagic Fever Virus Nucleocapsid Protein Augments mRNA Translation
    Article Snippet: A single-strand DNA linker then was polyadenylated and phosphorylated at the 5′ terminus using a 5′ DNA adenylation kit (NEB) and ligated to the 3′ end of the extracted RNA using T4 RNA ligase 2, truncated (NEB). .. The linked RNA was converted to cDNA using an anchoring primer complementary to the DNA linker sequence.

    Article Title: Polyadenylation and degradation of structurally abnormal mitochondrial tRNAs in human cells
    Article Snippet: Illumina TruSeq truncated reverse primer 5′ Phos-NNAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC-Amino 3′ was first adenylated using a 5′ DNA Adenylation Kit (New England Biolabs). .. Primers were designed for human mitochondrial tRNAs (GenBank entry ) and the truncated Illumina TruSeq forward adapter sequence 5′ ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3′ was added to the 5′ end of each of the specific primers (see ).

    Nucleic Acid Electrophoresis:

    Article Title: 3′READS+, a sensitive and accurate method for 3′ end sequencing of polyadenylated RNA
    Article Snippet: In protocol A, a 5′ adenylated 3′ adapter made by the 5′ DNA Adenylation Kit (NEB) was ligated to A30 using T4 RNA ligase II (truncated KQ version, NEB) with or without 15% polyethylene glycol (PEG) 8000 (NEB) at 22°C for 1 h. The reaction was then incubated in the same tube with a 5′ adapter, 1 mM ATP and T4 RNA ligase I at 22°C for 1 h. In protocol B, A30 was ligated to the 5′ adapter with T4 RNA ligase I (NEB) at 22°C for 1 h, in the presence of ATP. .. The RNAs in the reactions were then purified by phenol-chloroform extraction, precipitated in ethanol, and examined by gel electrophoresis and by autoradiography as described above.

    RNA Sequencing Assay:

    Article Title: Increased Hematopoietic Extracellular RNAs and Vesicles in the Lung during Allergic Airway Responses
    Article Snippet: Paragraph title: Small RNA sequencing and data analysis ... 3′ adapters were adenylated enzymatically using the 5′ DNA Adenylation Kit (New England Biolabs) for 80min at 65oC.

    Magnetic Beads:

    Article Title: 3′READS+, a sensitive and accurate method for 3′ end sequencing of polyadenylated RNA
    Article Snippet: In protocol A, a 5′ adenylated 3′ adapter made by the 5′ DNA Adenylation Kit (NEB) was ligated to A30 using T4 RNA ligase II (truncated KQ version, NEB) with or without 15% polyethylene glycol (PEG) 8000 (NEB) at 22°C for 1 h. The reaction was then incubated in the same tube with a 5′ adapter, 1 mM ATP and T4 RNA ligase I at 22°C for 1 h. In protocol B, A30 was ligated to the 5′ adapter with T4 RNA ligase I (NEB) at 22°C for 1 h, in the presence of ATP. .. The RNA was then captured using oligo(dT)25 magnetic beads (NEB) and eluted with H2 O at 70°C for 2 min, followed by ligation to the 5′ adenylated 3′ adapter by the T4 RNA ligase I in the presence of 15% PEG 8000.

    Isolation:

    Article Title: Bias in Ligation-Based Small RNA Sequencing Library Construction Is Determined by Adaptor and RNA Structure
    Article Snippet: DNA adaptors were adenylated using a 5’-DNA Adenylation Kit (New England Biolabs, NEB, Ipswich, MA) according to the instructions provided by the manufacturer. .. Bands corresponding to adenylated products were isolated, crushed and soaked in 10 mM Tris-HCl pH 8.0 overnight at room temperature with constant rotation.

    Article Title: Structural bias in T4 RNA ligase-mediated 3?-adapter ligation
    Article Snippet: The adapters were adenylated using a 5′-DNA Adenylation Kit (New England Biolabs) as described previously ( ). .. Bands corresponding to adenylated oligos were isolated, crushed and soaked in 1 ml water overnight at room temperature with constant rotation.

    Purification:

    Article Title: Structural bias in T4 RNA ligase-mediated 3?-adapter ligation
    Article Snippet: The adapters were adenylated using a 5′-DNA Adenylation Kit (New England Biolabs) as described previously ( ). .. The adenylation reactions were stopped by adding 1 µg of proteinase K (New England Biolabs) per µl of adenylation reaction and incubated at 37°C for 30 min. DNA was further purified by two extractions with phenol/chloroform/IAA followed by ethanol precipitation.

    Article Title: 3′READS+, a sensitive and accurate method for 3′ end sequencing of polyadenylated RNA
    Article Snippet: In protocol A, a 5′ adenylated 3′ adapter made by the 5′ DNA Adenylation Kit (NEB) was ligated to A30 using T4 RNA ligase II (truncated KQ version, NEB) with or without 15% polyethylene glycol (PEG) 8000 (NEB) at 22°C for 1 h. The reaction was then incubated in the same tube with a 5′ adapter, 1 mM ATP and T4 RNA ligase I at 22°C for 1 h. In protocol B, A30 was ligated to the 5′ adapter with T4 RNA ligase I (NEB) at 22°C for 1 h, in the presence of ATP. .. The RNAs in the reactions were then purified by phenol-chloroform extraction, precipitated in ethanol, and examined by gel electrophoresis and by autoradiography as described above.

    Polymerase Chain Reaction:

    Article Title: Polyadenylation and degradation of structurally abnormal mitochondrial tRNAs in human cells
    Article Snippet: Library preparation for targeted next-generation sequencing Illumina TruSeq truncated reverse primer 5′ Phos-NNAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC-Amino 3′ was first adenylated using a 5′ DNA Adenylation Kit (New England Biolabs). .. Amplification of the selected cDNAs was performed using a 2-step PCR approach.

    Article Title: Crimean-Congo Hemorrhagic Fever Virus Nucleocapsid Protein Augments mRNA Translation
    Article Snippet: A single-strand DNA linker then was polyadenylated and phosphorylated at the 5′ terminus using a 5′ DNA adenylation kit (NEB) and ligated to the 3′ end of the extracted RNA using T4 RNA ligase 2, truncated (NEB). .. The cDNA then was used to generate a PCR product with the forward primer complementary to the CCHF sequence and the anchoring primer as the reverse primer.

    Article Title: Polyadenylation and degradation of structurally abnormal mitochondrial tRNAs in human cells
    Article Snippet: Illumina TruSeq truncated reverse primer 5′ Phos-NNAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC-Amino 3′ was first adenylated using a 5′ DNA Adenylation Kit (New England Biolabs). .. Amplification of the selected cDNAs was performed using a 2-step PCR approach.

    cDNA Library Assay:

    Article Title: Selective Export into Extracellular Vesicles and Function of tRNA Fragments during T Cell Activation
    Article Snippet: Paragraph title: Small RNA cDNA library preparation ... Barcoded 3′-adaptors were adenylated by 5′DNA adenylation kit (NEB).

    Oligo Synthesis:

    Article Title: Selective Export into Extracellular Vesicles and Function of tRNA Fragments during T Cell Activation
    Article Snippet: Briefly, to reduce ligation bias, 5 random nucleotides were added into the 3′ end of 5′-adaptor and the 5′end of 3′-adaptors during the oligo synthesis. .. Barcoded 3′-adaptors were adenylated by 5′DNA adenylation kit (NEB).

    In Vitro:

    Article Title: 3′READS+, a sensitive and accurate method for 3′ end sequencing of polyadenylated RNA
    Article Snippet: In vitro transcribed radioactive A30 was captured using oligo(dT)25 beads, dephosphorylated with calf intestinal alkaline phosphatase (NEB) at 37°C for 45 min, and then phosphorylated with T4 polynucleotide kinase (NEB) at 37°C for 45 min (on a rotator). .. In protocol A, a 5′ adenylated 3′ adapter made by the 5′ DNA Adenylation Kit (NEB) was ligated to A30 using T4 RNA ligase II (truncated KQ version, NEB) with or without 15% polyethylene glycol (PEG) 8000 (NEB) at 22°C for 1 h. The reaction was then incubated in the same tube with a 5′ adapter, 1 mM ATP and T4 RNA ligase I at 22°C for 1 h. In protocol B, A30 was ligated to the 5′ adapter with T4 RNA ligase I (NEB) at 22°C for 1 h, in the presence of ATP.

    Ethanol Precipitation:

    Article Title: The use of duplex-specific nuclease in ribosome profiling and a user-friendly software package for Ribo-seq data analysis
    Article Snippet: The RNA was concentrated by ethanol precipitation, resuspended in 10 mM Tris–HCl pH 7.5 and ligated in a 20 µL reaction overnight at 14°C to a preadenylated 3′-adaptor (5′-rATGGAATTCTCGGGTGCCAAGG-3′) using T4 RNA Ligase 2 truncated K227Q (New England BioLabs). .. This 3′ adaptor was adenylated using a 5′ DNA adenylation kit (New England BioLabs) following the manufacturer's instructions.

    Article Title: Structural bias in T4 RNA ligase-mediated 3?-adapter ligation
    Article Snippet: The adapters were adenylated using a 5′-DNA Adenylation Kit (New England Biolabs) as described previously ( ). .. The adenylation reactions were stopped by adding 1 µg of proteinase K (New England Biolabs) per µl of adenylation reaction and incubated at 37°C for 30 min. DNA was further purified by two extractions with phenol/chloroform/IAA followed by ethanol precipitation.

    Next-Generation Sequencing:

    Article Title: Bias in Ligation-Based Small RNA Sequencing Library Construction Is Determined by Adaptor and RNA Structure
    Article Snippet: DNA adaptors were adenylated using a 5’-DNA Adenylation Kit (New England Biolabs, NEB, Ipswich, MA) according to the instructions provided by the manufacturer. .. Library preparation for high throughput sequencing was carried out using protocols and reagents found in the NEBNext Small RNA Library Prep Set for Illumina (NEB).

    Article Title: Polyadenylation and degradation of structurally abnormal mitochondrial tRNAs in human cells
    Article Snippet: .. Library preparation for targeted next-generation sequencing Illumina TruSeq truncated reverse primer 5′ Phos-NNAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC-Amino 3′ was first adenylated using a 5′ DNA Adenylation Kit (New England Biolabs). .. The adenylated oligo (5 pmol) was ligated to total RNA (500 ng) using truncated T4 RNA Ligase 2 (200 U, New England Biolabs) in a 10 μl reaction. cDNA was generated using a primer complementary to the ligated reverse primer, with Superscipt II RNA reverse transcriptase (400 U, ThermoFisher Scientific) in a 22 μl reaction.

    Article Title: Polyadenylation and degradation of structurally abnormal mitochondrial tRNAs in human cells
    Article Snippet: Paragraph title: Library preparation for targeted next-generation sequencing ... Illumina TruSeq truncated reverse primer 5′ Phos-NNAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC-Amino 3′ was first adenylated using a 5′ DNA Adenylation Kit (New England Biolabs).

    Concentration Assay:

    Article Title: Increased Hematopoietic Extracellular RNAs and Vesicles in the Lung during Allergic Airway Responses
    Article Snippet: 3′ adapters were adenylated enzymatically using the 5′ DNA Adenylation Kit (New England Biolabs) for 80min at 65oC. .. A mix of calibrators 1, 2, 3, 4 and 7 were used at a final combined concentration of 0.025nM in the 3′ ligation reaction.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 91
    New England Biolabs 5 dna adenylation kit
    Activity of the MthRnl and the K246A, K246Q and K97A mutants in different steps of the ligation reaction. (A) pH-dependence of <t>self-adenylation</t> activity of enzymes (step 1) in reactions with radioactive ATP. The reactions were carried out as described in the Methods and the products were resolved by an SDS-PAGE. Autoradiographs of the gels are shown. (B) pH-dependence of adenylation of 5’-phosphorylated, 3’-amino-blocked ssDNA (pDNA17-NH 2 ) (step 2) with wild type and the mutants of MthRnl under reaction conditions described in the Methods. The reaction products were separated by 15% urea-PAGE and visualized with SYBR Gold stain. (C) pH-dependence of deadenylation/hydrolysis of 5’ pre-adenylated <t>DNA</t> (AppDNA17-NH 2 ) with wild type and the mutants of MthRnl under reaction conditions described in the Methods. The products were analyzed on 15% urea-PAGE and stained with SYBR Gold. Enzymes used in each step of ligation reactions are indicated on the left. Position of DNA donor substrates and products are indicated on the right. The pH of the buffer is indicated at the bottom. The control (c) indicates the reaction without enzyme.
    5 Dna Adenylation Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 91/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/5 dna adenylation kit/product/New England Biolabs
    Average 91 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    5 dna adenylation kit - by Bioz Stars, 2020-01
    91/100 stars
      Buy from Supplier

    Image Search Results


    Activity of the MthRnl and the K246A, K246Q and K97A mutants in different steps of the ligation reaction. (A) pH-dependence of self-adenylation activity of enzymes (step 1) in reactions with radioactive ATP. The reactions were carried out as described in the Methods and the products were resolved by an SDS-PAGE. Autoradiographs of the gels are shown. (B) pH-dependence of adenylation of 5’-phosphorylated, 3’-amino-blocked ssDNA (pDNA17-NH 2 ) (step 2) with wild type and the mutants of MthRnl under reaction conditions described in the Methods. The reaction products were separated by 15% urea-PAGE and visualized with SYBR Gold stain. (C) pH-dependence of deadenylation/hydrolysis of 5’ pre-adenylated DNA (AppDNA17-NH 2 ) with wild type and the mutants of MthRnl under reaction conditions described in the Methods. The products were analyzed on 15% urea-PAGE and stained with SYBR Gold. Enzymes used in each step of ligation reactions are indicated on the left. Position of DNA donor substrates and products are indicated on the right. The pH of the buffer is indicated at the bottom. The control (c) indicates the reaction without enzyme.

    Journal: BMC Molecular Biology

    Article Title: Structure-function analysis of Methanobacterium thermoautotrophicum RNA ligase - engineering a thermostable ATP independent enzyme

    doi: 10.1186/1471-2199-13-24

    Figure Lengend Snippet: Activity of the MthRnl and the K246A, K246Q and K97A mutants in different steps of the ligation reaction. (A) pH-dependence of self-adenylation activity of enzymes (step 1) in reactions with radioactive ATP. The reactions were carried out as described in the Methods and the products were resolved by an SDS-PAGE. Autoradiographs of the gels are shown. (B) pH-dependence of adenylation of 5’-phosphorylated, 3’-amino-blocked ssDNA (pDNA17-NH 2 ) (step 2) with wild type and the mutants of MthRnl under reaction conditions described in the Methods. The reaction products were separated by 15% urea-PAGE and visualized with SYBR Gold stain. (C) pH-dependence of deadenylation/hydrolysis of 5’ pre-adenylated DNA (AppDNA17-NH 2 ) with wild type and the mutants of MthRnl under reaction conditions described in the Methods. The products were analyzed on 15% urea-PAGE and stained with SYBR Gold. Enzymes used in each step of ligation reactions are indicated on the left. Position of DNA donor substrates and products are indicated on the right. The pH of the buffer is indicated at the bottom. The control (c) indicates the reaction without enzyme.

    Article Snippet: Preparative adenylation of DNA and RNA linkers (donor substrates) were performed using 5’-DNA Adenylation kit (NEB) [ ] Table .

    Techniques: Activity Assay, Ligation, SDS Page, Polyacrylamide Gel Electrophoresis, Staining