3730xl dna analyzer (Thermo Fisher)
Thermo Fisher is a verified supplier 
99
Structured Review
Thermo Fisher
3730xl dna analyzer
3730xl Dna Analyzer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 4697 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/3730xl dna analyzer/product/Thermo Fisher
Average 99 stars, based on 4697 article reviews
Price from $9.99 to $1999.99
3730xl Dna Analyzer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 4697 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/3730xl dna analyzer/product/Thermo Fisher
Average 99 stars, based on 4697 article reviews
Price from $9.99 to $1999.99
3730xl dna analyzer - by Bioz Stars,
2020-01
99/100 stars
Related Products / Commonly Used Together
Images
Related Articles
Methylation Sequencing:Article Title: Role of HPA and the HPG-axis interaction in testosterone-mediated learned helpless behavior Article Snippet: Paragraph title: Bisulfite sequencing based promoter methylation analysis of Crh gene ... Methylation specific (MSP) nested PCR primers ( ) were used to specifically amplify (GeneAmp PCR System 9700, Applied Biosystems, Waltham, MA, USA) the target region within the Crh gene promoter and sequenced using the Clone Assay:Article Title: The Genomic Landscape of UM-SCC Oral Cavity Squamous Cell Carcinoma Cell Lines Article Snippet: .. PCR products were cloned out using pCR8 TOPO vector (Invitrogen) and submitted for Sanger sequencing at the University of Michigan DNA Sequencing Core on the Amplification:Article Title: The Genomic Landscape of UM-SCC Oral Cavity Squamous Cell Carcinoma Cell Lines Article Snippet: Genomic DNA was isolated following Gentra PureGene protocol (Qiagen) and PCR amplified with Platinum Taq DNA Polymerase High Fidelity (Invitrogen) according to manufacturer’s instructions. .. PCR products were cloned out using pCR8 TOPO vector (Invitrogen) and submitted for Sanger sequencing at the University of Michigan DNA Sequencing Core on the Article Title: High Prevalence of Fluoroquinolone-Resistant Campylobacter Bacteria in Sheep and Increased Campylobacter Counts in the Bile and Gallbladders of Sheep Medicated with Tetracycline in Feed Article Snippet: The seven housekeeping genes were amplified and sequenced using the primers recommended by the Campylobacter ), which was developed by Keith Jolley and Man-Suen Chan at the University of Oxford ( ). .. All PCR products were purified using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and then sequenced at the DNA Core Facility of Iowa State University using an Applied Biosystems Article Title: Regional Body Fat Changes and Metabolic Complications in Children With Dunnigan Lipodystrophy-Causing LMNA Variants Article Snippet: The LMNA exons including the splice site regions were amplified in 11 segments from 50 ng of genomic DNA using the PCR and exon-specific primer pairs (available on request). .. The purified PCR products were sequenced using dye-terminator chemistry and an Article Title: GJB3/GJB6 screening in GJB2 carriers with idiopathic hearing loss: Is it necessary?. GJB3/GJB6 screening in GJB2 carriers with idiopathic hearing loss: Is it necessary? Article Snippet: DNA fragments spanning the GJB2, GJB3 and GJB6 coding exons were amplified by PCR methods ( GJB2 : Forward primer: TTGGTGTTTGCTCAGGAAGA; Reverse primer: GGCCTACAGGGGTTTCAAAT; GJB3 : Forward primer: TACGATGGTTTTTCCTCTAATTCT; Reverse primer: TTGCATAACTTAGTGAACTCAGAG; GJB6 : Forward primer: TATCACCGTGTCACTTTCC; Reverse primer: CAGGTTGGTATTGCCTTC). .. The products were purified and sequenced by Sanger sequencing using a Article Title: Diesel degrading bacterial endophytes with plant growth promoting potential isolated from a petroleum storage facility Article Snippet: Genomic DNA isolation followed by PCR amplification was performed using universal primers 27F (5′AGAGTTTGATCMTGGCTCAG3′) (Barns et al. ) and 1492R (5′TACGGYTACCTTGTTACGACTT3′) (Lane ). .. Sequence detection was performed by capillary electrophoresis on a Lambda DNA Preparation:Article Title: High Prevalence of Fluoroquinolone-Resistant Campylobacter Bacteria in Sheep and Increased Campylobacter Counts in the Bile and Gallbladders of Sheep Medicated with Tetracycline in Feed Article Snippet: A Lambda DNA ladder (Bio-Rad) was used as the molecular size marker. .. All PCR products were purified using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and then sequenced at the DNA Core Facility of Iowa State University using an Applied Biosystems TA Cloning:Article Title: Characterization of expression and alternative splicing of the gene Cadherin-like and PC esterase Domain containing 1 (Cped1) Article Snippet: A TOPO TA cloning kit (Thermo, Cat no. K4500-01) was used to generate plasmids containing template for sequencing according to the manufacturer’s instructions. .. The reactions were then run on Applied Biosystem’s Blocking Assay:Article Title: Genotyping of the OATP1B1 c. 521 T > C Polymorphism from the Formalin-Fixed Paraffin-Embedded (FFPE) Tissue Specimens: an Optimized Protocol Article Snippet: .. Pipettes: Research Plus® 4-pack (0.1–2.5 μl, 2–20 μl, 20–200 μl, 100–1,000 μl) (Eppendorf, manufacture ID: 2231300004) Heat block (55–94 °C) (VWR, catalog number: 75838–318) Centrifuge (Eppendorf, model: 5424R) Vortex (Vortex Genie 2, 110V, VWR, catalog number: 100370–856) Thermocycler (Techne, Cole-Parmer Scientific Experts, TC-312) NanoDrop Spectrophotometer (NanoDrop Technologies, ND-1000 UV/Vis) Electrophoresis:Article Title: Diesel degrading bacterial endophytes with plant growth promoting potential isolated from a petroleum storage facility Article Snippet: .. Sequence detection was performed by capillary electrophoresis on a Transformation Assay:Article Title: Characterization of expression and alternative splicing of the gene Cadherin-like and PC esterase Domain containing 1 (Cped1) Article Snippet: Briefly, RT-PCR products were inserted into pCR2.1-TOPO vector and chemically transformed into One Shot competent E. coli cells. .. The reactions were then run on Applied Biosystem’s High Performance Liquid Chromatography:Article Title: Effects of hemoglobin variants HbJ Bangkok, HbE, HbG Taipei, and HbH on analysis of glycated hemoglobin via ion‐exchange high‐performance liquid chromatography. Effects of hemoglobin variants HbJ Bangkok, HbE, HbG Taipei, and HbH on analysis of glycated hemoglobin via ion‐exchange high‐performance liquid chromatography Article Snippet: The Primus Ultra2 analyzer is based on boronate affinity HPLC (BA‐HPLC). .. The Sequencing:Article Title: Management of dysfibrinogenemia in pregnancy: A case report. Management of dysfibrinogenemia in pregnancy: A case report Article Snippet: The PCR products were sequenced with an Article Title: Association of FOS‐Like Antigen 1 Promoter Polymorphism with Podocyte Foot Process Effacement in Immunoglobulin A Nephropathy Patients Article Snippet: SNP genotyping was conducted using direct sequencing using the specific primers for rs2239615 (sense: 5′‐ ATGCTCACGAGATTAGGACACG‐3′; anti‐sense: 5′‐CGGGTGAGTGGTAGTAAGAGA‐3′), rs7101 (sense: 5′‐CCCGTGACGTTTACACTCATTC‐3′; anti‐sense: 5′‐GCGGGTGAGTGGTAGTAAGAGA‐3′), rs12373539 (sense: 5′‐TGACGTCATTGCTAGGATACCA‐3′; anti‐sense: 5′‐GGCCGTAGCTCTGAGTCTTATG‐3′), rs2282695 (sense: 5′‐GACTTGCACCTTACTTCCCCAAC‐3′; anti‐sense: 5′‐TCTCAGATCTAGGGTTCTGATG‐3′), rs637571 (sense: 5′‐GACTTGCACCTTACTTCCCCAAC‐3′; anti‐sense: 5′‐TCTCAGATCTAGGGTTCTGATG‐3′), and rs925255 (sense: 5′‐CCTGCTCTAAGGTCTGTGCTCT‐3′; anti‐sense: 5′‐CTACCGGTTCCCTTTTTGTTTT‐3′). .. The PCR products were sequenced using an Article Title: The Genomic Landscape of UM-SCC Oral Cavity Squamous Cell Carcinoma Cell Lines Article Snippet: .. PCR products were cloned out using pCR8 TOPO vector (Invitrogen) and submitted for Sanger sequencing at the University of Michigan DNA Sequencing Core on the Article Title: Comparison of Three Different Commercial Kits for the Human Papilloma Virus Genotyping Article Snippet: .. To confirm the HPV genotypes, nucleotide sequence of PCR products was analyzed by Article Title: High-Resolution Melting Assay for Genotyping Variants of the CYP2C19 Enzyme and Predicting Voriconazole Effectiveness Article Snippet: .. Sequencing was carried out by the Sanger method on an Article Title: Effects of hemoglobin variants HbJ Bangkok, HbE, HbG Taipei, and HbH on analysis of glycated hemoglobin via ion‐exchange high‐performance liquid chromatography. Effects of hemoglobin variants HbJ Bangkok, HbE, HbG Taipei, and HbH on analysis of glycated hemoglobin via ion‐exchange high‐performance liquid chromatography Article Snippet: .. The Article Title: Genotyping of the OATP1B1 c. 521 T > C Polymorphism from the Formalin-Fixed Paraffin-Embedded (FFPE) Tissue Specimens: an Optimized Protocol Article Snippet: .. Pipettes: Research Plus® 4-pack (0.1–2.5 μl, 2–20 μl, 20–200 μl, 100–1,000 μl) (Eppendorf, manufacture ID: 2231300004) Heat block (55–94 °C) (VWR, catalog number: 75838–318) Centrifuge (Eppendorf, model: 5424R) Vortex (Vortex Genie 2, 110V, VWR, catalog number: 100370–856) Thermocycler (Techne, Cole-Parmer Scientific Experts, TC-312) NanoDrop Spectrophotometer (NanoDrop Technologies, ND-1000 UV/Vis) Article Title: Regional Body Fat Changes and Metabolic Complications in Children With Dunnigan Lipodystrophy-Causing LMNA Variants Article Snippet: The purified PCR products were sequenced using dye-terminator chemistry and an Article Title: GJB3/GJB6 screening in GJB2 carriers with idiopathic hearing loss: Is it necessary?. GJB3/GJB6 screening in GJB2 carriers with idiopathic hearing loss: Is it necessary? Article Snippet: .. The products were purified and sequenced by Sanger sequencing using a Article Title: Characterization of expression and alternative splicing of the gene Cadherin-like and PC esterase Domain containing 1 (Cped1) Article Snippet: Paragraph title: 2.6. Plasmid construction for Sanger sequencing and confirmation of splice variants ... The reactions were then run on Applied Biosystem’s Article Title: Role of HPA and the HPG-axis interaction in testosterone-mediated learned helpless behavior Article Snippet: Methylation specific (MSP) nested PCR primers ( ) were used to specifically amplify (GeneAmp PCR System 9700, Applied Biosystems, Waltham, MA, USA) the target region within the Crh gene promoter and sequenced using the Article Title: Diesel degrading bacterial endophytes with plant growth promoting potential isolated from a petroleum storage facility Article Snippet: .. Sequence detection was performed by capillary electrophoresis on a DNA Sequencing:Article Title: The Genomic Landscape of UM-SCC Oral Cavity Squamous Cell Carcinoma Cell Lines Article Snippet: .. PCR products were cloned out using pCR8 TOPO vector (Invitrogen) and submitted for Sanger sequencing at the University of Michigan DNA Sequencing Core on the Article Title: Role of HPA and the HPG-axis interaction in testosterone-mediated learned helpless behavior Article Snippet: Methylation specific (MSP) nested PCR primers ( ) were used to specifically amplify (GeneAmp PCR System 9700, Applied Biosystems, Waltham, MA, USA) the target region within the Crh gene promoter and sequenced using the Article Title: Diesel degrading bacterial endophytes with plant growth promoting potential isolated from a petroleum storage facility Article Snippet: .. Sequence detection was performed by capillary electrophoresis on a Reverse Transcription Polymerase Chain Reaction:Article Title: Characterization of expression and alternative splicing of the gene Cadherin-like and PC esterase Domain containing 1 (Cped1) Article Snippet: Briefly, RT-PCR products were inserted into pCR2.1-TOPO vector and chemically transformed into One Shot competent E. coli cells. .. The reactions were then run on Applied Biosystem’s Molecular Weight:Article Title: High-Resolution Melting Assay for Genotyping Variants of the CYP2C19 Enzyme and Predicting Voriconazole Effectiveness Article Snippet: PCR products were visualized on a 0.8% agarose gel using BenchTop 1-kb DNA ladder (Promega Corporation, Madison, WI) as the molecular weight marker. .. Sequencing was carried out by the Sanger method on an Imaging:Article Title: GJB3/GJB6 screening in GJB2 carriers with idiopathic hearing loss: Is it necessary?. GJB3/GJB6 screening in GJB2 carriers with idiopathic hearing loss: Is it necessary? Article Snippet: Temporal imaging and auditory assessments with auditory brainstem response (ABR) and distortion product otoacoustic emissions (DPOAE) in each participant had ruled out the risk of enlarged vestibular aqueduct or auditory neuropathy. .. The products were purified and sequenced by Sanger sequencing using a DNA Extraction:Article Title: Association of FOS‐Like Antigen 1 Promoter Polymorphism with Podocyte Foot Process Effacement in Immunoglobulin A Nephropathy Patients Article Snippet: DNA was isolated from a peripheral blood sample using the DNA Isolation Kit for blood (Roche, IN, USA). .. The PCR products were sequenced using an Article Title: Diesel degrading bacterial endophytes with plant growth promoting potential isolated from a petroleum storage facility Article Snippet: Genomic DNA isolation followed by PCR amplification was performed using universal primers 27F (5′AGAGTTTGATCMTGGCTCAG3′) (Barns et al. ) and 1492R (5′TACGGYTACCTTGTTACGACTT3′) (Lane ). .. Sequence detection was performed by capillary electrophoresis on a Methylation:Article Title: Role of HPA and the HPG-axis interaction in testosterone-mediated learned helpless behavior Article Snippet: .. Methylation specific (MSP) nested PCR primers ( ) were used to specifically amplify (GeneAmp PCR System 9700, Applied Biosystems, Waltham, MA, USA) the target region within the Crh gene promoter and sequenced using the Mutagenesis:Article Title: High Prevalence of Fluoroquinolone-Resistant Campylobacter Bacteria in Sheep and Increased Campylobacter Counts in the Bile and Gallbladders of Sheep Medicated with Tetracycline in Feed Article Snippet: Paragraph title: gyrA mutation determination. ... All PCR products were purified using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and then sequenced at the DNA Core Facility of Iowa State University using an Applied Biosystems Article Title: GJB3/GJB6 screening in GJB2 carriers with idiopathic hearing loss: Is it necessary?. GJB3/GJB6 screening in GJB2 carriers with idiopathic hearing loss: Is it necessary? Article Snippet: Also, neither the splice site mutation c. IVS1 + 1G > A, nor defects in exon 1 and its basal promoter in GJB2 was present. .. The products were purified and sequenced by Sanger sequencing using a Isolation:Article Title: Association of FOS‐Like Antigen 1 Promoter Polymorphism with Podocyte Foot Process Effacement in Immunoglobulin A Nephropathy Patients Article Snippet: DNA was isolated from a peripheral blood sample using the DNA Isolation Kit for blood (Roche, IN, USA). .. The PCR products were sequenced using an Article Title: The Genomic Landscape of UM-SCC Oral Cavity Squamous Cell Carcinoma Cell Lines Article Snippet: Genomic DNA was isolated following Gentra PureGene protocol (Qiagen) and PCR amplified with Platinum Taq DNA Polymerase High Fidelity (Invitrogen) according to manufacturer’s instructions. .. PCR products were cloned out using pCR8 TOPO vector (Invitrogen) and submitted for Sanger sequencing at the University of Michigan DNA Sequencing Core on the Purification:Article Title: High Prevalence of Fluoroquinolone-Resistant Campylobacter Bacteria in Sheep and Increased Campylobacter Counts in the Bile and Gallbladders of Sheep Medicated with Tetracycline in Feed Article Snippet: .. All PCR products were purified using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and then sequenced at the DNA Core Facility of Iowa State University using an Applied Biosystems Article Title: High-Resolution Melting Assay for Genotyping Variants of the CYP2C19 Enzyme and Predicting Voriconazole Effectiveness Article Snippet: A final volume of 10 μl consisting of 6.4 μl of water, 0.6 μl of primer (50 μM), and 3 μl of the purified PCR product was prepared for this purpose. .. Sequencing was carried out by the Sanger method on an Article Title: Regional Body Fat Changes and Metabolic Complications in Children With Dunnigan Lipodystrophy-Causing LMNA Variants Article Snippet: .. The purified PCR products were sequenced using dye-terminator chemistry and an Article Title: GJB3/GJB6 screening in GJB2 carriers with idiopathic hearing loss: Is it necessary?. GJB3/GJB6 screening in GJB2 carriers with idiopathic hearing loss: Is it necessary? Article Snippet: .. The products were purified and sequenced by Sanger sequencing using a Article Title: Diesel degrading bacterial endophytes with plant growth promoting potential isolated from a petroleum storage facility Article Snippet: Sequence detection was performed by capillary electrophoresis on a 3730xl Genetic Analyzer (Life Technologies, Applied Biosystems) using a 50 cm array, the Long DNA sequencing module (LongSeq50_POP7) and the KB analysis protocol (KB basecaller) with the default instrument settings. .. Sequence detection was performed by capillary electrophoresis on a Polymerase Chain Reaction:Article Title: Management of dysfibrinogenemia in pregnancy: A case report. Management of dysfibrinogenemia in pregnancy: A case report Article Snippet: .. The PCR products were sequenced with an Article Title: Association of FOS‐Like Antigen 1 Promoter Polymorphism with Podocyte Foot Process Effacement in Immunoglobulin A Nephropathy Patients Article Snippet: .. The PCR products were sequenced using an Article Title: High Prevalence of Fluoroquinolone-Resistant Campylobacter Bacteria in Sheep and Increased Campylobacter Counts in the Bile and Gallbladders of Sheep Medicated with Tetracycline in Feed Article Snippet: .. All PCR products were purified using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and then sequenced at the DNA Core Facility of Iowa State University using an Applied Biosystems Article Title: The Genomic Landscape of UM-SCC Oral Cavity Squamous Cell Carcinoma Cell Lines Article Snippet: .. PCR products were cloned out using pCR8 TOPO vector (Invitrogen) and submitted for Sanger sequencing at the University of Michigan DNA Sequencing Core on the Article Title: Comparison of Three Different Commercial Kits for the Human Papilloma Virus Genotyping Article Snippet: .. To confirm the HPV genotypes, nucleotide sequence of PCR products was analyzed by Article Title: High-Resolution Melting Assay for Genotyping Variants of the CYP2C19 Enzyme and Predicting Voriconazole Effectiveness Article Snippet: A final volume of 10 μl consisting of 6.4 μl of water, 0.6 μl of primer (50 μM), and 3 μl of the purified PCR product was prepared for this purpose. .. Sequencing was carried out by the Sanger method on an Article Title: Regional Body Fat Changes and Metabolic Complications in Children With Dunnigan Lipodystrophy-Causing LMNA Variants Article Snippet: .. The purified PCR products were sequenced using dye-terminator chemistry and an Article Title: GJB3/GJB6 screening in GJB2 carriers with idiopathic hearing loss: Is it necessary?. GJB3/GJB6 screening in GJB2 carriers with idiopathic hearing loss: Is it necessary? Article Snippet: Paragraph title: 2.1. Study participants, PCR, Sanger sequencing ... The products were purified and sequenced by Sanger sequencing using a Article Title: Role of HPA and the HPG-axis interaction in testosterone-mediated learned helpless behavior Article Snippet: .. Methylation specific (MSP) nested PCR primers ( ) were used to specifically amplify (GeneAmp PCR System 9700, Applied Biosystems, Waltham, MA, USA) the target region within the Crh gene promoter and sequenced using the Article Title: Diesel degrading bacterial endophytes with plant growth promoting potential isolated from a petroleum storage facility Article Snippet: Sequence detection was performed by capillary electrophoresis on a 3730xl Genetic Analyzer (Life Technologies, Applied Biosystems) using a 50 cm array, the Long DNA sequencing module (LongSeq50_POP7) and the KB analysis protocol (KB basecaller) with the default instrument settings. .. Sequence detection was performed by capillary electrophoresis on a Construct:Article Title: Diesel degrading bacterial endophytes with plant growth promoting potential isolated from a petroleum storage facility Article Snippet: Sequence detection was performed by capillary electrophoresis on a Nested PCR:Article Title: Role of HPA and the HPG-axis interaction in testosterone-mediated learned helpless behavior Article Snippet: .. Methylation specific (MSP) nested PCR primers ( ) were used to specifically amplify (GeneAmp PCR System 9700, Applied Biosystems, Waltham, MA, USA) the target region within the Crh gene promoter and sequenced using the Plasmid Preparation:Article Title: The Genomic Landscape of UM-SCC Oral Cavity Squamous Cell Carcinoma Cell Lines Article Snippet: .. PCR products were cloned out using pCR8 TOPO vector (Invitrogen) and submitted for Sanger sequencing at the University of Michigan DNA Sequencing Core on the Article Title: Characterization of expression and alternative splicing of the gene Cadherin-like and PC esterase Domain containing 1 (Cped1) Article Snippet: Paragraph title: 2.6. Plasmid construction for Sanger sequencing and confirmation of splice variants ... The reactions were then run on Applied Biosystem’s Software:Article Title: Association of FOS‐Like Antigen 1 Promoter Polymorphism with Podocyte Foot Process Effacement in Immunoglobulin A Nephropathy Patients Article Snippet: The PCR products were sequenced using an Article Title: The Genomic Landscape of UM-SCC Oral Cavity Squamous Cell Carcinoma Cell Lines Article Snippet: PCR products were cloned out using pCR8 TOPO vector (Invitrogen) and submitted for Sanger sequencing at the University of Michigan DNA Sequencing Core on the Article Title: High Prevalence of Fluoroquinolone-Resistant Campylobacter Bacteria in Sheep and Increased Campylobacter Counts in the Bile and Gallbladders of Sheep Medicated with Tetracycline in Feed Article Snippet: The PFGE patterns were analyzed by GelCompare II v.6.5 software (Applied Maths, Kortrijk, Belgium) using the Dice similarity coefficient and unweighted-pair group method with arithmetic averages (UPGMA) with 0.5% optimization and 1.5% position tolerance. .. All PCR products were purified using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and then sequenced at the DNA Core Facility of Iowa State University using an Applied Biosystems Article Title: High-Resolution Melting Assay for Genotyping Variants of the CYP2C19 Enzyme and Predicting Voriconazole Effectiveness Article Snippet: Sequencing was carried out by the Sanger method on an Article Title: Role of HPA and the HPG-axis interaction in testosterone-mediated learned helpless behavior Article Snippet: Methylation specific (MSP) nested PCR primers ( ) were used to specifically amplify (GeneAmp PCR System 9700, Applied Biosystems, Waltham, MA, USA) the target region within the Crh gene promoter and sequenced using the Article Title: Diesel degrading bacterial endophytes with plant growth promoting potential isolated from a petroleum storage facility Article Snippet: Sequence detection was performed by capillary electrophoresis on a Selection:Article Title: Association of FOS‐Like Antigen 1 Promoter Polymorphism with Podocyte Foot Process Effacement in Immunoglobulin A Nephropathy Patients Article Snippet: Paragraph title: SNP selection and genotyping ... The PCR products were sequenced using an Article Title: Characterization of expression and alternative splicing of the gene Cadherin-like and PC esterase Domain containing 1 (Cped1) Article Snippet: Color-based clone selection of bacterial colonies was performed using Lysogeny Broth (LB) agar plates containing 50 µg/mL ampicillin, 40 mg/mL 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal) in dimethylformamide (DMF), and 100 nM isopropyl β-D-1-thiogalactopyranoside (IPTG) in water. .. The reactions were then run on Applied Biosystem’s Agarose Gel Electrophoresis:Article Title: Comparison of Three Different Commercial Kits for the Human Papilloma Virus Genotyping Article Snippet: Then, the PCR products were electrophoresed on a 2% agarose gel at 100 V for 40 min and the DNA was stained with ethidium bromide. .. To confirm the HPV genotypes, nucleotide sequence of PCR products was analyzed by Article Title: High-Resolution Melting Assay for Genotyping Variants of the CYP2C19 Enzyme and Predicting Voriconazole Effectiveness Article Snippet: PCR products were visualized on a 0.8% agarose gel using BenchTop 1-kb DNA ladder (Promega Corporation, Madison, WI) as the molecular weight marker. .. Sequencing was carried out by the Sanger method on an Article Title: Regional Body Fat Changes and Metabolic Complications in Children With Dunnigan Lipodystrophy-Causing LMNA Variants Article Snippet: The resulting PCR product was analyzed in an agarose gel and purified using a PCR purification kit (Qiagen, Valencia, CA). .. The purified PCR products were sequenced using dye-terminator chemistry and an Spectrophotometry:Article Title: Genotyping of the OATP1B1 c. 521 T > C Polymorphism from the Formalin-Fixed Paraffin-Embedded (FFPE) Tissue Specimens: an Optimized Protocol Article Snippet: .. Pipettes: Research Plus® 4-pack (0.1–2.5 μl, 2–20 μl, 20–200 μl, 100–1,000 μl) (Eppendorf, manufacture ID: 2231300004) Heat block (55–94 °C) (VWR, catalog number: 75838–318) Centrifuge (Eppendorf, model: 5424R) Vortex (Vortex Genie 2, 110V, VWR, catalog number: 100370–856) Thermocycler (Techne, Cole-Parmer Scientific Experts, TC-312) NanoDrop Spectrophotometer (NanoDrop Technologies, ND-1000 UV/Vis) DNA Purification:Article Title: Role of HPA and the HPG-axis interaction in testosterone-mediated learned helpless behavior Article Snippet: Genomic DNA was extracted using the Wizard Genomic DNA purification kit (Promega, Madison, WI, USA). .. Methylation specific (MSP) nested PCR primers ( ) were used to specifically amplify (GeneAmp PCR System 9700, Applied Biosystems, Waltham, MA, USA) the target region within the Crh gene promoter and sequenced using the Marker:Article Title: High Prevalence of Fluoroquinolone-Resistant Campylobacter Bacteria in Sheep and Increased Campylobacter Counts in the Bile and Gallbladders of Sheep Medicated with Tetracycline in Feed Article Snippet: A Lambda DNA ladder (Bio-Rad) was used as the molecular size marker. .. All PCR products were purified using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and then sequenced at the DNA Core Facility of Iowa State University using an Applied Biosystems Article Title: High-Resolution Melting Assay for Genotyping Variants of the CYP2C19 Enzyme and Predicting Voriconazole Effectiveness Article Snippet: PCR products were visualized on a 0.8% agarose gel using BenchTop 1-kb DNA ladder (Promega Corporation, Madison, WI) as the molecular weight marker. .. Sequencing was carried out by the Sanger method on an Staining:Article Title: Comparison of Three Different Commercial Kits for the Human Papilloma Virus Genotyping Article Snippet: Then, the PCR products were electrophoresed on a 2% agarose gel at 100 V for 40 min and the DNA was stained with ethidium bromide. .. To confirm the HPV genotypes, nucleotide sequence of PCR products was analyzed by |