3730xl dna analyzer  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    3730xl DNA Analyzer
    Description:
    The 96-capillary 3730xl DNA Analyzer is the Gold Standard for high throughput genetic analysis. Use this for DNA fragment analysis applications such as microsatellites, AFLP, SNP analysis, mutation detection and traditional DNA sequencing. Get the highest quality data at a low cost per sample. • Higher optical sensitivity and advanced polymers enable you to obtain higher-quality sequencing data for less. • Multiple automation features decrease costly human errors. • Optimized polymers increase your productivity without compromising your results. • Perform a wide variety of sequencing and fragment analysis applications including resequencing, microsatellite analysis, AFLP, LOH, SSCP, SNP screening and SNP validation.Large-Scale DNA Analysis on a Small-Scale BudgetBy combining advances in automation with innovative optics and proprietary reagents to increase throughput, yield high-quality data, and minimize reagent consumption, the 3730xl Analyzer provides your laboratory and production facility with faster, better, cheaper analysis.Streamline Your Workflow The 3730xl DNA Analyzer system is engineered for highly reliable, unattended operation of up to 48 hours (applies to modules with run times longer than 30 minutes). To minimize the need for operator intervention and decrease the risk of human error, automation features include an integrated plate stacker, internal bar code reader, and onboard polymer delivery system.Increase ProductivityThe high signal-to-noise ratio ensures you get high-quality data – even when you use low-concentration samples and reagents. Labor-saving automation features minimize hands-on time and enable you to analyze more data more efficiently. Get the Highest-Quality Sequencing and Genotyping DataThe enhanced optical design provides a higher signal-to-noise ratio and a more uniform signal profile across the array. This design, combined with our new, advanced polymer, enables the longest read lengths of any available system, and provides enhanced color balance for streamlined genotyping sample handling. In addition, exceptional sensitivity enables higher success rates across a wide range of sample template types and concentrations. One Instrument, Multiple ApplicationsWith the 3730xl DNA Analyzer, you get the highest-quality data from a wide array of applications. In addition to being ideal for high-throughput sequencing, the analyzer's optimized application assays, instrument, and analysis software also provide a complete solution for genotyping and resequencing. Integrated Data Analysis Tools Reduce Time-to-ResultsThe 3730xl DNA Analyzer software suite allows you to generate more meaningful data with less work. This system's labor-saving software suite includes: • Data Collection (supplied with the instrument) – Manages your instrument setup, controls instrument operations, allows real-time data visualization, and performs diagnostics.• Sequencing Analysis Software – Designed to base-call; assign quality values; trim, display, edit and print DNA sequencing data using the KB basecaller • Seqscape – Provides everything you need to perform resequencing applications such as VariantSEQr Resequencing System • GeneMapper – Enables configurable, automated allele calling; a plus for high-throughput genotyping and includes tools for SNPlex data analysis New features include: • Auto-analysis with GeneMapper and SeqScape • Flexibility to use any choice in dye set option • Tools to assist with regulatory and compliance requirements (In the United States, this assists with FDA 21CFR part 11). • Additional optimized run modules covering more applications • Support for fragment analysis applications on the 96-capillary arrayThe instrument comes with a one year limited warranty on parts and labor. For Research Use Only. Not for use in diagnostics procedures.
    Catalog Number:
    3730XL
    Price:
    None
    Applications:
    Amplified Fragment Length Polymorphism-AFLP|Bacterial Artificial Chromosome (BAC) Fingerprinting|DNA Sequencing|Epigenetic Sequencing|Fragment Analysis|Genotyping & Genomic Profiling|Methylation-Sensitive Mobility Shift Assay|Microsatellite Marker Analysis|Mitochondrial Sequencing|Quantitative Fluorescence PCR (qf-PCR)|RNAi, Epigenetics & Non-Coding RNA Research|Resequencing|SNP Genotyping by Fragment-Analysis|Sanger Sequencing|Sanger Sequencing Technology & Accessories|Methylation Analysis|Gene Expression Analysis & Genotyping|SNP Genotyping|Sequencing|Methylation Analysis by Sequencing|Restriction Fragment Length Polymorphisms (RFLP) Analysis|Single-Strand Conformation Polymorphism (SSCP) Analysis|Genotyping Instruments, Software & Calibration|Chimerism|Microsatellite Instability|Microsatellite STR Analysis|ISSR (Inter-Simple Sequence Repeat) Analysis|Microsatellite Analysis
    Size:
    1 system
    Category:
    Instruments and Equipment, Sequencing & Genetic Analyzer Instruments & Accessories, Sequencing & Genetic Analyzer Instruments
    Score:
    85
    Buy from Supplier


    Structured Review

    Thermo Fisher 3730xl dna analyzer
    Separation of APTS-labelled oligosaccharides by CE in an ABI <t>3730xl</t> <t>DNA</t> sequencer. (A) Electropherogram trace (50 min) of APTS labelled hydrolysed dextran and β-1,4-xylo oligosaccharides DP1 to DP6. (B) Large DP hydrolysed dextran oligosaccharides can be resolved by extending the electrophoresis time to 90 minutes. RFU, relative fluorescence units; G, Glucose; X, Xylose.
    The 96-capillary 3730xl DNA Analyzer is the Gold Standard for high throughput genetic analysis. Use this for DNA fragment analysis applications such as microsatellites, AFLP, SNP analysis, mutation detection and traditional DNA sequencing. Get the highest quality data at a low cost per sample. • Higher optical sensitivity and advanced polymers enable you to obtain higher-quality sequencing data for less. • Multiple automation features decrease costly human errors. • Optimized polymers increase your productivity without compromising your results. • Perform a wide variety of sequencing and fragment analysis applications including resequencing, microsatellite analysis, AFLP, LOH, SSCP, SNP screening and SNP validation.Large-Scale DNA Analysis on a Small-Scale BudgetBy combining advances in automation with innovative optics and proprietary reagents to increase throughput, yield high-quality data, and minimize reagent consumption, the 3730xl Analyzer provides your laboratory and production facility with faster, better, cheaper analysis.Streamline Your Workflow The 3730xl DNA Analyzer system is engineered for highly reliable, unattended operation of up to 48 hours (applies to modules with run times longer than 30 minutes). To minimize the need for operator intervention and decrease the risk of human error, automation features include an integrated plate stacker, internal bar code reader, and onboard polymer delivery system.Increase ProductivityThe high signal-to-noise ratio ensures you get high-quality data – even when you use low-concentration samples and reagents. Labor-saving automation features minimize hands-on time and enable you to analyze more data more efficiently. Get the Highest-Quality Sequencing and Genotyping DataThe enhanced optical design provides a higher signal-to-noise ratio and a more uniform signal profile across the array. This design, combined with our new, advanced polymer, enables the longest read lengths of any available system, and provides enhanced color balance for streamlined genotyping sample handling. In addition, exceptional sensitivity enables higher success rates across a wide range of sample template types and concentrations. One Instrument, Multiple ApplicationsWith the 3730xl DNA Analyzer, you get the highest-quality data from a wide array of applications. In addition to being ideal for high-throughput sequencing, the analyzer's optimized application assays, instrument, and analysis software also provide a complete solution for genotyping and resequencing. Integrated Data Analysis Tools Reduce Time-to-ResultsThe 3730xl DNA Analyzer software suite allows you to generate more meaningful data with less work. This system's labor-saving software suite includes: • Data Collection (supplied with the instrument) – Manages your instrument setup, controls instrument operations, allows real-time data visualization, and performs diagnostics.• Sequencing Analysis Software – Designed to base-call; assign quality values; trim, display, edit and print DNA sequencing data using the KB basecaller • Seqscape – Provides everything you need to perform resequencing applications such as VariantSEQr Resequencing System • GeneMapper – Enables configurable, automated allele calling; a plus for high-throughput genotyping and includes tools for SNPlex data analysis New features include: • Auto-analysis with GeneMapper and SeqScape • Flexibility to use any choice in dye set option • Tools to assist with regulatory and compliance requirements (In the United States, this assists with FDA 21CFR part 11). • Additional optimized run modules covering more applications • Support for fragment analysis applications on the 96-capillary arrayThe instrument comes with a one year limited warranty on parts and labor. For Research Use Only. Not for use in diagnostics procedures.
    https://www.bioz.com/result/3730xl dna analyzer/product/Thermo Fisher
    Average 99 stars, based on 2731 article reviews
    Price from $9.99 to $1999.99
    3730xl dna analyzer - by Bioz Stars, 2019-12
    99/100 stars

    Images

    1) Product Images from "Development and application of a high throughput carbohydrate profiling technique for analyzing plant cell wall polysaccharides and carbohydrate active enzymes"

    Article Title: Development and application of a high throughput carbohydrate profiling technique for analyzing plant cell wall polysaccharides and carbohydrate active enzymes

    Journal: Biotechnology for Biofuels

    doi: 10.1186/1754-6834-6-94

    Separation of APTS-labelled oligosaccharides by CE in an ABI 3730xl DNA sequencer. (A) Electropherogram trace (50 min) of APTS labelled hydrolysed dextran and β-1,4-xylo oligosaccharides DP1 to DP6. (B) Large DP hydrolysed dextran oligosaccharides can be resolved by extending the electrophoresis time to 90 minutes. RFU, relative fluorescence units; G, Glucose; X, Xylose.
    Figure Legend Snippet: Separation of APTS-labelled oligosaccharides by CE in an ABI 3730xl DNA sequencer. (A) Electropherogram trace (50 min) of APTS labelled hydrolysed dextran and β-1,4-xylo oligosaccharides DP1 to DP6. (B) Large DP hydrolysed dextran oligosaccharides can be resolved by extending the electrophoresis time to 90 minutes. RFU, relative fluorescence units; G, Glucose; X, Xylose.

    Techniques Used: Electrophoresis, Fluorescence

    Related Articles

    Clone Assay:

    Article Title: Genomic and structural investigation on dolphin morbillivirus (DMV) in Mediterranean fin whales (Balaenoptera physalus)
    Article Snippet: Paragraph title: Primer design, PCR protocol and cloning procedures ... The PCR products obtained were size-separated by agarose gel electrophoresis, to be then displayed in agarose gel (3730xl DNA Analyzer, Thermo Scientific).

    Article Title: Genomic and proteomic analyses of Mycobacterium bovis BCG Mexico 1931 reveal a diverse immunogenic repertoire against tuberculosis infection
    Article Snippet: The genome of M. bovis BCG Mexico 1931 was sequenced using 454 pyrosequencing, which was performed by the Sequencing Unit of CINVESTAV, Irapuato, Mexico. .. Additionally, a fosmid library with inserts of approximately 40 kb was constructed using the CopyControl™ pCCFOS™ system (Epicentre Technologies, USA), and the fos-end sequences of 250 clones were determined using the Sanger method (3730xl DNA Analyzer, Applied Biosystems, USA). .. Draft assemblies were based on 623,000 reads (36× coverage), and the Phred/Phrap/Consed software package was employed for sequence assembly and quality assessment [ ] using the BCG Pasteur 1173P2 sequence as a reference [GenBank: AM408590 ].

    Amplification:

    Article Title: Microsatellite polymorphism in the Heme oxygenase-1 gene promoter is associated with dermal collagen density in Japanese obese male subjects
    Article Snippet: The promoter region of the HMOX1 gene was amplified by PCR using AmpliTaq Gold PCR Master Mix (Thermo Fisher Scientific) and specific primers with the following sequences: AGAGCCTGCAGCTTCTCAGA (forward) and ACAAAGTCTGGCCATAGGCA (reverse). .. The number of GT repeats was determined from the sequences of PCR products analyzed by dye terminator methods using a DNA capillary sequencer (3730xl DNA analyzer, Thermo Fisher Scientific).

    Article Title: Genomic and structural investigation on dolphin morbillivirus (DMV) in Mediterranean fin whales (Balaenoptera physalus)
    Article Snippet: Amplification was performed using a high-fidelity polymerase (Phusion Hot Start II DNA Polymerase, Thermo Scientific), with the following PCR conditions: 30 sec at 98 °C; 35 cycles of 10 sec at 98 °C, 30 sec at 58 °C, 1 min at 72 °C; 10 min at 72 °C. .. The PCR products obtained were size-separated by agarose gel electrophoresis, to be then displayed in agarose gel (3730xl DNA Analyzer, Thermo Scientific).

    Article Title: Variants in Human Prostacyclin Receptor Gene in Patients with Migraine Headache
    Article Snippet: The amplification mixture was prepared in 50μL volume including 1X buffer, 1.5 mmol/l magnesium chloride, 200 μmol/l dNTP, 400 nmol/L of each primer, 200 ng/μl DNA, and 2 U Taq DNA polymerase. .. The PCR products were sequenced using a cycle sequencing kit on an automated DNA sequencing machine (BigDye Terminator v3.1 and 3730XL DNA analyzer, Applied Biosystems).

    Article Title: Resistance-Associated NS5A Variants of Hepatitis C Virus Are Susceptible to Interferon-Based Therapy
    Article Snippet: Briefly, viral RNA was extracted from serum, reverse-transcribed and amplified by the two-step nested PCR method. .. The PCR products were purified and sequenced using an automated DNA sequencer (3730xl DNA Analyzer, Applied Biosystems).

    Article Title: Connexin 26 (GJB2) mutation in an Argentinean patient with keratitis-ichthyosis-deafness (KID) syndrome: a case report
    Article Snippet: Bi-directional DNA sequencing was performed on an automatic sequencer (3730xl DNA Analyzer, Applied Biosystems, Foster City, CA, USA). .. The sequence trace was aligned to the wild type sequence of the GJB2 gene (NCBI accession number NG_008358.1) using the NCBI interface ( http://www.ncbi.nlm.nih.gov/Blast.cgi ).

    Article Title: Biodiversity of Trichoderma (Hypocreaceae) in Southern Europe and Macaronesia
    Article Snippet: A 0.9 kb fragment of the larger subunit of ATP citrate lyase (acl1 ) was amplified using the primers acl1-230up and acl1-1220low ( ). .. DNA sequences were obtained after purification of the amplicons with an enzymatic PCR clean-up as described by using the BigDye Terminator v. 3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, California) and an automated DNA sequencer (3730xl DNA Analyzer, Applied Biosystems) with the same primers as in PCR or with the internal primers TEF1_INTF and TEF1_INTR ( ) for tef1 .

    Article Title: Molecular cytogenetic characterization of canine histiocytic sarcoma: A spontaneous model for human histiocytic cancer identifies deletion of tumor suppressor genes and highlights influence of genetic background on tumor behavior
    Article Snippet: Amplicons were visualized and evaluated by capillary-electrophoresis (3730xl DNA Analyzer, Applied BioSystems). .. Amplicons were visualized and evaluated by capillary-electrophoresis (3730xl DNA Analyzer, Applied BioSystems).

    Article Title: Real-life prevalence of resistance-associated variants against non-structural protein 5A inhibitors and efficiency of Daclatasvir + Asunaprevir therapy in Korean patients with genotype 1b hepatitis C
    Article Snippet: The extracted RNA was reverse transcribed and amplified by the PCR method using the SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (Invitrogen) with the pairs of primers as follows: sense (5872–5891) 5′-AAGAGGCTCCACCAGTGGAT-3′ and antisense (6730–6749) 5′-CGCCGGAGCGTACCTGTGCA-3′. .. The PCR products were purified using a QIAquick PCR Purification Kit (QIAGEN) and sequenced using an automated DNA sequencer (3730xl DNA Analyzer, Applied Biosystems).

    Article Title: Hypolobocera guayaquilensis (Decapoda: Pseudothelphusidae): A New Crab Intermediate Host of Paragonimus mexicanus in Manabí Province, Ecuador
    Article Snippet: Then, the amplicons with or without enzymatic treatment were separated by electrophoresis on 2% (w/v) agarose gels. .. All amplified products were sequenced using the corresponding primers and the BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific) on an automated sequencer (3730xl DNA Analyzer, Thermo Fisher Scientific). .. Sequences were aligned and compared using GENETYX-Win software (Ver.

    Article Title: Overexpression of Human-Derived DNMT3A Induced Intergenerational Inheritance of Active DNA Methylation Changes in Rat Sperm
    Article Snippet: The PCR program was as follows: 94°C 5 min; 94°C 30 s, 65°C 30 s, and 72°C for 1 min, decrease in the annealing temperature by 0.7°C per cycle during 12 cycles, and then 24 cycles of 94°C for 30 s, 56°C for 30 s, and 72°C for 1 min with a final extension of 10 min at 72°C. .. The selective amplification product was detected by capillary electrophoresis (3730xl DNA analyzer, Applied Biosystems, U.S.) and analyzed by GeneMapper 4.0 (Applied Biosystems, U.S.). .. Only the bands that had a signal height more than 1,000, a fragment length longer than 50 bp but shorter than 500 bp, and the same pattern in at least two of three replicates were used for subsequent analysis (Supplemental Figure ).

    Article Title: Complex Pattern of Resistance-Associated Substitutions of Hepatitis C Virus after Daclatasvir/Asunaprevir Treatment Failure
    Article Snippet: The extracted RNA was reverse-transcribed and amplified by the two-step nested PCR method using the SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (Invitrogen), with specific pairs of primers. .. The PCR products were purified using QIAquick PCR Purification Kit (QIAGEN) and sequenced using an automated DNA sequencer (3730xl DNA Analyzer, Applied Biosystems).

    Article Title: Molecular Modeling and Phylogeny of the Krüppel-like Factor 4 (cKLF4) Protein from the Arabian Camel, Camelus dromedarius
    Article Snippet: PCR products were analyzed by electrophoresis using a 1.2% agarose gel ( ). .. The full-length coding sequence of cKLF4 was obtained using the 3730XL series platform Sequencer (Applied Biosystems). cDNA fragments of 877 and 1,560 bp were amplified by PCR using the primer couple cKLF4F1/cKLF4R1 and cKLF4F2/cKLF4R2 ( , ), which were then sequenced using 3730XL DNA Sequencer (Applied Biosystems) using the same PCR primers; nucleotide sequences were determined in both forward and reverse directions, and the sequences were analyzed using Geneious 7.1.7 software ( http://www.geneious.com ). .. The similarity of the obtained sequence was examined in the GenBank database using the BLASTN algorithm on the NCBI BLAST server ( http://blast.ncbi.nlm.nih.gov/Blast.cgi ).

    Construct:

    Article Title: Genomic and proteomic analyses of Mycobacterium bovis BCG Mexico 1931 reveal a diverse immunogenic repertoire against tuberculosis infection
    Article Snippet: The genome of M. bovis BCG Mexico 1931 was sequenced using 454 pyrosequencing, which was performed by the Sequencing Unit of CINVESTAV, Irapuato, Mexico. .. Additionally, a fosmid library with inserts of approximately 40 kb was constructed using the CopyControl™ pCCFOS™ system (Epicentre Technologies, USA), and the fos-end sequences of 250 clones were determined using the Sanger method (3730xl DNA Analyzer, Applied Biosystems, USA). .. Draft assemblies were based on 623,000 reads (36× coverage), and the Phred/Phrap/Consed software package was employed for sequence assembly and quality assessment [ ] using the BCG Pasteur 1173P2 sequence as a reference [GenBank: AM408590 ].

    Electrophoresis:

    Article Title: Hypolobocera guayaquilensis (Decapoda: Pseudothelphusidae): A New Crab Intermediate Host of Paragonimus mexicanus in Manabí Province, Ecuador
    Article Snippet: Then, the amplicons with or without enzymatic treatment were separated by electrophoresis on 2% (w/v) agarose gels. .. All amplified products were sequenced using the corresponding primers and the BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific) on an automated sequencer (3730xl DNA Analyzer, Thermo Fisher Scientific).

    Article Title: Overexpression of Human-Derived DNMT3A Induced Intergenerational Inheritance of Active DNA Methylation Changes in Rat Sperm
    Article Snippet: The PCR program was as follows: 94°C 5 min; 94°C 30 s, 65°C 30 s, and 72°C for 1 min, decrease in the annealing temperature by 0.7°C per cycle during 12 cycles, and then 24 cycles of 94°C for 30 s, 56°C for 30 s, and 72°C for 1 min with a final extension of 10 min at 72°C. .. The selective amplification product was detected by capillary electrophoresis (3730xl DNA analyzer, Applied Biosystems, U.S.) and analyzed by GeneMapper 4.0 (Applied Biosystems, U.S.). .. Only the bands that had a signal height more than 1,000, a fragment length longer than 50 bp but shorter than 500 bp, and the same pattern in at least two of three replicates were used for subsequent analysis (Supplemental Figure ).

    Article Title: Analysis of Coinfections with A/H1N1 Strain Variants among Pigs in Poland by Multitemperature Single-Strand Conformational Polymorphism
    Article Snippet: The MSSCP conditions were optimized and the electrophoresis was performed on a polyacrylamide gel (10% T, 3.3% C), in 0.75x TBE buffer, at 40 W. The temperature profile of the electrophoresis was 15–10–5°C. .. The ssDNA was eluted, reamplified (using the primers and PCR conditions described above), purified with exonuclease I and shrimp alkaline phosphatase (Fermentas, catalogue numbers EN0581 and EF0511), and analyzed by Sanger sequencing (3730xl DNA Analyzer, Applied Biosystems, Carlsbad, CA, USA).

    Article Title: Phase I study of TP300 in patients with advanced solid tumors with pharmacokinetic, pharmacogenetic and pharmacodynamic analyses
    Article Snippet: The fragments obtained were purified using X-Terninator purification kit (Applied Biosystems) and analysed on an automated DNA sequencer (3730xl DNA Analyzer, Applied Biosystems). .. The fragments obtained were purified using X-Terninator purification kit (Applied Biosystems) and analysed on an automated DNA sequencer (3730xl DNA Analyzer, Applied Biosystems).

    Article Title: Effects of Age and Hindlimb Immobilization and Remobilization on Fast Troponin T Precursor mRNA Alternative Splicing in Rat Gastrocnemius Muscle
    Article Snippet: Briefly, the frozen gastrocnemius muscle was pulverized under liquid nitrogen and total RNA was isolated using Trizol reagent as per the manufacturer’s protocol (Invitrogen). cDNA was prepared using a High Capacity cDNA Reverse Transcription kit (Applied Biosystems), and PCR was carried out using GoTaq DNA polymerase (Promega) with a fluorescein-labeled forward primer and two reverse primers as previously described ( ). .. The fluorescein-labeled PCR amplicons were analyzed by capillary electrophoresis (3730XL DNA Analyzer, Applied Biosystems) and the fragment size of the PCR amplicons was determined using the 1200 LIZ internal size standard (Applied Biosystems). .. The peak height value for each PCR amplicon was obtained by analysis using Peak Scanner software (Applied Biosystems).

    Luciferase:

    Article Title: WT1 Protein Directly Regulates Expression of Vascular Endothelial Growth Factor and Is a Mediator of Tumor Response to Hypoxia
    Article Snippet: Mutations in putative WT1 binding sites in the VEGF promoter were prepared using the QuikChange site-directed mutagenesis kit (Agilent Technologies, Santa Clara, CA) on the luciferase reporter plasmid pPVEGF-luc. .. Mutations were confirmed by sequencing (3730xl DNA Analyzer, Applied Biosystems).

    Modification:

    Article Title: Overexpression of Human-Derived DNMT3A Induced Intergenerational Inheritance of Active DNA Methylation Changes in Rat Sperm
    Article Snippet: All EcoR I-selective primers were modified with 5′-FAM. .. The selective amplification product was detected by capillary electrophoresis (3730xl DNA analyzer, Applied Biosystems, U.S.) and analyzed by GeneMapper 4.0 (Applied Biosystems, U.S.).

    RAST Test:

    Article Title: Genomic and proteomic analyses of Mycobacterium bovis BCG Mexico 1931 reveal a diverse immunogenic repertoire against tuberculosis infection
    Article Snippet: Additionally, a fosmid library with inserts of approximately 40 kb was constructed using the CopyControl™ pCCFOS™ system (Epicentre Technologies, USA), and the fos-end sequences of 250 clones were determined using the Sanger method (3730xl DNA Analyzer, Applied Biosystems, USA). .. To close gaps and resolve duplicated regions, the complete sequences of three fosmids (approximately 40 kb) and 110 PCR end reads were obtained.

    Ligation:

    Article Title: Overexpression of Human-Derived DNMT3A Induced Intergenerational Inheritance of Active DNA Methylation Changes in Rat Sperm
    Article Snippet: The pre-amplification reaction contained 5 μl 10× PCR buffer, 4 μl dNTPs (2.5 mM), 5 U rTaq (TaKaRa, Japan), 5 μl diluted ligation product, 2 μl E1 primer (10 μM, Supplemental Table ), 2 μl HM1 primer (10 μM, Supplemental Table ), and ddH2 O to a final volume of 50 μl. .. The selective amplification product was detected by capillary electrophoresis (3730xl DNA analyzer, Applied Biosystems, U.S.) and analyzed by GeneMapper 4.0 (Applied Biosystems, U.S.).

    Generated:

    Article Title: TILLING in the two-rowed barley cultivar 'Barke' reveals preferred sites of functional diversity in the gene HvHox1
    Article Snippet: For confirmation of presumed mutated loci, amplicons of the respective target gene were generated from putative mutants by utilising the same PCR conditions as established for CEL I analysis. .. Sequencing reactions were resolved on a 96-capillary sequencing device (3730xl DNA Analyzer, Applied Biosystems, Foster City, USA).

    DNA Sequencing:

    Article Title: Variants in Human Prostacyclin Receptor Gene in Patients with Migraine Headache
    Article Snippet: The PCR products were stained and visualized on a UV transilluminator, following 1.5% gel electrophoresis. .. The PCR products were sequenced using a cycle sequencing kit on an automated DNA sequencing machine (BigDye Terminator v3.1 and 3730XL DNA analyzer, Applied Biosystems). .. All sequences were matched to the PTGIR reference sequence using NCBI blast.

    Article Title: A Report of a Novel Mutation in Human Prostacyclin Receptor Gene in Patients Affected with Migraine
    Article Snippet: Prior to sequencing, the PCR products were stained with ethidium bromide and visualized on a UV transilluminator following 1.5% gel electrophoresis. .. The PCR products were then sequenced using a cycle sequencing kit on an automated DNA sequencing machine (BigDye Terminator v3.1 and 3730XL DNA analyzer, Applied Biosystems). .. All sequences were matched to the PTGIR reference sequence using NCBI blast, and in silico analysis was performed to determine the effect of the variants.

    Article Title: Connexin 26 (GJB2) mutation in an Argentinean patient with keratitis-ichthyosis-deafness (KID) syndrome: a case report
    Article Snippet: PCR products were then purified from the remaining nucleotides and primers using QIAquick PCR purification Kit (Qiagen, GmbH, Hilden, Germany) according to the manufacturer’s protocol. .. Bi-directional DNA sequencing was performed on an automatic sequencer (3730xl DNA Analyzer, Applied Biosystems, Foster City, CA, USA). .. The sequence trace was aligned to the wild type sequence of the GJB2 gene (NCBI accession number NG_008358.1) using the NCBI interface ( http://www.ncbi.nlm.nih.gov/Blast.cgi ).

    Article Title: Molecular Modeling and Phylogeny of the Krüppel-like Factor 4 (cKLF4) Protein from the Arabian Camel, Camelus dromedarius
    Article Snippet: Paragraph title: DNA sequencing and prediction of amino acid sequence ... The full-length coding sequence of cKLF4 was obtained using the 3730XL series platform Sequencer (Applied Biosystems). cDNA fragments of 877 and 1,560 bp were amplified by PCR using the primer couple cKLF4F1/cKLF4R1 and cKLF4F2/cKLF4R2 ( , ), which were then sequenced using 3730XL DNA Sequencer (Applied Biosystems) using the same PCR primers; nucleotide sequences were determined in both forward and reverse directions, and the sequences were analyzed using Geneious 7.1.7 software ( http://www.geneious.com ).

    Article Title: TILLING in the two-rowed barley cultivar 'Barke' reveals preferred sites of functional diversity in the gene HvHox1
    Article Snippet: Paragraph title: DNA sequencing and sequence data processing ... Sequencing reactions were resolved on a 96-capillary sequencing device (3730xl DNA Analyzer, Applied Biosystems, Foster City, USA).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Real-life prevalence of resistance-associated variants against non-structural protein 5A inhibitors and efficiency of Daclatasvir + Asunaprevir therapy in Korean patients with genotype 1b hepatitis C
    Article Snippet: The extracted RNA was reverse transcribed and amplified by the PCR method using the SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (Invitrogen) with the pairs of primers as follows: sense (5872–5891) 5′-AAGAGGCTCCACCAGTGGAT-3′ and antisense (6730–6749) 5′-CGCCGGAGCGTACCTGTGCA-3′. .. The PCR products were purified using a QIAquick PCR Purification Kit (QIAGEN) and sequenced using an automated DNA sequencer (3730xl DNA Analyzer, Applied Biosystems).

    Article Title: Complex Pattern of Resistance-Associated Substitutions of Hepatitis C Virus after Daclatasvir/Asunaprevir Treatment Failure
    Article Snippet: The extracted RNA was reverse-transcribed and amplified by the two-step nested PCR method using the SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (Invitrogen), with specific pairs of primers. .. The PCR products were purified using QIAquick PCR Purification Kit (QIAGEN) and sequenced using an automated DNA sequencer (3730xl DNA Analyzer, Applied Biosystems).

    Binding Assay:

    Article Title: WT1 Protein Directly Regulates Expression of Vascular Endothelial Growth Factor and Is a Mediator of Tumor Response to Hypoxia
    Article Snippet: Mutations in putative WT1 binding sites in the VEGF promoter were prepared using the QuikChange site-directed mutagenesis kit (Agilent Technologies, Santa Clara, CA) on the luciferase reporter plasmid pPVEGF-luc. .. Mutations were confirmed by sequencing (3730xl DNA Analyzer, Applied Biosystems).

    Multiplexing:

    Article Title: Molecular cytogenetic characterization of canine histiocytic sarcoma: A spontaneous model for human histiocytic cancer identifies deletion of tumor suppressor genes and highlights influence of genetic background on tumor behavior
    Article Snippet: The M13 primer was tagged at the 5' end either with PET, VIC, FAM or NED (Applied Biosystems) to facilitate multiplexing of products. .. Amplicons were visualized and evaluated by capillary-electrophoresis (3730xl DNA Analyzer, Applied BioSystems).

    Nucleic Acid Electrophoresis:

    Article Title: Variants in Human Prostacyclin Receptor Gene in Patients with Migraine Headache
    Article Snippet: The PCR products were stained and visualized on a UV transilluminator, following 1.5% gel electrophoresis. .. The PCR products were sequenced using a cycle sequencing kit on an automated DNA sequencing machine (BigDye Terminator v3.1 and 3730XL DNA analyzer, Applied Biosystems).

    Article Title: A Report of a Novel Mutation in Human Prostacyclin Receptor Gene in Patients Affected with Migraine
    Article Snippet: Prior to sequencing, the PCR products were stained with ethidium bromide and visualized on a UV transilluminator following 1.5% gel electrophoresis. .. The PCR products were then sequenced using a cycle sequencing kit on an automated DNA sequencing machine (BigDye Terminator v3.1 and 3730XL DNA analyzer, Applied Biosystems).

    Methylation:

    Article Title: Overexpression of Human-Derived DNMT3A Induced Intergenerational Inheritance of Active DNA Methylation Changes in Rat Sperm
    Article Snippet: Paragraph title: Methylation-sensitive amplification polymorphism (MSAP) assay ... The selective amplification product was detected by capillary electrophoresis (3730xl DNA analyzer, Applied Biosystems, U.S.) and analyzed by GeneMapper 4.0 (Applied Biosystems, U.S.).

    Mutagenesis:

    Article Title: Connexin 26 (GJB2) mutation in an Argentinean patient with keratitis-ichthyosis-deafness (KID) syndrome: a case report
    Article Snippet: Paragraph title: Mutation analysis of GJB2 ... Bi-directional DNA sequencing was performed on an automatic sequencer (3730xl DNA Analyzer, Applied Biosystems, Foster City, CA, USA).

    Article Title: WT1 Protein Directly Regulates Expression of Vascular Endothelial Growth Factor and Is a Mediator of Tumor Response to Hypoxia
    Article Snippet: Mutations in putative WT1 binding sites in the VEGF promoter were prepared using the QuikChange site-directed mutagenesis kit (Agilent Technologies, Santa Clara, CA) on the luciferase reporter plasmid pPVEGF-luc. .. Mutations were confirmed by sequencing (3730xl DNA Analyzer, Applied Biosystems).

    Article Title: TILLING in the two-rowed barley cultivar 'Barke' reveals preferred sites of functional diversity in the gene HvHox1
    Article Snippet: Sequencing reactions were resolved on a 96-capillary sequencing device (3730xl DNA Analyzer, Applied Biosystems, Foster City, USA). .. Sequencing reactions were resolved on a 96-capillary sequencing device (3730xl DNA Analyzer, Applied Biosystems, Foster City, USA).

    Isolation:

    Article Title: Real-life prevalence of resistance-associated variants against non-structural protein 5A inhibitors and efficiency of Daclatasvir + Asunaprevir therapy in Korean patients with genotype 1b hepatitis C
    Article Snippet: Viral RNA was isolated from 200 μL plasma samples utilizing the QIA Amp MiniElute Virus Vacuum Kit (Catalog No. 57714 Qiagen, Inc. Valencia, CA) and the QiaCube workstation. .. The PCR products were purified using a QIAquick PCR Purification Kit (QIAGEN) and sequenced using an automated DNA sequencer (3730xl DNA Analyzer, Applied Biosystems).

    Article Title: Hypolobocera guayaquilensis (Decapoda: Pseudothelphusidae): A New Crab Intermediate Host of Paragonimus mexicanus in Manabí Province, Ecuador
    Article Snippet: All amplified products were sequenced using the corresponding primers and the BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific) on an automated sequencer (3730xl DNA Analyzer, Thermo Fisher Scientific). .. All amplified products were sequenced using the corresponding primers and the BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific) on an automated sequencer (3730xl DNA Analyzer, Thermo Fisher Scientific).

    Article Title: Effects of Age and Hindlimb Immobilization and Remobilization on Fast Troponin T Precursor mRNA Alternative Splicing in Rat Gastrocnemius Muscle
    Article Snippet: Briefly, the frozen gastrocnemius muscle was pulverized under liquid nitrogen and total RNA was isolated using Trizol reagent as per the manufacturer’s protocol (Invitrogen). cDNA was prepared using a High Capacity cDNA Reverse Transcription kit (Applied Biosystems), and PCR was carried out using GoTaq DNA polymerase (Promega) with a fluorescein-labeled forward primer and two reverse primers as previously described ( ). .. The fluorescein-labeled PCR amplicons were analyzed by capillary electrophoresis (3730XL DNA Analyzer, Applied Biosystems) and the fragment size of the PCR amplicons was determined using the 1200 LIZ internal size standard (Applied Biosystems).

    Sequencing:

    Article Title: Genomic and structural investigation on dolphin morbillivirus (DMV) in Mediterranean fin whales (Balaenoptera physalus)
    Article Snippet: The other set of primers ( ) were designed using Prime3 based on the available DMV gene sequence Genbank Acc. .. The PCR products obtained were size-separated by agarose gel electrophoresis, to be then displayed in agarose gel (3730xl DNA Analyzer, Thermo Scientific).

    Article Title: Variants in Human Prostacyclin Receptor Gene in Patients with Migraine Headache
    Article Snippet: The PCR products were stained and visualized on a UV transilluminator, following 1.5% gel electrophoresis. .. The PCR products were sequenced using a cycle sequencing kit on an automated DNA sequencing machine (BigDye Terminator v3.1 and 3730XL DNA analyzer, Applied Biosystems). .. All sequences were matched to the PTGIR reference sequence using NCBI blast.

    Article Title: A Report of a Novel Mutation in Human Prostacyclin Receptor Gene in Patients Affected with Migraine
    Article Snippet: Prior to sequencing, the PCR products were stained with ethidium bromide and visualized on a UV transilluminator following 1.5% gel electrophoresis. .. The PCR products were then sequenced using a cycle sequencing kit on an automated DNA sequencing machine (BigDye Terminator v3.1 and 3730XL DNA analyzer, Applied Biosystems). .. All sequences were matched to the PTGIR reference sequence using NCBI blast, and in silico analysis was performed to determine the effect of the variants.

    Article Title: Resistance-Associated NS5A Variants of Hepatitis C Virus Are Susceptible to Interferon-Based Therapy
    Article Snippet: Paragraph title: Analysis by direct sequencing ... The PCR products were purified and sequenced using an automated DNA sequencer (3730xl DNA Analyzer, Applied Biosystems).

    Article Title: Biodiversity of Trichoderma (Hypocreaceae) in Southern Europe and Macaronesia
    Article Snippet: A 0.9 kb fragment of the larger subunit of ATP citrate lyase (acl1 ) was amplified using the primers acl1-230up and acl1-1220low ( ). .. DNA sequences were obtained after purification of the amplicons with an enzymatic PCR clean-up as described by using the BigDye Terminator v. 3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, California) and an automated DNA sequencer (3730xl DNA Analyzer, Applied Biosystems) with the same primers as in PCR or with the internal primers TEF1_INTF and TEF1_INTR ( ) for tef1 . .. The three markers (acl1 , rpb2 , tef1 ) sequenced in the present study were analysed separately.

    Article Title: Genomic and proteomic analyses of Mycobacterium bovis BCG Mexico 1931 reveal a diverse immunogenic repertoire against tuberculosis infection
    Article Snippet: Paragraph title: BCG Mexico 1931 genome sequencing ... Additionally, a fosmid library with inserts of approximately 40 kb was constructed using the CopyControl™ pCCFOS™ system (Epicentre Technologies, USA), and the fos-end sequences of 250 clones were determined using the Sanger method (3730xl DNA Analyzer, Applied Biosystems, USA).

    Article Title: Real-life prevalence of resistance-associated variants against non-structural protein 5A inhibitors and efficiency of Daclatasvir + Asunaprevir therapy in Korean patients with genotype 1b hepatitis C
    Article Snippet: Direct sequencing of HCV NS5A Y93 and L31 gene regions from plasma samples was performed. .. The PCR products were purified using a QIAquick PCR Purification Kit (QIAGEN) and sequenced using an automated DNA sequencer (3730xl DNA Analyzer, Applied Biosystems).

    Article Title: Hypolobocera guayaquilensis (Decapoda: Pseudothelphusidae): A New Crab Intermediate Host of Paragonimus mexicanus in Manabí Province, Ecuador
    Article Snippet: Then, the amplicons with or without enzymatic treatment were separated by electrophoresis on 2% (w/v) agarose gels. .. All amplified products were sequenced using the corresponding primers and the BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific) on an automated sequencer (3730xl DNA Analyzer, Thermo Fisher Scientific). .. Sequences were aligned and compared using GENETYX-Win software (Ver.

    Article Title: WT1 Protein Directly Regulates Expression of Vascular Endothelial Growth Factor and Is a Mediator of Tumor Response to Hypoxia
    Article Snippet: Mutations in putative WT1 binding sites in the VEGF promoter were prepared using the QuikChange site-directed mutagenesis kit (Agilent Technologies, Santa Clara, CA) on the luciferase reporter plasmid pPVEGF-luc. .. Mutations were confirmed by sequencing (3730xl DNA Analyzer, Applied Biosystems). .. VEGF promoter regulation by WT1 was assayed using a reporter vector expressing the cDNA (pGL2) for firefly luciferase driven by 3.3 kb of the VEGF promoter.

    Article Title: Complex Pattern of Resistance-Associated Substitutions of Hepatitis C Virus after Daclatasvir/Asunaprevir Treatment Failure
    Article Snippet: Paragraph title: Analysis by direct sequencing ... The PCR products were purified using QIAquick PCR Purification Kit (QIAGEN) and sequenced using an automated DNA sequencer (3730xl DNA Analyzer, Applied Biosystems).

    Article Title: Analysis of Coinfections with A/H1N1 Strain Variants among Pigs in Poland by Multitemperature Single-Strand Conformational Polymorphism
    Article Snippet: The ssDNA bands of altered MSSCP mobility, compared to the reference sample, were cut out. .. The ssDNA was eluted, reamplified (using the primers and PCR conditions described above), purified with exonuclease I and shrimp alkaline phosphatase (Fermentas, catalogue numbers EN0581 and EF0511), and analyzed by Sanger sequencing (3730xl DNA Analyzer, Applied Biosystems, Carlsbad, CA, USA). .. The amplified HA gene fragments from the five isolates (sw1–5) were subjected to clonal selection of mixed genetic variants.

    Article Title: Molecular Modeling and Phylogeny of the Krüppel-like Factor 4 (cKLF4) Protein from the Arabian Camel, Camelus dromedarius
    Article Snippet: PCR products were analyzed by electrophoresis using a 1.2% agarose gel ( ). .. The full-length coding sequence of cKLF4 was obtained using the 3730XL series platform Sequencer (Applied Biosystems). cDNA fragments of 877 and 1,560 bp were amplified by PCR using the primer couple cKLF4F1/cKLF4R1 and cKLF4F2/cKLF4R2 ( , ), which were then sequenced using 3730XL DNA Sequencer (Applied Biosystems) using the same PCR primers; nucleotide sequences were determined in both forward and reverse directions, and the sequences were analyzed using Geneious 7.1.7 software ( http://www.geneious.com ). .. The similarity of the obtained sequence was examined in the GenBank database using the BLASTN algorithm on the NCBI BLAST server ( http://blast.ncbi.nlm.nih.gov/Blast.cgi ).

    Article Title: Phase I study of TP300 in patients with advanced solid tumors with pharmacokinetic, pharmacogenetic and pharmacodynamic analyses
    Article Snippet: The amplicons were subsequently treated with ExoSAP-IT (GE Healthcare) followed by the reactions with a cycle sequencing kit (BigDye Terminator v3.1, Applied Biosystems). .. The fragments obtained were purified using X-Terninator purification kit (Applied Biosystems) and analysed on an automated DNA sequencer (3730xl DNA Analyzer, Applied Biosystems).

    Article Title: Effects of Age and Hindlimb Immobilization and Remobilization on Fast Troponin T Precursor mRNA Alternative Splicing in Rat Gastrocnemius Muscle
    Article Snippet: The methods used for RNA isolation, reverse transcription, and PCR analysis as well as the sequence of the primers used to quantify TNNT3 splice forms has been previously published ( ). .. The fluorescein-labeled PCR amplicons were analyzed by capillary electrophoresis (3730XL DNA Analyzer, Applied Biosystems) and the fragment size of the PCR amplicons was determined using the 1200 LIZ internal size standard (Applied Biosystems).

    Article Title: TILLING in the two-rowed barley cultivar 'Barke' reveals preferred sites of functional diversity in the gene HvHox1
    Article Snippet: Amplicons were purified by ultrafiltration using a QIAvac 96 vacuum (Qiagen, Hilden, Germany), processed with a NucleoFast-96 PCR Plate (MACHEREY-NAGEL GmbH & Co. KG, Düren, Germany) and directly cycle-sequenced using the ABI Big Dye terminator v3.1 sequencing standard kit according to the manufacturer's protocol (Applied Biosystems, Foster City, USA). .. Sequencing reactions were resolved on a 96-capillary sequencing device (3730xl DNA Analyzer, Applied Biosystems, Foster City, USA). .. Sequences were aligned against the "wild-type" reference of the 'Barke' cultivar with Sequencher 4.6 software (Gene Codes, Ann Arbor, MI).

    Size-exclusion Chromatography:

    Article Title: Genomic and structural investigation on dolphin morbillivirus (DMV) in Mediterranean fin whales (Balaenoptera physalus)
    Article Snippet: Amplification was performed using a high-fidelity polymerase (Phusion Hot Start II DNA Polymerase, Thermo Scientific), with the following PCR conditions: 30 sec at 98 °C; 35 cycles of 10 sec at 98 °C, 30 sec at 58 °C, 1 min at 72 °C; 10 min at 72 °C. .. The PCR products obtained were size-separated by agarose gel electrophoresis, to be then displayed in agarose gel (3730xl DNA Analyzer, Thermo Scientific).

    Article Title: Hypolobocera guayaquilensis (Decapoda: Pseudothelphusidae): A New Crab Intermediate Host of Paragonimus mexicanus in Manabí Province, Ecuador
    Article Snippet: The PCR was carried out on a thermal cycler (TaKaRa PCR Thermal Cycler Dice Gradient, Takara Bio, Shiga, Japan), with 30 cycles of 98°C for 10 sec, 55°C for 10 sec, and 72°C for 15 sec. An initial denaturation and final extension were performed at 98°C for 30 sec and at 72°C for 7 min, respectively. .. All amplified products were sequenced using the corresponding primers and the BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific) on an automated sequencer (3730xl DNA Analyzer, Thermo Fisher Scientific).

    Labeling:

    Article Title: Molecular cytogenetic characterization of canine histiocytic sarcoma: A spontaneous model for human histiocytic cancer identifies deletion of tumor suppressor genes and highlights influence of genetic background on tumor behavior
    Article Snippet: PCR was conducted in 10 μl reactions containing 0.8 units Taq polymerase (Go Taq, Promega), 1.0 μl 10× reaction buffer (Promega), 0.25 mM each dNTP, 0.15 μM each microsatellite-specific primer, 0.1 μM 5' fluorescently labeled M13 primer and 50 ng template DNA. .. Amplicons were visualized and evaluated by capillary-electrophoresis (3730xl DNA Analyzer, Applied BioSystems).

    Purification:

    Article Title: Resistance-Associated NS5A Variants of Hepatitis C Virus Are Susceptible to Interferon-Based Therapy
    Article Snippet: Briefly, viral RNA was extracted from serum, reverse-transcribed and amplified by the two-step nested PCR method. .. The PCR products were purified and sequenced using an automated DNA sequencer (3730xl DNA Analyzer, Applied Biosystems). .. Each sequence was confirmed for the sense and anti-sense strands.

    Article Title: Connexin 26 (GJB2) mutation in an Argentinean patient with keratitis-ichthyosis-deafness (KID) syndrome: a case report
    Article Snippet: PCR products were then purified from the remaining nucleotides and primers using QIAquick PCR purification Kit (Qiagen, GmbH, Hilden, Germany) according to the manufacturer’s protocol. .. Bi-directional DNA sequencing was performed on an automatic sequencer (3730xl DNA Analyzer, Applied Biosystems, Foster City, CA, USA).

    Article Title: Biodiversity of Trichoderma (Hypocreaceae) in Southern Europe and Macaronesia
    Article Snippet: A 0.9 kb fragment of the larger subunit of ATP citrate lyase (acl1 ) was amplified using the primers acl1-230up and acl1-1220low ( ). .. DNA sequences were obtained after purification of the amplicons with an enzymatic PCR clean-up as described by using the BigDye Terminator v. 3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, California) and an automated DNA sequencer (3730xl DNA Analyzer, Applied Biosystems) with the same primers as in PCR or with the internal primers TEF1_INTF and TEF1_INTR ( ) for tef1 . .. The three markers (acl1 , rpb2 , tef1 ) sequenced in the present study were analysed separately.

    Article Title: Real-life prevalence of resistance-associated variants against non-structural protein 5A inhibitors and efficiency of Daclatasvir + Asunaprevir therapy in Korean patients with genotype 1b hepatitis C
    Article Snippet: The extracted RNA was reverse transcribed and amplified by the PCR method using the SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (Invitrogen) with the pairs of primers as follows: sense (5872–5891) 5′-AAGAGGCTCCACCAGTGGAT-3′ and antisense (6730–6749) 5′-CGCCGGAGCGTACCTGTGCA-3′. .. The PCR products were purified using a QIAquick PCR Purification Kit (QIAGEN) and sequenced using an automated DNA sequencer (3730xl DNA Analyzer, Applied Biosystems). .. Two primer sets for sequencing through the NS5A L31 and Y93 coding regions are: forward sequencing primer (1bseqF2) 5′-TCCGGCTCGTGGCTAAGAGATGTTTGGG-3′ and reverse sequencing primer (1bseqR5) 5′-CAGTGGTCATGCCCGTCACGTAGTG-3′.

    Article Title: Complex Pattern of Resistance-Associated Substitutions of Hepatitis C Virus after Daclatasvir/Asunaprevir Treatment Failure
    Article Snippet: The extracted RNA was reverse-transcribed and amplified by the two-step nested PCR method using the SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (Invitrogen), with specific pairs of primers. .. The PCR products were purified using QIAquick PCR Purification Kit (QIAGEN) and sequenced using an automated DNA sequencer (3730xl DNA Analyzer, Applied Biosystems). .. Each sequence was confirmed for both sense and anti-sense strands.

    Article Title: Analysis of Coinfections with A/H1N1 Strain Variants among Pigs in Poland by Multitemperature Single-Strand Conformational Polymorphism
    Article Snippet: The ssDNA bands of altered MSSCP mobility, compared to the reference sample, were cut out. .. The ssDNA was eluted, reamplified (using the primers and PCR conditions described above), purified with exonuclease I and shrimp alkaline phosphatase (Fermentas, catalogue numbers EN0581 and EF0511), and analyzed by Sanger sequencing (3730xl DNA Analyzer, Applied Biosystems, Carlsbad, CA, USA). .. The amplified HA gene fragments from the five isolates (sw1–5) were subjected to clonal selection of mixed genetic variants.

    Article Title: Phase I study of TP300 in patients with advanced solid tumors with pharmacokinetic, pharmacogenetic and pharmacodynamic analyses
    Article Snippet: The amplicons were subsequently treated with ExoSAP-IT (GE Healthcare) followed by the reactions with a cycle sequencing kit (BigDye Terminator v3.1, Applied Biosystems). .. The fragments obtained were purified using X-Terninator purification kit (Applied Biosystems) and analysed on an automated DNA sequencer (3730xl DNA Analyzer, Applied Biosystems). .. The resulted sequences were compared against the reference sequence using the variant reporter software (Applied Biosystems).

    Article Title: TILLING in the two-rowed barley cultivar 'Barke' reveals preferred sites of functional diversity in the gene HvHox1
    Article Snippet: Amplicons were purified by ultrafiltration using a QIAvac 96 vacuum (Qiagen, Hilden, Germany), processed with a NucleoFast-96 PCR Plate (MACHEREY-NAGEL GmbH & Co. KG, Düren, Germany) and directly cycle-sequenced using the ABI Big Dye terminator v3.1 sequencing standard kit according to the manufacturer's protocol (Applied Biosystems, Foster City, USA). .. Sequencing reactions were resolved on a 96-capillary sequencing device (3730xl DNA Analyzer, Applied Biosystems, Foster City, USA).

    Polymerase Chain Reaction:

    Article Title: Microsatellite polymorphism in the Heme oxygenase-1 gene promoter is associated with dermal collagen density in Japanese obese male subjects
    Article Snippet: The PCR products were extracted using a NucleoSpin Gel and PCR clean-up kit (Takara Bio, Shiga, Japan). .. The number of GT repeats was determined from the sequences of PCR products analyzed by dye terminator methods using a DNA capillary sequencer (3730xl DNA analyzer, Thermo Fisher Scientific). .. As a parameter of oxidative stress levels, genomic DNA was pretreated by 8OHdG Assay Preparation Reagent Set (Wako Pure Chemical, Osaka, Japan), and 8OHdG levels were measured using the Highly Sensitive ELISA kit for 8OHdG (Japan Institute for the Control of Aging, Shizuoka, Japan) according to the manufacturers’ instructions.

    Article Title: Genomic and structural investigation on dolphin morbillivirus (DMV) in Mediterranean fin whales (Balaenoptera physalus)
    Article Snippet: Amplification was performed using a high-fidelity polymerase (Phusion Hot Start II DNA Polymerase, Thermo Scientific), with the following PCR conditions: 30 sec at 98 °C; 35 cycles of 10 sec at 98 °C, 30 sec at 58 °C, 1 min at 72 °C; 10 min at 72 °C. .. The PCR products obtained were size-separated by agarose gel electrophoresis, to be then displayed in agarose gel (3730xl DNA Analyzer, Thermo Scientific). .. The PCR products obtained from lung and cerebral cDNA were purified, cloned into plasmid vector PCR-Blunt II TOPO (Thermo Scientific) according to the manufacturer’s instructions, and then sequenced.

    Article Title: Variants in Human Prostacyclin Receptor Gene in Patients with Migraine Headache
    Article Snippet: The PCR products were stained and visualized on a UV transilluminator, following 1.5% gel electrophoresis. .. The PCR products were sequenced using a cycle sequencing kit on an automated DNA sequencing machine (BigDye Terminator v3.1 and 3730XL DNA analyzer, Applied Biosystems). .. All sequences were matched to the PTGIR reference sequence using NCBI blast.

    Article Title: A Report of a Novel Mutation in Human Prostacyclin Receptor Gene in Patients Affected with Migraine
    Article Snippet: Prior to sequencing, the PCR products were stained with ethidium bromide and visualized on a UV transilluminator following 1.5% gel electrophoresis. .. The PCR products were then sequenced using a cycle sequencing kit on an automated DNA sequencing machine (BigDye Terminator v3.1 and 3730XL DNA analyzer, Applied Biosystems). .. All sequences were matched to the PTGIR reference sequence using NCBI blast, and in silico analysis was performed to determine the effect of the variants.

    Article Title: Resistance-Associated NS5A Variants of Hepatitis C Virus Are Susceptible to Interferon-Based Therapy
    Article Snippet: Briefly, viral RNA was extracted from serum, reverse-transcribed and amplified by the two-step nested PCR method. .. The PCR products were purified and sequenced using an automated DNA sequencer (3730xl DNA Analyzer, Applied Biosystems). .. Each sequence was confirmed for the sense and anti-sense strands.

    Article Title: Connexin 26 (GJB2) mutation in an Argentinean patient with keratitis-ichthyosis-deafness (KID) syndrome: a case report
    Article Snippet: PCR products were then purified from the remaining nucleotides and primers using QIAquick PCR purification Kit (Qiagen, GmbH, Hilden, Germany) according to the manufacturer’s protocol. .. Bi-directional DNA sequencing was performed on an automatic sequencer (3730xl DNA Analyzer, Applied Biosystems, Foster City, CA, USA).

    Article Title: Biodiversity of Trichoderma (Hypocreaceae) in Southern Europe and Macaronesia
    Article Snippet: A 0.9 kb fragment of the larger subunit of ATP citrate lyase (acl1 ) was amplified using the primers acl1-230up and acl1-1220low ( ). .. DNA sequences were obtained after purification of the amplicons with an enzymatic PCR clean-up as described by using the BigDye Terminator v. 3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, California) and an automated DNA sequencer (3730xl DNA Analyzer, Applied Biosystems) with the same primers as in PCR or with the internal primers TEF1_INTF and TEF1_INTR ( ) for tef1 . .. The three markers (acl1 , rpb2 , tef1 ) sequenced in the present study were analysed separately.

    Article Title: Molecular cytogenetic characterization of canine histiocytic sarcoma: A spontaneous model for human histiocytic cancer identifies deletion of tumor suppressor genes and highlights influence of genetic background on tumor behavior
    Article Snippet: PCR was conducted in 10 μl reactions containing 0.8 units Taq polymerase (Go Taq, Promega), 1.0 μl 10× reaction buffer (Promega), 0.25 mM each dNTP, 0.15 μM each microsatellite-specific primer, 0.1 μM 5' fluorescently labeled M13 primer and 50 ng template DNA. .. Amplicons were visualized and evaluated by capillary-electrophoresis (3730xl DNA Analyzer, Applied BioSystems).

    Article Title: Genomic and proteomic analyses of Mycobacterium bovis BCG Mexico 1931 reveal a diverse immunogenic repertoire against tuberculosis infection
    Article Snippet: Additionally, a fosmid library with inserts of approximately 40 kb was constructed using the CopyControl™ pCCFOS™ system (Epicentre Technologies, USA), and the fos-end sequences of 250 clones were determined using the Sanger method (3730xl DNA Analyzer, Applied Biosystems, USA). .. Draft assemblies were based on 623,000 reads (36× coverage), and the Phred/Phrap/Consed software package was employed for sequence assembly and quality assessment [ ] using the BCG Pasteur 1173P2 sequence as a reference [GenBank: AM408590 ].

    Article Title: Real-life prevalence of resistance-associated variants against non-structural protein 5A inhibitors and efficiency of Daclatasvir + Asunaprevir therapy in Korean patients with genotype 1b hepatitis C
    Article Snippet: The extracted RNA was reverse transcribed and amplified by the PCR method using the SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (Invitrogen) with the pairs of primers as follows: sense (5872–5891) 5′-AAGAGGCTCCACCAGTGGAT-3′ and antisense (6730–6749) 5′-CGCCGGAGCGTACCTGTGCA-3′. .. The PCR products were purified using a QIAquick PCR Purification Kit (QIAGEN) and sequenced using an automated DNA sequencer (3730xl DNA Analyzer, Applied Biosystems). .. Two primer sets for sequencing through the NS5A L31 and Y93 coding regions are: forward sequencing primer (1bseqF2) 5′-TCCGGCTCGTGGCTAAGAGATGTTTGGG-3′ and reverse sequencing primer (1bseqR5) 5′-CAGTGGTCATGCCCGTCACGTAGTG-3′.

    Article Title: Hypolobocera guayaquilensis (Decapoda: Pseudothelphusidae): A New Crab Intermediate Host of Paragonimus mexicanus in Manabí Province, Ecuador
    Article Snippet: For the PCR-RFLP, 10-μl portions of the amplified products were treated with 5 U of the restriction enzyme Hinc II (New England Biolabs, Ipswich, Massachusetts, USA) at 37°C for 1 hr. .. All amplified products were sequenced using the corresponding primers and the BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific) on an automated sequencer (3730xl DNA Analyzer, Thermo Fisher Scientific).

    Article Title: Overexpression of Human-Derived DNMT3A Induced Intergenerational Inheritance of Active DNA Methylation Changes in Rat Sperm
    Article Snippet: The PCR program was as follows: 94°C 5 min; 94°C 30 s, 65°C 30 s, and 72°C for 1 min, decrease in the annealing temperature by 0.7°C per cycle during 12 cycles, and then 24 cycles of 94°C for 30 s, 56°C for 30 s, and 72°C for 1 min with a final extension of 10 min at 72°C. .. The selective amplification product was detected by capillary electrophoresis (3730xl DNA analyzer, Applied Biosystems, U.S.) and analyzed by GeneMapper 4.0 (Applied Biosystems, U.S.).

    Article Title: Complex Pattern of Resistance-Associated Substitutions of Hepatitis C Virus after Daclatasvir/Asunaprevir Treatment Failure
    Article Snippet: The extracted RNA was reverse-transcribed and amplified by the two-step nested PCR method using the SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (Invitrogen), with specific pairs of primers. .. The PCR products were purified using QIAquick PCR Purification Kit (QIAGEN) and sequenced using an automated DNA sequencer (3730xl DNA Analyzer, Applied Biosystems). .. Each sequence was confirmed for both sense and anti-sense strands.

    Article Title: Analysis of Coinfections with A/H1N1 Strain Variants among Pigs in Poland by Multitemperature Single-Strand Conformational Polymorphism
    Article Snippet: The ssDNA bands of altered MSSCP mobility, compared to the reference sample, were cut out. .. The ssDNA was eluted, reamplified (using the primers and PCR conditions described above), purified with exonuclease I and shrimp alkaline phosphatase (Fermentas, catalogue numbers EN0581 and EF0511), and analyzed by Sanger sequencing (3730xl DNA Analyzer, Applied Biosystems, Carlsbad, CA, USA). .. The amplified HA gene fragments from the five isolates (sw1–5) were subjected to clonal selection of mixed genetic variants.

    Article Title: Molecular Modeling and Phylogeny of the Krüppel-like Factor 4 (cKLF4) Protein from the Arabian Camel, Camelus dromedarius
    Article Snippet: PCR products were analyzed by electrophoresis using a 1.2% agarose gel ( ). .. The full-length coding sequence of cKLF4 was obtained using the 3730XL series platform Sequencer (Applied Biosystems). cDNA fragments of 877 and 1,560 bp were amplified by PCR using the primer couple cKLF4F1/cKLF4R1 and cKLF4F2/cKLF4R2 ( , ), which were then sequenced using 3730XL DNA Sequencer (Applied Biosystems) using the same PCR primers; nucleotide sequences were determined in both forward and reverse directions, and the sequences were analyzed using Geneious 7.1.7 software ( http://www.geneious.com ). .. The similarity of the obtained sequence was examined in the GenBank database using the BLASTN algorithm on the NCBI BLAST server ( http://blast.ncbi.nlm.nih.gov/Blast.cgi ).

    Article Title: Phase I study of TP300 in patients with advanced solid tumors with pharmacokinetic, pharmacogenetic and pharmacodynamic analyses
    Article Snippet: The fragments obtained were purified using X-Terninator purification kit (Applied Biosystems) and analysed on an automated DNA sequencer (3730xl DNA Analyzer, Applied Biosystems). .. The fragments obtained were purified using X-Terninator purification kit (Applied Biosystems) and analysed on an automated DNA sequencer (3730xl DNA Analyzer, Applied Biosystems).

    Article Title: Effects of Age and Hindlimb Immobilization and Remobilization on Fast Troponin T Precursor mRNA Alternative Splicing in Rat Gastrocnemius Muscle
    Article Snippet: Briefly, the frozen gastrocnemius muscle was pulverized under liquid nitrogen and total RNA was isolated using Trizol reagent as per the manufacturer’s protocol (Invitrogen). cDNA was prepared using a High Capacity cDNA Reverse Transcription kit (Applied Biosystems), and PCR was carried out using GoTaq DNA polymerase (Promega) with a fluorescein-labeled forward primer and two reverse primers as previously described ( ). .. The fluorescein-labeled PCR amplicons were analyzed by capillary electrophoresis (3730XL DNA Analyzer, Applied Biosystems) and the fragment size of the PCR amplicons was determined using the 1200 LIZ internal size standard (Applied Biosystems). .. The peak height value for each PCR amplicon was obtained by analysis using Peak Scanner software (Applied Biosystems).

    Article Title: TILLING in the two-rowed barley cultivar 'Barke' reveals preferred sites of functional diversity in the gene HvHox1
    Article Snippet: Amplicons were purified by ultrafiltration using a QIAvac 96 vacuum (Qiagen, Hilden, Germany), processed with a NucleoFast-96 PCR Plate (MACHEREY-NAGEL GmbH & Co. KG, Düren, Germany) and directly cycle-sequenced using the ABI Big Dye terminator v3.1 sequencing standard kit according to the manufacturer's protocol (Applied Biosystems, Foster City, USA). .. Sequencing reactions were resolved on a 96-capillary sequencing device (3730xl DNA Analyzer, Applied Biosystems, Foster City, USA).

    Polyacrylamide Gel Electrophoresis:

    Article Title: Overexpression of Human-Derived DNMT3A Induced Intergenerational Inheritance of Active DNA Methylation Changes in Rat Sperm
    Article Snippet: The selective amplification product was detected by capillary electrophoresis (3730xl DNA analyzer, Applied Biosystems, U.S.) and analyzed by GeneMapper 4.0 (Applied Biosystems, U.S.). .. The selective amplification product was detected by capillary electrophoresis (3730xl DNA analyzer, Applied Biosystems, U.S.) and analyzed by GeneMapper 4.0 (Applied Biosystems, U.S.).

    Nested PCR:

    Article Title: Resistance-Associated NS5A Variants of Hepatitis C Virus Are Susceptible to Interferon-Based Therapy
    Article Snippet: Briefly, viral RNA was extracted from serum, reverse-transcribed and amplified by the two-step nested PCR method. .. The PCR products were purified and sequenced using an automated DNA sequencer (3730xl DNA Analyzer, Applied Biosystems).

    Article Title: Complex Pattern of Resistance-Associated Substitutions of Hepatitis C Virus after Daclatasvir/Asunaprevir Treatment Failure
    Article Snippet: The extracted RNA was reverse-transcribed and amplified by the two-step nested PCR method using the SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (Invitrogen), with specific pairs of primers. .. The PCR products were purified using QIAquick PCR Purification Kit (QIAGEN) and sequenced using an automated DNA sequencer (3730xl DNA Analyzer, Applied Biosystems).

    Silver Staining:

    Article Title: Overexpression of Human-Derived DNMT3A Induced Intergenerational Inheritance of Active DNA Methylation Changes in Rat Sperm
    Article Snippet: The selective amplification product was detected by capillary electrophoresis (3730xl DNA analyzer, Applied Biosystems, U.S.) and analyzed by GeneMapper 4.0 (Applied Biosystems, U.S.). .. The selective amplification product was detected by capillary electrophoresis (3730xl DNA analyzer, Applied Biosystems, U.S.) and analyzed by GeneMapper 4.0 (Applied Biosystems, U.S.).

    Article Title: Analysis of Coinfections with A/H1N1 Strain Variants among Pigs in Poland by Multitemperature Single-Strand Conformational Polymorphism
    Article Snippet: The separated ssDNA bands were visualized by silver nitrate staining (Silver Stain DNA Kit, BioVectis, catalogue number 200-101). .. The ssDNA was eluted, reamplified (using the primers and PCR conditions described above), purified with exonuclease I and shrimp alkaline phosphatase (Fermentas, catalogue numbers EN0581 and EF0511), and analyzed by Sanger sequencing (3730xl DNA Analyzer, Applied Biosystems, Carlsbad, CA, USA).

    Plasmid Preparation:

    Article Title: WT1 Protein Directly Regulates Expression of Vascular Endothelial Growth Factor and Is a Mediator of Tumor Response to Hypoxia
    Article Snippet: Mutations in putative WT1 binding sites in the VEGF promoter were prepared using the QuikChange site-directed mutagenesis kit (Agilent Technologies, Santa Clara, CA) on the luciferase reporter plasmid pPVEGF-luc. .. Mutations were confirmed by sequencing (3730xl DNA Analyzer, Applied Biosystems).

    Software:

    Article Title: Genomic and structural investigation on dolphin morbillivirus (DMV) in Mediterranean fin whales (Balaenoptera physalus)
    Article Snippet: The PCR products obtained were size-separated by agarose gel electrophoresis, to be then displayed in agarose gel (3730xl DNA Analyzer, Thermo Scientific). .. The PCR products obtained were size-separated by agarose gel electrophoresis, to be then displayed in agarose gel (3730xl DNA Analyzer, Thermo Scientific).

    Article Title: Molecular Modeling and Phylogeny of the Krüppel-like Factor 4 (cKLF4) Protein from the Arabian Camel, Camelus dromedarius
    Article Snippet: PCR products were analyzed by electrophoresis using a 1.2% agarose gel ( ). .. The full-length coding sequence of cKLF4 was obtained using the 3730XL series platform Sequencer (Applied Biosystems). cDNA fragments of 877 and 1,560 bp were amplified by PCR using the primer couple cKLF4F1/cKLF4R1 and cKLF4F2/cKLF4R2 ( , ), which were then sequenced using 3730XL DNA Sequencer (Applied Biosystems) using the same PCR primers; nucleotide sequences were determined in both forward and reverse directions, and the sequences were analyzed using Geneious 7.1.7 software ( http://www.geneious.com ). .. The similarity of the obtained sequence was examined in the GenBank database using the BLASTN algorithm on the NCBI BLAST server ( http://blast.ncbi.nlm.nih.gov/Blast.cgi ).

    Article Title: TILLING in the two-rowed barley cultivar 'Barke' reveals preferred sites of functional diversity in the gene HvHox1
    Article Snippet: Sequencing reactions were resolved on a 96-capillary sequencing device (3730xl DNA Analyzer, Applied Biosystems, Foster City, USA). .. Genes were routinely analysed using the program CODDLE to obtain a gene model and to identify the region that would have the highest likelihood of being functionally affected by EMS mutagenesis.

    Positron Emission Tomography:

    Article Title: Molecular cytogenetic characterization of canine histiocytic sarcoma: A spontaneous model for human histiocytic cancer identifies deletion of tumor suppressor genes and highlights influence of genetic background on tumor behavior
    Article Snippet: The M13 primer was tagged at the 5' end either with PET, VIC, FAM or NED (Applied Biosystems) to facilitate multiplexing of products. .. Amplicons were visualized and evaluated by capillary-electrophoresis (3730xl DNA Analyzer, Applied BioSystems).

    Agarose Gel Electrophoresis:

    Article Title: Genomic and structural investigation on dolphin morbillivirus (DMV) in Mediterranean fin whales (Balaenoptera physalus)
    Article Snippet: Amplification was performed using a high-fidelity polymerase (Phusion Hot Start II DNA Polymerase, Thermo Scientific), with the following PCR conditions: 30 sec at 98 °C; 35 cycles of 10 sec at 98 °C, 30 sec at 58 °C, 1 min at 72 °C; 10 min at 72 °C. .. The PCR products obtained were size-separated by agarose gel electrophoresis, to be then displayed in agarose gel (3730xl DNA Analyzer, Thermo Scientific). .. The PCR products obtained from lung and cerebral cDNA were purified, cloned into plasmid vector PCR-Blunt II TOPO (Thermo Scientific) according to the manufacturer’s instructions, and then sequenced.

    Article Title: Connexin 26 (GJB2) mutation in an Argentinean patient with keratitis-ichthyosis-deafness (KID) syndrome: a case report
    Article Snippet: PCR products were run on a 2 % agarose gel and stained with SyBr Safe to confirm fragment size (Invitrogen, Life Technologies, Eugene, Oregon, USA). .. Bi-directional DNA sequencing was performed on an automatic sequencer (3730xl DNA Analyzer, Applied Biosystems, Foster City, CA, USA).

    Article Title: Phase I study of TP300 in patients with advanced solid tumors with pharmacokinetic, pharmacogenetic and pharmacodynamic analyses
    Article Snippet: The fragments obtained were purified using X-Terninator purification kit (Applied Biosystems) and analysed on an automated DNA sequencer (3730xl DNA Analyzer, Applied Biosystems). .. The fragments obtained were purified using X-Terninator purification kit (Applied Biosystems) and analysed on an automated DNA sequencer (3730xl DNA Analyzer, Applied Biosystems).

    DNA Extraction:

    Article Title: Variants in Human Prostacyclin Receptor Gene in Patients with Migraine Headache
    Article Snippet: Peripheral blood samples (2 mL) were collected from the patients and genomic DNA was extracted from the samples according to the manufacturer protocol using PrimePrep Genomic DNA isolation kit (Genet Bio, Korea). .. The PCR products were sequenced using a cycle sequencing kit on an automated DNA sequencing machine (BigDye Terminator v3.1 and 3730XL DNA analyzer, Applied Biosystems).

    Article Title: A Report of a Novel Mutation in Human Prostacyclin Receptor Gene in Patients Affected with Migraine
    Article Snippet: Blood sample was collected from the patients, and genomic DNA was extracted from 200 microliter peripheral blood of the 2 patients using PrimePrep Genomic DNA isolation kit (Genet Bio, Korea) according to the manufacturer protocol. .. The PCR products were then sequenced using a cycle sequencing kit on an automated DNA sequencing machine (BigDye Terminator v3.1 and 3730XL DNA analyzer, Applied Biosystems).

    Article Title: Biodiversity of Trichoderma (Hypocreaceae) in Southern Europe and Macaronesia
    Article Snippet: Paragraph title: DNA isolation and sequencing ... DNA sequences were obtained after purification of the amplicons with an enzymatic PCR clean-up as described by using the BigDye Terminator v. 3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, California) and an automated DNA sequencer (3730xl DNA Analyzer, Applied Biosystems) with the same primers as in PCR or with the internal primers TEF1_INTF and TEF1_INTR ( ) for tef1 .

    Concentration Assay:

    Article Title: Analysis of Coinfections with A/H1N1 Strain Variants among Pigs in Poland by Multitemperature Single-Strand Conformational Polymorphism
    Article Snippet: The samples were maintained for 10 min at 100 V for concentration and then separated by MSSCP. .. The ssDNA was eluted, reamplified (using the primers and PCR conditions described above), purified with exonuclease I and shrimp alkaline phosphatase (Fermentas, catalogue numbers EN0581 and EF0511), and analyzed by Sanger sequencing (3730xl DNA Analyzer, Applied Biosystems, Carlsbad, CA, USA).

    Staining:

    Article Title: Variants in Human Prostacyclin Receptor Gene in Patients with Migraine Headache
    Article Snippet: The PCR products were stained and visualized on a UV transilluminator, following 1.5% gel electrophoresis. .. The PCR products were sequenced using a cycle sequencing kit on an automated DNA sequencing machine (BigDye Terminator v3.1 and 3730XL DNA analyzer, Applied Biosystems).

    Article Title: A Report of a Novel Mutation in Human Prostacyclin Receptor Gene in Patients Affected with Migraine
    Article Snippet: Prior to sequencing, the PCR products were stained with ethidium bromide and visualized on a UV transilluminator following 1.5% gel electrophoresis. .. The PCR products were then sequenced using a cycle sequencing kit on an automated DNA sequencing machine (BigDye Terminator v3.1 and 3730XL DNA analyzer, Applied Biosystems).

    Article Title: Connexin 26 (GJB2) mutation in an Argentinean patient with keratitis-ichthyosis-deafness (KID) syndrome: a case report
    Article Snippet: PCR products were run on a 2 % agarose gel and stained with SyBr Safe to confirm fragment size (Invitrogen, Life Technologies, Eugene, Oregon, USA). .. Bi-directional DNA sequencing was performed on an automatic sequencer (3730xl DNA Analyzer, Applied Biosystems, Foster City, CA, USA).

    Article Title: Analysis of Coinfections with A/H1N1 Strain Variants among Pigs in Poland by Multitemperature Single-Strand Conformational Polymorphism
    Article Snippet: The separated ssDNA bands were visualized by silver nitrate staining (Silver Stain DNA Kit, BioVectis, catalogue number 200-101). .. The ssDNA was eluted, reamplified (using the primers and PCR conditions described above), purified with exonuclease I and shrimp alkaline phosphatase (Fermentas, catalogue numbers EN0581 and EF0511), and analyzed by Sanger sequencing (3730xl DNA Analyzer, Applied Biosystems, Carlsbad, CA, USA).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher 3730xl dna analyzer
    Separation of APTS-labelled oligosaccharides by CE in an ABI <t>3730xl</t> <t>DNA</t> sequencer. (A) Electropherogram trace (50 min) of APTS labelled hydrolysed dextran and β-1,4-xylo oligosaccharides DP1 to DP6. (B) Large DP hydrolysed dextran oligosaccharides can be resolved by extending the electrophoresis time to 90 minutes. RFU, relative fluorescence units; G, Glucose; X, Xylose.
    3730xl Dna Analyzer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 2731 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/3730xl dna analyzer/product/Thermo Fisher
    Average 99 stars, based on 2731 article reviews
    Price from $9.99 to $1999.99
    3730xl dna analyzer - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    Image Search Results


    Separation of APTS-labelled oligosaccharides by CE in an ABI 3730xl DNA sequencer. (A) Electropherogram trace (50 min) of APTS labelled hydrolysed dextran and β-1,4-xylo oligosaccharides DP1 to DP6. (B) Large DP hydrolysed dextran oligosaccharides can be resolved by extending the electrophoresis time to 90 minutes. RFU, relative fluorescence units; G, Glucose; X, Xylose.

    Journal: Biotechnology for Biofuels

    Article Title: Development and application of a high throughput carbohydrate profiling technique for analyzing plant cell wall polysaccharides and carbohydrate active enzymes

    doi: 10.1186/1754-6834-6-94

    Figure Lengend Snippet: Separation of APTS-labelled oligosaccharides by CE in an ABI 3730xl DNA sequencer. (A) Electropherogram trace (50 min) of APTS labelled hydrolysed dextran and β-1,4-xylo oligosaccharides DP1 to DP6. (B) Large DP hydrolysed dextran oligosaccharides can be resolved by extending the electrophoresis time to 90 minutes. RFU, relative fluorescence units; G, Glucose; X, Xylose.

    Article Snippet: The plate was used directly for sample analysis in an ABI 3730xl 96-sample DNA sequencer using the standard DNA analysis buffer system, and the settings described in Table .

    Techniques: Electrophoresis, Fluorescence