rks5078  (ATCC)

Journal: Biology

Article Title: Bcl-xL Is Required by Primary Hippocampal Neurons during Development to Support Local Energy Metabolism at Neurites

doi: 10.3390/biology10080772

Figure Lengend Snippet: Bcl-xL depletion alters ATP/ADP ratio in primary hippocampal neurons. Primary rat hippocampal neurons were transduced with control shRNA or Bcl-xL shRNA. Immunoblotting ( A ) was performed to show depletion of the Bcl-xL protein levels in Bcl-xL shRNA transduced neurons ( n = 4, * p = 0.0286, Mann–Whitney test). ATP/ADP ratio ( B , C ) was measured using the GW1-PercevalHR sensor (F 488nm /F 405nm ). Bcl-xL depleted neurons showed lower ATP/ADP ratios in both the soma ( n = 20) and neurites ( n = 20). * p < 0.05, and *** p < 0.001, two-tailed Student’s t -test. Scale bar = 50 μm. Pseudocolour ratiometric micrographs ( D ) of neurons indicating the ATP/ADP ratio using the PercevalHR sensor. Red, higher ATP/ADP; Blue, lower ATP/ADP. Primary hippocampal neurons lacking Bcl-xL showed a significantly decreased TMRM signal ( E – G ), indicating a loss of mitochondrial inner membrane potential (Δψ) ( n = 12). ** p < 0.01, and **** p < 0.0001, two-tailed Student’s t -test. Scale bar = 20 μm.

Article Snippet: Briefly, neurons (0.3 × 10 6 cells/35 mm plate) were seeded on poly-l-lysin coated plates and grown in a neurobasal medium supplemented with B-27, glutamine, and antibiotics (Thermo Fisher Scientific, Waltham, MA, USA) for 21 days in vitro (DIV). shRNA lentiviral particle transduction: Primary hippocampal neurons were transduced with control shRNA lentiviral particles or Bcl-xL shRNA lentiviral particles (Santa Cruz Biotechnology, Dallas, TX, USA); copGFP control lentiviral particles or Bcl-xL shRNA-GFP lentiviral particles (Santa Cruz Biotechnology) at DIV 7.

Techniques: Transduction, shRNA, Western Blot, MANN-WHITNEY, Two Tailed Test

Journal: Biology

Article Title: Bcl-xL Is Required by Primary Hippocampal Neurons during Development to Support Local Energy Metabolism at Neurites

doi: 10.3390/biology10080772

Figure Lengend Snippet: Bcl-xL depletion disrupts mitochondrial motility in primary hippocampal neurons. Primary rat hippocampal neurons were transduced with control shRNA or Bcl-xL shRNA. Kymographs ( A ) were produced and analysis using the KymoAnalyzer was completed to give the percentage of mitochondria that showed mitochondria moving in the following directions: only anterograde ( B ), n = 40, net anterograde ( C ), n = 40, ** p = 0.0022, Mann-Whitney test, only retrograde ( D ), n = 40, net retrograde ( E ), n = 40, ** p = 0.0075, Mann–Whitney test, stationary ( F ), n = 40, *** p = 0.0001, Mann–Whitney test, and net stationary ( G ), n = 40, *** p = 0.0002, Mann–Whitney test. The analysis also provided the mitochondrial density (number of mitochondria/µm) for mitochondria exhibiting anterograde ( H ), n = 40 or retrograde ( I ), n = 40 motion, as well as mitochondria that reversed directions ( J ), n = 40, ** p = 0.0029, Mann–Whitney test during the image sequence and stationary mitochondria ( K ), n = 40, * p = 0.0177, Mann–Whitney test. The COX IV protein was labeled to visualize mitochondria ( L , M ), and mitochondria length was measured ( n = 63). * p < 0.05, two-tailed Student’s t -test. Scale bar = 20 μm.

Article Snippet: Briefly, neurons (0.3 × 10 6 cells/35 mm plate) were seeded on poly-l-lysin coated plates and grown in a neurobasal medium supplemented with B-27, glutamine, and antibiotics (Thermo Fisher Scientific, Waltham, MA, USA) for 21 days in vitro (DIV). shRNA lentiviral particle transduction: Primary hippocampal neurons were transduced with control shRNA lentiviral particles or Bcl-xL shRNA lentiviral particles (Santa Cruz Biotechnology, Dallas, TX, USA); copGFP control lentiviral particles or Bcl-xL shRNA-GFP lentiviral particles (Santa Cruz Biotechnology) at DIV 7.

Techniques: Transduction, shRNA, Produced, MANN-WHITNEY, Sequencing, Labeling, Two Tailed Test

Journal: Biology

Article Title: Bcl-xL Is Required by Primary Hippocampal Neurons during Development to Support Local Energy Metabolism at Neurites

doi: 10.3390/biology10080772

Figure Lengend Snippet: Bcl-xL depletion impairs neurite arborization and synapse formation in primary hippocampal neurons. Primary hippocampal neurons were transduced with conGFP control or Bcl-xL shRNA-GFP. The Sholl analysis ( A ) determined the number of neurite intersections ( n = 12). Pseudocolour images ( B ) show a qualitative difference in neurite intersections resulting from Bcl-xL depletion. Red, higher intersections; blue, fewer intersections. Scale bar = 50 µm. Immunocytochemistry ( C ) was performed, and Bassoon-positive puncta were counted from 50–100 µm from the soma ( n = 63). * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001, two-tailed Student’s t -test. ( D ) Red, Bassoon; Green, MAP2; Blue, DAPI. Scale bar = 20 μm.

Article Snippet: Briefly, neurons (0.3 × 10 6 cells/35 mm plate) were seeded on poly-l-lysin coated plates and grown in a neurobasal medium supplemented with B-27, glutamine, and antibiotics (Thermo Fisher Scientific, Waltham, MA, USA) for 21 days in vitro (DIV). shRNA lentiviral particle transduction: Primary hippocampal neurons were transduced with control shRNA lentiviral particles or Bcl-xL shRNA lentiviral particles (Santa Cruz Biotechnology, Dallas, TX, USA); copGFP control lentiviral particles or Bcl-xL shRNA-GFP lentiviral particles (Santa Cruz Biotechnology) at DIV 7.

Techniques: Transduction, shRNA, Immunocytochemistry, Two Tailed Test

Journal: Biology

Article Title: Bcl-xL Is Required by Primary Hippocampal Neurons during Development to Support Local Energy Metabolism at Neurites

doi: 10.3390/biology10080772

Figure Lengend Snippet: Bcl-xL depletion makes primary hippocampal neurons more susceptible to excitotoxicity. Primary hippocampal neurons transduced with control shRNA or Bcl-xL shRNA were treated with or without glutamate to induce excitotoxicity. Neurons were treated with Fluo-4 ( A , B ) to measure intracellular calcium concentration ( n = 121). ** p < 0.01 and **** p < 0.0001, Kruskal–Wallis test with Dunn’s multiple comparisons test. Calcein-AM and Hoechst staining ( C , D ) shows the proportion of healthy cells via fluorescent image analysis ( n = 100). ** p < 0.01, and *** p < 0.001, one-way ANOVA with a Tukey’s post-hoc-analysis. Scale bar = 20 μm. PI and Hoechst staining ( E , F ) shows the proportion of dead cells via fluorescent image analysis ( n = 20). **** p < 0.0001, one-way ANOVA with a Tukey’s post-hoc analysis. Scale bar = 50 μm.

Article Snippet: Briefly, neurons (0.3 × 10 6 cells/35 mm plate) were seeded on poly-l-lysin coated plates and grown in a neurobasal medium supplemented with B-27, glutamine, and antibiotics (Thermo Fisher Scientific, Waltham, MA, USA) for 21 days in vitro (DIV). shRNA lentiviral particle transduction: Primary hippocampal neurons were transduced with control shRNA lentiviral particles or Bcl-xL shRNA lentiviral particles (Santa Cruz Biotechnology, Dallas, TX, USA); copGFP control lentiviral particles or Bcl-xL shRNA-GFP lentiviral particles (Santa Cruz Biotechnology) at DIV 7.

Techniques: Transduction, shRNA, Concentration Assay, Staining

Journal: Cancers

Article Title: Regorafenib Alteration of the BCL-xL/MCL-1 Ratio Provides a Therapeutic Opportunity for BH3-Mimetics in Hepatocellular Carcinoma Models

doi: 10.3390/cancers12020332

Figure Lengend Snippet: BCL-xL antagonism potentiates regorafenib activity on liver cancer cells. ( A , B ) Hep3B and HepG2 cells were treated for 16 h with the BCL-xL inhibitor A-1331852 and regorafenib at different concentrations, and cell viability was quantified by MTT. ( C , D ) Hep3B and HepG2 cells were treated for 16 h with the BCL-2 inhibitor ABT-199 and regorafenib at different concentrations, and cell viability was quantified by MTT. ( E ) Hep3B cells were transfected with siRNA control or against BCL-xL and BCL-2 and after 48 h treated with regorafenib at different concentrations, and cell viability was quantified by MTT. ( F ) RNA interference was confirmed and protein levels of BCL-xL, BCL-2, and β-actin are shown in parallel panels. (n = 3) * p < 0.05 vs. control or siCTRL cells.

Article Snippet: BCL-2 siRNA (h) (sc-29214), BCL-xL siRNA (h) (sc-43630), and scrambled controls were purchased from Santa Cruz Biotechnology (Dallas, TX, USA), while a second siRNA for BCL-2 (ID#s1915) and for BCL-xL (ID#s1920) were obtained from Ambion Life technologies (Carlsbad, CA, USA).

Techniques: Activity Assay, Transfection

Journal: Cancers

Article Title: Regorafenib Alteration of the BCL-xL/MCL-1 Ratio Provides a Therapeutic Opportunity for BH3-Mimetics in Hepatocellular Carcinoma Models

doi: 10.3390/cancers12020332

Figure Lengend Snippet: MCL-1 inhibition sensitizes hepatoma cells to the BCL-xL inhibitor A-1331852. ( A ) Representative Western blot images of MCL-1, BCL-xL, BIM, BCL-2, BAX, BAK, and β-Actin exhibited by Hep3B and HepG2 cells at different times (0–16 h) after regorafenib treatment (5 µM). ( B ) Effect of the MCL-1 inhibitor A-1210477 on Hep3B cells and HepG2 cells treated with A-1331852 ( A , 0.05, 0.1, or 0.2 µM) for 24 h. * p < 0.05 vs. control cells. ( C ) Hep3B spheroids were seeded and after 24 h of aggregation treated with vehicle, regorafenib (R, 2.5 μM), and/or A-1331852 (A, 0.1 or 0.2 µM) for seven days. Spheroid growth was monitored daily (scale bar, 500 µm). (n = 3) * p < 0.05 vs. control cells, # p < 0.05 vs. regorafenib-treated cells.

Article Snippet: BCL-2 siRNA (h) (sc-29214), BCL-xL siRNA (h) (sc-43630), and scrambled controls were purchased from Santa Cruz Biotechnology (Dallas, TX, USA), while a second siRNA for BCL-2 (ID#s1915) and for BCL-xL (ID#s1920) were obtained from Ambion Life technologies (Carlsbad, CA, USA).

Techniques: Inhibition, Western Blot

Journal: Cancers

Article Title: Regorafenib Alteration of the BCL-xL/MCL-1 Ratio Provides a Therapeutic Opportunity for BH3-Mimetics in Hepatocellular Carcinoma Models

doi: 10.3390/cancers12020332

Figure Lengend Snippet: BCL-xL inhibitor A-1331852 remarkably reduced tumor growth in regorafenib-treated PDXs. ( A , B ), Subcutaneous growth quantification and images of BCLC9 tumors in mice treated with A-1331852 (25 mg/kg) and regorafenib (30 mg/kg) for 4 weeks (n = 4–6). * p < 0.05 vs. vehicle-treated mice. ( C ) Representative images of PCNA expression in tumor samples from BCLC9 PDXs and quantification (scale bar, 50 µm). ( D ) Transcriptomic analysis of cell death-related genes in BCLC9 tumors from nude mice treated with vehicle, regorafenib, and/or A-1331852. (n = 2).

Article Snippet: BCL-2 siRNA (h) (sc-29214), BCL-xL siRNA (h) (sc-43630), and scrambled controls were purchased from Santa Cruz Biotechnology (Dallas, TX, USA), while a second siRNA for BCL-2 (ID#s1915) and for BCL-xL (ID#s1920) were obtained from Ambion Life technologies (Carlsbad, CA, USA).

Techniques: Expressing

Journal: Cancers

Article Title: Regorafenib Alteration of the BCL-xL/MCL-1 Ratio Provides a Therapeutic Opportunity for BH3-Mimetics in Hepatocellular Carcinoma Models

doi: 10.3390/cancers12020332

Figure Lengend Snippet: Regorafenib-resistant HepG2 cells, exhibiting mRNA changes in BCL-xL and MCL-1, are re-sensitized to regorafenib by A-1331582. ( A ) Representative Western blot images of MCL-1, BCL-xL, BCL-2, BIM, and β-Actin protein levels in S and R HepG2 cells. * p < 0.05 vs. sensitive cells. ( B ) Effect of A-1331852 (A, 0.01 or 0.1 µM) on S and R HepG2 cells. * p < 0.05 vs. control cells. ( C ) Subcutaneous growth of R HepG2 cells in mice treated orally with A-1331852 (25 mg/kg) and regorafenib (30 mg/kg) for 2 weeks (n = 4). ( D ) Representative images of PCNA expression in tumors from HepG2 R CDXs (scale bar, 100 µm). * p < 0.05 vs. vehicle-treated mice.

Article Snippet: BCL-2 siRNA (h) (sc-29214), BCL-xL siRNA (h) (sc-43630), and scrambled controls were purchased from Santa Cruz Biotechnology (Dallas, TX, USA), while a second siRNA for BCL-2 (ID#s1915) and for BCL-xL (ID#s1920) were obtained from Ambion Life technologies (Carlsbad, CA, USA).

Techniques: Western Blot, Expressing

Journal: Cancers

Article Title: Regorafenib Alteration of the BCL-xL/MCL-1 Ratio Provides a Therapeutic Opportunity for BH3-Mimetics in Hepatocellular Carcinoma Models

doi: 10.3390/cancers12020332

Figure Lengend Snippet: Alterations in BCL-xL mRNA levels and BCL-xL/MCL-1 ratio in HCC patients. ( A ) BCL-xL and ( B ) BCL-xL/MCL-1 mRNA levels were measured by qPCR in healthy liver (n = 10) and in cirrhotic and tumoral tissue from HCC patients (n = 12) with Hepatitis C virus (HCV) and/or Ethanol (EtOH etiology. * p < 0.05 vs. control. ( C ) BCL-xL and ( D ) BCL-xL/MCL-1 mRNA levels were measured by qPCR in a commercial mRNA array with healthy liver (n = 8) and tumoral tissue from HCC patients in different stages (I-II, n = 14; IIIA-IV, n = 12). ( E , F ) Representation of survival probability depending on BCL-xL expression (blue, high; purple, low) in patients with liver and colorectal cancer, respectively.

Article Snippet: BCL-2 siRNA (h) (sc-29214), BCL-xL siRNA (h) (sc-43630), and scrambled controls were purchased from Santa Cruz Biotechnology (Dallas, TX, USA), while a second siRNA for BCL-2 (ID#s1915) and for BCL-xL (ID#s1920) were obtained from Ambion Life technologies (Carlsbad, CA, USA).

Techniques: Expressing

Journal: Experimental & Molecular Medicine

Article Title: Mitochondrial superoxide dismutase 2 mediates γ-irradiation-induced cancer cell invasion

doi: 10.1038/s12276-019-0207-5

Figure Lengend Snippet: a H460 cells were transfected with a control or a Bcl-X L -expression vector. After 24 and 48 h of incubation, SOD2 mRNA levels were compared by quantitative real-time PCR (top), and the levels of the indicated proteins were compared by western blotting (bottom). b The indicated cells were irradiated with the specified doses of γ-rays. Western blotting for SOD2 and Bcl-X L was performed at 24 and 48 h after irradiation. c Irradiated (2 Gy, 48 h) and untreated control H460 cells were incubated in the presence or absence of NAC (5 mM) and metformin (5 mM) for 1 h, and mitochondrial ROS levels were compared by staining cells with MitoSOX Red probes and analyzing them by flow cytometry. d Irradiated and untreated control cells were analyzed for their invasiveness in the presence or absence of NAC or metformin. The levels of Src and phosphorylated Src in the cells were compared by western blotting

Article Snippet: Small interfering RNA (siRNAs) targeting IL-6 (S7312) and Bcl-X L (120717) were purchased from Ambion (Austin, TX, USA). siRNAs targeting SOD2 (sc-41655), β-catenin (sc-44275), and STAT3 (sc-29209) as well as lentiviruses expressing small hairpin RNAs (shRNAs) targeting SOD2 (sc-41655-V), Bcl-X L (sc-43630-V), and SULF2 (sc-63088-V) were obtained from Santa Cruz Biotechnology.

Techniques: Transfection, Expressing, Plasmid Preparation, Incubation, Real-time Polymerase Chain Reaction, Western Blot, Irradiation, Staining, Flow Cytometry

Journal: Experimental & Molecular Medicine

Article Title: Mitochondrial superoxide dismutase 2 mediates γ-irradiation-induced cancer cell invasion

doi: 10.1038/s12276-019-0207-5

Figure Lengend Snippet: a H460 cells treated with a control, Bcl-X L -targeting, or SOD2-targeting siRNA were irradiated, and the levels of the indicated proteins were compared 24 h after irradiation. b H460 cells infected with lentiviruses expressing the specified shRNAs were transfected with a Bcl-X L or SOD2 expression vector in the indicated combinations. Cellular invasiveness and the levels of Bcl-X L and SOD2 were compared after 48 h of incubation. c H460 cells were transfected with a Bcl-X L or SOD2 expression vector in the indicated combinations. Cellular invasiveness and the levels of the indicated proteins were compared after 48 h of incubation. d H460 cells treated with a control or SOD2-targeting siRNA were irradiated (2 Gy). After 48 h of incubation, irradiated and untreated control cells were analyzed for their levels of O 2 •− and H 2 O 2 using MitoSox Red and Peroxy Orange-1, respectively. e H460 cells were transfected with a SULF2 expression vector and SOD2-targeting siRNA in the indicated combinations (left). Alternatively, H460 cells infected with lentiviruses expressing a control or SOD2-targeting shRNA were incubated in the presence or absence of 100 ng/mL IL-6 (right). After treatment for 24 h, cellular H 2 O 2 levels were compared using Peroxy Orange-1

Article Snippet: Small interfering RNA (siRNAs) targeting IL-6 (S7312) and Bcl-X L (120717) were purchased from Ambion (Austin, TX, USA). siRNAs targeting SOD2 (sc-41655), β-catenin (sc-44275), and STAT3 (sc-29209) as well as lentiviruses expressing small hairpin RNAs (shRNAs) targeting SOD2 (sc-41655-V), Bcl-X L (sc-43630-V), and SULF2 (sc-63088-V) were obtained from Santa Cruz Biotechnology.

Techniques: Irradiation, Infection, Expressing, Transfection, Plasmid Preparation, Incubation, shRNA

Journal: Experimental & Molecular Medicine

Article Title: Mitochondrial superoxide dismutase 2 mediates γ-irradiation-induced cancer cell invasion

doi: 10.1038/s12276-019-0207-5

Figure Lengend Snippet: STAT3 stimulated by IR via the p53/SULF2/β-catenin/IL-6 pathway induces Bcl-X L and SOD2 expression. Bcl-X L increases the ability of complex I to produce O 2 •− , and SOD2 converts mitochondrial O 2 •− to H 2 O 2 , which, in turn, acts as a signaling molecule to promote cell invasion

Article Snippet: Small interfering RNA (siRNAs) targeting IL-6 (S7312) and Bcl-X L (120717) were purchased from Ambion (Austin, TX, USA). siRNAs targeting SOD2 (sc-41655), β-catenin (sc-44275), and STAT3 (sc-29209) as well as lentiviruses expressing small hairpin RNAs (shRNAs) targeting SOD2 (sc-41655-V), Bcl-X L (sc-43630-V), and SULF2 (sc-63088-V) were obtained from Santa Cruz Biotechnology.

Techniques: Expressing

Journal: Molecular Medicine Reports

Article Title: Abnormal expression of miR-133a in patients with acute myocardial infarction following radical surgery for gastric cancer and the underlying mechanism

doi: 10.3892/mmr.2018.9541

Figure Lengend Snippet: miR-133a negatively regulates Bcl2l1 expression. A total of 48 h post-transfection, miR-133a and Bcl2l1 expression were detected using reverse transcription-quantitative polymerase chain reaction and western blot analysis. (A) miR-133a expression; (B) Bcl2l1 mRNA expression; (C) Bcl2l1 protein expression. Con, untreated HUVECs; NC: HUVECs transfected with NC; inhibitor, HUVECs transfected with a miR-133a inhibitor; inhibitor + Bcl2l1 siRNA: HUVECs cotransfected with a miR-133a inhibitor and Bcll12 siRNA. Data are presented as the mean ± standard deviation. *P<0.05 vs. the Con group; # P<0.05 vs. the NC group; & P<0.05 vs. the inhibitor group. Bcl2l1, B-cell lymphoma 2-like 1; HUVECs, human umbilical vein endothelial cells; miR-133a, microRNA-133a; NC, negative control; siRNA, small interfering RNA.

Article Snippet: A miR-133a inhibitor (5′CAGCUGGUUGAAGGGGACCAAA3′; 100 nM), NC (sense, 5′UUCUCCGAACGUGUCACGUTT3′ and antisense, 5′ACGUGACACGUUCGGAGAATT3′; 50 nM) or 2 µl B-cell lymphoma 2 (Bcl-2)-like 1 (Bcl2l1) small interfering (si)RNA (cat. no. sc-43630; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) were transfected into HUVECs (5×10 4 cells/well) using the Lipofectamine ® LTX kit (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol.

Techniques: Expressing, Transfection, Real-time Polymerase Chain Reaction, Western Blot, Standard Deviation, Negative Control, Small Interfering RNA

Journal: Molecular Medicine Reports

Article Title: Abnormal expression of miR-133a in patients with acute myocardial infarction following radical surgery for gastric cancer and the underlying mechanism

doi: 10.3892/mmr.2018.9541

Figure Lengend Snippet: Effects of miR-133a on HUVEC proliferation. A total of 48 h post-transfection, HUVEC proliferation was determined by MTT assay. Con, untreated HUVECs; NC: HUVECs transfected with NC; inhibitor, HUVECs transfected with a miR-133a inhibitor; inhibitor + Bcl2l1 siRNA, HUVECs cotransfected with a miR-133a inhibitor and Bcll12 siRNA. Data are presented as the mean ± standard deviation. *P<0.05 vs. the Con group; # P<0.05 vs. the NC group; & P<0.05 vs. the inhibitor group. Bcl2l1, B-cell lymphoma 2-like 1; HUVECs, human umbilical vein endothelial cells; miR-133a, microRNA-133a; NC, negative control; siRNA, small interfering RNA.

Article Snippet: A miR-133a inhibitor (5′CAGCUGGUUGAAGGGGACCAAA3′; 100 nM), NC (sense, 5′UUCUCCGAACGUGUCACGUTT3′ and antisense, 5′ACGUGACACGUUCGGAGAATT3′; 50 nM) or 2 µl B-cell lymphoma 2 (Bcl-2)-like 1 (Bcl2l1) small interfering (si)RNA (cat. no. sc-43630; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) were transfected into HUVECs (5×10 4 cells/well) using the Lipofectamine ® LTX kit (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol.

Techniques: Transfection, MTT Assay, Standard Deviation, Negative Control, Small Interfering RNA

Journal: Molecular Medicine Reports

Article Title: Abnormal expression of miR-133a in patients with acute myocardial infarction following radical surgery for gastric cancer and the underlying mechanism

doi: 10.3892/mmr.2018.9541

Figure Lengend Snippet: Effects of miR-133a on HUVEC apoptosis. (A) A total of 48 h post-transfection, HUVEC apoptosis was determined by flow cytometry. Con, untreated HUVECs; NC: HUVECs transfected with NC; inhibitor, HUVECs transfected with a miR-133a inhibitor; inhibitor + Bcl2l1 siRNA, HUVECs cotransfected with a miR-133a inhibitor and Bcll12 siRNA. (B) Data are presented as the mean ± standard deviation. *P<0.05 vs. the Con group; # P<0.05 vs. the NC group; & P<0.05 vs. the inhibitor group. Bcl2l1, B-cell lymphoma 2-like 1; FITC, fluorescein isothiocyanate; HUVECs, human umbilical vein endothelial cells; miR-133a, microRNA-133a; NC, negative control; PI, propidium iodide; siRNA, small interfering RNA.

Article Snippet: A miR-133a inhibitor (5′CAGCUGGUUGAAGGGGACCAAA3′; 100 nM), NC (sense, 5′UUCUCCGAACGUGUCACGUTT3′ and antisense, 5′ACGUGACACGUUCGGAGAATT3′; 50 nM) or 2 µl B-cell lymphoma 2 (Bcl-2)-like 1 (Bcl2l1) small interfering (si)RNA (cat. no. sc-43630; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) were transfected into HUVECs (5×10 4 cells/well) using the Lipofectamine ® LTX kit (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol.

Techniques: Transfection, Flow Cytometry, Standard Deviation, Negative Control, Small Interfering RNA