Review





Similar Products

90
NCIMB Ltd ncimb no. 43630
Ncimb No. 43630, supplied by NCIMB Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ncimb no. 43630/product/NCIMB Ltd
Average 90 stars, based on 1 article reviews
ncimb no. 43630 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology bcl xl shrna lentiviral particles
Bcl-xL depletion alters ATP/ADP ratio in primary hippocampal neurons. Primary rat hippocampal neurons were transduced with control <t>shRNA</t> or Bcl-xL shRNA. Immunoblotting ( A ) was performed to show depletion of the Bcl-xL protein levels in Bcl-xL shRNA transduced neurons ( n = 4, * p = 0.0286, Mann–Whitney test). ATP/ADP ratio ( B , C ) was measured using the GW1-PercevalHR sensor (F 488nm /F 405nm ). Bcl-xL depleted neurons showed lower ATP/ADP ratios in both the soma ( n = 20) and neurites ( n = 20). * p < 0.05, and *** p < 0.001, two-tailed Student’s t -test. Scale bar = 50 μm. Pseudocolour ratiometric micrographs ( D ) of neurons indicating the ATP/ADP ratio using the PercevalHR sensor. Red, higher ATP/ADP; Blue, lower ATP/ADP. Primary hippocampal neurons lacking Bcl-xL showed a significantly decreased TMRM signal ( E – G ), indicating a loss of mitochondrial inner membrane potential (Δψ) ( n = 12). ** p < 0.01, and **** p < 0.0001, two-tailed Student’s t -test. Scale bar = 20 μm.
Bcl Xl Shrna Lentiviral Particles, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/bcl xl shrna lentiviral particles/product/Santa Cruz Biotechnology
Average 93 stars, based on 1 article reviews
bcl xl shrna lentiviral particles - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology bcl xl
Bcl-xL depletion alters ATP/ADP ratio in primary hippocampal neurons. Primary rat hippocampal neurons were transduced with control <t>shRNA</t> or Bcl-xL shRNA. Immunoblotting ( A ) was performed to show depletion of the Bcl-xL protein levels in Bcl-xL shRNA transduced neurons ( n = 4, * p = 0.0286, Mann–Whitney test). ATP/ADP ratio ( B , C ) was measured using the GW1-PercevalHR sensor (F 488nm /F 405nm ). Bcl-xL depleted neurons showed lower ATP/ADP ratios in both the soma ( n = 20) and neurites ( n = 20). * p < 0.05, and *** p < 0.001, two-tailed Student’s t -test. Scale bar = 50 μm. Pseudocolour ratiometric micrographs ( D ) of neurons indicating the ATP/ADP ratio using the PercevalHR sensor. Red, higher ATP/ADP; Blue, lower ATP/ADP. Primary hippocampal neurons lacking Bcl-xL showed a significantly decreased TMRM signal ( E – G ), indicating a loss of mitochondrial inner membrane potential (Δψ) ( n = 12). ** p < 0.01, and **** p < 0.0001, two-tailed Student’s t -test. Scale bar = 20 μm.
Bcl Xl, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/bcl xl/product/Santa Cruz Biotechnology
Average 93 stars, based on 1 article reviews
bcl xl - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology bcl xl sirna h
BCL-xL antagonism potentiates regorafenib activity on liver cancer cells. ( A , B ) Hep3B and HepG2 cells were treated for 16 h with the BCL-xL inhibitor A-1331852 and regorafenib at different concentrations, and cell viability was quantified by MTT. ( C , D ) Hep3B and HepG2 cells were treated for 16 h with the BCL-2 inhibitor ABT-199 and regorafenib at different concentrations, and cell viability was quantified by MTT. ( E ) Hep3B cells were transfected with <t>siRNA</t> control or against BCL-xL and BCL-2 and after 48 h treated with regorafenib at different concentrations, and cell viability was quantified by MTT. ( F ) RNA interference was confirmed and protein levels of BCL-xL, BCL-2, and β-actin are shown in parallel panels. (n = 3) * p < 0.05 vs. control or siCTRL cells.
Bcl Xl Sirna H, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/bcl xl sirna h/product/Santa Cruz Biotechnology
Average 93 stars, based on 1 article reviews
bcl xl sirna h - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology orα bcl xl
BCL-xL antagonism potentiates regorafenib activity on liver cancer cells. ( A , B ) Hep3B and HepG2 cells were treated for 16 h with the BCL-xL inhibitor A-1331852 and regorafenib at different concentrations, and cell viability was quantified by MTT. ( C , D ) Hep3B and HepG2 cells were treated for 16 h with the BCL-2 inhibitor ABT-199 and regorafenib at different concentrations, and cell viability was quantified by MTT. ( E ) Hep3B cells were transfected with <t>siRNA</t> control or against BCL-xL and BCL-2 and after 48 h treated with regorafenib at different concentrations, and cell viability was quantified by MTT. ( F ) RNA interference was confirmed and protein levels of BCL-xL, BCL-2, and β-actin are shown in parallel panels. (n = 3) * p < 0.05 vs. control or siCTRL cells.
Orα Bcl Xl, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/orα bcl xl/product/Santa Cruz Biotechnology
Average 93 stars, based on 1 article reviews
orα bcl xl - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology bcl x l
BCL-xL antagonism potentiates regorafenib activity on liver cancer cells. ( A , B ) Hep3B and HepG2 cells were treated for 16 h with the BCL-xL inhibitor A-1331852 and regorafenib at different concentrations, and cell viability was quantified by MTT. ( C , D ) Hep3B and HepG2 cells were treated for 16 h with the BCL-2 inhibitor ABT-199 and regorafenib at different concentrations, and cell viability was quantified by MTT. ( E ) Hep3B cells were transfected with <t>siRNA</t> control or against BCL-xL and BCL-2 and after 48 h treated with regorafenib at different concentrations, and cell viability was quantified by MTT. ( F ) RNA interference was confirmed and protein levels of BCL-xL, BCL-2, and β-actin are shown in parallel panels. (n = 3) * p < 0.05 vs. control or siCTRL cells.
Bcl X L, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/bcl x l/product/Santa Cruz Biotechnology
Average 93 stars, based on 1 article reviews
bcl x l - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

90
Santa Cruz Biotechnology lentiviruses expressing shrnas targeting bcl-x l sc-43630-v
a–d Western blotting and RT-PCR were performed 48 h after γ-irradiation. a H460 and A549 lung cancer cells (p53 wt ) were infected with <t>lentiviruses</t> expressing control (nontargeting sequence) or SULF2-specific shRNA. These transfectants, along with H1299 lung cancer cells (p53 null ) and p53 wt -expressing or p53-knockout HCT116 colon cancer cells, were irradiated with the indicated doses of γ-rays, and SOD2 levels were compared by western blot analysis using β-actin as a loading control. SULF2 expression was compared by RT-PCR using GAPDH as a loading control. b A549 and H460 cells were transfected with an empty or SULF2 expression vector, and SOD2 protein and SULF2 mRNA levels were compared. c H460 cells treated with a control or an siRNA targeting β-catenin, IL-6, or STAT3 were irradiated with 2 Gy of γ-rays, and the levels of the indicated proteins were compared. d H460 cells infected with the lentiviruses indicated in a were irradiated, and SOD2 mRNA levels were analyzed by RT-PCR. e H460 cells treated with a control or a STAT3-targeting siRNA were irradiated, and SOD2 mRNA levels were compared by quantitative real-time PCR at 24 and 48 h after irradiation
Lentiviruses Expressing Shrnas Targeting Bcl X L Sc 43630 V, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lentiviruses expressing shrnas targeting bcl-x l sc-43630-v/product/Santa Cruz Biotechnology
Average 90 stars, based on 1 article reviews
lentiviruses expressing shrnas targeting bcl-x l sc-43630-v - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology bcl2l1 small
Figure 4. miR‑133a negatively regulates <t>Bcl2l1</t> expression. A total of 48 h post‑transfection, miR‑133a and Bcl2l1 expression were detected using reverse transcription‑quantitative polymerase chain reaction and western blot analysis. (A) miR‑133a expression; (B) Bcl2l1 mRNA expression; (C) Bcl2l1 protein expression. Con, untreated HUVECs; NC: HUVECs transfected with NC; inhibitor, HUVECs transfected with a miR‑133a inhibitor; inhibitor + Bcl2l1 siRNA: HUVECs cotransfected with a miR‑133a inhibitor and Bcll12 siRNA. Data are presented as the mean ± standard deviation. *P<0.05 vs. the Con group; #P<0.05 vs. the NC group; &P<0.05 vs. the inhibitor group. Bcl2l1, B‑cell lymphoma 2‑like 1; HUVECs, human umbilical vein endothelial cells; miR‑133a, microRNA‑133a; NC, negative control; siRNA, small interfering RNA.
Bcl2l1 Small, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/bcl2l1 small/product/Santa Cruz Biotechnology
Average 93 stars, based on 1 article reviews
bcl2l1 small - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology si rna
miR-133a negatively regulates Bcl2l1 expression. A total of 48 h post-transfection, miR-133a and Bcl2l1 expression were detected using reverse transcription-quantitative polymerase chain reaction and western blot analysis. (A) miR-133a expression; (B) Bcl2l1 mRNA expression; (C) Bcl2l1 protein expression. Con, untreated HUVECs; NC: HUVECs transfected with NC; inhibitor, HUVECs transfected with a miR-133a inhibitor; inhibitor + Bcl2l1 siRNA: HUVECs cotransfected with a miR-133a inhibitor and Bcll12 siRNA. Data are presented as the mean ± standard deviation. *P<0.05 vs. the Con group; # P<0.05 vs. the NC group; & P<0.05 vs. the inhibitor group. Bcl2l1, <t>B-cell</t> <t>lymphoma</t> 2-like 1; HUVECs, human umbilical vein endothelial cells; miR-133a, microRNA-133a; NC, negative control; siRNA, small interfering <t>RNA.</t>
Si Rna, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/si rna/product/Santa Cruz Biotechnology
Average 93 stars, based on 1 article reviews
si rna - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

Image Search Results


Bcl-xL depletion alters ATP/ADP ratio in primary hippocampal neurons. Primary rat hippocampal neurons were transduced with control shRNA or Bcl-xL shRNA. Immunoblotting ( A ) was performed to show depletion of the Bcl-xL protein levels in Bcl-xL shRNA transduced neurons ( n = 4, * p = 0.0286, Mann–Whitney test). ATP/ADP ratio ( B , C ) was measured using the GW1-PercevalHR sensor (F 488nm /F 405nm ). Bcl-xL depleted neurons showed lower ATP/ADP ratios in both the soma ( n = 20) and neurites ( n = 20). * p < 0.05, and *** p < 0.001, two-tailed Student’s t -test. Scale bar = 50 μm. Pseudocolour ratiometric micrographs ( D ) of neurons indicating the ATP/ADP ratio using the PercevalHR sensor. Red, higher ATP/ADP; Blue, lower ATP/ADP. Primary hippocampal neurons lacking Bcl-xL showed a significantly decreased TMRM signal ( E – G ), indicating a loss of mitochondrial inner membrane potential (Δψ) ( n = 12). ** p < 0.01, and **** p < 0.0001, two-tailed Student’s t -test. Scale bar = 20 μm.

Journal: Biology

Article Title: Bcl-xL Is Required by Primary Hippocampal Neurons during Development to Support Local Energy Metabolism at Neurites

doi: 10.3390/biology10080772

Figure Lengend Snippet: Bcl-xL depletion alters ATP/ADP ratio in primary hippocampal neurons. Primary rat hippocampal neurons were transduced with control shRNA or Bcl-xL shRNA. Immunoblotting ( A ) was performed to show depletion of the Bcl-xL protein levels in Bcl-xL shRNA transduced neurons ( n = 4, * p = 0.0286, Mann–Whitney test). ATP/ADP ratio ( B , C ) was measured using the GW1-PercevalHR sensor (F 488nm /F 405nm ). Bcl-xL depleted neurons showed lower ATP/ADP ratios in both the soma ( n = 20) and neurites ( n = 20). * p < 0.05, and *** p < 0.001, two-tailed Student’s t -test. Scale bar = 50 μm. Pseudocolour ratiometric micrographs ( D ) of neurons indicating the ATP/ADP ratio using the PercevalHR sensor. Red, higher ATP/ADP; Blue, lower ATP/ADP. Primary hippocampal neurons lacking Bcl-xL showed a significantly decreased TMRM signal ( E – G ), indicating a loss of mitochondrial inner membrane potential (Δψ) ( n = 12). ** p < 0.01, and **** p < 0.0001, two-tailed Student’s t -test. Scale bar = 20 μm.

Article Snippet: Briefly, neurons (0.3 × 10 6 cells/35 mm plate) were seeded on poly-l-lysin coated plates and grown in a neurobasal medium supplemented with B-27, glutamine, and antibiotics (Thermo Fisher Scientific, Waltham, MA, USA) for 21 days in vitro (DIV). shRNA lentiviral particle transduction: Primary hippocampal neurons were transduced with control shRNA lentiviral particles or Bcl-xL shRNA lentiviral particles (Santa Cruz Biotechnology, Dallas, TX, USA); copGFP control lentiviral particles or Bcl-xL shRNA-GFP lentiviral particles (Santa Cruz Biotechnology) at DIV 7.

Techniques: Transduction, Control, shRNA, Western Blot, MANN-WHITNEY, Two Tailed Test, Membrane

Bcl-xL depletion disrupts mitochondrial motility in primary hippocampal neurons. Primary rat hippocampal neurons were transduced with control shRNA or Bcl-xL shRNA. Kymographs ( A ) were produced and analysis using the KymoAnalyzer was completed to give the percentage of mitochondria that showed mitochondria moving in the following directions: only anterograde ( B ), n = 40, net anterograde ( C ), n = 40, ** p = 0.0022, Mann-Whitney test, only retrograde ( D ), n = 40, net retrograde ( E ), n = 40, ** p = 0.0075, Mann–Whitney test, stationary ( F ), n = 40, *** p = 0.0001, Mann–Whitney test, and net stationary ( G ), n = 40, *** p = 0.0002, Mann–Whitney test. The analysis also provided the mitochondrial density (number of mitochondria/µm) for mitochondria exhibiting anterograde ( H ), n = 40 or retrograde ( I ), n = 40 motion, as well as mitochondria that reversed directions ( J ), n = 40, ** p = 0.0029, Mann–Whitney test during the image sequence and stationary mitochondria ( K ), n = 40, * p = 0.0177, Mann–Whitney test. The COX IV protein was labeled to visualize mitochondria ( L , M ), and mitochondria length was measured ( n = 63). * p < 0.05, two-tailed Student’s t -test. Scale bar = 20 μm.

Journal: Biology

Article Title: Bcl-xL Is Required by Primary Hippocampal Neurons during Development to Support Local Energy Metabolism at Neurites

doi: 10.3390/biology10080772

Figure Lengend Snippet: Bcl-xL depletion disrupts mitochondrial motility in primary hippocampal neurons. Primary rat hippocampal neurons were transduced with control shRNA or Bcl-xL shRNA. Kymographs ( A ) were produced and analysis using the KymoAnalyzer was completed to give the percentage of mitochondria that showed mitochondria moving in the following directions: only anterograde ( B ), n = 40, net anterograde ( C ), n = 40, ** p = 0.0022, Mann-Whitney test, only retrograde ( D ), n = 40, net retrograde ( E ), n = 40, ** p = 0.0075, Mann–Whitney test, stationary ( F ), n = 40, *** p = 0.0001, Mann–Whitney test, and net stationary ( G ), n = 40, *** p = 0.0002, Mann–Whitney test. The analysis also provided the mitochondrial density (number of mitochondria/µm) for mitochondria exhibiting anterograde ( H ), n = 40 or retrograde ( I ), n = 40 motion, as well as mitochondria that reversed directions ( J ), n = 40, ** p = 0.0029, Mann–Whitney test during the image sequence and stationary mitochondria ( K ), n = 40, * p = 0.0177, Mann–Whitney test. The COX IV protein was labeled to visualize mitochondria ( L , M ), and mitochondria length was measured ( n = 63). * p < 0.05, two-tailed Student’s t -test. Scale bar = 20 μm.

Article Snippet: Briefly, neurons (0.3 × 10 6 cells/35 mm plate) were seeded on poly-l-lysin coated plates and grown in a neurobasal medium supplemented with B-27, glutamine, and antibiotics (Thermo Fisher Scientific, Waltham, MA, USA) for 21 days in vitro (DIV). shRNA lentiviral particle transduction: Primary hippocampal neurons were transduced with control shRNA lentiviral particles or Bcl-xL shRNA lentiviral particles (Santa Cruz Biotechnology, Dallas, TX, USA); copGFP control lentiviral particles or Bcl-xL shRNA-GFP lentiviral particles (Santa Cruz Biotechnology) at DIV 7.

Techniques: Transduction, Control, shRNA, Produced, MANN-WHITNEY, Sequencing, Labeling, Two Tailed Test

Bcl-xL depletion impairs neurite arborization and synapse formation in primary hippocampal neurons. Primary hippocampal neurons were transduced with conGFP control or Bcl-xL shRNA-GFP. The Sholl analysis ( A ) determined the number of neurite intersections ( n = 12). Pseudocolour images ( B ) show a qualitative difference in neurite intersections resulting from Bcl-xL depletion. Red, higher intersections; blue, fewer intersections. Scale bar = 50 µm. Immunocytochemistry ( C ) was performed, and Bassoon-positive puncta were counted from 50–100 µm from the soma ( n = 63). * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001, two-tailed Student’s t -test. ( D ) Red, Bassoon; Green, MAP2; Blue, DAPI. Scale bar = 20 μm.

Journal: Biology

Article Title: Bcl-xL Is Required by Primary Hippocampal Neurons during Development to Support Local Energy Metabolism at Neurites

doi: 10.3390/biology10080772

Figure Lengend Snippet: Bcl-xL depletion impairs neurite arborization and synapse formation in primary hippocampal neurons. Primary hippocampal neurons were transduced with conGFP control or Bcl-xL shRNA-GFP. The Sholl analysis ( A ) determined the number of neurite intersections ( n = 12). Pseudocolour images ( B ) show a qualitative difference in neurite intersections resulting from Bcl-xL depletion. Red, higher intersections; blue, fewer intersections. Scale bar = 50 µm. Immunocytochemistry ( C ) was performed, and Bassoon-positive puncta were counted from 50–100 µm from the soma ( n = 63). * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001, two-tailed Student’s t -test. ( D ) Red, Bassoon; Green, MAP2; Blue, DAPI. Scale bar = 20 μm.

Article Snippet: Briefly, neurons (0.3 × 10 6 cells/35 mm plate) were seeded on poly-l-lysin coated plates and grown in a neurobasal medium supplemented with B-27, glutamine, and antibiotics (Thermo Fisher Scientific, Waltham, MA, USA) for 21 days in vitro (DIV). shRNA lentiviral particle transduction: Primary hippocampal neurons were transduced with control shRNA lentiviral particles or Bcl-xL shRNA lentiviral particles (Santa Cruz Biotechnology, Dallas, TX, USA); copGFP control lentiviral particles or Bcl-xL shRNA-GFP lentiviral particles (Santa Cruz Biotechnology) at DIV 7.

Techniques: Transduction, Control, shRNA, Immunocytochemistry, Two Tailed Test

Bcl-xL depletion makes primary hippocampal neurons more susceptible to excitotoxicity. Primary hippocampal neurons transduced with control shRNA or Bcl-xL shRNA were treated with or without glutamate to induce excitotoxicity. Neurons were treated with Fluo-4 ( A , B ) to measure intracellular calcium concentration ( n = 121). ** p < 0.01 and **** p < 0.0001, Kruskal–Wallis test with Dunn’s multiple comparisons test. Calcein-AM and Hoechst staining ( C , D ) shows the proportion of healthy cells via fluorescent image analysis ( n = 100). ** p < 0.01, and *** p < 0.001, one-way ANOVA with a Tukey’s post-hoc-analysis. Scale bar = 20 μm. PI and Hoechst staining ( E , F ) shows the proportion of dead cells via fluorescent image analysis ( n = 20). **** p < 0.0001, one-way ANOVA with a Tukey’s post-hoc analysis. Scale bar = 50 μm.

Journal: Biology

Article Title: Bcl-xL Is Required by Primary Hippocampal Neurons during Development to Support Local Energy Metabolism at Neurites

doi: 10.3390/biology10080772

Figure Lengend Snippet: Bcl-xL depletion makes primary hippocampal neurons more susceptible to excitotoxicity. Primary hippocampal neurons transduced with control shRNA or Bcl-xL shRNA were treated with or without glutamate to induce excitotoxicity. Neurons were treated with Fluo-4 ( A , B ) to measure intracellular calcium concentration ( n = 121). ** p < 0.01 and **** p < 0.0001, Kruskal–Wallis test with Dunn’s multiple comparisons test. Calcein-AM and Hoechst staining ( C , D ) shows the proportion of healthy cells via fluorescent image analysis ( n = 100). ** p < 0.01, and *** p < 0.001, one-way ANOVA with a Tukey’s post-hoc-analysis. Scale bar = 20 μm. PI and Hoechst staining ( E , F ) shows the proportion of dead cells via fluorescent image analysis ( n = 20). **** p < 0.0001, one-way ANOVA with a Tukey’s post-hoc analysis. Scale bar = 50 μm.

Article Snippet: Briefly, neurons (0.3 × 10 6 cells/35 mm plate) were seeded on poly-l-lysin coated plates and grown in a neurobasal medium supplemented with B-27, glutamine, and antibiotics (Thermo Fisher Scientific, Waltham, MA, USA) for 21 days in vitro (DIV). shRNA lentiviral particle transduction: Primary hippocampal neurons were transduced with control shRNA lentiviral particles or Bcl-xL shRNA lentiviral particles (Santa Cruz Biotechnology, Dallas, TX, USA); copGFP control lentiviral particles or Bcl-xL shRNA-GFP lentiviral particles (Santa Cruz Biotechnology) at DIV 7.

Techniques: Transduction, Control, shRNA, Concentration Assay, Staining

BCL-xL antagonism potentiates regorafenib activity on liver cancer cells. ( A , B ) Hep3B and HepG2 cells were treated for 16 h with the BCL-xL inhibitor A-1331852 and regorafenib at different concentrations, and cell viability was quantified by MTT. ( C , D ) Hep3B and HepG2 cells were treated for 16 h with the BCL-2 inhibitor ABT-199 and regorafenib at different concentrations, and cell viability was quantified by MTT. ( E ) Hep3B cells were transfected with siRNA control or against BCL-xL and BCL-2 and after 48 h treated with regorafenib at different concentrations, and cell viability was quantified by MTT. ( F ) RNA interference was confirmed and protein levels of BCL-xL, BCL-2, and β-actin are shown in parallel panels. (n = 3) * p < 0.05 vs. control or siCTRL cells.

Journal: Cancers

Article Title: Regorafenib Alteration of the BCL-xL/MCL-1 Ratio Provides a Therapeutic Opportunity for BH3-Mimetics in Hepatocellular Carcinoma Models

doi: 10.3390/cancers12020332

Figure Lengend Snippet: BCL-xL antagonism potentiates regorafenib activity on liver cancer cells. ( A , B ) Hep3B and HepG2 cells were treated for 16 h with the BCL-xL inhibitor A-1331852 and regorafenib at different concentrations, and cell viability was quantified by MTT. ( C , D ) Hep3B and HepG2 cells were treated for 16 h with the BCL-2 inhibitor ABT-199 and regorafenib at different concentrations, and cell viability was quantified by MTT. ( E ) Hep3B cells were transfected with siRNA control or against BCL-xL and BCL-2 and after 48 h treated with regorafenib at different concentrations, and cell viability was quantified by MTT. ( F ) RNA interference was confirmed and protein levels of BCL-xL, BCL-2, and β-actin are shown in parallel panels. (n = 3) * p < 0.05 vs. control or siCTRL cells.

Article Snippet: BCL-2 siRNA (h) (sc-29214), BCL-xL siRNA (h) (sc-43630), and scrambled controls were purchased from Santa Cruz Biotechnology (Dallas, TX, USA), while a second siRNA for BCL-2 (ID#s1915) and for BCL-xL (ID#s1920) were obtained from Ambion Life technologies (Carlsbad, CA, USA).

Techniques: Activity Assay, Transfection, Control

a–d Western blotting and RT-PCR were performed 48 h after γ-irradiation. a H460 and A549 lung cancer cells (p53 wt ) were infected with lentiviruses expressing control (nontargeting sequence) or SULF2-specific shRNA. These transfectants, along with H1299 lung cancer cells (p53 null ) and p53 wt -expressing or p53-knockout HCT116 colon cancer cells, were irradiated with the indicated doses of γ-rays, and SOD2 levels were compared by western blot analysis using β-actin as a loading control. SULF2 expression was compared by RT-PCR using GAPDH as a loading control. b A549 and H460 cells were transfected with an empty or SULF2 expression vector, and SOD2 protein and SULF2 mRNA levels were compared. c H460 cells treated with a control or an siRNA targeting β-catenin, IL-6, or STAT3 were irradiated with 2 Gy of γ-rays, and the levels of the indicated proteins were compared. d H460 cells infected with the lentiviruses indicated in a were irradiated, and SOD2 mRNA levels were analyzed by RT-PCR. e H460 cells treated with a control or a STAT3-targeting siRNA were irradiated, and SOD2 mRNA levels were compared by quantitative real-time PCR at 24 and 48 h after irradiation

Journal: Experimental & Molecular Medicine

Article Title: Mitochondrial superoxide dismutase 2 mediates γ-irradiation-induced cancer cell invasion

doi: 10.1038/s12276-019-0207-5

Figure Lengend Snippet: a–d Western blotting and RT-PCR were performed 48 h after γ-irradiation. a H460 and A549 lung cancer cells (p53 wt ) were infected with lentiviruses expressing control (nontargeting sequence) or SULF2-specific shRNA. These transfectants, along with H1299 lung cancer cells (p53 null ) and p53 wt -expressing or p53-knockout HCT116 colon cancer cells, were irradiated with the indicated doses of γ-rays, and SOD2 levels were compared by western blot analysis using β-actin as a loading control. SULF2 expression was compared by RT-PCR using GAPDH as a loading control. b A549 and H460 cells were transfected with an empty or SULF2 expression vector, and SOD2 protein and SULF2 mRNA levels were compared. c H460 cells treated with a control or an siRNA targeting β-catenin, IL-6, or STAT3 were irradiated with 2 Gy of γ-rays, and the levels of the indicated proteins were compared. d H460 cells infected with the lentiviruses indicated in a were irradiated, and SOD2 mRNA levels were analyzed by RT-PCR. e H460 cells treated with a control or a STAT3-targeting siRNA were irradiated, and SOD2 mRNA levels were compared by quantitative real-time PCR at 24 and 48 h after irradiation

Article Snippet: Small interfering RNA (siRNAs) targeting IL-6 (S7312) and Bcl-X L (120717) were purchased from Ambion (Austin, TX, USA). siRNAs targeting SOD2 (sc-41655), β-catenin (sc-44275), and STAT3 (sc-29209) as well as lentiviruses expressing small hairpin RNAs (shRNAs) targeting SOD2 (sc-41655-V), Bcl-X L (sc-43630-V), and SULF2 (sc-63088-V) were obtained from Santa Cruz Biotechnology.

Techniques: Western Blot, Reverse Transcription Polymerase Chain Reaction, Irradiation, Infection, Expressing, Control, Sequencing, shRNA, Knock-Out, Transfection, Plasmid Preparation, Real-time Polymerase Chain Reaction

a H460 and A549 cells were transfected with control (empty vector) or SOD2 expression vector. After 48 h of incubation, a cell invasion assay was performed. Cells that invaded through Matrigel-coated polycarbonate filters were imaged, and the number of invaded cells was counted and plotted. SOD protein levels were compared by western blot analysis. b H460 cells infected with lentiviruses expressing a control or SOD2-targeting shRNA were irradiated, and invasiveness and protein levels were then analyzed 48 h after irradiation. c H460 cells were cotransfected with a SULF2 expression vector and SOD2 siRNA as per the indicated combinations, and cell invasiveness was then assessed. d H460 cells infected with lentiviruses expressing control RNA or SOD2-specific shRNA were incubated in the presence or absence of IL-6 (100 ng/mL) for 24 h. Cell invasiveness was then assessed

Journal: Experimental & Molecular Medicine

Article Title: Mitochondrial superoxide dismutase 2 mediates γ-irradiation-induced cancer cell invasion

doi: 10.1038/s12276-019-0207-5

Figure Lengend Snippet: a H460 and A549 cells were transfected with control (empty vector) or SOD2 expression vector. After 48 h of incubation, a cell invasion assay was performed. Cells that invaded through Matrigel-coated polycarbonate filters were imaged, and the number of invaded cells was counted and plotted. SOD protein levels were compared by western blot analysis. b H460 cells infected with lentiviruses expressing a control or SOD2-targeting shRNA were irradiated, and invasiveness and protein levels were then analyzed 48 h after irradiation. c H460 cells were cotransfected with a SULF2 expression vector and SOD2 siRNA as per the indicated combinations, and cell invasiveness was then assessed. d H460 cells infected with lentiviruses expressing control RNA or SOD2-specific shRNA were incubated in the presence or absence of IL-6 (100 ng/mL) for 24 h. Cell invasiveness was then assessed

Article Snippet: Small interfering RNA (siRNAs) targeting IL-6 (S7312) and Bcl-X L (120717) were purchased from Ambion (Austin, TX, USA). siRNAs targeting SOD2 (sc-41655), β-catenin (sc-44275), and STAT3 (sc-29209) as well as lentiviruses expressing small hairpin RNAs (shRNAs) targeting SOD2 (sc-41655-V), Bcl-X L (sc-43630-V), and SULF2 (sc-63088-V) were obtained from Santa Cruz Biotechnology.

Techniques: Transfection, Control, Plasmid Preparation, Expressing, Incubation, Invasion Assay, Western Blot, Infection, shRNA, Irradiation

a H460 cells treated with a control, Bcl-X L -targeting, or SOD2-targeting siRNA were irradiated, and the levels of the indicated proteins were compared 24 h after irradiation. b H460 cells infected with lentiviruses expressing the specified shRNAs were transfected with a Bcl-X L or SOD2 expression vector in the indicated combinations. Cellular invasiveness and the levels of Bcl-X L and SOD2 were compared after 48 h of incubation. c H460 cells were transfected with a Bcl-X L or SOD2 expression vector in the indicated combinations. Cellular invasiveness and the levels of the indicated proteins were compared after 48 h of incubation. d H460 cells treated with a control or SOD2-targeting siRNA were irradiated (2 Gy). After 48 h of incubation, irradiated and untreated control cells were analyzed for their levels of O 2 •− and H 2 O 2 using MitoSox Red and Peroxy Orange-1, respectively. e H460 cells were transfected with a SULF2 expression vector and SOD2-targeting siRNA in the indicated combinations (left). Alternatively, H460 cells infected with lentiviruses expressing a control or SOD2-targeting shRNA were incubated in the presence or absence of 100 ng/mL IL-6 (right). After treatment for 24 h, cellular H 2 O 2 levels were compared using Peroxy Orange-1

Journal: Experimental & Molecular Medicine

Article Title: Mitochondrial superoxide dismutase 2 mediates γ-irradiation-induced cancer cell invasion

doi: 10.1038/s12276-019-0207-5

Figure Lengend Snippet: a H460 cells treated with a control, Bcl-X L -targeting, or SOD2-targeting siRNA were irradiated, and the levels of the indicated proteins were compared 24 h after irradiation. b H460 cells infected with lentiviruses expressing the specified shRNAs were transfected with a Bcl-X L or SOD2 expression vector in the indicated combinations. Cellular invasiveness and the levels of Bcl-X L and SOD2 were compared after 48 h of incubation. c H460 cells were transfected with a Bcl-X L or SOD2 expression vector in the indicated combinations. Cellular invasiveness and the levels of the indicated proteins were compared after 48 h of incubation. d H460 cells treated with a control or SOD2-targeting siRNA were irradiated (2 Gy). After 48 h of incubation, irradiated and untreated control cells were analyzed for their levels of O 2 •− and H 2 O 2 using MitoSox Red and Peroxy Orange-1, respectively. e H460 cells were transfected with a SULF2 expression vector and SOD2-targeting siRNA in the indicated combinations (left). Alternatively, H460 cells infected with lentiviruses expressing a control or SOD2-targeting shRNA were incubated in the presence or absence of 100 ng/mL IL-6 (right). After treatment for 24 h, cellular H 2 O 2 levels were compared using Peroxy Orange-1

Article Snippet: Small interfering RNA (siRNAs) targeting IL-6 (S7312) and Bcl-X L (120717) were purchased from Ambion (Austin, TX, USA). siRNAs targeting SOD2 (sc-41655), β-catenin (sc-44275), and STAT3 (sc-29209) as well as lentiviruses expressing small hairpin RNAs (shRNAs) targeting SOD2 (sc-41655-V), Bcl-X L (sc-43630-V), and SULF2 (sc-63088-V) were obtained from Santa Cruz Biotechnology.

Techniques: Control, Irradiation, Infection, Expressing, Transfection, Plasmid Preparation, Incubation, shRNA

H460 and A549 cells were infected with lentiviruses expressing a control or SOD2-targeting shRNA and irradiated with the indicated doses of γ-rays, and cell survival was then analyzed by clonogenic assays

Journal: Experimental & Molecular Medicine

Article Title: Mitochondrial superoxide dismutase 2 mediates γ-irradiation-induced cancer cell invasion

doi: 10.1038/s12276-019-0207-5

Figure Lengend Snippet: H460 and A549 cells were infected with lentiviruses expressing a control or SOD2-targeting shRNA and irradiated with the indicated doses of γ-rays, and cell survival was then analyzed by clonogenic assays

Article Snippet: Small interfering RNA (siRNAs) targeting IL-6 (S7312) and Bcl-X L (120717) were purchased from Ambion (Austin, TX, USA). siRNAs targeting SOD2 (sc-41655), β-catenin (sc-44275), and STAT3 (sc-29209) as well as lentiviruses expressing small hairpin RNAs (shRNAs) targeting SOD2 (sc-41655-V), Bcl-X L (sc-43630-V), and SULF2 (sc-63088-V) were obtained from Santa Cruz Biotechnology.

Techniques: Infection, Expressing, Control, shRNA, Irradiation

Figure 4. miR‑133a negatively regulates Bcl2l1 expression. A total of 48 h post‑transfection, miR‑133a and Bcl2l1 expression were detected using reverse transcription‑quantitative polymerase chain reaction and western blot analysis. (A) miR‑133a expression; (B) Bcl2l1 mRNA expression; (C) Bcl2l1 protein expression. Con, untreated HUVECs; NC: HUVECs transfected with NC; inhibitor, HUVECs transfected with a miR‑133a inhibitor; inhibitor + Bcl2l1 siRNA: HUVECs cotransfected with a miR‑133a inhibitor and Bcll12 siRNA. Data are presented as the mean ± standard deviation. *P<0.05 vs. the Con group; #P<0.05 vs. the NC group; &P<0.05 vs. the inhibitor group. Bcl2l1, B‑cell lymphoma 2‑like 1; HUVECs, human umbilical vein endothelial cells; miR‑133a, microRNA‑133a; NC, negative control; siRNA, small interfering RNA.

Journal: Molecular medicine reports

Article Title: Abnormal expression of miR‑133a in patients with acute myocardial infarction following radical surgery for gastric cancer and the underlying mechanism.

doi: 10.3892/mmr.2018.9541

Figure Lengend Snippet: Figure 4. miR‑133a negatively regulates Bcl2l1 expression. A total of 48 h post‑transfection, miR‑133a and Bcl2l1 expression were detected using reverse transcription‑quantitative polymerase chain reaction and western blot analysis. (A) miR‑133a expression; (B) Bcl2l1 mRNA expression; (C) Bcl2l1 protein expression. Con, untreated HUVECs; NC: HUVECs transfected with NC; inhibitor, HUVECs transfected with a miR‑133a inhibitor; inhibitor + Bcl2l1 siRNA: HUVECs cotransfected with a miR‑133a inhibitor and Bcll12 siRNA. Data are presented as the mean ± standard deviation. *P<0.05 vs. the Con group; #P<0.05 vs. the NC group; &P<0.05 vs. the inhibitor group. Bcl2l1, B‑cell lymphoma 2‑like 1; HUVECs, human umbilical vein endothelial cells; miR‑133a, microRNA‑133a; NC, negative control; siRNA, small interfering RNA.

Article Snippet: A miR-133a inhibitor (5'CAG CUG GUU GAA GGG GAC CAA A3'; 100 nM), NC (sense, 5'UUC UCC GAA CGU GUC ACG UTT3' and antisense, 5'ACG UGA CAC GUU CGG AGA ATT3'; 50 nM) or 2 μl B-cell lymphoma 2 (Bcl-2)-like 1 (Bcl2l1) small interfering (si)RNA (cat. no. sc-43630; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) were transfected into HUVECs (5x104 cells/well) using the Lipofectamine® LTX kit (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol.

Techniques: Expressing, Polymerase Chain Reaction, Western Blot, Transfection, Standard Deviation, Negative Control, Small Interfering RNA

Figure 5. Effects of miR‑133a on HUVEC proliferation. A total of 48 h post‑transfection, HUVEC proliferation was determined by MTT assay. Con, untreated HUVECs; NC: HUVECs transfected with NC; inhibitor, HUVECs transfected with a miR‑133a inhibitor; inhibitor + Bcl2l1 siRNA, HUVECs cotransfected with a miR‑133a inhibitor and Bcll12 siRNA. Data are presented as the mean ± standard deviation. *P<0.05 vs. the Con group; #P<0.05 vs. the NC group; &P<0.05 vs. the inhibitor group. Bcl2l1, B‑cell lymphoma 2‑like 1; HUVECs, human umbilical vein endothelial cells; miR‑133a, microRNA‑133a; NC, negative control; siRNA, small interfering RNA.

Journal: Molecular medicine reports

Article Title: Abnormal expression of miR‑133a in patients with acute myocardial infarction following radical surgery for gastric cancer and the underlying mechanism.

doi: 10.3892/mmr.2018.9541

Figure Lengend Snippet: Figure 5. Effects of miR‑133a on HUVEC proliferation. A total of 48 h post‑transfection, HUVEC proliferation was determined by MTT assay. Con, untreated HUVECs; NC: HUVECs transfected with NC; inhibitor, HUVECs transfected with a miR‑133a inhibitor; inhibitor + Bcl2l1 siRNA, HUVECs cotransfected with a miR‑133a inhibitor and Bcll12 siRNA. Data are presented as the mean ± standard deviation. *P<0.05 vs. the Con group; #P<0.05 vs. the NC group; &P<0.05 vs. the inhibitor group. Bcl2l1, B‑cell lymphoma 2‑like 1; HUVECs, human umbilical vein endothelial cells; miR‑133a, microRNA‑133a; NC, negative control; siRNA, small interfering RNA.

Article Snippet: A miR-133a inhibitor (5'CAG CUG GUU GAA GGG GAC CAA A3'; 100 nM), NC (sense, 5'UUC UCC GAA CGU GUC ACG UTT3' and antisense, 5'ACG UGA CAC GUU CGG AGA ATT3'; 50 nM) or 2 μl B-cell lymphoma 2 (Bcl-2)-like 1 (Bcl2l1) small interfering (si)RNA (cat. no. sc-43630; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) were transfected into HUVECs (5x104 cells/well) using the Lipofectamine® LTX kit (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol.

Techniques: MTT Assay, Transfection, Standard Deviation, Negative Control, Small Interfering RNA

Figure 3. Bcl2l1 is a direct target of miR‑133a. (A) Interaction between miR‑133a and the 3'UTR of Bcl2l1 was predicted using TargetScan. (B) LUC activity of a reporter containing Bcl2l1‑WT 3'UTR or Bcl2l1‑MUT 3'. Bcl2l1‑MUT indicates the Bcl2l1 3'UTR with a mutation in the miR‑133a binding site. All data are presented as the mean ± standard deviation of three independent experiments. *P<0.05 vs. the control group. Bcl2l1, B‑cell lymphoma 2‑like 1; LUC, luciferase; miR‑133a, microRNA‑133a; MUT, mutant; UTR, untranslated region; WT, wild type.

Journal: Molecular medicine reports

Article Title: Abnormal expression of miR‑133a in patients with acute myocardial infarction following radical surgery for gastric cancer and the underlying mechanism.

doi: 10.3892/mmr.2018.9541

Figure Lengend Snippet: Figure 3. Bcl2l1 is a direct target of miR‑133a. (A) Interaction between miR‑133a and the 3'UTR of Bcl2l1 was predicted using TargetScan. (B) LUC activity of a reporter containing Bcl2l1‑WT 3'UTR or Bcl2l1‑MUT 3'. Bcl2l1‑MUT indicates the Bcl2l1 3'UTR with a mutation in the miR‑133a binding site. All data are presented as the mean ± standard deviation of three independent experiments. *P<0.05 vs. the control group. Bcl2l1, B‑cell lymphoma 2‑like 1; LUC, luciferase; miR‑133a, microRNA‑133a; MUT, mutant; UTR, untranslated region; WT, wild type.

Article Snippet: A miR-133a inhibitor (5'CAG CUG GUU GAA GGG GAC CAA A3'; 100 nM), NC (sense, 5'UUC UCC GAA CGU GUC ACG UTT3' and antisense, 5'ACG UGA CAC GUU CGG AGA ATT3'; 50 nM) or 2 μl B-cell lymphoma 2 (Bcl-2)-like 1 (Bcl2l1) small interfering (si)RNA (cat. no. sc-43630; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) were transfected into HUVECs (5x104 cells/well) using the Lipofectamine® LTX kit (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol.

Techniques: Activity Assay, Mutagenesis, Binding Assay, Standard Deviation, Control, Luciferase

Figure 6. Effects of miR‑133a on HUVEC apoptosis. (A) A total of 48 h post‑transfection, HUVEC apoptosis was determined by flow cytometry. Con, untreated HUVECs; NC: HUVECs transfected with NC; inhibitor, HUVECs transfected with a miR‑133a inhibitor; inhibitor + Bcl2l1 siRNA, HUVECs cotransfected with a miR‑133a inhibitor and Bcll12 siRNA. (B) Data are presented as the mean ± standard deviation. *P<0.05 vs. the Con group; #P<0.05 vs. the NC group; &P<0.05 vs. the inhibitor group. Bcl2l1, B‑cell lymphoma 2‑like 1; FITC, fluorescein isothiocyanate; HUVECs, human umbilical vein endothelial cells; miR‑133a, microRNA‑133a; NC, negative control; PI, propidium iodide; siRNA, small interfering RNA.

Journal: Molecular medicine reports

Article Title: Abnormal expression of miR‑133a in patients with acute myocardial infarction following radical surgery for gastric cancer and the underlying mechanism.

doi: 10.3892/mmr.2018.9541

Figure Lengend Snippet: Figure 6. Effects of miR‑133a on HUVEC apoptosis. (A) A total of 48 h post‑transfection, HUVEC apoptosis was determined by flow cytometry. Con, untreated HUVECs; NC: HUVECs transfected with NC; inhibitor, HUVECs transfected with a miR‑133a inhibitor; inhibitor + Bcl2l1 siRNA, HUVECs cotransfected with a miR‑133a inhibitor and Bcll12 siRNA. (B) Data are presented as the mean ± standard deviation. *P<0.05 vs. the Con group; #P<0.05 vs. the NC group; &P<0.05 vs. the inhibitor group. Bcl2l1, B‑cell lymphoma 2‑like 1; FITC, fluorescein isothiocyanate; HUVECs, human umbilical vein endothelial cells; miR‑133a, microRNA‑133a; NC, negative control; PI, propidium iodide; siRNA, small interfering RNA.

Article Snippet: A miR-133a inhibitor (5'CAG CUG GUU GAA GGG GAC CAA A3'; 100 nM), NC (sense, 5'UUC UCC GAA CGU GUC ACG UTT3' and antisense, 5'ACG UGA CAC GUU CGG AGA ATT3'; 50 nM) or 2 μl B-cell lymphoma 2 (Bcl-2)-like 1 (Bcl2l1) small interfering (si)RNA (cat. no. sc-43630; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) were transfected into HUVECs (5x104 cells/well) using the Lipofectamine® LTX kit (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol.

Techniques: Flow Cytometry, Transfection, Standard Deviation, Negative Control, Small Interfering RNA

miR-133a negatively regulates Bcl2l1 expression. A total of 48 h post-transfection, miR-133a and Bcl2l1 expression were detected using reverse transcription-quantitative polymerase chain reaction and western blot analysis. (A) miR-133a expression; (B) Bcl2l1 mRNA expression; (C) Bcl2l1 protein expression. Con, untreated HUVECs; NC: HUVECs transfected with NC; inhibitor, HUVECs transfected with a miR-133a inhibitor; inhibitor + Bcl2l1 siRNA: HUVECs cotransfected with a miR-133a inhibitor and Bcll12 siRNA. Data are presented as the mean ± standard deviation. *P<0.05 vs. the Con group; # P<0.05 vs. the NC group; & P<0.05 vs. the inhibitor group. Bcl2l1, B-cell lymphoma 2-like 1; HUVECs, human umbilical vein endothelial cells; miR-133a, microRNA-133a; NC, negative control; siRNA, small interfering RNA.

Journal: Molecular Medicine Reports

Article Title: Abnormal expression of miR-133a in patients with acute myocardial infarction following radical surgery for gastric cancer and the underlying mechanism

doi: 10.3892/mmr.2018.9541

Figure Lengend Snippet: miR-133a negatively regulates Bcl2l1 expression. A total of 48 h post-transfection, miR-133a and Bcl2l1 expression were detected using reverse transcription-quantitative polymerase chain reaction and western blot analysis. (A) miR-133a expression; (B) Bcl2l1 mRNA expression; (C) Bcl2l1 protein expression. Con, untreated HUVECs; NC: HUVECs transfected with NC; inhibitor, HUVECs transfected with a miR-133a inhibitor; inhibitor + Bcl2l1 siRNA: HUVECs cotransfected with a miR-133a inhibitor and Bcll12 siRNA. Data are presented as the mean ± standard deviation. *P<0.05 vs. the Con group; # P<0.05 vs. the NC group; & P<0.05 vs. the inhibitor group. Bcl2l1, B-cell lymphoma 2-like 1; HUVECs, human umbilical vein endothelial cells; miR-133a, microRNA-133a; NC, negative control; siRNA, small interfering RNA.

Article Snippet: A miR-133a inhibitor (5′CAGCUGGUUGAAGGGGACCAAA3′; 100 nM), NC (sense, 5′UUCUCCGAACGUGUCACGUTT3′ and antisense, 5′ACGUGACACGUUCGGAGAATT3′; 50 nM) or 2 µl B-cell lymphoma 2 (Bcl-2)-like 1 (Bcl2l1) small interfering (si)RNA (cat. no. sc-43630; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) were transfected into HUVECs (5×10 4 cells/well) using the Lipofectamine ® LTX kit (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol.

Techniques: Expressing, Transfection, Real-time Polymerase Chain Reaction, Western Blot, Standard Deviation, Negative Control, Small Interfering RNA

Effects of miR-133a on HUVEC proliferation. A total of 48 h post-transfection, HUVEC proliferation was determined by MTT assay. Con, untreated HUVECs; NC: HUVECs transfected with NC; inhibitor, HUVECs transfected with a miR-133a inhibitor; inhibitor + Bcl2l1 siRNA, HUVECs cotransfected with a miR-133a inhibitor and Bcll12 siRNA. Data are presented as the mean ± standard deviation. *P<0.05 vs. the Con group; # P<0.05 vs. the NC group; & P<0.05 vs. the inhibitor group. Bcl2l1, B-cell lymphoma 2-like 1; HUVECs, human umbilical vein endothelial cells; miR-133a, microRNA-133a; NC, negative control; siRNA, small interfering RNA.

Journal: Molecular Medicine Reports

Article Title: Abnormal expression of miR-133a in patients with acute myocardial infarction following radical surgery for gastric cancer and the underlying mechanism

doi: 10.3892/mmr.2018.9541

Figure Lengend Snippet: Effects of miR-133a on HUVEC proliferation. A total of 48 h post-transfection, HUVEC proliferation was determined by MTT assay. Con, untreated HUVECs; NC: HUVECs transfected with NC; inhibitor, HUVECs transfected with a miR-133a inhibitor; inhibitor + Bcl2l1 siRNA, HUVECs cotransfected with a miR-133a inhibitor and Bcll12 siRNA. Data are presented as the mean ± standard deviation. *P<0.05 vs. the Con group; # P<0.05 vs. the NC group; & P<0.05 vs. the inhibitor group. Bcl2l1, B-cell lymphoma 2-like 1; HUVECs, human umbilical vein endothelial cells; miR-133a, microRNA-133a; NC, negative control; siRNA, small interfering RNA.

Article Snippet: A miR-133a inhibitor (5′CAGCUGGUUGAAGGGGACCAAA3′; 100 nM), NC (sense, 5′UUCUCCGAACGUGUCACGUTT3′ and antisense, 5′ACGUGACACGUUCGGAGAATT3′; 50 nM) or 2 µl B-cell lymphoma 2 (Bcl-2)-like 1 (Bcl2l1) small interfering (si)RNA (cat. no. sc-43630; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) were transfected into HUVECs (5×10 4 cells/well) using the Lipofectamine ® LTX kit (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol.

Techniques: Transfection, MTT Assay, Standard Deviation, Negative Control, Small Interfering RNA

Effects of miR-133a on HUVEC apoptosis. (A) A total of 48 h post-transfection, HUVEC apoptosis was determined by flow cytometry. Con, untreated HUVECs; NC: HUVECs transfected with NC; inhibitor, HUVECs transfected with a miR-133a inhibitor; inhibitor + Bcl2l1 siRNA, HUVECs cotransfected with a miR-133a inhibitor and Bcll12 siRNA. (B) Data are presented as the mean ± standard deviation. *P<0.05 vs. the Con group; # P<0.05 vs. the NC group; & P<0.05 vs. the inhibitor group. Bcl2l1, B-cell lymphoma 2-like 1; FITC, fluorescein isothiocyanate; HUVECs, human umbilical vein endothelial cells; miR-133a, microRNA-133a; NC, negative control; PI, propidium iodide; siRNA, small interfering RNA.

Journal: Molecular Medicine Reports

Article Title: Abnormal expression of miR-133a in patients with acute myocardial infarction following radical surgery for gastric cancer and the underlying mechanism

doi: 10.3892/mmr.2018.9541

Figure Lengend Snippet: Effects of miR-133a on HUVEC apoptosis. (A) A total of 48 h post-transfection, HUVEC apoptosis was determined by flow cytometry. Con, untreated HUVECs; NC: HUVECs transfected with NC; inhibitor, HUVECs transfected with a miR-133a inhibitor; inhibitor + Bcl2l1 siRNA, HUVECs cotransfected with a miR-133a inhibitor and Bcll12 siRNA. (B) Data are presented as the mean ± standard deviation. *P<0.05 vs. the Con group; # P<0.05 vs. the NC group; & P<0.05 vs. the inhibitor group. Bcl2l1, B-cell lymphoma 2-like 1; FITC, fluorescein isothiocyanate; HUVECs, human umbilical vein endothelial cells; miR-133a, microRNA-133a; NC, negative control; PI, propidium iodide; siRNA, small interfering RNA.

Article Snippet: A miR-133a inhibitor (5′CAGCUGGUUGAAGGGGACCAAA3′; 100 nM), NC (sense, 5′UUCUCCGAACGUGUCACGUTT3′ and antisense, 5′ACGUGACACGUUCGGAGAATT3′; 50 nM) or 2 µl B-cell lymphoma 2 (Bcl-2)-like 1 (Bcl2l1) small interfering (si)RNA (cat. no. sc-43630; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) were transfected into HUVECs (5×10 4 cells/well) using the Lipofectamine ® LTX kit (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol.

Techniques: Transfection, Flow Cytometry, Standard Deviation, Negative Control, Small Interfering RNA