3730xl dna analyzer  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher 3730xl dna analyzer
    3730xl Dna Analyzer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 4697 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/3730xl dna analyzer/product/Thermo Fisher
    Average 99 stars, based on 4697 article reviews
    Price from $9.99 to $1999.99
    3730xl dna analyzer - by Bioz Stars, 2020-01
    99/100 stars

    Images

    Related Articles

    Methylation Sequencing:

    Article Title: Role of HPA and the HPG-axis interaction in testosterone-mediated learned helpless behavior
    Article Snippet: Paragraph title: Bisulfite sequencing based promoter methylation analysis of Crh gene ... Methylation specific (MSP) nested PCR primers ( ) were used to specifically amplify (GeneAmp PCR System 9700, Applied Biosystems, Waltham, MA, USA) the target region within the Crh gene promoter and sequenced using the 3730xl DNA Analyzer (ABI Life Technologies, Grand Island, NY, USA).

    Clone Assay:

    Article Title: The Genomic Landscape of UM-SCC Oral Cavity Squamous Cell Carcinoma Cell Lines
    Article Snippet: .. PCR products were cloned out using pCR8 TOPO vector (Invitrogen) and submitted for Sanger sequencing at the University of Michigan DNA Sequencing Core on the 3730XL DNA Sequencer (Applied Biosystems). .. Sequences were aligned using the DNASTAR Lasergene software suite.

    Amplification:

    Article Title: The Genomic Landscape of UM-SCC Oral Cavity Squamous Cell Carcinoma Cell Lines
    Article Snippet: Genomic DNA was isolated following Gentra PureGene protocol (Qiagen) and PCR amplified with Platinum Taq DNA Polymerase High Fidelity (Invitrogen) according to manufacturer’s instructions. .. PCR products were cloned out using pCR8 TOPO vector (Invitrogen) and submitted for Sanger sequencing at the University of Michigan DNA Sequencing Core on the 3730XL DNA Sequencer (Applied Biosystems).

    Article Title: High Prevalence of Fluoroquinolone-Resistant Campylobacter Bacteria in Sheep and Increased Campylobacter Counts in the Bile and Gallbladders of Sheep Medicated with Tetracycline in Feed
    Article Snippet: The seven housekeeping genes were amplified and sequenced using the primers recommended by the Campylobacter ), which was developed by Keith Jolley and Man-Suen Chan at the University of Oxford ( ). .. All PCR products were purified using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and then sequenced at the DNA Core Facility of Iowa State University using an Applied Biosystems 3730xl DNA analyzer.

    Article Title: Regional Body Fat Changes and Metabolic Complications in Children With Dunnigan Lipodystrophy-Causing LMNA Variants
    Article Snippet: The LMNA exons including the splice site regions were amplified in 11 segments from 50 ng of genomic DNA using the PCR and exon-specific primer pairs (available on request). .. The purified PCR products were sequenced using dye-terminator chemistry and an ABI 3730xl DNA analyzer (Applied Biosystems, Foster City, CA).

    Article Title: GJB3/GJB6 screening in GJB2 carriers with idiopathic hearing loss: Is it necessary?. GJB3/GJB6 screening in GJB2 carriers with idiopathic hearing loss: Is it necessary?
    Article Snippet: DNA fragments spanning the GJB2, GJB3 and GJB6 coding exons were amplified by PCR methods ( GJB2 : Forward primer: TTGGTGTTTGCTCAGGAAGA; Reverse primer: GGCCTACAGGGGTTTCAAAT; GJB3 : Forward primer: TACGATGGTTTTTCCTCTAATTCT; Reverse primer: TTGCATAACTTAGTGAACTCAGAG; GJB6 : Forward primer: TATCACCGTGTCACTTTCC; Reverse primer: CAGGTTGGTATTGCCTTC). .. The products were purified and sequenced by Sanger sequencing using a 3730XL DNA analyzer (Applied Biosystems, Carlsbad, California, USA).

    Article Title: Diesel degrading bacterial endophytes with plant growth promoting potential isolated from a petroleum storage facility
    Article Snippet: Genomic DNA isolation followed by PCR amplification was performed using universal primers 27F (5′AGAGTTTGATCMTGGCTCAG3′) (Barns et al. ) and 1492R (5′TACGGYTACCTTGTTACGACTT3′) (Lane ). .. Sequence detection was performed by capillary electrophoresis on a 3730xl Genetic Analyzer (Life Technologies, Applied Biosystems) using a 50 cm array, the Long DNA sequencing module (LongSeq50_POP7) and the KB analysis protocol (KB basecaller) with the default instrument settings.

    Lambda DNA Preparation:

    Article Title: High Prevalence of Fluoroquinolone-Resistant Campylobacter Bacteria in Sheep and Increased Campylobacter Counts in the Bile and Gallbladders of Sheep Medicated with Tetracycline in Feed
    Article Snippet: A Lambda DNA ladder (Bio-Rad) was used as the molecular size marker. .. All PCR products were purified using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and then sequenced at the DNA Core Facility of Iowa State University using an Applied Biosystems 3730xl DNA analyzer.

    TA Cloning:

    Article Title: Characterization of expression and alternative splicing of the gene Cadherin-like and PC esterase Domain containing 1 (Cped1)
    Article Snippet: A TOPO TA cloning kit (Thermo, Cat no. K4500-01) was used to generate plasmids containing template for sequencing according to the manufacturer’s instructions. .. The reactions were then run on Applied Biosystem’s 3730xl DNA Analyzer.

    Blocking Assay:

    Article Title: Genotyping of the OATP1B1 c. 521 T > C Polymorphism from the Formalin-Fixed Paraffin-Embedded (FFPE) Tissue Specimens: an Optimized Protocol
    Article Snippet: .. Pipettes: Research Plus® 4-pack (0.1–2.5 μl, 2–20 μl, 20–200 μl, 100–1,000 μl) (Eppendorf, manufacture ID: 2231300004) Heat block (55–94 °C) (VWR, catalog number: 75838–318) Centrifuge (Eppendorf, model: 5424R) Vortex (Vortex Genie 2, 110V, VWR, catalog number: 100370–856) Thermocycler (Techne, Cole-Parmer Scientific Experts, TC-312) NanoDrop Spectrophotometer (NanoDrop Technologies, ND-1000 UV/Vis) 3730xl DNA Analyzer for sequencing (Applied Biosystems, 3730xl) BioRad Molecular XRS Imager (BioRad, Hercules, CA) .. ) Image Lab software (BioRad, Hercules, CA) To help readers follow the experimental procedure more easily, we have made some minor modifications marked in red.

    Electrophoresis:

    Article Title: Diesel degrading bacterial endophytes with plant growth promoting potential isolated from a petroleum storage facility
    Article Snippet: .. Sequence detection was performed by capillary electrophoresis on a 3730xl Genetic Analyzer (Life Technologies, Applied Biosystems) using a 50 cm array, the Long DNA sequencing module (LongSeq50_POP7) and the KB analysis protocol (KB basecaller) with the default instrument settings. .. Post-detection, raw signal data was initially processed on the 3730xl Genetic Analyzer computer using Sequencing Analysis v5.3.1 (Life Technologies, Applied Biosystems) from Macrogen®, USA.).

    Transformation Assay:

    Article Title: Characterization of expression and alternative splicing of the gene Cadherin-like and PC esterase Domain containing 1 (Cped1)
    Article Snippet: Briefly, RT-PCR products were inserted into pCR2.1-TOPO vector and chemically transformed into One Shot competent E. coli cells. .. The reactions were then run on Applied Biosystem’s 3730xl DNA Analyzer.

    High Performance Liquid Chromatography:

    Article Title: Effects of hemoglobin variants HbJ Bangkok, HbE, HbG Taipei, and HbH on analysis of glycated hemoglobin via ion‐exchange high‐performance liquid chromatography. Effects of hemoglobin variants HbJ Bangkok, HbE, HbG Taipei, and HbH on analysis of glycated hemoglobin via ion‐exchange high‐performance liquid chromatography
    Article Snippet: The Primus Ultra2 analyzer is based on boronate affinity HPLC (BA‐HPLC). .. The Applied Biosystems 3730xl sequencer (Applied Biosystems, Foster City, CA, USA) uses dideoxy‐mediated chain termination (Sanger method) for sequencing genes that encode Hb.

    Sequencing:

    Article Title: Management of dysfibrinogenemia in pregnancy: A case report. Management of dysfibrinogenemia in pregnancy: A case report
    Article Snippet: The PCR products were sequenced with an ABI 3730XL sequencer (Applied Biosystems, NY, USA). .. Sequence analysis from patient, her mother, sister and her older son revealed a heterozygous point mutation in exon 2 of FGA gene at the position 1233C→A, which causes the His→Arg substitution at position 16 of the Aα chain (Figure ).

    Article Title: Association of FOS‐Like Antigen 1 Promoter Polymorphism with Podocyte Foot Process Effacement in Immunoglobulin A Nephropathy Patients
    Article Snippet: SNP genotyping was conducted using direct sequencing using the specific primers for rs2239615 (sense: 5′‐ ATGCTCACGAGATTAGGACACG‐3′; anti‐sense: 5′‐CGGGTGAGTGGTAGTAAGAGA‐3′), rs7101 (sense: 5′‐CCCGTGACGTTTACACTCATTC‐3′; anti‐sense: 5′‐GCGGGTGAGTGGTAGTAAGAGA‐3′), rs12373539 (sense: 5′‐TGACGTCATTGCTAGGATACCA‐3′; anti‐sense: 5′‐GGCCGTAGCTCTGAGTCTTATG‐3′), rs2282695 (sense: 5′‐GACTTGCACCTTACTTCCCCAAC‐3′; anti‐sense: 5′‐TCTCAGATCTAGGGTTCTGATG‐3′), rs637571 (sense: 5′‐GACTTGCACCTTACTTCCCCAAC‐3′; anti‐sense: 5′‐TCTCAGATCTAGGGTTCTGATG‐3′), and rs925255 (sense: 5′‐CCTGCTCTAAGGTCTGTGCTCT‐3′; anti‐sense: 5′‐CTACCGGTTCCCTTTTTGTTTT‐3′). .. The PCR products were sequenced using an ABI PRISM 3730XL analyzer (PE Applied Biosystems, Foster City, CA, USA).

    Article Title: The Genomic Landscape of UM-SCC Oral Cavity Squamous Cell Carcinoma Cell Lines
    Article Snippet: .. PCR products were cloned out using pCR8 TOPO vector (Invitrogen) and submitted for Sanger sequencing at the University of Michigan DNA Sequencing Core on the 3730XL DNA Sequencer (Applied Biosystems). .. Sequences were aligned using the DNASTAR Lasergene software suite.

    Article Title: Comparison of Three Different Commercial Kits for the Human Papilloma Virus Genotyping
    Article Snippet: .. To confirm the HPV genotypes, nucleotide sequence of PCR products was analyzed by ABI 3730xl DNA analyzer (Life Technologies, Carlsbad, CA, USA) and compared with GenBank BLAST database. ..

    Article Title: High-Resolution Melting Assay for Genotyping Variants of the CYP2C19 Enzyme and Predicting Voriconazole Effectiveness
    Article Snippet: .. Sequencing was carried out by the Sanger method on an ABI 3730XL (Applied Biosystems). .. The sequences of all the processed samples were edited and analyzed using the DNASTAR software package (DNAStar, Inc.; Lasergene), using as reference several CYP2C19 gene sequences (GenBank accession numbers , , , , and to ).

    Article Title: Effects of hemoglobin variants HbJ Bangkok, HbE, HbG Taipei, and HbH on analysis of glycated hemoglobin via ion‐exchange high‐performance liquid chromatography. Effects of hemoglobin variants HbJ Bangkok, HbE, HbG Taipei, and HbH on analysis of glycated hemoglobin via ion‐exchange high‐performance liquid chromatography
    Article Snippet: .. The Applied Biosystems 3730xl sequencer (Applied Biosystems, Foster City, CA, USA) uses dideoxy‐mediated chain termination (Sanger method) for sequencing genes that encode Hb. ..

    Article Title: Genotyping of the OATP1B1 c. 521 T > C Polymorphism from the Formalin-Fixed Paraffin-Embedded (FFPE) Tissue Specimens: an Optimized Protocol
    Article Snippet: .. Pipettes: Research Plus® 4-pack (0.1–2.5 μl, 2–20 μl, 20–200 μl, 100–1,000 μl) (Eppendorf, manufacture ID: 2231300004) Heat block (55–94 °C) (VWR, catalog number: 75838–318) Centrifuge (Eppendorf, model: 5424R) Vortex (Vortex Genie 2, 110V, VWR, catalog number: 100370–856) Thermocycler (Techne, Cole-Parmer Scientific Experts, TC-312) NanoDrop Spectrophotometer (NanoDrop Technologies, ND-1000 UV/Vis) 3730xl DNA Analyzer for sequencing (Applied Biosystems, 3730xl) BioRad Molecular XRS Imager (BioRad, Hercules, CA) .. ) Image Lab software (BioRad, Hercules, CA) To help readers follow the experimental procedure more easily, we have made some minor modifications marked in red.

    Article Title: Regional Body Fat Changes and Metabolic Complications in Children With Dunnigan Lipodystrophy-Causing LMNA Variants
    Article Snippet: The purified PCR products were sequenced using dye-terminator chemistry and an ABI 3730xl DNA analyzer (Applied Biosystems, Foster City, CA). .. Sequence variants were verified by manually inspecting the chromatograms of both the wild-type and mutated products.

    Article Title: GJB3/GJB6 screening in GJB2 carriers with idiopathic hearing loss: Is it necessary?. GJB3/GJB6 screening in GJB2 carriers with idiopathic hearing loss: Is it necessary?
    Article Snippet: .. The products were purified and sequenced by Sanger sequencing using a 3730XL DNA analyzer (Applied Biosystems, Carlsbad, California, USA). .. We extended our study by using targeted deafness genes capture and NGS on samples III:2 from the family‐GDHY to explore other hidden modified alleles.

    Article Title: Characterization of expression and alternative splicing of the gene Cadherin-like and PC esterase Domain containing 1 (Cped1)
    Article Snippet: Paragraph title: 2.6. Plasmid construction for Sanger sequencing and confirmation of splice variants ... The reactions were then run on Applied Biosystem’s 3730xl DNA Analyzer.

    Article Title: Role of HPA and the HPG-axis interaction in testosterone-mediated learned helpless behavior
    Article Snippet: Methylation specific (MSP) nested PCR primers ( ) were used to specifically amplify (GeneAmp PCR System 9700, Applied Biosystems, Waltham, MA, USA) the target region within the Crh gene promoter and sequenced using the 3730xl DNA Analyzer (ABI Life Technologies, Grand Island, NY, USA). .. Sequencing results were viewed and interpreted using the Chromas program (Technelysium, DNA Sequencing Software, Australia).

    Article Title: Diesel degrading bacterial endophytes with plant growth promoting potential isolated from a petroleum storage facility
    Article Snippet: .. Sequence detection was performed by capillary electrophoresis on a 3730xl Genetic Analyzer (Life Technologies, Applied Biosystems) using a 50 cm array, the Long DNA sequencing module (LongSeq50_POP7) and the KB analysis protocol (KB basecaller) with the default instrument settings. .. Post-detection, raw signal data was initially processed on the 3730xl Genetic Analyzer computer using Sequencing Analysis v5.3.1 (Life Technologies, Applied Biosystems) from Macrogen®, USA.).

    DNA Sequencing:

    Article Title: The Genomic Landscape of UM-SCC Oral Cavity Squamous Cell Carcinoma Cell Lines
    Article Snippet: .. PCR products were cloned out using pCR8 TOPO vector (Invitrogen) and submitted for Sanger sequencing at the University of Michigan DNA Sequencing Core on the 3730XL DNA Sequencer (Applied Biosystems). .. Sequences were aligned using the DNASTAR Lasergene software suite.

    Article Title: Role of HPA and the HPG-axis interaction in testosterone-mediated learned helpless behavior
    Article Snippet: Methylation specific (MSP) nested PCR primers ( ) were used to specifically amplify (GeneAmp PCR System 9700, Applied Biosystems, Waltham, MA, USA) the target region within the Crh gene promoter and sequenced using the 3730xl DNA Analyzer (ABI Life Technologies, Grand Island, NY, USA). .. Sequencing results were viewed and interpreted using the Chromas program (Technelysium, DNA Sequencing Software, Australia).

    Article Title: Diesel degrading bacterial endophytes with plant growth promoting potential isolated from a petroleum storage facility
    Article Snippet: .. Sequence detection was performed by capillary electrophoresis on a 3730xl Genetic Analyzer (Life Technologies, Applied Biosystems) using a 50 cm array, the Long DNA sequencing module (LongSeq50_POP7) and the KB analysis protocol (KB basecaller) with the default instrument settings. .. Post-detection, raw signal data was initially processed on the 3730xl Genetic Analyzer computer using Sequencing Analysis v5.3.1 (Life Technologies, Applied Biosystems) from Macrogen®, USA.).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Characterization of expression and alternative splicing of the gene Cadherin-like and PC esterase Domain containing 1 (Cped1)
    Article Snippet: Briefly, RT-PCR products were inserted into pCR2.1-TOPO vector and chemically transformed into One Shot competent E. coli cells. .. The reactions were then run on Applied Biosystem’s 3730xl DNA Analyzer.

    Molecular Weight:

    Article Title: High-Resolution Melting Assay for Genotyping Variants of the CYP2C19 Enzyme and Predicting Voriconazole Effectiveness
    Article Snippet: PCR products were visualized on a 0.8% agarose gel using BenchTop 1-kb DNA ladder (Promega Corporation, Madison, WI) as the molecular weight marker. .. Sequencing was carried out by the Sanger method on an ABI 3730XL (Applied Biosystems).

    Imaging:

    Article Title: GJB3/GJB6 screening in GJB2 carriers with idiopathic hearing loss: Is it necessary?. GJB3/GJB6 screening in GJB2 carriers with idiopathic hearing loss: Is it necessary?
    Article Snippet: Temporal imaging and auditory assessments with auditory brainstem response (ABR) and distortion product otoacoustic emissions (DPOAE) in each participant had ruled out the risk of enlarged vestibular aqueduct or auditory neuropathy. .. The products were purified and sequenced by Sanger sequencing using a 3730XL DNA analyzer (Applied Biosystems, Carlsbad, California, USA).

    DNA Extraction:

    Article Title: Association of FOS‐Like Antigen 1 Promoter Polymorphism with Podocyte Foot Process Effacement in Immunoglobulin A Nephropathy Patients
    Article Snippet: DNA was isolated from a peripheral blood sample using the DNA Isolation Kit for blood (Roche, IN, USA). .. The PCR products were sequenced using an ABI PRISM 3730XL analyzer (PE Applied Biosystems, Foster City, CA, USA).

    Article Title: Diesel degrading bacterial endophytes with plant growth promoting potential isolated from a petroleum storage facility
    Article Snippet: Genomic DNA isolation followed by PCR amplification was performed using universal primers 27F (5′AGAGTTTGATCMTGGCTCAG3′) (Barns et al. ) and 1492R (5′TACGGYTACCTTGTTACGACTT3′) (Lane ). .. Sequence detection was performed by capillary electrophoresis on a 3730xl Genetic Analyzer (Life Technologies, Applied Biosystems) using a 50 cm array, the Long DNA sequencing module (LongSeq50_POP7) and the KB analysis protocol (KB basecaller) with the default instrument settings.

    Methylation:

    Article Title: Role of HPA and the HPG-axis interaction in testosterone-mediated learned helpless behavior
    Article Snippet: .. Methylation specific (MSP) nested PCR primers ( ) were used to specifically amplify (GeneAmp PCR System 9700, Applied Biosystems, Waltham, MA, USA) the target region within the Crh gene promoter and sequenced using the 3730xl DNA Analyzer (ABI Life Technologies, Grand Island, NY, USA). .. Sequencing results were viewed and interpreted using the Chromas program (Technelysium, DNA Sequencing Software, Australia).

    Mutagenesis:

    Article Title: High Prevalence of Fluoroquinolone-Resistant Campylobacter Bacteria in Sheep and Increased Campylobacter Counts in the Bile and Gallbladders of Sheep Medicated with Tetracycline in Feed
    Article Snippet: Paragraph title: gyrA mutation determination. ... All PCR products were purified using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and then sequenced at the DNA Core Facility of Iowa State University using an Applied Biosystems 3730xl DNA analyzer.

    Article Title: GJB3/GJB6 screening in GJB2 carriers with idiopathic hearing loss: Is it necessary?. GJB3/GJB6 screening in GJB2 carriers with idiopathic hearing loss: Is it necessary?
    Article Snippet: Also, neither the splice site mutation c. IVS1 + 1G > A, nor defects in exon 1 and its basal promoter in GJB2 was present. .. The products were purified and sequenced by Sanger sequencing using a 3730XL DNA analyzer (Applied Biosystems, Carlsbad, California, USA).

    Isolation:

    Article Title: Association of FOS‐Like Antigen 1 Promoter Polymorphism with Podocyte Foot Process Effacement in Immunoglobulin A Nephropathy Patients
    Article Snippet: DNA was isolated from a peripheral blood sample using the DNA Isolation Kit for blood (Roche, IN, USA). .. The PCR products were sequenced using an ABI PRISM 3730XL analyzer (PE Applied Biosystems, Foster City, CA, USA).

    Article Title: The Genomic Landscape of UM-SCC Oral Cavity Squamous Cell Carcinoma Cell Lines
    Article Snippet: Genomic DNA was isolated following Gentra PureGene protocol (Qiagen) and PCR amplified with Platinum Taq DNA Polymerase High Fidelity (Invitrogen) according to manufacturer’s instructions. .. PCR products were cloned out using pCR8 TOPO vector (Invitrogen) and submitted for Sanger sequencing at the University of Michigan DNA Sequencing Core on the 3730XL DNA Sequencer (Applied Biosystems).

    Purification:

    Article Title: High Prevalence of Fluoroquinolone-Resistant Campylobacter Bacteria in Sheep and Increased Campylobacter Counts in the Bile and Gallbladders of Sheep Medicated with Tetracycline in Feed
    Article Snippet: .. All PCR products were purified using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and then sequenced at the DNA Core Facility of Iowa State University using an Applied Biosystems 3730xl DNA analyzer. ..

    Article Title: High-Resolution Melting Assay for Genotyping Variants of the CYP2C19 Enzyme and Predicting Voriconazole Effectiveness
    Article Snippet: A final volume of 10 μl consisting of 6.4 μl of water, 0.6 μl of primer (50 μM), and 3 μl of the purified PCR product was prepared for this purpose. .. Sequencing was carried out by the Sanger method on an ABI 3730XL (Applied Biosystems).

    Article Title: Regional Body Fat Changes and Metabolic Complications in Children With Dunnigan Lipodystrophy-Causing LMNA Variants
    Article Snippet: .. The purified PCR products were sequenced using dye-terminator chemistry and an ABI 3730xl DNA analyzer (Applied Biosystems, Foster City, CA). .. Sequence variants were verified by manually inspecting the chromatograms of both the wild-type and mutated products.

    Article Title: GJB3/GJB6 screening in GJB2 carriers with idiopathic hearing loss: Is it necessary?. GJB3/GJB6 screening in GJB2 carriers with idiopathic hearing loss: Is it necessary?
    Article Snippet: .. The products were purified and sequenced by Sanger sequencing using a 3730XL DNA analyzer (Applied Biosystems, Carlsbad, California, USA). .. We extended our study by using targeted deafness genes capture and NGS on samples III:2 from the family‐GDHY to explore other hidden modified alleles.

    Article Title: Diesel degrading bacterial endophytes with plant growth promoting potential isolated from a petroleum storage facility
    Article Snippet: Sequence detection was performed by capillary electrophoresis on a 3730xl Genetic Analyzer (Life Technologies, Applied Biosystems) using a 50 cm array, the Long DNA sequencing module (LongSeq50_POP7) and the KB analysis protocol (KB basecaller) with the default instrument settings. .. Sequence detection was performed by capillary electrophoresis on a 3730xl Genetic Analyzer (Life Technologies, Applied Biosystems) using a 50 cm array, the Long DNA sequencing module (LongSeq50_POP7) and the KB analysis protocol (KB basecaller) with the default instrument settings.

    Polymerase Chain Reaction:

    Article Title: Management of dysfibrinogenemia in pregnancy: A case report. Management of dysfibrinogenemia in pregnancy: A case report
    Article Snippet: .. The PCR products were sequenced with an ABI 3730XL sequencer (Applied Biosystems, NY, USA). .. Sequence analysis from patient, her mother, sister and her older son revealed a heterozygous point mutation in exon 2 of FGA gene at the position 1233C→A, which causes the His→Arg substitution at position 16 of the Aα chain (Figure ).

    Article Title: Association of FOS‐Like Antigen 1 Promoter Polymorphism with Podocyte Foot Process Effacement in Immunoglobulin A Nephropathy Patients
    Article Snippet: .. The PCR products were sequenced using an ABI PRISM 3730XL analyzer (PE Applied Biosystems, Foster City, CA, USA). .. Sequence data were analyzed using SeqManII software (DNASTAR Inc., Madison, WI, USA).

    Article Title: High Prevalence of Fluoroquinolone-Resistant Campylobacter Bacteria in Sheep and Increased Campylobacter Counts in the Bile and Gallbladders of Sheep Medicated with Tetracycline in Feed
    Article Snippet: .. All PCR products were purified using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and then sequenced at the DNA Core Facility of Iowa State University using an Applied Biosystems 3730xl DNA analyzer. ..

    Article Title: The Genomic Landscape of UM-SCC Oral Cavity Squamous Cell Carcinoma Cell Lines
    Article Snippet: .. PCR products were cloned out using pCR8 TOPO vector (Invitrogen) and submitted for Sanger sequencing at the University of Michigan DNA Sequencing Core on the 3730XL DNA Sequencer (Applied Biosystems). .. Sequences were aligned using the DNASTAR Lasergene software suite.

    Article Title: Comparison of Three Different Commercial Kits for the Human Papilloma Virus Genotyping
    Article Snippet: .. To confirm the HPV genotypes, nucleotide sequence of PCR products was analyzed by ABI 3730xl DNA analyzer (Life Technologies, Carlsbad, CA, USA) and compared with GenBank BLAST database. ..

    Article Title: High-Resolution Melting Assay for Genotyping Variants of the CYP2C19 Enzyme and Predicting Voriconazole Effectiveness
    Article Snippet: A final volume of 10 μl consisting of 6.4 μl of water, 0.6 μl of primer (50 μM), and 3 μl of the purified PCR product was prepared for this purpose. .. Sequencing was carried out by the Sanger method on an ABI 3730XL (Applied Biosystems).

    Article Title: Regional Body Fat Changes and Metabolic Complications in Children With Dunnigan Lipodystrophy-Causing LMNA Variants
    Article Snippet: .. The purified PCR products were sequenced using dye-terminator chemistry and an ABI 3730xl DNA analyzer (Applied Biosystems, Foster City, CA). .. Sequence variants were verified by manually inspecting the chromatograms of both the wild-type and mutated products.

    Article Title: GJB3/GJB6 screening in GJB2 carriers with idiopathic hearing loss: Is it necessary?. GJB3/GJB6 screening in GJB2 carriers with idiopathic hearing loss: Is it necessary?
    Article Snippet: Paragraph title: 2.1. Study participants, PCR, Sanger sequencing ... The products were purified and sequenced by Sanger sequencing using a 3730XL DNA analyzer (Applied Biosystems, Carlsbad, California, USA).

    Article Title: Role of HPA and the HPG-axis interaction in testosterone-mediated learned helpless behavior
    Article Snippet: .. Methylation specific (MSP) nested PCR primers ( ) were used to specifically amplify (GeneAmp PCR System 9700, Applied Biosystems, Waltham, MA, USA) the target region within the Crh gene promoter and sequenced using the 3730xl DNA Analyzer (ABI Life Technologies, Grand Island, NY, USA). .. Sequencing results were viewed and interpreted using the Chromas program (Technelysium, DNA Sequencing Software, Australia).

    Article Title: Diesel degrading bacterial endophytes with plant growth promoting potential isolated from a petroleum storage facility
    Article Snippet: Sequence detection was performed by capillary electrophoresis on a 3730xl Genetic Analyzer (Life Technologies, Applied Biosystems) using a 50 cm array, the Long DNA sequencing module (LongSeq50_POP7) and the KB analysis protocol (KB basecaller) with the default instrument settings. .. Sequence detection was performed by capillary electrophoresis on a 3730xl Genetic Analyzer (Life Technologies, Applied Biosystems) using a 50 cm array, the Long DNA sequencing module (LongSeq50_POP7) and the KB analysis protocol (KB basecaller) with the default instrument settings.

    Construct:

    Article Title: Diesel degrading bacterial endophytes with plant growth promoting potential isolated from a petroleum storage facility
    Article Snippet: Sequence detection was performed by capillary electrophoresis on a 3730xl Genetic Analyzer (Life Technologies, Applied Biosystems) using a 50 cm array, the Long DNA sequencing module (LongSeq50_POP7) and the KB analysis protocol (KB basecaller) with the default instrument settings. .. The sequence data of closely related validly named type strains were retrieved from the database of the EzTaxon Server and alignment was performed using Clustal W. Gaps and ambiguous data were deleted in the alignment as described previously (Ahmed et al. ) and neighbor joining (NJ) phylogenetic tree was constructed using the Kimura 2-parameter model contained in MEGA 7.0 software package (Kumar et al. ).

    Nested PCR:

    Article Title: Role of HPA and the HPG-axis interaction in testosterone-mediated learned helpless behavior
    Article Snippet: .. Methylation specific (MSP) nested PCR primers ( ) were used to specifically amplify (GeneAmp PCR System 9700, Applied Biosystems, Waltham, MA, USA) the target region within the Crh gene promoter and sequenced using the 3730xl DNA Analyzer (ABI Life Technologies, Grand Island, NY, USA). .. Sequencing results were viewed and interpreted using the Chromas program (Technelysium, DNA Sequencing Software, Australia).

    Plasmid Preparation:

    Article Title: The Genomic Landscape of UM-SCC Oral Cavity Squamous Cell Carcinoma Cell Lines
    Article Snippet: .. PCR products were cloned out using pCR8 TOPO vector (Invitrogen) and submitted for Sanger sequencing at the University of Michigan DNA Sequencing Core on the 3730XL DNA Sequencer (Applied Biosystems). .. Sequences were aligned using the DNASTAR Lasergene software suite.

    Article Title: Characterization of expression and alternative splicing of the gene Cadherin-like and PC esterase Domain containing 1 (Cped1)
    Article Snippet: Paragraph title: 2.6. Plasmid construction for Sanger sequencing and confirmation of splice variants ... The reactions were then run on Applied Biosystem’s 3730xl DNA Analyzer.

    Software:

    Article Title: Association of FOS‐Like Antigen 1 Promoter Polymorphism with Podocyte Foot Process Effacement in Immunoglobulin A Nephropathy Patients
    Article Snippet: The PCR products were sequenced using an ABI PRISM 3730XL analyzer (PE Applied Biosystems, Foster City, CA, USA). .. Sequence data were analyzed using SeqManII software (DNASTAR Inc., Madison, WI, USA).

    Article Title: The Genomic Landscape of UM-SCC Oral Cavity Squamous Cell Carcinoma Cell Lines
    Article Snippet: PCR products were cloned out using pCR8 TOPO vector (Invitrogen) and submitted for Sanger sequencing at the University of Michigan DNA Sequencing Core on the 3730XL DNA Sequencer (Applied Biosystems). .. Sequences were aligned using the DNASTAR Lasergene software suite.

    Article Title: High Prevalence of Fluoroquinolone-Resistant Campylobacter Bacteria in Sheep and Increased Campylobacter Counts in the Bile and Gallbladders of Sheep Medicated with Tetracycline in Feed
    Article Snippet: The PFGE patterns were analyzed by GelCompare II v.6.5 software (Applied Maths, Kortrijk, Belgium) using the Dice similarity coefficient and unweighted-pair group method with arithmetic averages (UPGMA) with 0.5% optimization and 1.5% position tolerance. .. All PCR products were purified using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and then sequenced at the DNA Core Facility of Iowa State University using an Applied Biosystems 3730xl DNA analyzer.

    Article Title: High-Resolution Melting Assay for Genotyping Variants of the CYP2C19 Enzyme and Predicting Voriconazole Effectiveness
    Article Snippet: Sequencing was carried out by the Sanger method on an ABI 3730XL (Applied Biosystems). .. The sequences of all the processed samples were edited and analyzed using the DNASTAR software package (DNAStar, Inc.; Lasergene), using as reference several CYP2C19 gene sequences (GenBank accession numbers , , , , and to ).

    Article Title: Role of HPA and the HPG-axis interaction in testosterone-mediated learned helpless behavior
    Article Snippet: Methylation specific (MSP) nested PCR primers ( ) were used to specifically amplify (GeneAmp PCR System 9700, Applied Biosystems, Waltham, MA, USA) the target region within the Crh gene promoter and sequenced using the 3730xl DNA Analyzer (ABI Life Technologies, Grand Island, NY, USA). .. Sequencing results were viewed and interpreted using the Chromas program (Technelysium, DNA Sequencing Software, Australia).

    Article Title: Diesel degrading bacterial endophytes with plant growth promoting potential isolated from a petroleum storage facility
    Article Snippet: Sequence detection was performed by capillary electrophoresis on a 3730xl Genetic Analyzer (Life Technologies, Applied Biosystems) using a 50 cm array, the Long DNA sequencing module (LongSeq50_POP7) and the KB analysis protocol (KB basecaller) with the default instrument settings. .. The sequence data of closely related validly named type strains were retrieved from the database of the EzTaxon Server and alignment was performed using Clustal W. Gaps and ambiguous data were deleted in the alignment as described previously (Ahmed et al. ) and neighbor joining (NJ) phylogenetic tree was constructed using the Kimura 2-parameter model contained in MEGA 7.0 software package (Kumar et al. ).

    Selection:

    Article Title: Association of FOS‐Like Antigen 1 Promoter Polymorphism with Podocyte Foot Process Effacement in Immunoglobulin A Nephropathy Patients
    Article Snippet: Paragraph title: SNP selection and genotyping ... The PCR products were sequenced using an ABI PRISM 3730XL analyzer (PE Applied Biosystems, Foster City, CA, USA).

    Article Title: Characterization of expression and alternative splicing of the gene Cadherin-like and PC esterase Domain containing 1 (Cped1)
    Article Snippet: Color-based clone selection of bacterial colonies was performed using Lysogeny Broth (LB) agar plates containing 50 µg/mL ampicillin, 40 mg/mL 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal) in dimethylformamide (DMF), and 100 nM isopropyl β-D-1-thiogalactopyranoside (IPTG) in water. .. The reactions were then run on Applied Biosystem’s 3730xl DNA Analyzer.

    Agarose Gel Electrophoresis:

    Article Title: Comparison of Three Different Commercial Kits for the Human Papilloma Virus Genotyping
    Article Snippet: Then, the PCR products were electrophoresed on a 2% agarose gel at 100 V for 40 min and the DNA was stained with ethidium bromide. .. To confirm the HPV genotypes, nucleotide sequence of PCR products was analyzed by ABI 3730xl DNA analyzer (Life Technologies, Carlsbad, CA, USA) and compared with GenBank BLAST database.

    Article Title: High-Resolution Melting Assay for Genotyping Variants of the CYP2C19 Enzyme and Predicting Voriconazole Effectiveness
    Article Snippet: PCR products were visualized on a 0.8% agarose gel using BenchTop 1-kb DNA ladder (Promega Corporation, Madison, WI) as the molecular weight marker. .. Sequencing was carried out by the Sanger method on an ABI 3730XL (Applied Biosystems).

    Article Title: Regional Body Fat Changes and Metabolic Complications in Children With Dunnigan Lipodystrophy-Causing LMNA Variants
    Article Snippet: The resulting PCR product was analyzed in an agarose gel and purified using a PCR purification kit (Qiagen, Valencia, CA). .. The purified PCR products were sequenced using dye-terminator chemistry and an ABI 3730xl DNA analyzer (Applied Biosystems, Foster City, CA).

    Spectrophotometry:

    Article Title: Genotyping of the OATP1B1 c. 521 T > C Polymorphism from the Formalin-Fixed Paraffin-Embedded (FFPE) Tissue Specimens: an Optimized Protocol
    Article Snippet: .. Pipettes: Research Plus® 4-pack (0.1–2.5 μl, 2–20 μl, 20–200 μl, 100–1,000 μl) (Eppendorf, manufacture ID: 2231300004) Heat block (55–94 °C) (VWR, catalog number: 75838–318) Centrifuge (Eppendorf, model: 5424R) Vortex (Vortex Genie 2, 110V, VWR, catalog number: 100370–856) Thermocycler (Techne, Cole-Parmer Scientific Experts, TC-312) NanoDrop Spectrophotometer (NanoDrop Technologies, ND-1000 UV/Vis) 3730xl DNA Analyzer for sequencing (Applied Biosystems, 3730xl) BioRad Molecular XRS Imager (BioRad, Hercules, CA) .. ) Image Lab software (BioRad, Hercules, CA) To help readers follow the experimental procedure more easily, we have made some minor modifications marked in red.

    DNA Purification:

    Article Title: Role of HPA and the HPG-axis interaction in testosterone-mediated learned helpless behavior
    Article Snippet: Genomic DNA was extracted using the Wizard Genomic DNA purification kit (Promega, Madison, WI, USA). .. Methylation specific (MSP) nested PCR primers ( ) were used to specifically amplify (GeneAmp PCR System 9700, Applied Biosystems, Waltham, MA, USA) the target region within the Crh gene promoter and sequenced using the 3730xl DNA Analyzer (ABI Life Technologies, Grand Island, NY, USA).

    Marker:

    Article Title: High Prevalence of Fluoroquinolone-Resistant Campylobacter Bacteria in Sheep and Increased Campylobacter Counts in the Bile and Gallbladders of Sheep Medicated with Tetracycline in Feed
    Article Snippet: A Lambda DNA ladder (Bio-Rad) was used as the molecular size marker. .. All PCR products were purified using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and then sequenced at the DNA Core Facility of Iowa State University using an Applied Biosystems 3730xl DNA analyzer.

    Article Title: High-Resolution Melting Assay for Genotyping Variants of the CYP2C19 Enzyme and Predicting Voriconazole Effectiveness
    Article Snippet: PCR products were visualized on a 0.8% agarose gel using BenchTop 1-kb DNA ladder (Promega Corporation, Madison, WI) as the molecular weight marker. .. Sequencing was carried out by the Sanger method on an ABI 3730XL (Applied Biosystems).

    Staining:

    Article Title: Comparison of Three Different Commercial Kits for the Human Papilloma Virus Genotyping
    Article Snippet: Then, the PCR products were electrophoresed on a 2% agarose gel at 100 V for 40 min and the DNA was stained with ethidium bromide. .. To confirm the HPV genotypes, nucleotide sequence of PCR products was analyzed by ABI 3730xl DNA analyzer (Life Technologies, Carlsbad, CA, USA) and compared with GenBank BLAST database.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher 3730xl dna analyzer
    3730xl Dna Analyzer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 4697 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/3730xl dna analyzer/product/Thermo Fisher
    Average 90 stars, based on 4697 article reviews
    Price from $9.99 to $1999.99
    3730xl dna analyzer - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    N/A
    This is a Capillary Array for the Applied Biosystems 3730xl DNA Analyzer Each array contains 96 capillaries 36 cm long Used for sequencing microsatellite SNP genotyping and fragment analysis runs
      Buy from Supplier

    Image Search Results