m132  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    ATCC m132
    M132, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/m132/product/ATCC
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    m132 - by Bioz Stars, 2024-10
    93/100 stars

    Images

    pa5 43521  (Thermo Fisher)


    Bioz Verified Symbol Thermo Fisher is a verified supplier
    Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    Thermo Fisher pa5 43521
    Immunohistochemical reagents used in experiments
    Pa5 43521, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pa5 43521/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pa5 43521 - by Bioz Stars, 2024-10
    86/100 stars

    Images

    1) Product Images from "Cone Synaptic Function is Modulated by the Leucine-Rich Repeat Adhesion Molecule LRFN2"

    Article Title: Cone Synaptic Function is Modulated by the Leucine-Rich Repeat Adhesion Molecule LRFN2

    Journal: eNeuro

    doi: 10.1523/ENEURO.0120-23.2024

    Immunohistochemical reagents used in experiments
    Figure Legend Snippet: Immunohistochemical reagents used in experiments

    Techniques Used: Immunohistochemical staining

    pa5 43521 pna molecular probes  (Thermo Fisher)


    Bioz Verified Symbol Thermo Fisher is a verified supplier
    Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    Thermo Fisher pa5 43521 pna molecular probes
    Key resources table
    Pa5 43521 Pna Molecular Probes, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pa5 43521 pna molecular probes/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pa5 43521 pna molecular probes - by Bioz Stars, 2024-10
    86/100 stars

    Images

    1) Product Images from "LRIT3 expression in cone photoreceptors restores post-synaptic bipolar cell signalplex assembly and partial function in Lrit3 −/− mice"

    Article Title: LRIT3 expression in cone photoreceptors restores post-synaptic bipolar cell signalplex assembly and partial function in Lrit3 −/− mice

    Journal: iScience

    doi: 10.1016/j.isci.2023.106499

    Key resources table
    Figure Legend Snippet: Key resources table

    Techniques Used: CRAfT Assay, Clone Assay, Recombinant, Plasmid Preparation, Software

    pa5 43521 pna molecular probes  (Thermo Fisher)


    Bioz Verified Symbol Thermo Fisher is a verified supplier
    Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    Thermo Fisher pa5 43521 pna molecular probes
    Key resources table
    Pa5 43521 Pna Molecular Probes, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pa5 43521 pna molecular probes/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pa5 43521 pna molecular probes - by Bioz Stars, 2024-10
    86/100 stars

    Images

    1) Product Images from "LRIT3 expression in cone photoreceptors restores post-synaptic bipolar cell signalplex assembly and partial function in Lrit3 −/− mice"

    Article Title: LRIT3 expression in cone photoreceptors restores post-synaptic bipolar cell signalplex assembly and partial function in Lrit3 −/− mice

    Journal: iScience

    doi: 10.1016/j.isci.2023.106499

    Key resources table
    Figure Legend Snippet: Key resources table

    Techniques Used: CRAfT Assay, Clone Assay, Recombinant, Plasmid Preparation, Software

    m132  (ATCC)


    Bioz Verified Symbol ATCC is a verified supplier
    Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    ATCC m132
    M132, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/m132/product/ATCC
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    m132 - by Bioz Stars, 2024-10
    93/100 stars

    Images

    pa5 43521  (Thermo Fisher)


    Bioz Verified Symbol Thermo Fisher is a verified supplier
    Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    Thermo Fisher pa5 43521
    Antibodies used for immunofluorescence, Co-Immunoprecipitation and immunoblotting
    Pa5 43521, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pa5 43521/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pa5 43521 - by Bioz Stars, 2024-10
    86/100 stars

    Images

    1) Product Images from "Frmpd1 Facilitates Trafficking of G-Protein Transducin and Modulates Synaptic Function in Rod Photoreceptors of Mammalian Retina"

    Article Title: Frmpd1 Facilitates Trafficking of G-Protein Transducin and Modulates Synaptic Function in Rod Photoreceptors of Mammalian Retina

    Journal: eNeuro

    doi: 10.1523/ENEURO.0348-22.2022

    Antibodies used for immunofluorescence, Co-Immunoprecipitation and immunoblotting
    Figure Legend Snippet: Antibodies used for immunofluorescence, Co-Immunoprecipitation and immunoblotting

    Techniques Used: Immunofluorescence, Western Blot, Immunoprecipitation

    51 43521 ″ e longitude  (Kannur corporation)

     
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    Kannur corporation 51 43521 ″ e longitude
    51 43521 ″ E Longitude, supplied by Kannur corporation, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/51 43521 ″ e longitude/product/Kannur corporation
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    51 43521 ″ e longitude - by Bioz Stars, 2024-10
    86/100 stars

    Images

    m132  (ATCC)


    Bioz Verified Symbol ATCC is a verified supplier
    Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    ATCC m132
    In silico analyses of restriction-modification systems in the sequenced M . hominis .
    M132, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/m132/product/ATCC
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    m132 - by Bioz Stars, 2024-10
    93/100 stars

    Images

    1) Product Images from "Random transposon insertion in the Mycoplasma hominis minimal genome"

    Article Title: Random transposon insertion in the Mycoplasma hominis minimal genome

    Journal: Scientific Reports

    doi: 10.1038/s41598-019-49919-y

    In silico analyses of restriction-modification systems in the sequenced M . hominis .
    Figure Legend Snippet: In silico analyses of restriction-modification systems in the sequenced M . hominis .

    Techniques Used: In Silico

    Position of the tet (M) gene in the M . hominis M132 transformants.
    Figure Legend Snippet: Position of the tet (M) gene in the M . hominis M132 transformants.

    Techniques Used:

    Insertion site of the tet (M) gene in the genome of the M . hominis M132 transformant 28-2. ( A ) Scheme of the transposon inserted into the M . hominis M132 genome. The region contains inverted repeats (point rectangles), the sequence of the pMT85 plasmid (white rectangles) and the tet (M) gene (dark gray rectangle). ( B ) Scheme of insertion site for transformant 28-2. Hatched rectangles represent the M . hominis M132 gene where the tet (M) gene inserted. Double thin lines represent the position of the insertion inside the M . hominis M132 gene. Clear gray rectangles correspond to sequence of the bacterial genome. Numbers above single thin lines indicate the position around the genome. Black arrows indicate the position of the PCR primers P75-F1 and P75-R1, and gray arrows indicate the position of the PCR primers P75-F2 and P75-R2.
    Figure Legend Snippet: Insertion site of the tet (M) gene in the genome of the M . hominis M132 transformant 28-2. ( A ) Scheme of the transposon inserted into the M . hominis M132 genome. The region contains inverted repeats (point rectangles), the sequence of the pMT85 plasmid (white rectangles) and the tet (M) gene (dark gray rectangle). ( B ) Scheme of insertion site for transformant 28-2. Hatched rectangles represent the M . hominis M132 gene where the tet (M) gene inserted. Double thin lines represent the position of the insertion inside the M . hominis M132 gene. Clear gray rectangles correspond to sequence of the bacterial genome. Numbers above single thin lines indicate the position around the genome. Black arrows indicate the position of the PCR primers P75-F1 and P75-R1, and gray arrows indicate the position of the PCR primers P75-F2 and P75-R2.

    Techniques Used: Sequencing, Plasmid Preparation

    Test of adhesion to HeLa cells. The graph shows the quantity of adhered M . hominis (copies/µL) as a function of the M . hominis inoculum (in CFU/mL). Blue points correspond to the M132 wild-type strain and gray points correspond to the 28-2 mutant. This experiment was performed in triplicate, and average values are represented. Standard deviation represents the above points by vertical lines.
    Figure Legend Snippet: Test of adhesion to HeLa cells. The graph shows the quantity of adhered M . hominis (copies/µL) as a function of the M . hominis inoculum (in CFU/mL). Blue points correspond to the M132 wild-type strain and gray points correspond to the 28-2 mutant. This experiment was performed in triplicate, and average values are represented. Standard deviation represents the above points by vertical lines.

    Techniques Used: Mutagenesis, Standard Deviation

    l gen n hominis  (ATCC)


    Bioz Verified Symbol ATCC is a verified supplier
    Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    ATCC l gen n hominis
    L Gen N Hominis, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/l gen n hominis/product/ATCC
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    l gen n hominis - by Bioz Stars, 2024-10
    93/100 stars

    Images

    cp009652 mycoplasma hominis atcc  (ATCC)


    Bioz Verified Symbol ATCC is a verified supplier
    Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    ATCC cp009652 mycoplasma hominis atcc
    Cp009652 Mycoplasma Hominis Atcc, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cp009652 mycoplasma hominis atcc/product/ATCC
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    cp009652 mycoplasma hominis atcc - by Bioz Stars, 2024-10
    93/100 stars

    Images

    fp236530 mycoplasma hominis atcc  (ATCC)


    Bioz Verified Symbol ATCC is a verified supplier
    Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    ATCC fp236530 mycoplasma hominis atcc
    Fp236530 Mycoplasma Hominis Atcc, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fp236530 mycoplasma hominis atcc/product/ATCC
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    fp236530 mycoplasma hominis atcc - by Bioz Stars, 2024-10
    93/100 stars

    Images

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • m132  (ATCC)
    93
    ATCC m132
    M132, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/m132/product/ATCC
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    m132 - by Bioz Stars, 2024-10
    93/100 stars
    		  Buy from Supplier
    pa5 43521  (Thermo Fisher)
    86
    Thermo Fisher pa5 43521
    Immunohistochemical reagents used in experiments
    Pa5 43521, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pa5 43521/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pa5 43521 - by Bioz Stars, 2024-10
    86/100 stars
    		  Buy from Supplier
    pa5 43521 pna molecular probes  (Thermo Fisher)
    86
    Thermo Fisher pa5 43521 pna molecular probes
    Key resources table
    Pa5 43521 Pna Molecular Probes, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pa5 43521 pna molecular probes/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pa5 43521 pna molecular probes - by Bioz Stars, 2024-10
    86/100 stars
    		  Buy from Supplier
    51 43521 ″ e longitude  (Kannur corporation)
    86
    Kannur corporation 51 43521 ″ e longitude
    Key resources table
    51 43521 ″ E Longitude, supplied by Kannur corporation, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/51 43521 ″ e longitude/product/Kannur corporation
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    51 43521 ″ e longitude - by Bioz Stars, 2024-10
    86/100 stars
    		  Buy from Supplier
    l gen n hominis  (ATCC)
    93
    ATCC l gen n hominis
    Key resources table
    L Gen N Hominis, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/l gen n hominis/product/ATCC
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    l gen n hominis - by Bioz Stars, 2024-10
    93/100 stars
    		  Buy from Supplier
    cp009652 mycoplasma hominis atcc  (ATCC)
    93
    ATCC cp009652 mycoplasma hominis atcc
    Key resources table
    Cp009652 Mycoplasma Hominis Atcc, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cp009652 mycoplasma hominis atcc/product/ATCC
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    cp009652 mycoplasma hominis atcc - by Bioz Stars, 2024-10
    93/100 stars
    		  Buy from Supplier
    fp236530 mycoplasma hominis atcc  (ATCC)
    93
    ATCC fp236530 mycoplasma hominis atcc
    Key resources table
    Fp236530 Mycoplasma Hominis Atcc, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fp236530 mycoplasma hominis atcc/product/ATCC
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    fp236530 mycoplasma hominis atcc - by Bioz Stars, 2024-10
    93/100 stars
    		  Buy from Supplier

    Image Search Results


    Immunohistochemical reagents used in experiments

    Journal: eNeuro

    Article Title: Cone Synaptic Function is Modulated by the Leucine-Rich Repeat Adhesion Molecule LRFN2

    doi: 10.1523/ENEURO.0120-23.2024

    Figure Lengend Snippet: Immunohistochemical reagents used in experiments

    Article Snippet: ELFN2 , 1:2,000 , Invitrogen , PA5-43521,.

    Techniques: Immunohistochemical staining

    Key resources table

    Journal: iScience

    Article Title: LRIT3 expression in cone photoreceptors restores post-synaptic bipolar cell signalplex assembly and partial function in Lrit3 −/− mice

    doi: 10.1016/j.isci.2023.106499

    Figure Lengend Snippet: Key resources table

    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Guinea pig anti-LRIT3 Ronald Gregg; Hasan et al. 10 N/A Rabbit anti-TRPM1 Ronald Gregg; Hasan et al. 10 N/A Goat anti-mGluR6 Ronald Gregg; This paper N/A Sheep anti-GPR179 Ronald Gregg; Peachey et al. 19 N/A Rabbit anti-mCAR Sheryl Craft, Zhu et al. 41 N/A Chicken anti-GFP Invitrogen Cat# A10262 Sheep anti-RGS11 Kiril Martemyanov; Cao et al. 42 N/A Rabbit anti-ELFN2 Invitrogen Cat# PA5-43521 PNA Molecular Probes Cat# L-32460 Donkey anti-sheep IgG-AlexaFluor 488 Life Technologies Cat# A111015 Donkey anti-rabbit IgG-AlexaFluor 647 Life Technologies Cat# A31573 Donkey anti-guinea pig IgG-Cy3 Millipore Cat# AP193C Donkey anti-rabbit IgG-AlexaFluor 488 Life Technologies Cat# A21206 Donkey anti-goat IgG-AlexaFluor 647 Life Technologies Cat# A32849 Donkey anti-chicken IgG-AlexaFluor 488 Jackson Immuno Research Laboratories Cat# 703-545-155;RRID: AB_2340375 Bacterial and virus strains pAAV-Gnat2::Lrit3 Ronald Gregg; This paper N/A rAAV8 capsid Vigene Biosciences N/A Critical commercial assays In-Fusion® HD Cloning Plus Takara Cat # 638910 Experimental models: Organisms/strains Mouse: Lrit3 em1Rgg Ronald Gregg MGI: 5645054 Mouse:C57Bl6/J Jackson Labs Stock # 000664; RRID:IMSR_JAX:000664 Oligonucleotides Lrit3 KO genotyping forward CTTTAAACGGAGTCTCGAAGC N/A Lrit3 KO genotyping reverse CTGACCGCCTCGTTTGGCAC N/A Recombinant DNA Plasmid Gnat2::Lrit3 This paper N/A Software and algorithms Prism 9.4.0 (673) Graphpad Software RRID: SCR_002798 MC_Rack 4.6.2 Multi Channel System RRID: SCR_014955 Offline Sorter 3.3.5 Plexon Inc RRID: SCR_000012 NeuroExplorer 5.103 Nex Technologies RRID: SCR_001818 Fluoview Olympus RRID: SCR_017015 Open in a separate window Key resources table .

    Techniques: CRAfT Assay, Clone Assay, Recombinant, Plasmid Preparation, Software