3 oligonucleotide primers  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Custom DNA and RNA Oligos
    Description:
    To place your order click here
    Catalog Number:
    oligo
    Price:
    None
    Buy from Supplier


    Structured Review

    Millipore 3 oligonucleotide primers
    Custom DNA and RNA Oligos
    To place your order click here
    https://www.bioz.com/result/3 oligonucleotide primers/product/Millipore
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    3 oligonucleotide primers - by Bioz Stars, 2020-08
    99/100 stars

    Images

    Related Articles

    Transfection:

    Article Title: Hepatitis B Virus Induces Cell Proliferation via HBx-Induced microRNA-21 in Hepatocellular Carcinoma by Targeting Programmed Cell Death Protein4 (PDCD4) and Phosphatase and Tensin Homologue (PTEN)
    Article Snippet: .. For transfection with pre-miRNA oligos (Sigma Aldrich, USA) or anti-miR-21, siPORT NeoFX transfection agent (Applied Biosystems, USA) was used according to the manufacturer's instructions. pSG5-HBx plasmid was used to transfect HBx gene in hepatic cells, and as a control, an empty vector was used in all the plasmid transfection experiments. .. To test the efficiency of transfection, enhanced Green Fluorescent Protein-N1 (eGFP-N1) plasmid vector was used in initial experiments.

    Article Title: Targeted TPX2 increases chromosome missegregation and suppresses tumor cell growth in human prostate cancer
    Article Snippet: .. Small interfering RNA (siRNA) and knockdown of gene expression The TPX2 siRNA oligos pool (1: 5′-GGACGAACCGGUAGUGAU-3′; 2: 5′-GCAUAAGGCAAAUCCAAUA-3′; 3: 5′-GUACCAUUGUUAAGCCUUU-3′; 4: 5′-GAAAUU CUACCCUCUAAGA-3′) was synthesized by Sigma-Aldrich Co. All transient transfections of the TPX2 siRNA oligos pool at a final concentration of 20 nM were accomplished with LipofectAMINE RNAiMAX (Thermo Fisher Scientific) according to the manufacturer’s protocols. .. Cell proliferation, colony formation, and anchorage-independent (spheroid) growth The initiated cell density for TPX2 siRNA transfection was 1.5×105 cells per 2 mL suspension.

    Sequencing:

    Article Title: In situ imaging and isolation of proteins using dsDNA oligonucleotides
    Article Snippet: .. For construction of functionalized dsDNA oligos recognized by LacI, two 41 bp single-stranded oligonucleotides were constructed encoding the symmetrical Lac operator 19 bp core sequence O-Sym ( ): O-Sym-1 (* gcgtgtgccagaattgtgagcgctcacaatttcttgaatct) and O-Sym-2 (* agattcaagaaattgtgagcgctcacaattctggctcacgc); where * represents a 5′ modification with either biotin, Cy3 or a disulfide group linked via a (CH2 )6 spacer (Sigma). ..

    Cell Cycle Assay:

    Article Title: Oligo-Fucoidan prevents IL-6 and CCL2 production and cooperates with p53 to suppress ATM signaling and tumor progression
    Article Snippet: .. Cell cycle analysis HCT116 cells (1 × 106 ) were treated with Oligo-Fucoidan (400 μg/ml) and/or etoposide (40 μM) for 48 h. The cells were subsequently fixed with 70% ethanol at −20 °C for 1 h and incubated with 0.1% (v/v) Triton X-100 (Sigma-Aldrich), 5 μg/ml DNase-free RNase A (Sigma-Aldrich) and 10 μg/ml propidium iodide (PI) (Thermo Fisher Scientific) in PBS in the dark for 20 min at room temperature. .. PI fluorescence was analyzed by a FACSCalibur flow cytometer on the FL2 emission channel at an excitation wavelength of 488 nm.

    Mutagenesis:

    Article Title: SMAD4 Regulates Cell Motility through Transcription of N-Cadherin in Human Pancreatic Ductal Epithelium
    Article Snippet: .. The four potential SBE sequences of the promoter and mutant oligos were purchased from Sigma (Sigma-Aldrich, Woodlands, TX). .. Chromatin immunoprecipitation (ChIP) ChIP assay was performed with a kit (EMD Millipore, Billerica, MA) as previously described .

    Synthesized:

    Article Title: Targeted TPX2 increases chromosome missegregation and suppresses tumor cell growth in human prostate cancer
    Article Snippet: .. Small interfering RNA (siRNA) and knockdown of gene expression The TPX2 siRNA oligos pool (1: 5′-GGACGAACCGGUAGUGAU-3′; 2: 5′-GCAUAAGGCAAAUCCAAUA-3′; 3: 5′-GUACCAUUGUUAAGCCUUU-3′; 4: 5′-GAAAUU CUACCCUCUAAGA-3′) was synthesized by Sigma-Aldrich Co. All transient transfections of the TPX2 siRNA oligos pool at a final concentration of 20 nM were accomplished with LipofectAMINE RNAiMAX (Thermo Fisher Scientific) according to the manufacturer’s protocols. .. Cell proliferation, colony formation, and anchorage-independent (spheroid) growth The initiated cell density for TPX2 siRNA transfection was 1.5×105 cells per 2 mL suspension.

    Article Title: Genome-wide discovery of G-quadruplex forming sequences and their functional relevance in plants
    Article Snippet: .. Validation of G-quadruplex structure formation The selected DNA oligos were synthesized commercially (Sigma). ..

    Small Interfering RNA:

    Article Title: Targeted TPX2 increases chromosome missegregation and suppresses tumor cell growth in human prostate cancer
    Article Snippet: .. Small interfering RNA (siRNA) and knockdown of gene expression The TPX2 siRNA oligos pool (1: 5′-GGACGAACCGGUAGUGAU-3′; 2: 5′-GCAUAAGGCAAAUCCAAUA-3′; 3: 5′-GUACCAUUGUUAAGCCUUU-3′; 4: 5′-GAAAUU CUACCCUCUAAGA-3′) was synthesized by Sigma-Aldrich Co. All transient transfections of the TPX2 siRNA oligos pool at a final concentration of 20 nM were accomplished with LipofectAMINE RNAiMAX (Thermo Fisher Scientific) according to the manufacturer’s protocols. .. Cell proliferation, colony formation, and anchorage-independent (spheroid) growth The initiated cell density for TPX2 siRNA transfection was 1.5×105 cells per 2 mL suspension.

    Construct:

    Article Title: In situ imaging and isolation of proteins using dsDNA oligonucleotides
    Article Snippet: .. For construction of functionalized dsDNA oligos recognized by LacI, two 41 bp single-stranded oligonucleotides were constructed encoding the symmetrical Lac operator 19 bp core sequence O-Sym ( ): O-Sym-1 (* gcgtgtgccagaattgtgagcgctcacaatttcttgaatct) and O-Sym-2 (* agattcaagaaattgtgagcgctcacaattctggctcacgc); where * represents a 5′ modification with either biotin, Cy3 or a disulfide group linked via a (CH2 )6 spacer (Sigma). ..

    Concentration Assay:

    Article Title: Targeted TPX2 increases chromosome missegregation and suppresses tumor cell growth in human prostate cancer
    Article Snippet: .. Small interfering RNA (siRNA) and knockdown of gene expression The TPX2 siRNA oligos pool (1: 5′-GGACGAACCGGUAGUGAU-3′; 2: 5′-GCAUAAGGCAAAUCCAAUA-3′; 3: 5′-GUACCAUUGUUAAGCCUUU-3′; 4: 5′-GAAAUU CUACCCUCUAAGA-3′) was synthesized by Sigma-Aldrich Co. All transient transfections of the TPX2 siRNA oligos pool at a final concentration of 20 nM were accomplished with LipofectAMINE RNAiMAX (Thermo Fisher Scientific) according to the manufacturer’s protocols. .. Cell proliferation, colony formation, and anchorage-independent (spheroid) growth The initiated cell density for TPX2 siRNA transfection was 1.5×105 cells per 2 mL suspension.

    Incubation:

    Article Title: Oligo-Fucoidan prevents IL-6 and CCL2 production and cooperates with p53 to suppress ATM signaling and tumor progression
    Article Snippet: .. Cell cycle analysis HCT116 cells (1 × 106 ) were treated with Oligo-Fucoidan (400 μg/ml) and/or etoposide (40 μM) for 48 h. The cells were subsequently fixed with 70% ethanol at −20 °C for 1 h and incubated with 0.1% (v/v) Triton X-100 (Sigma-Aldrich), 5 μg/ml DNase-free RNase A (Sigma-Aldrich) and 10 μg/ml propidium iodide (PI) (Thermo Fisher Scientific) in PBS in the dark for 20 min at room temperature. .. PI fluorescence was analyzed by a FACSCalibur flow cytometer on the FL2 emission channel at an excitation wavelength of 488 nm.

    other:

    Article Title: High content image analysis reveals function of miR-124 upstream of Vimentin in regulating motor neuron mitochondria
    Article Snippet: Oligomycin A (Sigma, 1 µM) for 15 min, in 37 °C and analyzed 24 hrs. afterwards.

    Negative Control:

    Article Title: Species difference in ANP32A underlies influenza A virus polymerase host restriction
    Article Snippet: .. Total RNA was extracted as described previously but with 100μl of cell lysate added to AVL buffer before continuing with the RNeasy mini kit (Qiagen). siRNAs for target genes were as follows:, AllStars Negative Control, huANP32A (SI02655212 FlexiTube), huANP32B (SI02655380 FlexiTube) (Qiagen), 50-92 NP (5’-AAGGAUCUUAUUUCUUCGGAG-3’), chANP32A (5’-GAGCTGGAATTCTTGAGTACA-3’) (custom RNA oligos, Sigma-Aldrich). .. Quantification of chANP32A and B mRNA levels Total RNA from RH clones and DF-1 cells were extracted using an RNeasy mini kit (Qiagen), following manufacturer’s instructions.

    Expressing:

    Article Title: Targeted TPX2 increases chromosome missegregation and suppresses tumor cell growth in human prostate cancer
    Article Snippet: .. Small interfering RNA (siRNA) and knockdown of gene expression The TPX2 siRNA oligos pool (1: 5′-GGACGAACCGGUAGUGAU-3′; 2: 5′-GCAUAAGGCAAAUCCAAUA-3′; 3: 5′-GUACCAUUGUUAAGCCUUU-3′; 4: 5′-GAAAUU CUACCCUCUAAGA-3′) was synthesized by Sigma-Aldrich Co. All transient transfections of the TPX2 siRNA oligos pool at a final concentration of 20 nM were accomplished with LipofectAMINE RNAiMAX (Thermo Fisher Scientific) according to the manufacturer’s protocols. .. Cell proliferation, colony formation, and anchorage-independent (spheroid) growth The initiated cell density for TPX2 siRNA transfection was 1.5×105 cells per 2 mL suspension.

    Modification:

    Article Title: In situ imaging and isolation of proteins using dsDNA oligonucleotides
    Article Snippet: .. For construction of functionalized dsDNA oligos recognized by LacI, two 41 bp single-stranded oligonucleotides were constructed encoding the symmetrical Lac operator 19 bp core sequence O-Sym ( ): O-Sym-1 (* gcgtgtgccagaattgtgagcgctcacaatttcttgaatct) and O-Sym-2 (* agattcaagaaattgtgagcgctcacaattctggctcacgc); where * represents a 5′ modification with either biotin, Cy3 or a disulfide group linked via a (CH2 )6 spacer (Sigma). ..

    Plasmid Preparation:

    Article Title: Hepatitis B Virus Induces Cell Proliferation via HBx-Induced microRNA-21 in Hepatocellular Carcinoma by Targeting Programmed Cell Death Protein4 (PDCD4) and Phosphatase and Tensin Homologue (PTEN)
    Article Snippet: .. For transfection with pre-miRNA oligos (Sigma Aldrich, USA) or anti-miR-21, siPORT NeoFX transfection agent (Applied Biosystems, USA) was used according to the manufacturer's instructions. pSG5-HBx plasmid was used to transfect HBx gene in hepatic cells, and as a control, an empty vector was used in all the plasmid transfection experiments. .. To test the efficiency of transfection, enhanced Green Fluorescent Protein-N1 (eGFP-N1) plasmid vector was used in initial experiments.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Millipore t7 phages
    Experimental test of model predictions for phage-biofilm coexistence. Biofilms containing mixtures of phage T7-susceptible  E. coli  AR3110 and a phage T7-resistant mutant carrying a deletion of  trxA  were grown for 48 h before administering a pulse of phages to the two-strain biofilm population. The frequency of resistant cells is shown in traces colored according to their initial frequency, where each trace is an independent run of the experiment. (A) Population dynamics traces showing the frequency of phage-resistant  E. coli  as a function of its initial population frequency. Each trace is a single replicate of the experiment, with various initial ratios of the two strains as in our simulations. (B and C) Time series of phage-resistant (blue) and phage-susceptible cells (red) following a pulse of phages into the chambers. The panels from left to right show biofilms at ∼0, 0.5, 1, and 2 days after phage exposure. Each image is an  x - y  optical section from a stack of images covering the whole biofilm volume, acquired by confocal microscopy.
    T7 Phages, supplied by Millipore, used in various techniques. Bioz Stars score: 94/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t7 phages/product/Millipore
    Average 94 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    t7 phages - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    93
    Millipore cmv promoter
    Design and characterization FLEX-Cre system. (A,B) Schematic representation of the FLEX vector which encodes a double-Floxed, inverted shRNA and GFP. In the presence of Cre, a FLip-EXcision (FLEX) switch occurs, leading to a U6 promoter-driven expression of the gene-specific shRNA, and a <t>CMV</t> promoter- driven expression of GFP. (C) The FLEX-shFyn plasmid was incubated with (+ Cre) or without (− Cre) Cre <t>recombinase</t> in vitro and infection was evaluated by staining cells with anti-GFP antibodies (right panels). (D,E) Characterization of Cre-driven Fyn knockdown in HEK293T cells. (D,E) FLEX-shFyn or FLEX-SCR plasmids were pretreated with (+ Cre) or without Cre recombinase then co-transfected with Fyn plasmid as indicated. mRNA expression (D) and protein levels (E) were analyzed by RT-PCR and western blot analysis, respectively. 1. pUSE-empty plasmid, 2. pUSE-Fyn, 3. pUSE-Fyn + pLVX-FLEX-SCR, 4. pUSE-Fyn + pLVX-FLEX-SCR + Cre, 5. pUSE-Fyn + pLVX-FLEX-shFyn, 6. pUSE-Fyn + pLVX-FLEX-shFyn + Cre. Two-tailed t -test. *** p
    Cmv Promoter, supplied by Millipore, used in various techniques. Bioz Stars score: 93/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cmv promoter/product/Millipore
    Average 93 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    cmv promoter - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    99
    Millipore aphidicolin
    CAGAGG Repeats Impede DNA synthesis (A) Schematic of in vitro Pol δHE primer-extension assay. (B) Representative images of Pol δHE reaction products. Pol δHE DNA synthesis products from ssDNA templates containing (CAGAGG) 15 , (CCTCTG) 15 , or scrambled control inserts (purine-rich or pyrimidine-rich) with increasing reaction times (3 – 15 minutes, triangle) were separated by denaturing PAGE alongside a dideoxynucleotide sequencing of the same template (TACG). Left: (CCTCTG) 15 and (CAGAGG) 15 insert-containing templates; Right: for pyrimidine-rich scrambled control. (C) Pol δHE termination probability. Termination probability, normalized by the number of nucleotides in each region, was quantified as the ratio of DNA molecules within a specific region over these plus all longer DNA molecules. (D) Effect of (CAGAGG) n repeats on plasmid DNA synthesis in cells. Left: (CAGAGG) 105 ). Right: Representative 2D gels. Plasmid transfected cells were either untreated (UT) or treated with 0.6 μM <t>aphidicolin</t> (APH) for 24 hours. Isolated episomal DNA was digested with DpnI, EcoRI (RI) and Eco NI (NI) and replication intermediates were resolved by 2D neutral-neutral gel electrophoresis with Southern hybridization to the indicated probe. Arrows denote the point of divergence of the double-Y structure from the simple-Y arc. (E) Replication intermediates of plasmids containing origin-distal (CAGAGG) 105 . Left: Schematic of the ori-distal vectors(2.7 kB from the origin). Right : Representative 2D gels. Experiment was carried out as described in (A), except that the purified DNAs were digested with DpnI, PpuMI, and SacII and detected with the indicated probe. (F) Schematic of replication through ori-proximal vectors and the formation of double-Y structures. Dashed red line indicates the center of the RI-NI fragment, the expected apex of the simple-Y arc. (G) Left: Schematic of replication fork barrier (RFB) index quantitation. The RFB index is the number of double Y structures (red) divided by the number present in > 1.5N simple-Y structures (blue). Right: Quantitation of the RFB index in CAGAGG) 105 .
    Aphidicolin, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 327 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/aphidicolin/product/Millipore
    Average 99 stars, based on 327 article reviews
    Price from $9.99 to $1999.99
    aphidicolin - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    Image Search Results


    Experimental test of model predictions for phage-biofilm coexistence. Biofilms containing mixtures of phage T7-susceptible  E. coli  AR3110 and a phage T7-resistant mutant carrying a deletion of  trxA  were grown for 48 h before administering a pulse of phages to the two-strain biofilm population. The frequency of resistant cells is shown in traces colored according to their initial frequency, where each trace is an independent run of the experiment. (A) Population dynamics traces showing the frequency of phage-resistant  E. coli  as a function of its initial population frequency. Each trace is a single replicate of the experiment, with various initial ratios of the two strains as in our simulations. (B and C) Time series of phage-resistant (blue) and phage-susceptible cells (red) following a pulse of phages into the chambers. The panels from left to right show biofilms at ∼0, 0.5, 1, and 2 days after phage exposure. Each image is an  x - y  optical section from a stack of images covering the whole biofilm volume, acquired by confocal microscopy.

    Journal: mSystems

    Article Title: Biofilm Structure Promotes Coexistence of Phage-Resistant and Phage-Susceptible Bacteria

    doi: 10.1128/mSystems.00877-19

    Figure Lengend Snippet: Experimental test of model predictions for phage-biofilm coexistence. Biofilms containing mixtures of phage T7-susceptible E. coli AR3110 and a phage T7-resistant mutant carrying a deletion of trxA were grown for 48 h before administering a pulse of phages to the two-strain biofilm population. The frequency of resistant cells is shown in traces colored according to their initial frequency, where each trace is an independent run of the experiment. (A) Population dynamics traces showing the frequency of phage-resistant E. coli as a function of its initial population frequency. Each trace is a single replicate of the experiment, with various initial ratios of the two strains as in our simulations. (B and C) Time series of phage-resistant (blue) and phage-susceptible cells (red) following a pulse of phages into the chambers. The panels from left to right show biofilms at ∼0, 0.5, 1, and 2 days after phage exposure. Each image is an x - y optical section from a stack of images covering the whole biofilm volume, acquired by confocal microscopy.

    Article Snippet: T7 phages ( ) were used for all experiments.

    Techniques: Mutagenesis, Confocal Microscopy

    Design and characterization FLEX-Cre system. (A,B) Schematic representation of the FLEX vector which encodes a double-Floxed, inverted shRNA and GFP. In the presence of Cre, a FLip-EXcision (FLEX) switch occurs, leading to a U6 promoter-driven expression of the gene-specific shRNA, and a CMV promoter- driven expression of GFP. (C) The FLEX-shFyn plasmid was incubated with (+ Cre) or without (− Cre) Cre recombinase in vitro and infection was evaluated by staining cells with anti-GFP antibodies (right panels). (D,E) Characterization of Cre-driven Fyn knockdown in HEK293T cells. (D,E) FLEX-shFyn or FLEX-SCR plasmids were pretreated with (+ Cre) or without Cre recombinase then co-transfected with Fyn plasmid as indicated. mRNA expression (D) and protein levels (E) were analyzed by RT-PCR and western blot analysis, respectively. 1. pUSE-empty plasmid, 2. pUSE-Fyn, 3. pUSE-Fyn + pLVX-FLEX-SCR, 4. pUSE-Fyn + pLVX-FLEX-SCR + Cre, 5. pUSE-Fyn + pLVX-FLEX-shFyn, 6. pUSE-Fyn + pLVX-FLEX-shFyn + Cre. Two-tailed t -test. *** p

    Journal: Frontiers in Molecular Neuroscience

    Article Title: Fyn Signaling Is Compartmentalized to Dopamine D1 Receptor Expressing Neurons in the Dorsal Medial Striatum

    doi: 10.3389/fnmol.2017.00273

    Figure Lengend Snippet: Design and characterization FLEX-Cre system. (A,B) Schematic representation of the FLEX vector which encodes a double-Floxed, inverted shRNA and GFP. In the presence of Cre, a FLip-EXcision (FLEX) switch occurs, leading to a U6 promoter-driven expression of the gene-specific shRNA, and a CMV promoter- driven expression of GFP. (C) The FLEX-shFyn plasmid was incubated with (+ Cre) or without (− Cre) Cre recombinase in vitro and infection was evaluated by staining cells with anti-GFP antibodies (right panels). (D,E) Characterization of Cre-driven Fyn knockdown in HEK293T cells. (D,E) FLEX-shFyn or FLEX-SCR plasmids were pretreated with (+ Cre) or without Cre recombinase then co-transfected with Fyn plasmid as indicated. mRNA expression (D) and protein levels (E) were analyzed by RT-PCR and western blot analysis, respectively. 1. pUSE-empty plasmid, 2. pUSE-Fyn, 3. pUSE-Fyn + pLVX-FLEX-SCR, 4. pUSE-Fyn + pLVX-FLEX-SCR + Cre, 5. pUSE-Fyn + pLVX-FLEX-shFyn, 6. pUSE-Fyn + pLVX-FLEX-shFyn + Cre. Two-tailed t -test. *** p

    Article Snippet: Specifically, in order to construct a lentivirus vector that expresses shRNA targeting Fyn only in the presence of Cre recombinase, first shFyn sequence (or scramble sequence) and CMV promoter (from pLL3.7 vector, sense primer: 5′-ACATTGATTATTGACTAGTTA-3′, antisense primer: 5′- GCTTATATAGACCTCCC-3′) were subcloned in a reversed orientation into pAAV-DIO-hChR2 between two sets of lox sites using NheI, AflII, and AscI sites [(shuttled in pUSEamp(+) vector (EMD Millipore (Temecula, CA)].

    Techniques: Plasmid Preparation, shRNA, Expressing, Incubation, In Vitro, Infection, Staining, Transfection, Reverse Transcription Polymerase Chain Reaction, Western Blot, Two Tailed Test

    CAGAGG Repeats Impede DNA synthesis (A) Schematic of in vitro Pol δHE primer-extension assay. (B) Representative images of Pol δHE reaction products. Pol δHE DNA synthesis products from ssDNA templates containing (CAGAGG) 15 , (CCTCTG) 15 , or scrambled control inserts (purine-rich or pyrimidine-rich) with increasing reaction times (3 – 15 minutes, triangle) were separated by denaturing PAGE alongside a dideoxynucleotide sequencing of the same template (TACG). Left: (CCTCTG) 15 and (CAGAGG) 15 insert-containing templates; Right: for pyrimidine-rich scrambled control. (C) Pol δHE termination probability. Termination probability, normalized by the number of nucleotides in each region, was quantified as the ratio of DNA molecules within a specific region over these plus all longer DNA molecules. (D) Effect of (CAGAGG) n repeats on plasmid DNA synthesis in cells. Left: (CAGAGG) 105 ). Right: Representative 2D gels. Plasmid transfected cells were either untreated (UT) or treated with 0.6 μM aphidicolin (APH) for 24 hours. Isolated episomal DNA was digested with DpnI, EcoRI (RI) and Eco NI (NI) and replication intermediates were resolved by 2D neutral-neutral gel electrophoresis with Southern hybridization to the indicated probe. Arrows denote the point of divergence of the double-Y structure from the simple-Y arc. (E) Replication intermediates of plasmids containing origin-distal (CAGAGG) 105 . Left: Schematic of the ori-distal vectors(2.7 kB from the origin). Right : Representative 2D gels. Experiment was carried out as described in (A), except that the purified DNAs were digested with DpnI, PpuMI, and SacII and detected with the indicated probe. (F) Schematic of replication through ori-proximal vectors and the formation of double-Y structures. Dashed red line indicates the center of the RI-NI fragment, the expected apex of the simple-Y arc. (G) Left: Schematic of replication fork barrier (RFB) index quantitation. The RFB index is the number of double Y structures (red) divided by the number present in > 1.5N simple-Y structures (blue). Right: Quantitation of the RFB index in CAGAGG) 105 .

    Journal: Molecular cell

    Article Title: Genome-wide identification of structure-forming repeats as principal sites of fork collapse upon ATR inhibition

    doi: 10.1016/j.molcel.2018.08.047

    Figure Lengend Snippet: CAGAGG Repeats Impede DNA synthesis (A) Schematic of in vitro Pol δHE primer-extension assay. (B) Representative images of Pol δHE reaction products. Pol δHE DNA synthesis products from ssDNA templates containing (CAGAGG) 15 , (CCTCTG) 15 , or scrambled control inserts (purine-rich or pyrimidine-rich) with increasing reaction times (3 – 15 minutes, triangle) were separated by denaturing PAGE alongside a dideoxynucleotide sequencing of the same template (TACG). Left: (CCTCTG) 15 and (CAGAGG) 15 insert-containing templates; Right: for pyrimidine-rich scrambled control. (C) Pol δHE termination probability. Termination probability, normalized by the number of nucleotides in each region, was quantified as the ratio of DNA molecules within a specific region over these plus all longer DNA molecules. (D) Effect of (CAGAGG) n repeats on plasmid DNA synthesis in cells. Left: (CAGAGG) 105 ). Right: Representative 2D gels. Plasmid transfected cells were either untreated (UT) or treated with 0.6 μM aphidicolin (APH) for 24 hours. Isolated episomal DNA was digested with DpnI, EcoRI (RI) and Eco NI (NI) and replication intermediates were resolved by 2D neutral-neutral gel electrophoresis with Southern hybridization to the indicated probe. Arrows denote the point of divergence of the double-Y structure from the simple-Y arc. (E) Replication intermediates of plasmids containing origin-distal (CAGAGG) 105 . Left: Schematic of the ori-distal vectors(2.7 kB from the origin). Right : Representative 2D gels. Experiment was carried out as described in (A), except that the purified DNAs were digested with DpnI, PpuMI, and SacII and detected with the indicated probe. (F) Schematic of replication through ori-proximal vectors and the formation of double-Y structures. Dashed red line indicates the center of the RI-NI fragment, the expected apex of the simple-Y arc. (G) Left: Schematic of replication fork barrier (RFB) index quantitation. The RFB index is the number of double Y structures (red) divided by the number present in > 1.5N simple-Y structures (blue). Right: Quantitation of the RFB index in CAGAGG) 105 .

    Article Snippet: cells were treated with either DMSO or 1 μM ATR-45 ( ) and 0.2 μM aphidicolin (Calbiochem, CAS 38966–21-1) for 18 hrs; 1μM ATR-45 and 0.2 μM aphidicolin for 9 hrs; 1 μM ATR-45 for 18 hrs; and 0.2 μM aphidicolin for 18 hrs.

    Techniques: DNA Synthesis, In Vitro, Primer Extension Assay, Polyacrylamide Gel Electrophoresis, Sequencing, Plasmid Preparation, Transfection, Isolation, Nucleic Acid Electrophoresis, Hybridization, Purification, Quantitation Assay