gactaccagggtatctaatcc succinivibrio  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    ATCC gactaccagggtatctaatcc succinivibrio
    Gactaccagggtatctaatcc Succinivibrio, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gactaccagggtatctaatcc succinivibrio/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    gactaccagggtatctaatcc succinivibrio - by Bioz Stars, 2024-02
    86/100 stars

    Images

    gactaccagggtatctaatcc succinivibrio  (ATCC)


    Bioz Verified Symbol ATCC is a verified supplier
    Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    ATCC gactaccagggtatctaatcc succinivibrio
    Primers used for detection of particular functional bacterial phylotypes in the present study a
    Gactaccagggtatctaatcc Succinivibrio, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gactaccagggtatctaatcc succinivibrio/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    gactaccagggtatctaatcc succinivibrio - by Bioz Stars, 2024-02
    86/100 stars

    Images

    1) Product Images from "Impact of Feed Efficiency and Diet on Adaptive Variations in the Bacterial Community in the Rumen Fluid of Cattle"

    Article Title: Impact of Feed Efficiency and Diet on Adaptive Variations in the Bacterial Community in the Rumen Fluid of Cattle

    Journal: Applied and Environmental Microbiology

    doi: 10.1128/AEM.05114-11

    Primers used for detection of particular functional bacterial phylotypes in the present study a
    Figure Legend Snippet: Primers used for detection of particular functional bacterial phylotypes in the present study a

    Techniques Used: Functional Assay, Sequencing, Amplification

    Differences in particular bacterial species between LE and HE diets by RFI group ( n = 19)
    Figure Legend Snippet: Differences in particular bacterial species between LE and HE diets by RFI group ( n = 19)

    Techniques Used:

    Differences in particular bacterial species populations between L- and H-RFI groups on LE and HE diets ( n = 19)
    Figure Legend Snippet: Differences in particular bacterial species populations between L- and H-RFI groups on LE and HE diets ( n = 19)

    Techniques Used:

    Taxonomical identification of RFI-associated PCR-DGGE bands for particular diets ( n = 19)
    Figure Legend Snippet: Taxonomical identification of RFI-associated PCR-DGGE bands for particular diets ( n = 19)

    Techniques Used:

    Taxonomical identification of diet-associated PCR-DGGE bands within particular RFI groups ( n = 19)
    Figure Legend Snippet: Taxonomical identification of diet-associated PCR-DGGE bands within particular RFI groups ( n = 19)

    Techniques Used: Sequencing

    gactaccagggtatctaatcc succinivibrio  (ATCC)


    Bioz Verified Symbol ATCC is a verified supplier
    Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    ATCC gactaccagggtatctaatcc succinivibrio
    Primers used for detection of particular functional bacterial phylotypes in the present study a
    Gactaccagggtatctaatcc Succinivibrio, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gactaccagggtatctaatcc succinivibrio/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    gactaccagggtatctaatcc succinivibrio - by Bioz Stars, 2024-02
    86/100 stars

    Images

    1) Product Images from "Impact of Feed Efficiency and Diet on Adaptive Variations in the Bacterial Community in the Rumen Fluid of Cattle"

    Article Title: Impact of Feed Efficiency and Diet on Adaptive Variations in the Bacterial Community in the Rumen Fluid of Cattle

    Journal: Applied and Environmental Microbiology

    doi: 10.1128/AEM.05114-11

    Primers used for detection of particular functional bacterial phylotypes in the present study a
    Figure Legend Snippet: Primers used for detection of particular functional bacterial phylotypes in the present study a

    Techniques Used: Functional Assay, Sequencing, Amplification

    Differences in particular bacterial species between LE and HE diets by RFI group ( n = 19)
    Figure Legend Snippet: Differences in particular bacterial species between LE and HE diets by RFI group ( n = 19)

    Techniques Used:

    Differences in particular bacterial species populations between L- and H-RFI groups on LE and HE diets ( n = 19)
    Figure Legend Snippet: Differences in particular bacterial species populations between L- and H-RFI groups on LE and HE diets ( n = 19)

    Techniques Used:

    Taxonomical identification of RFI-associated PCR-DGGE bands for particular diets ( n = 19)
    Figure Legend Snippet: Taxonomical identification of RFI-associated PCR-DGGE bands for particular diets ( n = 19)

    Techniques Used:

    Taxonomical identification of diet-associated PCR-DGGE bands within particular RFI groups ( n = 19)
    Figure Legend Snippet: Taxonomical identification of diet-associated PCR-DGGE bands within particular RFI groups ( n = 19)

    Techniques Used: Sequencing