3730xl dna analyzer (Thermo Fisher)
Thermo Fisher is a verified supplier 
99
|
Name:
3730xl DNA Analyzer
Description:
The 96-capillary 3730xl DNA Analyzer is the Gold Standard for high throughput genetic analysis. Use this for DNA fragment analysis applications such as microsatellites, AFLP, SNP analysis, mutation detection and traditional DNA sequencing. Get the highest quality data at a low cost per sample. • Higher optical sensitivity and advanced polymers enable you to obtain higher-quality sequencing data for less. • Multiple automation features decrease costly human errors. • Optimized polymers increase your productivity without compromising your results. • Perform a wide variety of sequencing and fragment analysis applications including resequencing, microsatellite analysis, AFLP, LOH, SSCP, SNP screening and SNP validation.Large-Scale DNA Analysis on a Small-Scale BudgetBy combining advances in automation with innovative optics and proprietary reagents to increase throughput, yield high-quality data, and minimize reagent consumption, the 3730xl Analyzer provides your laboratory and production facility with faster, better, cheaper analysis.Streamline Your Workflow The 3730xl DNA Analyzer system is engineered for highly reliable, unattended operation of up to 48 hours (applies to modules with run times longer than 30 minutes). To minimize the need for operator intervention and decrease the risk of human error, automation features include an integrated plate stacker, internal bar code reader, and onboard polymer delivery system.Increase ProductivityThe high signal-to-noise ratio ensures you get high-quality data – even when you use low-concentration samples and reagents. Labor-saving automation features minimize hands-on time and enable you to analyze more data more efficiently. Get the Highest-Quality Sequencing and Genotyping DataThe enhanced optical design provides a higher signal-to-noise ratio and a more uniform signal profile across the array. This design, combined with our new, advanced polymer, enables the longest read lengths of any available system, and provides enhanced color balance for streamlined genotyping sample handling. In addition, exceptional sensitivity enables higher success rates across a wide range of sample template types and concentrations. One Instrument, Multiple ApplicationsWith the 3730xl DNA Analyzer, you get the highest-quality data from a wide array of applications. In addition to being ideal for high-throughput sequencing, the analyzer's optimized application assays, instrument, and analysis software also provide a complete solution for genotyping and resequencing. Integrated Data Analysis Tools Reduce Time-to-ResultsThe 3730xl DNA Analyzer software suite allows you to generate more meaningful data with less work. This system's labor-saving software suite includes: • Data Collection (supplied with the instrument) – Manages your instrument setup, controls instrument operations, allows real-time data visualization, and performs diagnostics.• Sequencing Analysis Software – Designed to base-call; assign quality values; trim, display, edit and print DNA sequencing data using the KB basecaller • Seqscape – Provides everything you need to perform resequencing applications such as VariantSEQr Resequencing System • GeneMapper – Enables configurable, automated allele calling; a plus for high-throughput genotyping and includes tools for SNPlex data analysis New features include: • Auto-analysis with GeneMapper and SeqScape • Flexibility to use any choice in dye set option • Tools to assist with regulatory and compliance requirements (In the United States, this assists with FDA 21CFR part 11). • Additional optimized run modules covering more applications • Support for fragment analysis applications on the 96-capillary arrayThe instrument comes with a one year limited warranty on parts and labor. For Research Use Only. Not for use in diagnostics procedures.
Catalog Number:
3730XL
Price:
None
Applications:
Amplified Fragment Length Polymorphism-AFLP|Bacterial Artificial Chromosome (BAC) Fingerprinting|DNA Sequencing|Epigenetic Sequencing|Fragment Analysis|Genotyping & Genomic Profiling|Methylation-Sensitive Mobility Shift Assay|Microsatellite Marker Analysis|Mitochondrial Sequencing|Quantitative Fluorescence PCR (qf-PCR)|RNAi, Epigenetics & Non-Coding RNA Research|Resequencing|SNP Genotyping by Fragment-Analysis|Sanger Sequencing|Sanger Sequencing Technology & Accessories|Methylation Analysis|Gene Expression Analysis & Genotyping|SNP Genotyping|Sequencing|Methylation Analysis by Sequencing|Restriction Fragment Length Polymorphisms (RFLP) Analysis|Single-Strand Conformation Polymorphism (SSCP) Analysis|Genotyping Instruments, Software & Calibration|Chimerism|Microsatellite Instability|Microsatellite STR Analysis|ISSR (Inter-Simple Sequence Repeat) Analysis|Microsatellite Analysis
Size:
1 system
Category:
Instruments and Equipment, Sequencing & Genetic Analyzer Instruments & Accessories, Sequencing & Genetic Analyzer Instruments
Score:
85
|
Buy from Supplier |
Structured Review
Thermo Fisher
3730xl dna analyzer
The 96-capillary 3730xl DNA Analyzer is the Gold Standard for high throughput genetic analysis. Use this for DNA fragment analysis applications such as microsatellites, AFLP, SNP analysis, mutation detection and traditional DNA sequencing. Get the highest quality data at a low cost per sample. • Higher optical sensitivity and advanced polymers enable you to obtain higher-quality sequencing data for less. • Multiple automation features decrease costly human errors. • Optimized polymers increase your productivity without compromising your results. • Perform a wide variety of sequencing and fragment analysis applications including resequencing, microsatellite analysis, AFLP, LOH, SSCP, SNP screening and SNP validation.Large-Scale DNA Analysis on a Small-Scale BudgetBy combining advances in automation with innovative optics and proprietary reagents to increase throughput, yield high-quality data, and minimize reagent consumption, the 3730xl Analyzer provides your laboratory and production facility with faster, better, cheaper analysis.Streamline Your Workflow The 3730xl DNA Analyzer system is engineered for highly reliable, unattended operation of up to 48 hours (applies to modules with run times longer than 30 minutes). To minimize the need for operator intervention and decrease the risk of human error, automation features include an integrated plate stacker, internal bar code reader, and onboard polymer delivery system.Increase ProductivityThe high signal-to-noise ratio ensures you get high-quality data – even when you use low-concentration samples and reagents. Labor-saving automation features minimize hands-on time and enable you to analyze more data more efficiently. Get the Highest-Quality Sequencing and Genotyping DataThe enhanced optical design provides a higher signal-to-noise ratio and a more uniform signal profile across the array. This design, combined with our new, advanced polymer, enables the longest read lengths of any available system, and provides enhanced color balance for streamlined genotyping sample handling. In addition, exceptional sensitivity enables higher success rates across a wide range of sample template types and concentrations. One Instrument, Multiple ApplicationsWith the 3730xl DNA Analyzer, you get the highest-quality data from a wide array of applications. In addition to being ideal for high-throughput sequencing, the analyzer's optimized application assays, instrument, and analysis software also provide a complete solution for genotyping and resequencing. Integrated Data Analysis Tools Reduce Time-to-ResultsThe 3730xl DNA Analyzer software suite allows you to generate more meaningful data with less work. This system's labor-saving software suite includes: • Data Collection (supplied with the instrument) – Manages your instrument setup, controls instrument operations, allows real-time data visualization, and performs diagnostics.• Sequencing Analysis Software – Designed to base-call; assign quality values; trim, display, edit and print DNA sequencing data using the KB basecaller • Seqscape – Provides everything you need to perform resequencing applications such as VariantSEQr Resequencing System • GeneMapper – Enables configurable, automated allele calling; a plus for high-throughput genotyping and includes tools for SNPlex data analysis New features include: • Auto-analysis with GeneMapper and SeqScape • Flexibility to use any choice in dye set option • Tools to assist with regulatory and compliance requirements (In the United States, this assists with FDA 21CFR part 11). • Additional optimized run modules covering more applications • Support for fragment analysis applications on the 96-capillary arrayThe instrument comes with a one year limited warranty on parts and labor. For Research Use Only. Not for use in diagnostics procedures.
https://www.bioz.com/result/3730xl dna analyzer/product/Thermo Fisher
Average 99 stars, based on 2731 article reviews
Price from $9.99 to $1999.99
The 96-capillary 3730xl DNA Analyzer is the Gold Standard for high throughput genetic analysis. Use this for DNA fragment analysis applications such as microsatellites, AFLP, SNP analysis, mutation detection and traditional DNA sequencing. Get the highest quality data at a low cost per sample. • Higher optical sensitivity and advanced polymers enable you to obtain higher-quality sequencing data for less. • Multiple automation features decrease costly human errors. • Optimized polymers increase your productivity without compromising your results. • Perform a wide variety of sequencing and fragment analysis applications including resequencing, microsatellite analysis, AFLP, LOH, SSCP, SNP screening and SNP validation.Large-Scale DNA Analysis on a Small-Scale BudgetBy combining advances in automation with innovative optics and proprietary reagents to increase throughput, yield high-quality data, and minimize reagent consumption, the 3730xl Analyzer provides your laboratory and production facility with faster, better, cheaper analysis.Streamline Your Workflow The 3730xl DNA Analyzer system is engineered for highly reliable, unattended operation of up to 48 hours (applies to modules with run times longer than 30 minutes). To minimize the need for operator intervention and decrease the risk of human error, automation features include an integrated plate stacker, internal bar code reader, and onboard polymer delivery system.Increase ProductivityThe high signal-to-noise ratio ensures you get high-quality data – even when you use low-concentration samples and reagents. Labor-saving automation features minimize hands-on time and enable you to analyze more data more efficiently. Get the Highest-Quality Sequencing and Genotyping DataThe enhanced optical design provides a higher signal-to-noise ratio and a more uniform signal profile across the array. This design, combined with our new, advanced polymer, enables the longest read lengths of any available system, and provides enhanced color balance for streamlined genotyping sample handling. In addition, exceptional sensitivity enables higher success rates across a wide range of sample template types and concentrations. One Instrument, Multiple ApplicationsWith the 3730xl DNA Analyzer, you get the highest-quality data from a wide array of applications. In addition to being ideal for high-throughput sequencing, the analyzer's optimized application assays, instrument, and analysis software also provide a complete solution for genotyping and resequencing. Integrated Data Analysis Tools Reduce Time-to-ResultsThe 3730xl DNA Analyzer software suite allows you to generate more meaningful data with less work. This system's labor-saving software suite includes: • Data Collection (supplied with the instrument) – Manages your instrument setup, controls instrument operations, allows real-time data visualization, and performs diagnostics.• Sequencing Analysis Software – Designed to base-call; assign quality values; trim, display, edit and print DNA sequencing data using the KB basecaller • Seqscape – Provides everything you need to perform resequencing applications such as VariantSEQr Resequencing System • GeneMapper – Enables configurable, automated allele calling; a plus for high-throughput genotyping and includes tools for SNPlex data analysis New features include: • Auto-analysis with GeneMapper and SeqScape • Flexibility to use any choice in dye set option • Tools to assist with regulatory and compliance requirements (In the United States, this assists with FDA 21CFR part 11). • Additional optimized run modules covering more applications • Support for fragment analysis applications on the 96-capillary arrayThe instrument comes with a one year limited warranty on parts and labor. For Research Use Only. Not for use in diagnostics procedures.
https://www.bioz.com/result/3730xl dna analyzer/product/Thermo Fisher
Average 99 stars, based on 2731 article reviews
Price from $9.99 to $1999.99
3730xl dna analyzer - by Bioz Stars,
2019-12
99/100 stars
Related Products / Commonly Used Together
Images
1) Product Images from "Development and application of a high throughput carbohydrate profiling technique for analyzing plant cell wall polysaccharides and carbohydrate active enzymes"
Article Title: Development and application of a high throughput carbohydrate profiling technique for analyzing plant cell wall polysaccharides and carbohydrate active enzymes
Journal: Biotechnology for Biofuels
doi: 10.1186/1754-6834-6-94
Figure Legend Snippet: Separation of APTS-labelled oligosaccharides by CE in an ABI 3730xl DNA sequencer. (A) Electropherogram trace (50 min) of APTS labelled hydrolysed dextran and β-1,4-xylo oligosaccharides DP1 to DP6. (B) Large DP hydrolysed dextran oligosaccharides can be resolved by extending the electrophoresis time to 90 minutes. RFU, relative fluorescence units; G, Glucose; X, Xylose.
Techniques Used: Electrophoresis, Fluorescence
Related Articles
Clone Assay:Article Title: Genomic and structural investigation on dolphin morbillivirus (DMV) in Mediterranean fin whales (Balaenoptera physalus) Article Snippet: Paragraph title: Primer design, PCR protocol and cloning procedures ... The PCR products obtained were size-separated by agarose gel electrophoresis, to be then displayed in Article Title: Genomic and proteomic analyses of Mycobacterium bovis BCG Mexico 1931 reveal a diverse immunogenic repertoire against tuberculosis infection Article Snippet: The genome of M. bovis BCG Mexico 1931 was sequenced using 454 pyrosequencing, which was performed by the Sequencing Unit of CINVESTAV, Irapuato, Mexico. .. Additionally, a fosmid library with inserts of approximately 40 kb was constructed using the CopyControl™ pCCFOS™ system (Epicentre Technologies, USA), and the fos-end sequences of 250 clones were determined using the Amplification:Article Title: Microsatellite polymorphism in the Heme oxygenase-1 gene promoter is associated with dermal collagen density in Japanese obese male subjects Article Snippet: The promoter region of the HMOX1 gene was amplified by PCR using AmpliTaq Gold PCR Master Mix (Thermo Fisher Scientific) and specific primers with the following sequences: AGAGCCTGCAGCTTCTCAGA (forward) and ACAAAGTCTGGCCATAGGCA (reverse). .. The number of GT repeats was determined from the sequences of PCR products analyzed by dye terminator methods using a Article Title: Genomic and structural investigation on dolphin morbillivirus (DMV) in Mediterranean fin whales (Balaenoptera physalus) Article Snippet: Amplification was performed using a high-fidelity polymerase (Phusion Hot Start II DNA Polymerase, Thermo Scientific), with the following PCR conditions: 30 sec at 98 °C; 35 cycles of 10 sec at 98 °C, 30 sec at 58 °C, 1 min at 72 °C; 10 min at 72 °C. .. The PCR products obtained were size-separated by agarose gel electrophoresis, to be then displayed in Article Title: Variants in Human Prostacyclin Receptor Gene in Patients with Migraine Headache Article Snippet: The amplification mixture was prepared in 50μL volume including 1X buffer, 1.5 mmol/l magnesium chloride, 200 μmol/l dNTP, 400 nmol/L of each primer, 200 ng/μl DNA, and 2 U Taq DNA polymerase. .. The PCR products were sequenced using a cycle sequencing kit on an automated Article Title: Resistance-Associated NS5A Variants of Hepatitis C Virus Are Susceptible to Interferon-Based Therapy Article Snippet: Briefly, viral RNA was extracted from serum, reverse-transcribed and amplified by the two-step nested PCR method. .. The PCR products were purified and sequenced using an automated Article Title: Connexin 26 (GJB2) mutation in an Argentinean patient with keratitis-ichthyosis-deafness (KID) syndrome: a case report Article Snippet: Bi-directional DNA sequencing was performed on an automatic Article Title: Biodiversity of Trichoderma (Hypocreaceae) in Southern Europe and Macaronesia Article Snippet: A 0.9 kb fragment of the larger subunit of ATP citrate lyase (acl1 ) was amplified using the primers acl1-230up and acl1-1220low ( ). .. DNA sequences were obtained after purification of the amplicons with an enzymatic PCR clean-up as described by using the BigDye Terminator v. 3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, California) and an automated Article Title: Molecular cytogenetic characterization of canine histiocytic sarcoma: A spontaneous model for human histiocytic cancer identifies deletion of tumor suppressor genes and highlights influence of genetic background on tumor behavior Article Snippet: Amplicons were visualized and evaluated by capillary-electrophoresis (3730xl DNA Analyzer, Applied BioSystems). .. Amplicons were visualized and evaluated by Article Title: Real-life prevalence of resistance-associated variants against non-structural protein 5A inhibitors and efficiency of Daclatasvir + Asunaprevir therapy in Korean patients with genotype 1b hepatitis C Article Snippet: The extracted RNA was reverse transcribed and amplified by the PCR method using the SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (Invitrogen) with the pairs of primers as follows: sense (5872–5891) 5′-AAGAGGCTCCACCAGTGGAT-3′ and antisense (6730–6749) 5′-CGCCGGAGCGTACCTGTGCA-3′. .. The PCR products were purified using a QIAquick PCR Purification Kit (QIAGEN) and sequenced using an automated Article Title: Hypolobocera guayaquilensis (Decapoda: Pseudothelphusidae): A New Crab Intermediate Host of Paragonimus mexicanus in Manabí Province, Ecuador Article Snippet: Then, the amplicons with or without enzymatic treatment were separated by electrophoresis on 2% (w/v) agarose gels. .. All amplified products were sequenced using the corresponding primers and the BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific) on an automated Article Title: Overexpression of Human-Derived DNMT3A Induced Intergenerational Inheritance of Active DNA Methylation Changes in Rat Sperm Article Snippet: The PCR program was as follows: 94°C 5 min; 94°C 30 s, 65°C 30 s, and 72°C for 1 min, decrease in the annealing temperature by 0.7°C per cycle during 12 cycles, and then 24 cycles of 94°C for 30 s, 56°C for 30 s, and 72°C for 1 min with a final extension of 10 min at 72°C. .. The selective amplification product was detected by Article Title: Complex Pattern of Resistance-Associated Substitutions of Hepatitis C Virus after Daclatasvir/Asunaprevir Treatment Failure Article Snippet: The extracted RNA was reverse-transcribed and amplified by the two-step nested PCR method using the SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (Invitrogen), with specific pairs of primers. .. The PCR products were purified using QIAquick PCR Purification Kit (QIAGEN) and sequenced using an automated Article Title: Molecular Modeling and Phylogeny of the Krüppel-like Factor 4 (cKLF4) Protein from the Arabian Camel, Camelus dromedarius Article Snippet: PCR products were analyzed by electrophoresis using a 1.2% agarose gel ( ). .. The full-length coding sequence of cKLF4 was obtained using the Construct:Article Title: Genomic and proteomic analyses of Mycobacterium bovis BCG Mexico 1931 reveal a diverse immunogenic repertoire against tuberculosis infection Article Snippet: The genome of M. bovis BCG Mexico 1931 was sequenced using 454 pyrosequencing, which was performed by the Sequencing Unit of CINVESTAV, Irapuato, Mexico. .. Additionally, a fosmid library with inserts of approximately 40 kb was constructed using the CopyControl™ pCCFOS™ system (Epicentre Technologies, USA), and the fos-end sequences of 250 clones were determined using the Electrophoresis:Article Title: Hypolobocera guayaquilensis (Decapoda: Pseudothelphusidae): A New Crab Intermediate Host of Paragonimus mexicanus in Manabí Province, Ecuador Article Snippet: Then, the amplicons with or without enzymatic treatment were separated by electrophoresis on 2% (w/v) agarose gels. .. All amplified products were sequenced using the corresponding primers and the BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific) on an automated Article Title: Overexpression of Human-Derived DNMT3A Induced Intergenerational Inheritance of Active DNA Methylation Changes in Rat Sperm Article Snippet: The PCR program was as follows: 94°C 5 min; 94°C 30 s, 65°C 30 s, and 72°C for 1 min, decrease in the annealing temperature by 0.7°C per cycle during 12 cycles, and then 24 cycles of 94°C for 30 s, 56°C for 30 s, and 72°C for 1 min with a final extension of 10 min at 72°C. .. The selective amplification product was detected by Article Title: Analysis of Coinfections with A/H1N1 Strain Variants among Pigs in Poland by Multitemperature Single-Strand Conformational Polymorphism Article Snippet: The MSSCP conditions were optimized and the electrophoresis was performed on a polyacrylamide gel (10% T, 3.3% C), in 0.75x TBE buffer, at 40 W. The temperature profile of the electrophoresis was 15–10–5°C. .. The ssDNA was eluted, reamplified (using the primers and PCR conditions described above), purified with exonuclease I and shrimp alkaline phosphatase (Fermentas, catalogue numbers EN0581 and EF0511), and analyzed by Article Title: Phase I study of TP300 in patients with advanced solid tumors with pharmacokinetic, pharmacogenetic and pharmacodynamic analyses Article Snippet: The fragments obtained were purified using X-Terninator purification kit (Applied Biosystems) and analysed on an automated DNA sequencer (3730xl DNA Analyzer, Applied Biosystems). .. The fragments obtained were purified using X-Terninator purification kit (Applied Biosystems) and analysed on an automated Article Title: Effects of Age and Hindlimb Immobilization and Remobilization on Fast Troponin T Precursor mRNA Alternative Splicing in Rat Gastrocnemius Muscle Article Snippet: Briefly, the frozen gastrocnemius muscle was pulverized under liquid nitrogen and total RNA was isolated using Trizol reagent as per the manufacturer’s protocol (Invitrogen). cDNA was prepared using a High Capacity cDNA Reverse Transcription kit (Applied Biosystems), and PCR was carried out using GoTaq DNA polymerase (Promega) with a fluorescein-labeled forward primer and two reverse primers as previously described ( ). .. The fluorescein-labeled PCR amplicons were analyzed by Luciferase:Article Title: WT1 Protein Directly Regulates Expression of Vascular Endothelial Growth Factor and Is a Mediator of Tumor Response to Hypoxia Article Snippet: Mutations in putative WT1 binding sites in the VEGF promoter were prepared using the QuikChange site-directed mutagenesis kit (Agilent Technologies, Santa Clara, CA) on the luciferase reporter plasmid pPVEGF-luc. .. Mutations were confirmed by Modification:Article Title: Overexpression of Human-Derived DNMT3A Induced Intergenerational Inheritance of Active DNA Methylation Changes in Rat Sperm Article Snippet: All EcoR I-selective primers were modified with 5′-FAM. .. The selective amplification product was detected by RAST Test:Article Title: Genomic and proteomic analyses of Mycobacterium bovis BCG Mexico 1931 reveal a diverse immunogenic repertoire against tuberculosis infection Article Snippet: Additionally, a fosmid library with inserts of approximately 40 kb was constructed using the CopyControl™ pCCFOS™ system (Epicentre Technologies, USA), and the fos-end sequences of 250 clones were determined using the Ligation:Article Title: Overexpression of Human-Derived DNMT3A Induced Intergenerational Inheritance of Active DNA Methylation Changes in Rat Sperm Article Snippet: The pre-amplification reaction contained 5 μl 10× PCR buffer, 4 μl dNTPs (2.5 mM), 5 U rTaq (TaKaRa, Japan), 5 μl diluted ligation product, 2 μl E1 primer (10 μM, Supplemental Table ), 2 μl HM1 primer (10 μM, Supplemental Table ), and ddH2 O to a final volume of 50 μl. .. The selective amplification product was detected by Generated:Article Title: TILLING in the two-rowed barley cultivar 'Barke' reveals preferred sites of functional diversity in the gene HvHox1 Article Snippet: For confirmation of presumed mutated loci, amplicons of the respective target gene were generated from putative mutants by utilising the same PCR conditions as established for CEL I analysis. .. Sequencing reactions were resolved on a DNA Sequencing:Article Title: Variants in Human Prostacyclin Receptor Gene in Patients with Migraine Headache Article Snippet: The PCR products were stained and visualized on a UV transilluminator, following 1.5% gel electrophoresis. .. The PCR products were sequenced using a cycle sequencing kit on an automated Article Title: A Report of a Novel Mutation in Human Prostacyclin Receptor Gene in Patients Affected with Migraine Article Snippet: Prior to sequencing, the PCR products were stained with ethidium bromide and visualized on a UV transilluminator following 1.5% gel electrophoresis. .. The PCR products were then sequenced using a cycle sequencing kit on an automated Article Title: Connexin 26 (GJB2) mutation in an Argentinean patient with keratitis-ichthyosis-deafness (KID) syndrome: a case report Article Snippet: PCR products were then purified from the remaining nucleotides and primers using QIAquick PCR purification Kit (Qiagen, GmbH, Hilden, Germany) according to the manufacturer’s protocol. .. Bi-directional DNA sequencing was performed on an automatic Article Title: Molecular Modeling and Phylogeny of the Krüppel-like Factor 4 (cKLF4) Protein from the Arabian Camel, Camelus dromedarius Article Snippet: Paragraph title: DNA sequencing and prediction of amino acid sequence ... The full-length coding sequence of cKLF4 was obtained using the 3730XL series platform Sequencer (Applied Biosystems). cDNA fragments of 877 and 1,560 bp were amplified by PCR using the primer couple cKLF4F1/cKLF4R1 and cKLF4F2/cKLF4R2 ( , ), which were then sequenced using Article Title: TILLING in the two-rowed barley cultivar 'Barke' reveals preferred sites of functional diversity in the gene HvHox1 Article Snippet: Paragraph title: DNA sequencing and sequence data processing ... Sequencing reactions were resolved on a Reverse Transcription Polymerase Chain Reaction:Article Title: Real-life prevalence of resistance-associated variants against non-structural protein 5A inhibitors and efficiency of Daclatasvir + Asunaprevir therapy in Korean patients with genotype 1b hepatitis C Article Snippet: The extracted RNA was reverse transcribed and amplified by the PCR method using the SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (Invitrogen) with the pairs of primers as follows: sense (5872–5891) 5′-AAGAGGCTCCACCAGTGGAT-3′ and antisense (6730–6749) 5′-CGCCGGAGCGTACCTGTGCA-3′. .. The PCR products were purified using a QIAquick PCR Purification Kit (QIAGEN) and sequenced using an automated Article Title: Complex Pattern of Resistance-Associated Substitutions of Hepatitis C Virus after Daclatasvir/Asunaprevir Treatment Failure Article Snippet: The extracted RNA was reverse-transcribed and amplified by the two-step nested PCR method using the SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (Invitrogen), with specific pairs of primers. .. The PCR products were purified using QIAquick PCR Purification Kit (QIAGEN) and sequenced using an automated Binding Assay:Article Title: WT1 Protein Directly Regulates Expression of Vascular Endothelial Growth Factor and Is a Mediator of Tumor Response to Hypoxia Article Snippet: Mutations in putative WT1 binding sites in the VEGF promoter were prepared using the QuikChange site-directed mutagenesis kit (Agilent Technologies, Santa Clara, CA) on the luciferase reporter plasmid pPVEGF-luc. .. Mutations were confirmed by Multiplexing:Article Title: Molecular cytogenetic characterization of canine histiocytic sarcoma: A spontaneous model for human histiocytic cancer identifies deletion of tumor suppressor genes and highlights influence of genetic background on tumor behavior Article Snippet: The M13 primer was tagged at the 5' end either with PET, VIC, FAM or NED (Applied Biosystems) to facilitate multiplexing of products. .. Amplicons were visualized and evaluated by Nucleic Acid Electrophoresis:Article Title: Variants in Human Prostacyclin Receptor Gene in Patients with Migraine Headache Article Snippet: The PCR products were stained and visualized on a UV transilluminator, following 1.5% gel electrophoresis. .. The PCR products were sequenced using a cycle sequencing kit on an automated Article Title: A Report of a Novel Mutation in Human Prostacyclin Receptor Gene in Patients Affected with Migraine Article Snippet: Prior to sequencing, the PCR products were stained with ethidium bromide and visualized on a UV transilluminator following 1.5% gel electrophoresis. .. The PCR products were then sequenced using a cycle sequencing kit on an automated Methylation:Article Title: Overexpression of Human-Derived DNMT3A Induced Intergenerational Inheritance of Active DNA Methylation Changes in Rat Sperm Article Snippet: Paragraph title: Methylation-sensitive amplification polymorphism (MSAP) assay ... The selective amplification product was detected by Mutagenesis:Article Title: Connexin 26 (GJB2) mutation in an Argentinean patient with keratitis-ichthyosis-deafness (KID) syndrome: a case report Article Snippet: Paragraph title: Mutation analysis of GJB2 ... Bi-directional DNA sequencing was performed on an automatic Article Title: WT1 Protein Directly Regulates Expression of Vascular Endothelial Growth Factor and Is a Mediator of Tumor Response to Hypoxia Article Snippet: Mutations in putative WT1 binding sites in the VEGF promoter were prepared using the QuikChange site-directed mutagenesis kit (Agilent Technologies, Santa Clara, CA) on the luciferase reporter plasmid pPVEGF-luc. .. Mutations were confirmed by Article Title: TILLING in the two-rowed barley cultivar 'Barke' reveals preferred sites of functional diversity in the gene HvHox1 Article Snippet: Sequencing reactions were resolved on a Isolation:Article Title: Real-life prevalence of resistance-associated variants against non-structural protein 5A inhibitors and efficiency of Daclatasvir + Asunaprevir therapy in Korean patients with genotype 1b hepatitis C Article Snippet: Viral RNA was isolated from 200 μL plasma samples utilizing the QIA Amp MiniElute Virus Vacuum Kit (Catalog No. 57714 Qiagen, Inc. Valencia, CA) and the QiaCube workstation. .. The PCR products were purified using a QIAquick PCR Purification Kit (QIAGEN) and sequenced using an automated Article Title: Hypolobocera guayaquilensis (Decapoda: Pseudothelphusidae): A New Crab Intermediate Host of Paragonimus mexicanus in Manabí Province, Ecuador Article Snippet: All amplified products were sequenced using the corresponding primers and the BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific) on an automated Article Title: Effects of Age and Hindlimb Immobilization and Remobilization on Fast Troponin T Precursor mRNA Alternative Splicing in Rat Gastrocnemius Muscle Article Snippet: Briefly, the frozen gastrocnemius muscle was pulverized under liquid nitrogen and total RNA was isolated using Trizol reagent as per the manufacturer’s protocol (Invitrogen). cDNA was prepared using a High Capacity cDNA Reverse Transcription kit (Applied Biosystems), and PCR was carried out using GoTaq DNA polymerase (Promega) with a fluorescein-labeled forward primer and two reverse primers as previously described ( ). .. The fluorescein-labeled PCR amplicons were analyzed by Sequencing:Article Title: Genomic and structural investigation on dolphin morbillivirus (DMV) in Mediterranean fin whales (Balaenoptera physalus) Article Snippet: The other set of primers ( ) were designed using Prime3 based on the available DMV gene sequence Genbank Acc. .. The PCR products obtained were size-separated by agarose gel electrophoresis, to be then displayed in Article Title: Variants in Human Prostacyclin Receptor Gene in Patients with Migraine Headache Article Snippet: The PCR products were stained and visualized on a UV transilluminator, following 1.5% gel electrophoresis. .. The PCR products were sequenced using a cycle sequencing kit on an automated Article Title: A Report of a Novel Mutation in Human Prostacyclin Receptor Gene in Patients Affected with Migraine Article Snippet: Prior to sequencing, the PCR products were stained with ethidium bromide and visualized on a UV transilluminator following 1.5% gel electrophoresis. .. The PCR products were then sequenced using a cycle sequencing kit on an automated Article Title: Resistance-Associated NS5A Variants of Hepatitis C Virus Are Susceptible to Interferon-Based Therapy Article Snippet: Paragraph title: Analysis by direct sequencing ... The PCR products were purified and sequenced using an automated Article Title: Biodiversity of Trichoderma (Hypocreaceae) in Southern Europe and Macaronesia Article Snippet: A 0.9 kb fragment of the larger subunit of ATP citrate lyase (acl1 ) was amplified using the primers acl1-230up and acl1-1220low ( ). .. DNA sequences were obtained after purification of the amplicons with an enzymatic PCR clean-up as described by using the BigDye Terminator v. 3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, California) and an automated Article Title: Genomic and proteomic analyses of Mycobacterium bovis BCG Mexico 1931 reveal a diverse immunogenic repertoire against tuberculosis infection Article Snippet: Paragraph title: BCG Mexico 1931 genome sequencing ... Additionally, a fosmid library with inserts of approximately 40 kb was constructed using the CopyControl™ pCCFOS™ system (Epicentre Technologies, USA), and the fos-end sequences of 250 clones were determined using the Article Title: Real-life prevalence of resistance-associated variants against non-structural protein 5A inhibitors and efficiency of Daclatasvir + Asunaprevir therapy in Korean patients with genotype 1b hepatitis C Article Snippet: Direct sequencing of HCV NS5A Y93 and L31 gene regions from plasma samples was performed. .. The PCR products were purified using a QIAquick PCR Purification Kit (QIAGEN) and sequenced using an automated Article Title: Hypolobocera guayaquilensis (Decapoda: Pseudothelphusidae): A New Crab Intermediate Host of Paragonimus mexicanus in Manabí Province, Ecuador Article Snippet: Then, the amplicons with or without enzymatic treatment were separated by electrophoresis on 2% (w/v) agarose gels. .. All amplified products were sequenced using the corresponding primers and the BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific) on an automated Article Title: WT1 Protein Directly Regulates Expression of Vascular Endothelial Growth Factor and Is a Mediator of Tumor Response to Hypoxia Article Snippet: Mutations in putative WT1 binding sites in the VEGF promoter were prepared using the QuikChange site-directed mutagenesis kit (Agilent Technologies, Santa Clara, CA) on the luciferase reporter plasmid pPVEGF-luc. .. Mutations were confirmed by Article Title: Complex Pattern of Resistance-Associated Substitutions of Hepatitis C Virus after Daclatasvir/Asunaprevir Treatment Failure Article Snippet: Paragraph title: Analysis by direct sequencing ... The PCR products were purified using QIAquick PCR Purification Kit (QIAGEN) and sequenced using an automated Article Title: Analysis of Coinfections with A/H1N1 Strain Variants among Pigs in Poland by Multitemperature Single-Strand Conformational Polymorphism Article Snippet: The ssDNA bands of altered MSSCP mobility, compared to the reference sample, were cut out. .. The ssDNA was eluted, reamplified (using the primers and PCR conditions described above), purified with exonuclease I and shrimp alkaline phosphatase (Fermentas, catalogue numbers EN0581 and EF0511), and analyzed by Article Title: Molecular Modeling and Phylogeny of the Krüppel-like Factor 4 (cKLF4) Protein from the Arabian Camel, Camelus dromedarius Article Snippet: PCR products were analyzed by electrophoresis using a 1.2% agarose gel ( ). .. The full-length coding sequence of cKLF4 was obtained using the Article Title: Phase I study of TP300 in patients with advanced solid tumors with pharmacokinetic, pharmacogenetic and pharmacodynamic analyses Article Snippet: The amplicons were subsequently treated with ExoSAP-IT (GE Healthcare) followed by the reactions with a cycle sequencing kit (BigDye Terminator v3.1, Applied Biosystems). .. The fragments obtained were purified using X-Terninator purification kit (Applied Biosystems) and analysed on an automated Article Title: Effects of Age and Hindlimb Immobilization and Remobilization on Fast Troponin T Precursor mRNA Alternative Splicing in Rat Gastrocnemius Muscle Article Snippet: The methods used for RNA isolation, reverse transcription, and PCR analysis as well as the sequence of the primers used to quantify TNNT3 splice forms has been previously published ( ). .. The fluorescein-labeled PCR amplicons were analyzed by Article Title: TILLING in the two-rowed barley cultivar 'Barke' reveals preferred sites of functional diversity in the gene HvHox1 Article Snippet: Amplicons were purified by ultrafiltration using a QIAvac 96 vacuum (Qiagen, Hilden, Germany), processed with a NucleoFast-96 PCR Plate (MACHEREY-NAGEL GmbH & Co. KG, Düren, Germany) and directly cycle-sequenced using the ABI Big Dye terminator v3.1 sequencing standard kit according to the manufacturer's protocol (Applied Biosystems, Foster City, USA). .. Sequencing reactions were resolved on a Size-exclusion Chromatography:Article Title: Genomic and structural investigation on dolphin morbillivirus (DMV) in Mediterranean fin whales (Balaenoptera physalus) Article Snippet: Amplification was performed using a high-fidelity polymerase (Phusion Hot Start II DNA Polymerase, Thermo Scientific), with the following PCR conditions: 30 sec at 98 °C; 35 cycles of 10 sec at 98 °C, 30 sec at 58 °C, 1 min at 72 °C; 10 min at 72 °C. .. The PCR products obtained were size-separated by agarose gel electrophoresis, to be then displayed in Article Title: Hypolobocera guayaquilensis (Decapoda: Pseudothelphusidae): A New Crab Intermediate Host of Paragonimus mexicanus in Manabí Province, Ecuador Article Snippet: The PCR was carried out on a thermal cycler (TaKaRa PCR Thermal Cycler Dice Gradient, Takara Bio, Shiga, Japan), with 30 cycles of 98°C for 10 sec, 55°C for 10 sec, and 72°C for 15 sec. An initial denaturation and final extension were performed at 98°C for 30 sec and at 72°C for 7 min, respectively. .. All amplified products were sequenced using the corresponding primers and the BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific) on an automated Labeling:Article Title: Molecular cytogenetic characterization of canine histiocytic sarcoma: A spontaneous model for human histiocytic cancer identifies deletion of tumor suppressor genes and highlights influence of genetic background on tumor behavior Article Snippet: PCR was conducted in 10 μl reactions containing 0.8 units Taq polymerase (Go Taq, Promega), 1.0 μl 10× reaction buffer (Promega), 0.25 mM each dNTP, 0.15 μM each microsatellite-specific primer, 0.1 μM 5' fluorescently labeled M13 primer and 50 ng template DNA. .. Amplicons were visualized and evaluated by Purification:Article Title: Resistance-Associated NS5A Variants of Hepatitis C Virus Are Susceptible to Interferon-Based Therapy Article Snippet: Briefly, viral RNA was extracted from serum, reverse-transcribed and amplified by the two-step nested PCR method. .. The PCR products were purified and sequenced using an automated Article Title: Connexin 26 (GJB2) mutation in an Argentinean patient with keratitis-ichthyosis-deafness (KID) syndrome: a case report Article Snippet: PCR products were then purified from the remaining nucleotides and primers using QIAquick PCR purification Kit (Qiagen, GmbH, Hilden, Germany) according to the manufacturer’s protocol. .. Bi-directional DNA sequencing was performed on an automatic Article Title: Biodiversity of Trichoderma (Hypocreaceae) in Southern Europe and Macaronesia Article Snippet: A 0.9 kb fragment of the larger subunit of ATP citrate lyase (acl1 ) was amplified using the primers acl1-230up and acl1-1220low ( ). .. DNA sequences were obtained after purification of the amplicons with an enzymatic PCR clean-up as described by using the BigDye Terminator v. 3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, California) and an automated Article Title: Real-life prevalence of resistance-associated variants against non-structural protein 5A inhibitors and efficiency of Daclatasvir + Asunaprevir therapy in Korean patients with genotype 1b hepatitis C Article Snippet: The extracted RNA was reverse transcribed and amplified by the PCR method using the SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (Invitrogen) with the pairs of primers as follows: sense (5872–5891) 5′-AAGAGGCTCCACCAGTGGAT-3′ and antisense (6730–6749) 5′-CGCCGGAGCGTACCTGTGCA-3′. .. The PCR products were purified using a QIAquick PCR Purification Kit (QIAGEN) and sequenced using an automated Article Title: Complex Pattern of Resistance-Associated Substitutions of Hepatitis C Virus after Daclatasvir/Asunaprevir Treatment Failure Article Snippet: The extracted RNA was reverse-transcribed and amplified by the two-step nested PCR method using the SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (Invitrogen), with specific pairs of primers. .. The PCR products were purified using QIAquick PCR Purification Kit (QIAGEN) and sequenced using an automated Article Title: Analysis of Coinfections with A/H1N1 Strain Variants among Pigs in Poland by Multitemperature Single-Strand Conformational Polymorphism Article Snippet: The ssDNA bands of altered MSSCP mobility, compared to the reference sample, were cut out. .. The ssDNA was eluted, reamplified (using the primers and PCR conditions described above), purified with exonuclease I and shrimp alkaline phosphatase (Fermentas, catalogue numbers EN0581 and EF0511), and analyzed by Article Title: Phase I study of TP300 in patients with advanced solid tumors with pharmacokinetic, pharmacogenetic and pharmacodynamic analyses Article Snippet: The amplicons were subsequently treated with ExoSAP-IT (GE Healthcare) followed by the reactions with a cycle sequencing kit (BigDye Terminator v3.1, Applied Biosystems). .. The fragments obtained were purified using X-Terninator purification kit (Applied Biosystems) and analysed on an automated Article Title: TILLING in the two-rowed barley cultivar 'Barke' reveals preferred sites of functional diversity in the gene HvHox1 Article Snippet: Amplicons were purified by ultrafiltration using a QIAvac 96 vacuum (Qiagen, Hilden, Germany), processed with a NucleoFast-96 PCR Plate (MACHEREY-NAGEL GmbH & Co. KG, Düren, Germany) and directly cycle-sequenced using the ABI Big Dye terminator v3.1 sequencing standard kit according to the manufacturer's protocol (Applied Biosystems, Foster City, USA). .. Sequencing reactions were resolved on a Polymerase Chain Reaction:Article Title: Microsatellite polymorphism in the Heme oxygenase-1 gene promoter is associated with dermal collagen density in Japanese obese male subjects Article Snippet: The PCR products were extracted using a NucleoSpin Gel and PCR clean-up kit (Takara Bio, Shiga, Japan). .. The number of GT repeats was determined from the sequences of PCR products analyzed by dye terminator methods using a Article Title: Genomic and structural investigation on dolphin morbillivirus (DMV) in Mediterranean fin whales (Balaenoptera physalus) Article Snippet: Amplification was performed using a high-fidelity polymerase (Phusion Hot Start II DNA Polymerase, Thermo Scientific), with the following PCR conditions: 30 sec at 98 °C; 35 cycles of 10 sec at 98 °C, 30 sec at 58 °C, 1 min at 72 °C; 10 min at 72 °C. .. The PCR products obtained were size-separated by agarose gel electrophoresis, to be then displayed in Article Title: Variants in Human Prostacyclin Receptor Gene in Patients with Migraine Headache Article Snippet: The PCR products were stained and visualized on a UV transilluminator, following 1.5% gel electrophoresis. .. The PCR products were sequenced using a cycle sequencing kit on an automated Article Title: A Report of a Novel Mutation in Human Prostacyclin Receptor Gene in Patients Affected with Migraine Article Snippet: Prior to sequencing, the PCR products were stained with ethidium bromide and visualized on a UV transilluminator following 1.5% gel electrophoresis. .. The PCR products were then sequenced using a cycle sequencing kit on an automated Article Title: Resistance-Associated NS5A Variants of Hepatitis C Virus Are Susceptible to Interferon-Based Therapy Article Snippet: Briefly, viral RNA was extracted from serum, reverse-transcribed and amplified by the two-step nested PCR method. .. The PCR products were purified and sequenced using an automated Article Title: Connexin 26 (GJB2) mutation in an Argentinean patient with keratitis-ichthyosis-deafness (KID) syndrome: a case report Article Snippet: PCR products were then purified from the remaining nucleotides and primers using QIAquick PCR purification Kit (Qiagen, GmbH, Hilden, Germany) according to the manufacturer’s protocol. .. Bi-directional DNA sequencing was performed on an automatic Article Title: Biodiversity of Trichoderma (Hypocreaceae) in Southern Europe and Macaronesia Article Snippet: A 0.9 kb fragment of the larger subunit of ATP citrate lyase (acl1 ) was amplified using the primers acl1-230up and acl1-1220low ( ). .. DNA sequences were obtained after purification of the amplicons with an enzymatic PCR clean-up as described by using the BigDye Terminator v. 3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, California) and an automated Article Title: Molecular cytogenetic characterization of canine histiocytic sarcoma: A spontaneous model for human histiocytic cancer identifies deletion of tumor suppressor genes and highlights influence of genetic background on tumor behavior Article Snippet: PCR was conducted in 10 μl reactions containing 0.8 units Taq polymerase (Go Taq, Promega), 1.0 μl 10× reaction buffer (Promega), 0.25 mM each dNTP, 0.15 μM each microsatellite-specific primer, 0.1 μM 5' fluorescently labeled M13 primer and 50 ng template DNA. .. Amplicons were visualized and evaluated by Article Title: Genomic and proteomic analyses of Mycobacterium bovis BCG Mexico 1931 reveal a diverse immunogenic repertoire against tuberculosis infection Article Snippet: Additionally, a fosmid library with inserts of approximately 40 kb was constructed using the CopyControl™ pCCFOS™ system (Epicentre Technologies, USA), and the fos-end sequences of 250 clones were determined using the Article Title: Real-life prevalence of resistance-associated variants against non-structural protein 5A inhibitors and efficiency of Daclatasvir + Asunaprevir therapy in Korean patients with genotype 1b hepatitis C Article Snippet: The extracted RNA was reverse transcribed and amplified by the PCR method using the SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (Invitrogen) with the pairs of primers as follows: sense (5872–5891) 5′-AAGAGGCTCCACCAGTGGAT-3′ and antisense (6730–6749) 5′-CGCCGGAGCGTACCTGTGCA-3′. .. The PCR products were purified using a QIAquick PCR Purification Kit (QIAGEN) and sequenced using an automated Article Title: Hypolobocera guayaquilensis (Decapoda: Pseudothelphusidae): A New Crab Intermediate Host of Paragonimus mexicanus in Manabí Province, Ecuador Article Snippet: For the PCR-RFLP, 10-μl portions of the amplified products were treated with 5 U of the restriction enzyme Hinc II (New England Biolabs, Ipswich, Massachusetts, USA) at 37°C for 1 hr. .. All amplified products were sequenced using the corresponding primers and the BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific) on an automated Article Title: Overexpression of Human-Derived DNMT3A Induced Intergenerational Inheritance of Active DNA Methylation Changes in Rat Sperm Article Snippet: The PCR program was as follows: 94°C 5 min; 94°C 30 s, 65°C 30 s, and 72°C for 1 min, decrease in the annealing temperature by 0.7°C per cycle during 12 cycles, and then 24 cycles of 94°C for 30 s, 56°C for 30 s, and 72°C for 1 min with a final extension of 10 min at 72°C. .. The selective amplification product was detected by Article Title: Complex Pattern of Resistance-Associated Substitutions of Hepatitis C Virus after Daclatasvir/Asunaprevir Treatment Failure Article Snippet: The extracted RNA was reverse-transcribed and amplified by the two-step nested PCR method using the SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (Invitrogen), with specific pairs of primers. .. The PCR products were purified using QIAquick PCR Purification Kit (QIAGEN) and sequenced using an automated Article Title: Analysis of Coinfections with A/H1N1 Strain Variants among Pigs in Poland by Multitemperature Single-Strand Conformational Polymorphism Article Snippet: The ssDNA bands of altered MSSCP mobility, compared to the reference sample, were cut out. .. The ssDNA was eluted, reamplified (using the primers and PCR conditions described above), purified with exonuclease I and shrimp alkaline phosphatase (Fermentas, catalogue numbers EN0581 and EF0511), and analyzed by Article Title: Molecular Modeling and Phylogeny of the Krüppel-like Factor 4 (cKLF4) Protein from the Arabian Camel, Camelus dromedarius Article Snippet: PCR products were analyzed by electrophoresis using a 1.2% agarose gel ( ). .. The full-length coding sequence of cKLF4 was obtained using the Article Title: Phase I study of TP300 in patients with advanced solid tumors with pharmacokinetic, pharmacogenetic and pharmacodynamic analyses Article Snippet: The fragments obtained were purified using X-Terninator purification kit (Applied Biosystems) and analysed on an automated DNA sequencer (3730xl DNA Analyzer, Applied Biosystems). .. The fragments obtained were purified using X-Terninator purification kit (Applied Biosystems) and analysed on an automated Article Title: Effects of Age and Hindlimb Immobilization and Remobilization on Fast Troponin T Precursor mRNA Alternative Splicing in Rat Gastrocnemius Muscle Article Snippet: Briefly, the frozen gastrocnemius muscle was pulverized under liquid nitrogen and total RNA was isolated using Trizol reagent as per the manufacturer’s protocol (Invitrogen). cDNA was prepared using a High Capacity cDNA Reverse Transcription kit (Applied Biosystems), and PCR was carried out using GoTaq DNA polymerase (Promega) with a fluorescein-labeled forward primer and two reverse primers as previously described ( ). .. The fluorescein-labeled PCR amplicons were analyzed by Article Title: TILLING in the two-rowed barley cultivar 'Barke' reveals preferred sites of functional diversity in the gene HvHox1 Article Snippet: Amplicons were purified by ultrafiltration using a QIAvac 96 vacuum (Qiagen, Hilden, Germany), processed with a NucleoFast-96 PCR Plate (MACHEREY-NAGEL GmbH & Co. KG, Düren, Germany) and directly cycle-sequenced using the ABI Big Dye terminator v3.1 sequencing standard kit according to the manufacturer's protocol (Applied Biosystems, Foster City, USA). .. Sequencing reactions were resolved on a Polyacrylamide Gel Electrophoresis:Article Title: Overexpression of Human-Derived DNMT3A Induced Intergenerational Inheritance of Active DNA Methylation Changes in Rat Sperm Article Snippet: The selective amplification product was detected by Nested PCR:Article Title: Resistance-Associated NS5A Variants of Hepatitis C Virus Are Susceptible to Interferon-Based Therapy Article Snippet: Briefly, viral RNA was extracted from serum, reverse-transcribed and amplified by the two-step nested PCR method. .. The PCR products were purified and sequenced using an automated Article Title: Complex Pattern of Resistance-Associated Substitutions of Hepatitis C Virus after Daclatasvir/Asunaprevir Treatment Failure Article Snippet: The extracted RNA was reverse-transcribed and amplified by the two-step nested PCR method using the SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (Invitrogen), with specific pairs of primers. .. The PCR products were purified using QIAquick PCR Purification Kit (QIAGEN) and sequenced using an automated Silver Staining:Article Title: Overexpression of Human-Derived DNMT3A Induced Intergenerational Inheritance of Active DNA Methylation Changes in Rat Sperm Article Snippet: The selective amplification product was detected by Article Title: Analysis of Coinfections with A/H1N1 Strain Variants among Pigs in Poland by Multitemperature Single-Strand Conformational Polymorphism Article Snippet: The separated ssDNA bands were visualized by silver nitrate staining (Silver Stain DNA Kit, BioVectis, catalogue number 200-101). .. The ssDNA was eluted, reamplified (using the primers and PCR conditions described above), purified with exonuclease I and shrimp alkaline phosphatase (Fermentas, catalogue numbers EN0581 and EF0511), and analyzed by Plasmid Preparation:Article Title: WT1 Protein Directly Regulates Expression of Vascular Endothelial Growth Factor and Is a Mediator of Tumor Response to Hypoxia Article Snippet: Mutations in putative WT1 binding sites in the VEGF promoter were prepared using the QuikChange site-directed mutagenesis kit (Agilent Technologies, Santa Clara, CA) on the luciferase reporter plasmid pPVEGF-luc. .. Mutations were confirmed by Software:Article Title: Genomic and structural investigation on dolphin morbillivirus (DMV) in Mediterranean fin whales (Balaenoptera physalus) Article Snippet: The PCR products obtained were size-separated by agarose gel electrophoresis, to be then displayed in Article Title: Molecular Modeling and Phylogeny of the Krüppel-like Factor 4 (cKLF4) Protein from the Arabian Camel, Camelus dromedarius Article Snippet: PCR products were analyzed by electrophoresis using a 1.2% agarose gel ( ). .. The full-length coding sequence of cKLF4 was obtained using the Article Title: TILLING in the two-rowed barley cultivar 'Barke' reveals preferred sites of functional diversity in the gene HvHox1 Article Snippet: Sequencing reactions were resolved on a Positron Emission Tomography:Article Title: Molecular cytogenetic characterization of canine histiocytic sarcoma: A spontaneous model for human histiocytic cancer identifies deletion of tumor suppressor genes and highlights influence of genetic background on tumor behavior Article Snippet: The M13 primer was tagged at the 5' end either with PET, VIC, FAM or NED (Applied Biosystems) to facilitate multiplexing of products. .. Amplicons were visualized and evaluated by Agarose Gel Electrophoresis:Article Title: Genomic and structural investigation on dolphin morbillivirus (DMV) in Mediterranean fin whales (Balaenoptera physalus) Article Snippet: Amplification was performed using a high-fidelity polymerase (Phusion Hot Start II DNA Polymerase, Thermo Scientific), with the following PCR conditions: 30 sec at 98 °C; 35 cycles of 10 sec at 98 °C, 30 sec at 58 °C, 1 min at 72 °C; 10 min at 72 °C. .. The PCR products obtained were size-separated by agarose gel electrophoresis, to be then displayed in Article Title: Connexin 26 (GJB2) mutation in an Argentinean patient with keratitis-ichthyosis-deafness (KID) syndrome: a case report Article Snippet: PCR products were run on a 2 % agarose gel and stained with SyBr Safe to confirm fragment size (Invitrogen, Life Technologies, Eugene, Oregon, USA). .. Bi-directional DNA sequencing was performed on an automatic Article Title: Phase I study of TP300 in patients with advanced solid tumors with pharmacokinetic, pharmacogenetic and pharmacodynamic analyses Article Snippet: The fragments obtained were purified using X-Terninator purification kit (Applied Biosystems) and analysed on an automated DNA sequencer (3730xl DNA Analyzer, Applied Biosystems). .. The fragments obtained were purified using X-Terninator purification kit (Applied Biosystems) and analysed on an automated DNA Extraction:Article Title: Variants in Human Prostacyclin Receptor Gene in Patients with Migraine Headache Article Snippet: Peripheral blood samples (2 mL) were collected from the patients and genomic DNA was extracted from the samples according to the manufacturer protocol using PrimePrep Genomic DNA isolation kit (Genet Bio, Korea). .. The PCR products were sequenced using a cycle sequencing kit on an automated Article Title: A Report of a Novel Mutation in Human Prostacyclin Receptor Gene in Patients Affected with Migraine Article Snippet: Blood sample was collected from the patients, and genomic DNA was extracted from 200 microliter peripheral blood of the 2 patients using PrimePrep Genomic DNA isolation kit (Genet Bio, Korea) according to the manufacturer protocol. .. The PCR products were then sequenced using a cycle sequencing kit on an automated Article Title: Biodiversity of Trichoderma (Hypocreaceae) in Southern Europe and Macaronesia Article Snippet: Paragraph title: DNA isolation and sequencing ... DNA sequences were obtained after purification of the amplicons with an enzymatic PCR clean-up as described by using the BigDye Terminator v. 3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, California) and an automated Concentration Assay:Article Title: Analysis of Coinfections with A/H1N1 Strain Variants among Pigs in Poland by Multitemperature Single-Strand Conformational Polymorphism Article Snippet: The samples were maintained for 10 min at 100 V for concentration and then separated by MSSCP. .. The ssDNA was eluted, reamplified (using the primers and PCR conditions described above), purified with exonuclease I and shrimp alkaline phosphatase (Fermentas, catalogue numbers EN0581 and EF0511), and analyzed by Staining:Article Title: Variants in Human Prostacyclin Receptor Gene in Patients with Migraine Headache Article Snippet: The PCR products were stained and visualized on a UV transilluminator, following 1.5% gel electrophoresis. .. The PCR products were sequenced using a cycle sequencing kit on an automated Article Title: A Report of a Novel Mutation in Human Prostacyclin Receptor Gene in Patients Affected with Migraine Article Snippet: Prior to sequencing, the PCR products were stained with ethidium bromide and visualized on a UV transilluminator following 1.5% gel electrophoresis. .. The PCR products were then sequenced using a cycle sequencing kit on an automated Article Title: Connexin 26 (GJB2) mutation in an Argentinean patient with keratitis-ichthyosis-deafness (KID) syndrome: a case report Article Snippet: PCR products were run on a 2 % agarose gel and stained with SyBr Safe to confirm fragment size (Invitrogen, Life Technologies, Eugene, Oregon, USA). .. Bi-directional DNA sequencing was performed on an automatic Article Title: Analysis of Coinfections with A/H1N1 Strain Variants among Pigs in Poland by Multitemperature Single-Strand Conformational Polymorphism Article Snippet: The separated ssDNA bands were visualized by silver nitrate staining (Silver Stain DNA Kit, BioVectis, catalogue number 200-101). .. The ssDNA was eluted, reamplified (using the primers and PCR conditions described above), purified with exonuclease I and shrimp alkaline phosphatase (Fermentas, catalogue numbers EN0581 and EF0511), and analyzed by |