n d 0 5 s pullorum c7913  (ATCC)

Journal: bioRxiv

Article Title: Structural basis of lipid head group entry to the Kennedy pathway by FLVCR1

doi: 10.1101/2023.09.28.560019

Figure Lengend Snippet: a , Uptake of 21.5 μM choline by FLVCR1 -knockout HEK293T cells expressing a vector control (grey) or FLVCR1 cDNA (black) for 30 minutes. Error bars represent the standard deviation, n=3. b , Schematic of FLVCR1 colored by helix. c-d , Cryo-EM density map (c) and model of FLVCR1 (d). Model is colored by helix as in b. Grey lines correspond to the approximate position of the membrane. e , Central slice of FLVCR1 with surface colored by electrostatic potential. f , Central slice of FLVCR1 with choline and choline-coordinating residues shown as sticks. Density is shown as a grey isosurface and contoured at 3.0 α. g-h , Choline-binding site. Residues that comprise the substrate-binding site are shown as sticks. Density is shown as a grey isosurface in (g) and contoured at 3.0 α.

Article Snippet: Cryo-EM maps have been deposited in the EMDB under accession codes EMD-42107 (choline-bound FLVCR1), EMD-42108 (ethanolamine-bound FLVCR1), EMD-42109 (endogenous choline-bound FLVCR1), EMD-42110 (endogenous choline-bound FLVCR1, from images collected in 1 mM ethanolamine) and EMD-42111 (endogenous ligand-bound FLVCR1).

Techniques: Knock-Out, Expressing, Plasmid Preparation, Standard Deviation, Cryo-EM Sample Prep, Membrane, Binding Assay

Journal: bioRxiv

Article Title: Structural basis of lipid head group entry to the Kennedy pathway by FLVCR1

doi: 10.1101/2023.09.28.560019

Figure Lengend Snippet: a,c , FLVCR1 in endogenous choline-bound (a) or endogenous ligand-bound (c) states, determined from particles imaged in the absence of exogenous substrate. Dashed box corresponds to the substrate-binding sites shown in b and d. b,d , Substrate-binding sites in endogenous choline-bound (b) or endogenous ligand-bound (d) states, determined from particles imaged in the absence of exogenous substrate. Residues and modelled substrates are shown as sticks. Density is shown as a grey isosurface and contoured at 3.0 α. e , Superposition of endogenous choline-bound (blue) and endogenous ligand-bound (green) states. f , Superposition of substrate-binding sites in endogenous choline-bound (blue) and endogenous ligand-bound (green). Substrate-binding site residues and modelled substrates are shown as sticks.

Article Snippet: Cryo-EM maps have been deposited in the EMDB under accession codes EMD-42107 (choline-bound FLVCR1), EMD-42108 (ethanolamine-bound FLVCR1), EMD-42109 (endogenous choline-bound FLVCR1), EMD-42110 (endogenous choline-bound FLVCR1, from images collected in 1 mM ethanolamine) and EMD-42111 (endogenous ligand-bound FLVCR1).

Techniques: Binding Assay

Journal: bioRxiv

Article Title: Structural basis of lipid head group entry to the Kennedy pathway by FLVCR1

doi: 10.1101/2023.09.28.560019

Figure Lengend Snippet: a , Pearson correlation of co-dependencies between FLVCR1 and all genes computed from CRISPR DepMap Chronos 2023Q2. Genes in the ethanolamine (gold) and choline (blue) branches of the Kennedy pathway are highlighted. b , Schematic of the ethanolamine (left) and choline (right) branches of the Kennedy pathway. c-d , Uptake of 2 µM ethanolamine (c) or 21.5 µM choline (d) by control HEK293T cells, FLVCR1 -knockout HEK293T cells expressing a vector control, and FLVCR1 -knockout HEK293T cells expressing FLVCR1 cDNA normalized to the uptake of control HEK293T cells. Error bars represent the standard deviation, n=3. e , Uptake of 2 µM ethanolamine by FLVCR1 -knockout HEK293T cells expressing a vector control (grey) or FLVCR1 cDNA (black), incubated for the indicated time point. Error bars represent the standard deviation, n=3. f , Uptake of ethanolamine by FLVCR1 -knockout HEK293T cells expressing a vector control (grey) or FLVCR1 cDNA (black), incubated with the indicated total ethanolamine concentration for 30 minutes. Error bars represent the standard deviation, n=3. g , Substrate-binding site in the ethanolamine-bound state. Residues and modelled substrates are shown as sticks. Density is shown as a grey isosurface and contoured at 3.0 α. h-i , Superposition of substrate-binding sites in the choline-bound (blue) and ethanolamine-bound (gold) states, shown in two views. Substrate-binding site residues and modelled substrates are shown as sticks.

Article Snippet: Cryo-EM maps have been deposited in the EMDB under accession codes EMD-42107 (choline-bound FLVCR1), EMD-42108 (ethanolamine-bound FLVCR1), EMD-42109 (endogenous choline-bound FLVCR1), EMD-42110 (endogenous choline-bound FLVCR1, from images collected in 1 mM ethanolamine) and EMD-42111 (endogenous ligand-bound FLVCR1).

Techniques: CRISPR, Knock-Out, Expressing, Plasmid Preparation, Standard Deviation, Incubation, Concentration Assay, Binding Assay

Journal: bioRxiv

Article Title: Structural basis of lipid head group entry to the Kennedy pathway by FLVCR1

doi: 10.1101/2023.09.28.560019

Figure Lengend Snippet: a , Uptake of 2 µM ethanolamine (a) or 2 µM choline (b) by FLVCR1 -knockout HEK293T cells expressing a vector control or wild-type or mutant FLVCR1 cDNA for 30 minutes normalized to the uptake by FLVCR1 -knockout HEK293T cells expressing wild-type FLVCR1 . Error bars represent the standard deviation, n=3. c-d , Schematic for tracing [1,2- 13 C 2 ] ethanolamine (c) or [1,2- 13 C 2 ] choline (d) into downstream metabolites. e , Abundance of phosphoethanolamine M+2 after incubation with 2 µM [1,2- 13 C 2 ] ethanolamine for 1 hour in FLVCR1 -knockout HEK293T cells expressing a vector control or wild-type or mutant FLVCR1 cDNA. Data shown as mean ± standard deviation; n=3. f , Abundance of phosphocholine M+2 after incubation with 21.5 µM [1,2- 13 C 2 ] choline for 1 hour in FLVCR1 -knockout HEK293T cells expressing a vector control or wild-type or mutant FLVCR1 cDNA. Data shown as mean ± standard deviation; n=3. g , Schematic of the phosphatidylcholine and phosphatidylethanolamine biosynthetic pathways.

Article Snippet: Cryo-EM maps have been deposited in the EMDB under accession codes EMD-42107 (choline-bound FLVCR1), EMD-42108 (ethanolamine-bound FLVCR1), EMD-42109 (endogenous choline-bound FLVCR1), EMD-42110 (endogenous choline-bound FLVCR1, from images collected in 1 mM ethanolamine) and EMD-42111 (endogenous ligand-bound FLVCR1).

Techniques: Knock-Out, Expressing, Plasmid Preparation, Mutagenesis, Standard Deviation, Incubation

Journal: Environmental Microbiology

Article Title: Nutrient-regulated transcriptional responses in the brown tide forming alga Aureococcus anophagefferens

doi: 10.1111/j.1462-2920.2010.02351.x

Figure Lengend Snippet: Successfully annotated tags showing greater than two-fold up-regulation in both the –N and –P libraries relative to the control library ( R -value >2). A protein ID is given for: 1) tags that map directly to the genome where a gene model exists, or 2) tags that map to an EST that overlaps with a gene model on the genome. ESTs are given for tags annotated by mapping to an EST.

Article Snippet: Additionally, three tags (1814, 2687, and 922) mapped to three different proteins involved in light harvesting, with all three tags showing similar magnitudes of up-regulation ( ). table ft1 table-wrap mode="anchored" t5 caption a7 Tag ID Sequence R -value Fold change for: Putative annotation EST Protein ID -P -N 1814 CATGATGGGCGTCACGGGCGC 15.58 4.8 3.2 Chloroplast light harvesting protein isoform 3 [Isochrysis galbana] - 59955 10695 CATGGAGGAGGTCAACCTCCT 3.940 14.6 17.6 Contains oxidoreductase domain - 72519 2687 CATGTTCGGCGAGGGCCAGAC 3.834 4.4 2.7 Plastid light harvesting protein isoform 39 (manually curated) 1 - 77828 922 CATGCCGGCGGCCGTGCCGGG 3.401 3.6 3.9 Fucoxanthin chlorophyll a/c protein, deviant [Phaeodactylum tricornutum CCAP 1055/1] 4208996:1 - 1894 CATGCTCGGGCTCGCGCACGC 3.327 7.8 3.6 Glycosyl transferase group 1 [Herpetosiphon aurantiacus ATCC 23779] 4211177:45 - 1481 CATGGCCCGCAGCGACCTCCA 3.276 2.3 5.4 Sensory transduction histidine kinase [Psychroflexus torquis ATCC 700755] - 71871 1839 CATGCCCGACTACACCAAGTC 3.041 3.4 2.0 Oxidoreductase, acting on the aldehyde or oxo group of donors, disulfide as acceptor / pyruvate dehydrogenase (acetyl-transferring) [Arabidopsis thaliana] - 53060 1951 CATGTTCCTGTCGCTCGACGT 3.026 16.0 6.8 Cation efflux system protein [Oceanicola batsensis HTCC2597] 4211177:393 - 6839 CATGGTCGGCGGCATCGACGA 3.026 16.0 6.8 RecName: Full=ATP synthase subunit beta, mitochondrial; Flags: Precursor 4206114:1 - 3296 CATGCCGACGCCGCGCGCGCT 2.610 Absent 2 Absent PREDICTED: similar to dishevelled-associated activator of morphogenesis 1 isoform 1 [Danio rerio] - 70943 1941 CATGTGGATGCAAGCGGCTGC 2.580 3.3 3.7 Glutaminyl-tRNA synthetase, putative [Perkinsus marinus ATCC 50983] 4211177:152 - 2546 CATGGCGCGGTACCAGATCGG 2.057 7.3 2.7 O-methyltransferase, putative [Streptomyces ghanaensis ATCC 14672] 4211177:220 - Open in a separate window 1 Manually curated notes the gene model was manually assigned a function and reviewed by a curator.

Techniques: Sequencing, Transduction