2a ar  (Santa Cruz Biotechnology)

Journal: bioRxiv

Article Title: Translation-independent association of mRNAs encoding protomers of the 5-HT 2A -mGlu2 receptor complex in living cells

doi: 10.1101/2024.06.17.599432

Figure Lengend Snippet: ( A-C ) HEK293 cells were transfected with non-targeting siRNA or 5-HT 2A R siRNA. Forty-eight hours after siRNA transfection, cells were transfected with pcDNA3.1-cMyc-5-HT 2A R. RNA and protein extractions were carried out 24 h following DNA transfection. 5-HT 2A R mRNA was assessed by RT-qPCR (n = 4 independent experiments) ( A ), and 5-HT 2A R immunoreactivity was assessed by Western blot (n = 3 independent experiments) ( B ). Representative immunoblots are shown ( C ). ( D-F ) HEK293 cells were transfected with non-targeting siRNA or 5-HT 2A R siRNA. Forty-eight hours after siRNA transfection, cells were co-transfected with pcDNA3.1-cMyc-5-HT 2A R and HA-mGluR2. RNA and protein extractions were carried out 24 h following DNA transfection. mGluR2 mRNA was assessed by RT-qPCR (n = 6 independent experiments) ( D ), and mGluR2 immunoreactivity was assessed by Western blot (n = 3 independent experiments) ( E ). Representative immunoblots are shown ( F ). ( G-I ) HEK293 cells were transfected with non-targeting siRNA or 5-HT 2A R siRNA. Forty-eight hours after siRNA transfection, cells were co-transfected with pcDNA3.1-cMyc-5-HT 2A R and HA-mGluR3. RNA and protein extractions were carried out 24 h following DNA transfection. mGluR3 mRNA was assessed by RT-qPCR (n = 9 independent experiments) ( G ), and mGluR3 immunoreactivity was assessed by Western blot (n = 3 independent experiments) ( H ). Representative immunoblots are shown ( I ). Unpaired two-tailed Student’s t -test (*p < 0.05).

Article Snippet: For small interfering RNA (siRNA) assays, cells were transfected with non-targeting siRNA (Santa Cruz Biotechnology, Inc.), 5-HT 2A R siRNA, mGluR2 siRNA or RPS24 siRNA (for siRNA target sequences, see Table S3) (Sigma) using Oligofectamine (Invitrogen), following manufacturer’s instructions.

Techniques: Transfection, Quantitative RT-PCR, Western Blot, Two Tailed Test

Journal: bioRxiv

Article Title: Translation-independent association of mRNAs encoding protomers of the 5-HT 2A -mGlu2 receptor complex in living cells

doi: 10.1101/2024.06.17.599432

Figure Lengend Snippet: ( A-C ) HEK293 cells were transfected with non-targeting siRNA or mGluR2 siRNA. Forty-eight hours after siRNA transfection, cells were transfected with pcDNA3.1-HA-mGluR2. RNA and protein extractions were carried out 24 h following DNA transfection. mGluR2 mRNA was assessed by RT-qPCR (n = 6 independent experiments) ( A ), and mGluR2 immunoreactivity was assessed by Western blot (n = 3 independent experiments) ( B ). Representative immunoblots are shown ( C ). ( D-F ) HEK293 cells were transfected with non-targeting siRNA or mGluR2 siRNA. Forty-eight hours after siRNA transfection, cells were co-transfected with pcDNA3.1-HA-mGluR2 and pcDNA3.1-c-Myc-5-HT 2A R. RNA and protein extractions were carried out 24 h following DNA transfection. 5-HT 2A R mRNA was assessed by RT-qPCR (n = 6 independent experiments) ( D ), and 5-HT 2A R immunoreactivity was assessed by Western blot (n = 3 independent experiments) ( E ). Representative immunoblots are shown ( F ). Unpaired two-tailed Student’s t -test (p > 0.05).

Article Snippet: For small interfering RNA (siRNA) assays, cells were transfected with non-targeting siRNA (Santa Cruz Biotechnology, Inc.), 5-HT 2A R siRNA, mGluR2 siRNA or RPS24 siRNA (for siRNA target sequences, see Table S3) (Sigma) using Oligofectamine (Invitrogen), following manufacturer’s instructions.

Techniques: Transfection, Quantitative RT-PCR, Western Blot, Two Tailed Test

Journal: bioRxiv

Article Title: Translation-independent association of mRNAs encoding protomers of the 5-HT 2A -mGlu2 receptor complex in living cells

doi: 10.1101/2024.06.17.599432

Figure Lengend Snippet: (A, B) Validation of cytosolic fractionation of RNP complexes using RIP Assay kit by using a cytosolic marker α-Tubulin (A) and a nuclear marker Lamin A/C (B) . (C) Immunoblot with an anti-cMyc antibody in HEK293 cells transiently transfected with pcDNA3.1-c-Myc-5-HT 2A R or pcDNA3.1-5-HT 2C R-cMyc. (D) Immunoblot with an anti-HA antibody in HEK293 cells transiently transfected with pcDNA3.1-HA-mGluR2 or pcDNA3.1-HA-mGluR3.

Article Snippet: For small interfering RNA (siRNA) assays, cells were transfected with non-targeting siRNA (Santa Cruz Biotechnology, Inc.), 5-HT 2A R siRNA, mGluR2 siRNA or RPS24 siRNA (for siRNA target sequences, see Table S3) (Sigma) using Oligofectamine (Invitrogen), following manufacturer’s instructions.

Techniques: Fractionation, Marker, Western Blot, Transfection

Journal: bioRxiv

Article Title: Translation-independent association of mRNAs encoding protomers of the 5-HT 2A -mGlu2 receptor complex in living cells

doi: 10.1101/2024.06.17.599432

Figure Lengend Snippet: ( A ) Schematic representation illustrating the co-translational association of 5-HT 2A R and mGluR2 polypeptides, depicted in red and yellow, respectively, as they emerge from ribosomes shown in blue and green. The polypeptides originate from neighboring 5-HT 2A R and mGluR2 transcripts, depicted in black. The mGluR2 targeting antibody (anti-HA, magenta) used for immunoprecipitation of the mRNA/protein complex is indicated, bound to the N-terminal of mGluR2. ( B ) Schematic representation illustrating the co-translational association of 5-HT 2A R and mGluR2 polypeptides, depicted in red and yellow, respectively, as they emerge from ribosomes shown in blue and green. The polypeptides originate from neighboring 5-HT 2A R and mGluR2 transcripts, depicted in black. The 5-HT 2A R targeting antibody (anti-cMyc, dark green) used for immunoprecipitation of the mRNA/protein complex is indicated, bound to the N-terminal of 5-HT 2A R. ( C ) HEK293 cells were co-transfected with pcDNA3.1-HA-mGluR2, and pcDNA3.1-cMyc-5-HT 2A R or pcDNA3.1-5-HT 2C R-cMyc constructs, or mock. Images show representative RT-PCR products for mGluR2 , 5-HT 2A R and 5-HT 2C R transcripts from HEK293 cells before (Input) and after immuno-precipitation (IP) using an anti-HA antibody. For control, cells separately expressing the c-Myc- or HA-tagged forms were mixed. Data are representative from three independent experiments. ( D ) HEK293 cells were co-transfected with pcDNA3.1-cMyc-5-HT 2A R, and pcDNA3.1-HA-mGluR2, pcDNA3.1-HA-mGluR3 or pcDNA3.1-TAA-HA-mGluR2 constructs. Images show representative RT-PCR products for 5-HT 2A R , mGluR2 and mGluR3 transcripts from HEK293 cells before (Input) and after immuno-precipitation (IP) using an anti-cMyc antibody. For control, cells separately expressing the c-Myc- or HA-tagged forms were mixed. Data are representative from three independent experiments. ( E ) Schematic showing anti-cMyc antibody used to immunoprecipitate 5-HT 2A R protein and association of 5-HT 2A R and mGluR2 transcripts in the absence of mGluR2 protein. ( F ) Immunoblot demonstrating loss of HA-mGluR2 protein when the translation initiation site is mutated (TAA). (G, H) HEK293 cells were co-transfected with pcDNA3.1-cMyc-5-HT 2A R and pcDNA3.1-HA-mGluR2 constructs. Images show representative RT-PCR products for 5-HT 2A R and mGluR2 transcripts from HEK293 cells before (Input) and after immuno-precipitation (IP) using an anti-HA antibody. RIP assays were performed in presence and absence of EDTA (25 mM). ( H ) Quantification of change in IP band intensities of RT-PCR products for 5-HT 2A R and mGluR2 transcripts as observed in presence and absence of 25mM EDTA. Representative image ( G ), and quantification of IP/input band intensities (n = 3 independent experiments performed in triplicate) ( H ). ( I ) Images show representative RT-PCR products for 5-HT 2A R , 5-HT 2C R and mGluR2 transcripts from mouse frontal cortex samples before (Input) and after immuno-precipitation (IP) using an anti-mGluR2 antibody. Data are representative from three independent experiments in 3 mice. ( J ) Mouse frontal cortex samples were subjected to RIP assays employing an anti-mGluR2 antibody. Subsequently, the RNP complexes underwent processing for RNA isolation and RT-qPCR assays for the detection of 5-HT 2A R and 5-HT 2C R transcripts. Data are shown as fold change of IP/Input (n = 3 mice). Two-way ANOVA followed by Bonferroni’s post-hoc test ( H ), and unpaired two-tailed Student’s t -test ( J ). (*p < 0.05, **p < 0.001).

Article Snippet: For small interfering RNA (siRNA) assays, cells were transfected with non-targeting siRNA (Santa Cruz Biotechnology, Inc.), 5-HT 2A R siRNA, mGluR2 siRNA or RPS24 siRNA (for siRNA target sequences, see Table S3) (Sigma) using Oligofectamine (Invitrogen), following manufacturer’s instructions.

Techniques: Immunoprecipitation, Transfection, Construct, Reverse Transcription Polymerase Chain Reaction, Control, Expressing, Western Blot, Isolation, Quantitative RT-PCR, Two Tailed Test

Journal: bioRxiv

Article Title: Translation-independent association of mRNAs encoding protomers of the 5-HT 2A -mGlu2 receptor complex in living cells

doi: 10.1101/2024.06.17.599432

Figure Lengend Snippet: ( A ) Confocal micrographs of HEK293 cells transiently transfected with pcDNA3.1-cMyc-5-HT 2A R-mCherry (red) and HA-mGluR2-mCitrine (green), and stained with anti-calnexin (upper panel, magenta) or anti-58-K (lower panel, magenta) and secondary antibodies, and imaged to detect mCherry, mCitrine, anti-calnexin, and anti-58-K. Nuclei were stained in blue with Hoechst. Scale bars, 5 µM. ( B ) Schematic representation of a working model for the mechanism of 5-HT 2A R and mGluR2 transcript association and subcellular localization of the 5-HT 2A R-mGluR2 heterocomplex during maturation. Following co-translational association within RNP complexes containing RPS24, 5-HT 2A R and mGluR2 are trafficked to the ER as part of a protein complex. Subsequently, this GPCR heterocomplex is translocated to the Golgi apparatus and directed to the cell membrane or other subcellular compartments.

Article Snippet: For small interfering RNA (siRNA) assays, cells were transfected with non-targeting siRNA (Santa Cruz Biotechnology, Inc.), 5-HT 2A R siRNA, mGluR2 siRNA or RPS24 siRNA (for siRNA target sequences, see Table S3) (Sigma) using Oligofectamine (Invitrogen), following manufacturer’s instructions.

Techniques: Transfection, Staining, Membrane

Journal: bioRxiv

Article Title: Translation-independent association of mRNAs encoding protomers of the 5-HT 2A -mGlu2 receptor complex in living cells

doi: 10.1101/2024.06.17.599432

Figure Lengend Snippet: (A-C) Mouse frontal cortex samples were subjected to RIP assays employing an anti-mGluR2 antibody. Subsequently, input and IP samples underwent processing for RNA isolation and RT-qPCR assays for the detection of 5-HT 2A R (A) , 5-HT 2C R (B) and mGluR2 (C) transcripts (n = 3 mice). Unpaired two-tailed Student’s t -test (*p < 0.05, **p < 0.01).

Article Snippet: For small interfering RNA (siRNA) assays, cells were transfected with non-targeting siRNA (Santa Cruz Biotechnology, Inc.), 5-HT 2A R siRNA, mGluR2 siRNA or RPS24 siRNA (for siRNA target sequences, see Table S3) (Sigma) using Oligofectamine (Invitrogen), following manufacturer’s instructions.

Techniques: Isolation, Quantitative RT-PCR, Two Tailed Test

Journal: bioRxiv

Article Title: Translation-independent association of mRNAs encoding protomers of the 5-HT 2A -mGlu2 receptor complex in living cells

doi: 10.1101/2024.06.17.599432

Figure Lengend Snippet: ( A ) Venn diagram showing the overlap of identified polypeptides by LC-MS/MS in parental HEK293 cells, cells transfected solely with pcDNA3.1-HA-mGluR2 or pcDNA3.1-HA-mGluR3, and cells co-transfected with pcDNA3.1-HA-mGluR2 and pcDNA3.1-cMyc-5HT 2A R following RIP assay using the anti-HA antibody. ( B ) Dot plot depicting polypeptides present in HEK293 cells transfected solely with pcDNA3.1-HA-mGluR2 as well as in cells co-transfected with pcDNA3.1-HA-mGluR2 and pcDNA3.1-cMyc-5HT 2A R, but not in parental HEK293 cells or in cells transfected solely with pcDNA3.1-HA-mGluR3. ( C ) LC-MS/MS analysis identifying with high confidence two tryptic peptides – QMVIDVLHPGK (top) and TTPKVIFVFGFR (bottom) – from RPS24. Mass-to-Charge (m/z) peptide fragments for the y ions (blue) and the b ions (red) are displayed in the spectra (D, E) HEK293 cells were co-transfected with pcDNA3.1-cMyc-5-HT 2A R, and pcDNA3.1-HA-mGluR2 or pcDNA3.1-HA-mGluR3. Images show representative RT-PCR products for 5-HT 2A R , mGluR2 and mGluR3 transcripts from HEK293 cells before (Input) and after immuno-precipitation (IP) using an anti-RPS24 antibody. Representative image ( D ), and quantification of IP/input band intensities (n = 3 independent experiments) ( E ). ( F ) HEK293 cells were transfected with non-targeting siRNA or RPS24 siRNA. Forty-eight hours after siRNA transfection, cells were transfected with pcDNA3.1-c-Myc-5-HT 2A R and pcDNA3.1-HA-mGluR2 constructs. RIP assays were carried out 24 h following DNA transfection using an anti-HA antibody. Subsequently, the RNP complexes underwent processing for RNA isolation and RT-qPCR assays for the detection of 5-HT 2A R and mGluR2 transcripts. Data are shown as fold change of IP/Input (n = 4 independent samples). Unpaired two-tailed Student’s t -test (*p < 0.05, ***p < 0.001).

Article Snippet: For small interfering RNA (siRNA) assays, cells were transfected with non-targeting siRNA (Santa Cruz Biotechnology, Inc.), 5-HT 2A R siRNA, mGluR2 siRNA or RPS24 siRNA (for siRNA target sequences, see Table S3) (Sigma) using Oligofectamine (Invitrogen), following manufacturer’s instructions.

Techniques: Liquid Chromatography with Mass Spectroscopy, Transfection, Reverse Transcription Polymerase Chain Reaction, Immunoprecipitation, Construct, Isolation, Quantitative RT-PCR, Two Tailed Test

Journal: bioRxiv

Article Title: Translation-independent association of mRNAs encoding protomers of the 5-HT 2A -mGlu2 receptor complex in living cells

doi: 10.1101/2024.06.17.599432

Figure Lengend Snippet: (A) Immunoblot depicting RPS24 immunoreactivity in RIP preparations from parental HEK293 cells, as well as cells co-transfected with pcDNA3.1-cMyc-5HT 2A R, and pcDNA3.1-HA-mGluR2 or pcDNA3.1-HA-mGluR3. (B) HEK293 cells were transfected with non-targeting siRNA or RPS24 siRNA. Forty-eight hours after siRNA transfection, cells were co-transfected with pcDNA3.1-cMyc-5HT 2A R and pcDNA3.1-HA-mGluR2 constructs. RNA extractions were carried out 24 h following DNA transfection in Input samples. RPS24 mRNA was assessed by RT-qPCR (n = 4 independent samples). Unpaired two-tailed Student’s t -test (***p < 0.01).

Article Snippet: For small interfering RNA (siRNA) assays, cells were transfected with non-targeting siRNA (Santa Cruz Biotechnology, Inc.), 5-HT 2A R siRNA, mGluR2 siRNA or RPS24 siRNA (for siRNA target sequences, see Table S3) (Sigma) using Oligofectamine (Invitrogen), following manufacturer’s instructions.

Techniques: Western Blot, Transfection, Construct, Quantitative RT-PCR, Two Tailed Test

Journal: bioRxiv

Article Title: Translation-independent association of mRNAs encoding protomers of the 5-HT 2A -mGlu2 receptor complex in living cells

doi: 10.1101/2024.06.17.599432

Figure Lengend Snippet: ( A-C ) HEK293 cells were transfected with non-targeting siRNA or 5-HT 2A R siRNA. Forty-eight hours after siRNA transfection, cells were transfected with pcDNA3.1-cMyc-5-HT 2A R. RNA and protein extractions were carried out 24 h following DNA transfection. 5-HT 2A R mRNA was assessed by RT-qPCR (n = 4 independent experiments) ( A ), and 5-HT 2A R immunoreactivity was assessed by Western blot (n = 3 independent experiments) ( B ). Representative immunoblots are shown ( C ). ( D-F ) HEK293 cells were transfected with non-targeting siRNA or 5-HT 2A R siRNA. Forty-eight hours after siRNA transfection, cells were co-transfected with pcDNA3.1-cMyc-5-HT 2A R and HA-mGluR2. RNA and protein extractions were carried out 24 h following DNA transfection. mGluR2 mRNA was assessed by RT-qPCR (n = 6 independent experiments) ( D ), and mGluR2 immunoreactivity was assessed by Western blot (n = 3 independent experiments) ( E ). Representative immunoblots are shown ( F ). ( G-I ) HEK293 cells were transfected with non-targeting siRNA or 5-HT 2A R siRNA. Forty-eight hours after siRNA transfection, cells were co-transfected with pcDNA3.1-cMyc-5-HT 2A R and HA-mGluR3. RNA and protein extractions were carried out 24 h following DNA transfection. mGluR3 mRNA was assessed by RT-qPCR (n = 9 independent experiments) ( G ), and mGluR3 immunoreactivity was assessed by Western blot (n = 3 independent experiments) ( H ). Representative immunoblots are shown ( I ). Unpaired two-tailed Student’s t -test (*p < 0.05).

Article Snippet: For small interfering RNA (siRNA) assays, cells were transfected with non-targeting siRNA (Santa Cruz Biotechnology, Inc.), 5-HT 2A R siRNA, mGluR2 siRNA or RPS24 siRNA (for siRNA target sequences, see Table S3) (Sigma) using Oligofectamine (Invitrogen), following manufacturer’s instructions.

Techniques: Transfection, Quantitative RT-PCR, Western Blot, Two Tailed Test

Journal: bioRxiv

Article Title: Translation-independent association of mRNAs encoding protomers of the 5-HT 2A -mGlu2 receptor complex in living cells

doi: 10.1101/2024.06.17.599432

Figure Lengend Snippet: ( A-C ) HEK293 cells were transfected with non-targeting siRNA or mGluR2 siRNA. Forty-eight hours after siRNA transfection, cells were transfected with pcDNA3.1-HA-mGluR2. RNA and protein extractions were carried out 24 h following DNA transfection. mGluR2 mRNA was assessed by RT-qPCR (n = 6 independent experiments) ( A ), and mGluR2 immunoreactivity was assessed by Western blot (n = 3 independent experiments) ( B ). Representative immunoblots are shown ( C ). ( D-F ) HEK293 cells were transfected with non-targeting siRNA or mGluR2 siRNA. Forty-eight hours after siRNA transfection, cells were co-transfected with pcDNA3.1-HA-mGluR2 and pcDNA3.1-c-Myc-5-HT 2A R. RNA and protein extractions were carried out 24 h following DNA transfection. 5-HT 2A R mRNA was assessed by RT-qPCR (n = 6 independent experiments) ( D ), and 5-HT 2A R immunoreactivity was assessed by Western blot (n = 3 independent experiments) ( E ). Representative immunoblots are shown ( F ). Unpaired two-tailed Student’s t -test (p > 0.05).

Article Snippet: For small interfering RNA (siRNA) assays, cells were transfected with non-targeting siRNA (Santa Cruz Biotechnology, Inc.), 5-HT 2A R siRNA, mGluR2 siRNA or RPS24 siRNA (for siRNA target sequences, see Table S3) (Sigma) using Oligofectamine (Invitrogen), following manufacturer’s instructions.

Techniques: Transfection, Quantitative RT-PCR, Western Blot, Two Tailed Test

Journal: bioRxiv

Article Title: Translation-independent association of mRNAs encoding protomers of the 5-HT 2A -mGlu2 receptor complex in living cells

doi: 10.1101/2024.06.17.599432

Figure Lengend Snippet: (A, B) Validation of cytosolic fractionation of RNP complexes using RIP Assay kit by using a cytosolic marker α-Tubulin (A) and a nuclear marker Lamin A/C (B) . (C) Immunoblot with an anti-cMyc antibody in HEK293 cells transiently transfected with pcDNA3.1-c-Myc-5-HT 2A R or pcDNA3.1-5-HT 2C R-cMyc. (D) Immunoblot with an anti-HA antibody in HEK293 cells transiently transfected with pcDNA3.1-HA-mGluR2 or pcDNA3.1-HA-mGluR3.

Article Snippet: For small interfering RNA (siRNA) assays, cells were transfected with non-targeting siRNA (Santa Cruz Biotechnology, Inc.), 5-HT 2A R siRNA, mGluR2 siRNA or RPS24 siRNA (for siRNA target sequences, see Table S3) (Sigma) using Oligofectamine (Invitrogen), following manufacturer’s instructions.

Techniques: Fractionation, Marker, Western Blot, Transfection

Journal: bioRxiv

Article Title: Translation-independent association of mRNAs encoding protomers of the 5-HT 2A -mGlu2 receptor complex in living cells

doi: 10.1101/2024.06.17.599432

Figure Lengend Snippet: ( A ) Schematic representation illustrating the co-translational association of 5-HT 2A R and mGluR2 polypeptides, depicted in red and yellow, respectively, as they emerge from ribosomes shown in blue and green. The polypeptides originate from neighboring 5-HT 2A R and mGluR2 transcripts, depicted in black. The mGluR2 targeting antibody (anti-HA, magenta) used for immunoprecipitation of the mRNA/protein complex is indicated, bound to the N-terminal of mGluR2. ( B ) Schematic representation illustrating the co-translational association of 5-HT 2A R and mGluR2 polypeptides, depicted in red and yellow, respectively, as they emerge from ribosomes shown in blue and green. The polypeptides originate from neighboring 5-HT 2A R and mGluR2 transcripts, depicted in black. The 5-HT 2A R targeting antibody (anti-cMyc, dark green) used for immunoprecipitation of the mRNA/protein complex is indicated, bound to the N-terminal of 5-HT 2A R. ( C ) HEK293 cells were co-transfected with pcDNA3.1-HA-mGluR2, and pcDNA3.1-cMyc-5-HT 2A R or pcDNA3.1-5-HT 2C R-cMyc constructs, or mock. Images show representative RT-PCR products for mGluR2 , 5-HT 2A R and 5-HT 2C R transcripts from HEK293 cells before (Input) and after immuno-precipitation (IP) using an anti-HA antibody. For control, cells separately expressing the c-Myc- or HA-tagged forms were mixed. Data are representative from three independent experiments. ( D ) HEK293 cells were co-transfected with pcDNA3.1-cMyc-5-HT 2A R, and pcDNA3.1-HA-mGluR2, pcDNA3.1-HA-mGluR3 or pcDNA3.1-TAA-HA-mGluR2 constructs. Images show representative RT-PCR products for 5-HT 2A R , mGluR2 and mGluR3 transcripts from HEK293 cells before (Input) and after immuno-precipitation (IP) using an anti-cMyc antibody. For control, cells separately expressing the c-Myc- or HA-tagged forms were mixed. Data are representative from three independent experiments. ( E ) Schematic showing anti-cMyc antibody used to immunoprecipitate 5-HT 2A R protein and association of 5-HT 2A R and mGluR2 transcripts in the absence of mGluR2 protein. ( F ) Immunoblot demonstrating loss of HA-mGluR2 protein when the translation initiation site is mutated (TAA). (G, H) HEK293 cells were co-transfected with pcDNA3.1-cMyc-5-HT 2A R and pcDNA3.1-HA-mGluR2 constructs. Images show representative RT-PCR products for 5-HT 2A R and mGluR2 transcripts from HEK293 cells before (Input) and after immuno-precipitation (IP) using an anti-HA antibody. RIP assays were performed in presence and absence of EDTA (25 mM). ( H ) Quantification of change in IP band intensities of RT-PCR products for 5-HT 2A R and mGluR2 transcripts as observed in presence and absence of 25mM EDTA. Representative image ( G ), and quantification of IP/input band intensities (n = 3 independent experiments performed in triplicate) ( H ). ( I ) Images show representative RT-PCR products for 5-HT 2A R , 5-HT 2C R and mGluR2 transcripts from mouse frontal cortex samples before (Input) and after immuno-precipitation (IP) using an anti-mGluR2 antibody. Data are representative from three independent experiments in 3 mice. ( J ) Mouse frontal cortex samples were subjected to RIP assays employing an anti-mGluR2 antibody. Subsequently, the RNP complexes underwent processing for RNA isolation and RT-qPCR assays for the detection of 5-HT 2A R and 5-HT 2C R transcripts. Data are shown as fold change of IP/Input (n = 3 mice). Two-way ANOVA followed by Bonferroni’s post-hoc test ( H ), and unpaired two-tailed Student’s t -test ( J ). (*p < 0.05, **p < 0.001).

Article Snippet: For small interfering RNA (siRNA) assays, cells were transfected with non-targeting siRNA (Santa Cruz Biotechnology, Inc.), 5-HT 2A R siRNA, mGluR2 siRNA or RPS24 siRNA (for siRNA target sequences, see Table S3) (Sigma) using Oligofectamine (Invitrogen), following manufacturer’s instructions.

Techniques: Immunoprecipitation, Transfection, Construct, Reverse Transcription Polymerase Chain Reaction, Control, Expressing, Western Blot, Isolation, Quantitative RT-PCR, Two Tailed Test

Journal: bioRxiv

Article Title: Translation-independent association of mRNAs encoding protomers of the 5-HT 2A -mGlu2 receptor complex in living cells

doi: 10.1101/2024.06.17.599432

Figure Lengend Snippet: ( A ) Confocal micrographs of HEK293 cells transiently transfected with pcDNA3.1-cMyc-5-HT 2A R-mCherry (red) and HA-mGluR2-mCitrine (green), and stained with anti-calnexin (upper panel, magenta) or anti-58-K (lower panel, magenta) and secondary antibodies, and imaged to detect mCherry, mCitrine, anti-calnexin, and anti-58-K. Nuclei were stained in blue with Hoechst. Scale bars, 5 µM. ( B ) Schematic representation of a working model for the mechanism of 5-HT 2A R and mGluR2 transcript association and subcellular localization of the 5-HT 2A R-mGluR2 heterocomplex during maturation. Following co-translational association within RNP complexes containing RPS24, 5-HT 2A R and mGluR2 are trafficked to the ER as part of a protein complex. Subsequently, this GPCR heterocomplex is translocated to the Golgi apparatus and directed to the cell membrane or other subcellular compartments.

Article Snippet: For small interfering RNA (siRNA) assays, cells were transfected with non-targeting siRNA (Santa Cruz Biotechnology, Inc.), 5-HT 2A R siRNA, mGluR2 siRNA or RPS24 siRNA (for siRNA target sequences, see Table S3) (Sigma) using Oligofectamine (Invitrogen), following manufacturer’s instructions.

Techniques: Transfection, Staining, Membrane

Journal: bioRxiv

Article Title: Translation-independent association of mRNAs encoding protomers of the 5-HT 2A -mGlu2 receptor complex in living cells

doi: 10.1101/2024.06.17.599432

Figure Lengend Snippet: (A-C) Mouse frontal cortex samples were subjected to RIP assays employing an anti-mGluR2 antibody. Subsequently, input and IP samples underwent processing for RNA isolation and RT-qPCR assays for the detection of 5-HT 2A R (A) , 5-HT 2C R (B) and mGluR2 (C) transcripts (n = 3 mice). Unpaired two-tailed Student’s t -test (*p < 0.05, **p < 0.01).

Article Snippet: For small interfering RNA (siRNA) assays, cells were transfected with non-targeting siRNA (Santa Cruz Biotechnology, Inc.), 5-HT 2A R siRNA, mGluR2 siRNA or RPS24 siRNA (for siRNA target sequences, see Table S3) (Sigma) using Oligofectamine (Invitrogen), following manufacturer’s instructions.

Techniques: Isolation, Quantitative RT-PCR, Two Tailed Test

Journal: bioRxiv

Article Title: Translation-independent association of mRNAs encoding protomers of the 5-HT 2A -mGlu2 receptor complex in living cells

doi: 10.1101/2024.06.17.599432

Figure Lengend Snippet: ( A ) Venn diagram showing the overlap of identified polypeptides by LC-MS/MS in parental HEK293 cells, cells transfected solely with pcDNA3.1-HA-mGluR2 or pcDNA3.1-HA-mGluR3, and cells co-transfected with pcDNA3.1-HA-mGluR2 and pcDNA3.1-cMyc-5HT 2A R following RIP assay using the anti-HA antibody. ( B ) Dot plot depicting polypeptides present in HEK293 cells transfected solely with pcDNA3.1-HA-mGluR2 as well as in cells co-transfected with pcDNA3.1-HA-mGluR2 and pcDNA3.1-cMyc-5HT 2A R, but not in parental HEK293 cells or in cells transfected solely with pcDNA3.1-HA-mGluR3. ( C ) LC-MS/MS analysis identifying with high confidence two tryptic peptides – QMVIDVLHPGK (top) and TTPKVIFVFGFR (bottom) – from RPS24. Mass-to-Charge (m/z) peptide fragments for the y ions (blue) and the b ions (red) are displayed in the spectra (D, E) HEK293 cells were co-transfected with pcDNA3.1-cMyc-5-HT 2A R, and pcDNA3.1-HA-mGluR2 or pcDNA3.1-HA-mGluR3. Images show representative RT-PCR products for 5-HT 2A R , mGluR2 and mGluR3 transcripts from HEK293 cells before (Input) and after immuno-precipitation (IP) using an anti-RPS24 antibody. Representative image ( D ), and quantification of IP/input band intensities (n = 3 independent experiments) ( E ). ( F ) HEK293 cells were transfected with non-targeting siRNA or RPS24 siRNA. Forty-eight hours after siRNA transfection, cells were transfected with pcDNA3.1-c-Myc-5-HT 2A R and pcDNA3.1-HA-mGluR2 constructs. RIP assays were carried out 24 h following DNA transfection using an anti-HA antibody. Subsequently, the RNP complexes underwent processing for RNA isolation and RT-qPCR assays for the detection of 5-HT 2A R and mGluR2 transcripts. Data are shown as fold change of IP/Input (n = 4 independent samples). Unpaired two-tailed Student’s t -test (*p < 0.05, ***p < 0.001).

Article Snippet: For small interfering RNA (siRNA) assays, cells were transfected with non-targeting siRNA (Santa Cruz Biotechnology, Inc.), 5-HT 2A R siRNA, mGluR2 siRNA or RPS24 siRNA (for siRNA target sequences, see Table S3) (Sigma) using Oligofectamine (Invitrogen), following manufacturer’s instructions.

Techniques: Liquid Chromatography with Mass Spectroscopy, Transfection, Reverse Transcription Polymerase Chain Reaction, Immunoprecipitation, Construct, Isolation, Quantitative RT-PCR, Two Tailed Test

Journal: bioRxiv

Article Title: Translation-independent association of mRNAs encoding protomers of the 5-HT 2A -mGlu2 receptor complex in living cells

doi: 10.1101/2024.06.17.599432

Figure Lengend Snippet: (A) Immunoblot depicting RPS24 immunoreactivity in RIP preparations from parental HEK293 cells, as well as cells co-transfected with pcDNA3.1-cMyc-5HT 2A R, and pcDNA3.1-HA-mGluR2 or pcDNA3.1-HA-mGluR3. (B) HEK293 cells were transfected with non-targeting siRNA or RPS24 siRNA. Forty-eight hours after siRNA transfection, cells were co-transfected with pcDNA3.1-cMyc-5HT 2A R and pcDNA3.1-HA-mGluR2 constructs. RNA extractions were carried out 24 h following DNA transfection in Input samples. RPS24 mRNA was assessed by RT-qPCR (n = 4 independent samples). Unpaired two-tailed Student’s t -test (***p < 0.01).

Article Snippet: For small interfering RNA (siRNA) assays, cells were transfected with non-targeting siRNA (Santa Cruz Biotechnology, Inc.), 5-HT 2A R siRNA, mGluR2 siRNA or RPS24 siRNA (for siRNA target sequences, see Table S3) (Sigma) using Oligofectamine (Invitrogen), following manufacturer’s instructions.

Techniques: Western Blot, Transfection, Construct, Quantitative RT-PCR, Two Tailed Test

Journal: Aging Cell

Article Title: Amygdala neuronal dyshomeostasis via 5‐HT receptors mediates mood and cognitive defects in Alzheimer's disease

doi: 10.1111/acel.14187

Figure Lengend Snippet: Serotonin receptors are abnormally upregulated during early‐stage AD in the BLA. (a) A hierarchically clustered heatmap showed expression patterns of 13 emotion‐related genes in the human amygdala. (b) The mRNA expression levels of emotion‐related genes in the human amygdala ( n = 11–18 brain samples for each group). (c) Expression levels of 5‐HT 1A R, 5‐HT 2A R, 5‐HT 2B R, 5‐HT 2C R, 5‐HT 3A R, 5‐HT 4 R, 5‐HT 6 R and 5‐HT 7 R proteins in the amygdala from PW10 WT and APP/PS1 mice ( n = 3 animals for each group). (d, e) Representative images and summary data of 5‐HT 2A R immunofluorescence co‐localized with different types of neurons in WT and APP/PS1 mice ( n = 4 to 5 mice for each group). The white arrowheads denote co‐labeled 5‐HT 2A R + /TBR1 + , 5‐HT 2A R + /PV + or 5‐HT 2A R + /SOM + cells, and the white squares denote the enlarged view. Scale bar, 50 μm; 5 μm for magnified images. (f, g) Representative images and summary data of 5‐HT 1A R immunofluorescence co‐localized with different types of neurons in WT and APP/PS1 mice ( n = 6 mice for each group). The white arrowheads denote co‐labeled 5‐HT 1A R + /TBR1 + , 5‐HT 1A R + /PV + or 5‐HT 1A R + /SOM + cells, and the white squares denote the enlarged view. Scale bar, 50 μm; 5 μm for magnified images. Statistical significance was assessed by unpaired Student's t test in (c), (e), and (g), one‐way ANOVA with post hoc comparisons (Tukey test) between groups in (b). All data are presented as the mean ± SEM. * means the difference between normal brain and probably AD brain or normal brain and definite AD brain, # means the difference between probably AD brain and definite AD brain. * p < 0.05; ** p < 0.01; **** p < 0.0001; # p < 0.05; ## p < 0.01; ### p < 0.001; #### p < 0.0001.

Article Snippet: The following viruses were used: AAV‐hSyn‐GCaMP6s was purchased from Shanghai Taitool Bioscience Co. Ltd.; AAV‐DIO‐ChR2(H134R)‐EYFP, AAV‐CaMKIIα‐5‐HT 2A R‐shRNA‐mCherry (sequence AAAGCTGCAGAATGCCACCAACT) (Kim et al., ), AAV2/1‐hSyn‐Cre and AAV‐CaMKIIα‐mCherry were purchased from BrainVTA; AAV‐DIO‐5‐HT 1A R‐shRNA‐EGFP(sequence AAGAAGATCATCAAGTGCA), AAV‐DIO‐EGFP and AAV‐DIO‐mCherry were purchased from Obio Technology Co. Ltd. AAV‐hSyn‐5HT3.0 was purchased from WZ Biosciences.

Techniques: Expressing, Immunofluorescence, Labeling

Journal: Aging Cell

Article Title: Amygdala neuronal dyshomeostasis via 5‐HT receptors mediates mood and cognitive defects in Alzheimer's disease

doi: 10.1111/acel.14187

Figure Lengend Snippet: Double knockdown of serotonin receptors rescues mood defeats in APP/PS1 mice. (a) The schematic illustrates combined knockdown 5‐HT 2A R in pyramidal neuron and 5‐HT 1A R in PV interneuron. (b) Left panel showed experimental scheme of virus injection in BLA and data analysis. Right panel showed histologically verified placements of viral injections in BLA. Scale bars, 200 μm; 125 μm for magnified images. (c) Knocking down 5‐HT 2A R in pyramidal neurons and 5‐HT 1A R in PV interneurons reduce the central time and total distance of APP/PS1 mice in OFT ( n = 8–10 animals for each group). (d) Knocking down 5‐HT 2A R in pyramidal neurons and 5‐HT 1A R in PV interneurons reduce the time in open arms of APP/PS1 mice in EPM ( n = 8–10 animals for each group). (e) Representative traces for action potential firing of WT + SCR‐shRNA, WT + D‐shRNA, APP/PS1 + SCR‐shRNA and APP/PS1 + D‐shRNA mice and statistical data for action potential firing recorded in four groups ( n = 12–14 cells from 3 to 4 mice for each group). (f) Sample traces of eEPSC from WT + SCR‐shRNA, WT + D‐shRNA, APP/PS1 + SCR‐shRNA and APP/PS1 + D‐shRNA mice and summary data for eEPSCs from the four groups ( n = 12–16 cells from 3 to 4 mice per group). (g) Sample traces of sEPSC from WT + SCR‐shRNA, WT + D‐shRNA, APP/PS1 + SCR‐shRNA and APP/PS1 + D‐shRNA mice and summary data for sEPSCs from the four groups ( n = 12–15 cells from 3 to 4 mice per group). (h) Sample traces of sIPSC from WT + SCR‐shRNA, WT + D‐shRNA, APP/PS1 + SCR‐shRNA and APP/PS1 + D‐shRNA mice and summary data for sIPSCs from the four groups ( n = 12–15 cells from 3 to 4 mice per group). Statistical significance was assessed by two‐way repeated measures ANOVA with post hoc comparisons (Tukey test) between groups in (c)–(h). All data are presented as mean ± SEM. * p < 0.05; ** p < 0.01; **** p < 0.0001.

Article Snippet: The following viruses were used: AAV‐hSyn‐GCaMP6s was purchased from Shanghai Taitool Bioscience Co. Ltd.; AAV‐DIO‐ChR2(H134R)‐EYFP, AAV‐CaMKIIα‐5‐HT 2A R‐shRNA‐mCherry (sequence AAAGCTGCAGAATGCCACCAACT) (Kim et al., ), AAV2/1‐hSyn‐Cre and AAV‐CaMKIIα‐mCherry were purchased from BrainVTA; AAV‐DIO‐5‐HT 1A R‐shRNA‐EGFP(sequence AAGAAGATCATCAAGTGCA), AAV‐DIO‐EGFP and AAV‐DIO‐mCherry were purchased from Obio Technology Co. Ltd. AAV‐hSyn‐5HT3.0 was purchased from WZ Biosciences.

Techniques: Knockdown, Virus, Injection, shRNA

Journal: Scientific Reports

Article Title: Adenosine A 2A receptors control synaptic remodeling in the adult brain

doi: 10.1038/s41598-022-18884-4

Figure Lengend Snippet: Pharmacological activation of A 2A Rs induces the formation of abnormal secondary axons in cultured hippocampal neurons. ( a ) Representative images of E18 rat-derived hippocampal neurons cultured in the absence and in the presence of the selective agonist of A 2A Rs, CGS21680 (30 nM), from DIV0, double immunolabeled with SMI31 (axonal marker; yellow) and βIII-tubulin (neuronal marker; blue) antibodies at DIV 3 (scale bar, 30 µm), showing that ( b ) the exposure to CGS21680 increased the number of axons per neuron (upper graph), reflecting an increased percentage of neurons with multiple axons (lower graph). The selective antagonist of A 2A Rs, SCH58261 (50 nM), did not modify the average number of axons per neuron, but prevented the ability of CGS21680 to modify the number of axons per neuron. ( c ) CGS21680 increased axonal length (in those cells displaying more than one axon, it was counted the longest axon), whereas SCH58261 was devoid of effects. In the presence of SCH58261, CGS21680 did not modify axonal length. Neither CGS21680 nor SCH58261 significantly modified axonal branching. Data are mean ± SEM quantified from 6 independent cultures, analyzing a minimum of 100 cells per culture and condition. ( d ) In cells electroporated at DIV0 with either shRNA-Control (shCTR) or shRNA-A 2A R (shA 2A R) (EGFP + ), CGS21680 increased the number of axons per neuron and axonal length in cells transfected with shCTR but not in cells transfected with shA 2A R. Scale bar, 10 μm. Data are mean ± SEM quantified from 7 independent cultures, analyzing a minimum of 25 transfected cells per culture and condition. ** P < 0.01 and *** P < 0.001. ( b upper ; c lower) one-way ANOVA with Dunnet’s post-hoc test; ( b lower ; d left ) two-way ANOVA with Sidak’s post-hoc test; ( c upper ; d right ) one-sample t -test vs. hypothetical value of 1. ( e ) Immunocytochemical analysis of A 2A R immunoreactivity (yellow) in a non-polarized neuron and in an axonal growth cone labelled with phalloidin (blue). Scale bar for upper and middle image, 10 μm; scale bar for the lower image, 5 μm.

Article Snippet: In vitro electroporation of dissociated cells with validated shRNA-A 2A R and a non-targeting control (shRNA-Control) encoding EGFP ( ; see Supplementary Figs. , ) was performed using Ingenio Electroporation kit (Mirus Biotech®; Cat#MIR 50118) and Nucleofector® IIb device (Amaxa Biosystems) as previously described .

Techniques: Activation Assay, Cell Culture, Derivative Assay, Immunolabeling, Marker, Modification, shRNA, Transfection

Journal: Scientific Reports

Article Title: Adenosine A 2A receptors control synaptic remodeling in the adult brain

doi: 10.1038/s41598-022-18884-4

Figure Lengend Snippet: Knockdown of A 2A Rs in dentate granule cells reduces status epilepticus-induced hippocampal mossy fiber sprouting. ( a ) Lentivirus encoding EGFP and shRNA-Control (shCTR) or shRNA-A 2A R (shA 2A R) were injected into the hippocampal dentate gyrus (DG) in the left or in the right hemisphere. After 10 days, rats were injected with saline (Control group) or pilocarpine (Status epilepticus group). All rats were administered with scopolamine methylbromide (2 mg/kg, i.p. ) 30 min before. Only animals reaching at least stage 4 seizures were considered. ( b ) After 55 days, mossy fiber (MF) sprouting was assessed by immunohistochemical analysis of synaptoporin (MF terminals marker). Representative images of the immunolabelling of synaptoporin and neuronal nuclei (NeuN) showing that in rats that experienced status epilepticus (SE) it was observed synaptoporin immunoreactivity in the inner molecular layer (IML) of the DG (white arrows), which was not observed in control rats. Scale bar, 300 μm. ( c ) Representative image showing a DG segment infected with lentivirus encoding shCTR from a rat that experienced SE, immunolabelled with synaptoporin and NeuN and displaying EGFP + -dentate granule cells. Scale bar, 100 µm. ( d ) Schematic illustration of the quantitative method used to analyse the extent of MF sprouting. A Δsprouting ratio for each acquired image with obviously different EGFP + -cell density in adjacent areas was calculated by measuring the incremental proportion of the synaptoporin (cyan) puncta density (PD2 to PD1) in the IML vs. the incremental proportion of EGFP + -neuron density (ED2 to ED1) in the granule cell layer (GCL), defined by NeuN immunoreactivity. ( e ) The brain sections from shCTR- or shRNA-A 2A R-injected DG from control animals displayed no synaptoporin staining (cyan) in the IML. In SE group, shA 2A R-injected DG sections displayed lower synaptoporin puncta densities in the IML region corresponding to the higher EGFP + -cell density region in GCL which was not observed in shCTR-injected DG. Scale bar, 25 μm. ( f ) Δsprouting ratio in shA 2A R-injected DG and shCTR-injected DG in each individual animal that had experienced SE ( left ), supporting a significant lower Δsprouting in shA 2A R-injected DG vs. shCTR-injected DG (right). The data are median and interquartile range ( left graph) or mean ± SEM ( right graph). * P < 0.05 and *** P < 0.001, paired t -test. H-Hilus.

Article Snippet: In vitro electroporation of dissociated cells with validated shRNA-A 2A R and a non-targeting control (shRNA-Control) encoding EGFP ( ; see Supplementary Figs. , ) was performed using Ingenio Electroporation kit (Mirus Biotech®; Cat#MIR 50118) and Nucleofector® IIb device (Amaxa Biosystems) as previously described .

Techniques: shRNA, Injection, Saline, Immunohistochemistry, Marker, Infection, Staining

Journal: Scientific Reports

Article Title: Adenosine A 2A receptors control synaptic remodeling in the adult brain

doi: 10.1038/s41598-022-18884-4

Figure Lengend Snippet: Impact of the pharmacological blockade of A 2A Rs in status epilepticus-induced cell proliferation and migration of adult-born neurons. ( a ) Six/seven weeks old rats were injected either with saline (Control group) or with pilocarpine (Status Epilepticus group), 30 min after the administration of scopolamine methylbromide (2 mg/kg, i.p. ). Only animals reaching at least stage 4 seizures were considered. Convulsions were suppressed with diazepam (10 mg/kg, i.p. ) 2 h after the occurrence of the first stage 4 seizure. The rats from each group were assigned into two subgroups: one subgroup was daily injected with the selective antagonist of A 2A R, SCH58261 (0.1 mg/kg i.p. ), and the other with vehicle (0.2% Tween-20 in saline), starting 10 h after the onset of status epilepticus. All the animals were i.p. injected with BrdU at 24 h (200 mg/kg), 7 days (200 mg/kg) and 8 days (100 mg/kg) after status epilepticus. BrdU + -cells in the granule cell layer (GCL) per dentate gyrus (DG) was evaluated at 42 days post-status epilepticus by ( b ) immunohistochemical analysis of BrdU (green), NeuN (magenta) and GFAP (cyan). Scale bar, 300 μm. ( c ) Status epilepticus induced a significant increase in BrdU + -cells in the GCL per DG in vehicle-injected rats. SCH58261 significantly modified status epilepticus-induced increase in BrdU + -cells density (* P < 0.05 status epilepticus x SCH58261 interaction; two-way ANOVA). Post-hoc analysis revealed that status epilepticus did not significantly increase BrdU + -cells density in rats administered with SCH58261, but also there was no significant difference between status epilepticus-vehicle and status epilepticus-SCH58261. ( d ) Vehicle-injected rats that experienced status epilepticus displayed a higher relative percentage of BrdU + -cells in the outer two-thirds of the GCL in comparison with the Control group. No interaction was found between SCH58261 and status epilepticus factors (two-way ANOVA). The data are mean ± SEM of the number of the BrdU + -cells in GCL or the relative percentage of cells in the inner (1/3) and in the outer (2/3) parts of GCL. Control-Vehicle, n = 7; Control-SCH58261, n = 4; Status Epilepticus-Vehicle, n = 12; Status Epilepticus-SCH58261, n = 6. ML—molecular layer; GCL—granule cell layer; SGZ—subgranular zone. * P < 0.05, ** P < 0.01 and *** P < 0.001, two-way ANOVA with Sidak’s test.

Article Snippet: In vitro electroporation of dissociated cells with validated shRNA-A 2A R and a non-targeting control (shRNA-Control) encoding EGFP ( ; see Supplementary Figs. , ) was performed using Ingenio Electroporation kit (Mirus Biotech®; Cat#MIR 50118) and Nucleofector® IIb device (Amaxa Biosystems) as previously described .

Techniques: Migration, Injection, Saline, Immunohistochemistry, Modification, Comparison

Journal: Molecular Therapy. Methods & Clinical Development

Article Title: Targeted knockdown of the adenosine A 2A receptor by lipid NPs rescues the chemotaxis of head and neck cancer memory T cells

doi: 10.1016/j.omtm.2021.03.001

Figure Lengend Snippet: ADORA2A siRNAs decrease ADORA2A mRNA and A 2A R protein expression (A) Representation of the structure of the lipid NPs labeled with fluorescent streptavidin and biotinylated targeting antibody and loaded with siRNAs. PE: phosphoethanolamine; PEG: polyethylene glycol (B) Relative quantity (RQ) of ADORA2A mRNA expression in activated HD CD3 + or CD8 + T cells 24 h post-transfection with 10 nM scr or ADORA2A siRNAs (n = 5; 3 CD3 + T cell samples, 2 CD8 + T cell samples). GAPDH (Glyceraldehyde 3-phosphate dehydrogenase) was used as the reference gene. Data are shown as mean ± standard deviation and significance is determined by a paired Student’s t test. (C) (Left) Fold change of normalized A 2A R protein expression in activated HD CD3 + or CD8 + T cells 24 h (n = 5; 3 CD3 + T cell samples, 2 CD8 + T cell samples), 48 h (n = 5; 3 CD3 + T cell samples, 2 CD8 + T cell samples), or 72 h (n = 4; 2 CD3 + T cell samples, 2 CD8 + T cell samples) post-transfection with 10 nM ADORA2A siRNAs as compared to scr-RNAs. (Right) The normalized MFI of A 2A R expression showing the highest degree of A 2A R protein knockdown post-transfection with 10 nM ADORA2A siRNAs as compared to corresponding scr-RNAs for each individual sample regardless of time point at which knockdown occurred. Data are shown as mean ± standard error of the mean (n = 5). Data are compared using a paired Student’s t test. (D) Flow cytometry gating strategy for determining A 2A R expression in transfected cells. The cells were first gated on T lymphocytes and then on GFP fluorescence (indicating that the cells were successfully transfected with siRNAs) to determine A 2A R expression. The unstained sample is indicated in orange in the histogram while the A 2A R expression of cells treated with scr-RNAs is indicated in blue and the A 2A R expression of cells treated with ADORA2A siRNAs is indicated in red. (E) Representative histogram showing A 2A R antibody specificity where CD3 + T cells were stained with A 2A R antibody ± peptide followed by secondary antibody. Unstained cells are indicated in gray, A 2A R antibody + peptide is indicated in red and A 2A R antibody alone is indicated in blue. Shown here is a representative experiment from two identical experiments performed in HDs.

Article Snippet: A 2A R expression post-transfection is as follows: activated HD CD3 + or CD8 + T cells transfected with scr or A 2A R siRNAs were fixed with 1%–4% paraformaldehyde (Affymetrix, Thermo Fisher Scientific), permeablized with BD Perm/Wash buffer (Fixation/Permeabilization Solution kit; BD Cytofix/Cytoperm Plus, BD Biosciences) and then stained with anti-human anti-adenosine A 2A R rabbit polyclonal antibody (Alomone labs) in BD Perm/Wash buffer followed by staining with a secondary anti-rabbit antibody—either Alexa Fluor-647 conjugated donkey anti-rabbit antibody (Thermo Fisher) or Brilliant Violet 421 conjugated donkey anti-rabbit antibody (BioLegend).

Techniques: Expressing, Labeling, Transfection, Standard Deviation, Flow Cytometry, Fluorescence, Staining

Journal: Molecular Therapy. Methods & Clinical Development

Article Title: Targeted knockdown of the adenosine A 2A receptor by lipid NPs rescues the chemotaxis of head and neck cancer memory T cells

doi: 10.1016/j.omtm.2021.03.001

Figure Lengend Snippet: CD45RO(A 2A R)-NPs rescue the chemotactic ability of HNSCC CD8 + memory T cells in the presence of adenosine (A and B) Representative two point trajectories of T cells migrating along the CXCL10 gradient (green) or CXCL10 + adenosine (ADO) gradient (blue) in HNSCC CD8 + memory T cells treated with (A) CD45RO(scr)-NPs or (B) CD45RO(A 2A R)-NPs. Trajectories artificially set to start at the origin with the red triangle representing the Y-COM. (C) Y-COM of HNSCC CD8 + memory T cells treated with (left) CD45RO(scr)-NPs (n = 6) or (right) CD45RO(A 2A R)-NPs (n = 6) in the presence of CXCL10 or CXCL10 + adenosine. Significance was determined using (left) a Wilcoxon signed rank test or (right) paired Student’s t test. (D) Percent inhibition of Y-COM of HNSCC CD8 + memory T cells in the presence of CXCL10 + adenosine compared to CXCL10 alone when treated with CD45RO(scr)-NPs (n = 6) compared to CD45RO(A 2A R)-NPs (n = 6). Data are represented single dot plots (colored dots; wherein each dot represents a single donor) and as mean ± standard deviation (shown in black). Significance was determined using Student’s t test.

Article Snippet: A 2A R expression post-transfection is as follows: activated HD CD3 + or CD8 + T cells transfected with scr or A 2A R siRNAs were fixed with 1%–4% paraformaldehyde (Affymetrix, Thermo Fisher Scientific), permeablized with BD Perm/Wash buffer (Fixation/Permeabilization Solution kit; BD Cytofix/Cytoperm Plus, BD Biosciences) and then stained with anti-human anti-adenosine A 2A R rabbit polyclonal antibody (Alomone labs) in BD Perm/Wash buffer followed by staining with a secondary anti-rabbit antibody—either Alexa Fluor-647 conjugated donkey anti-rabbit antibody (Thermo Fisher) or Brilliant Violet 421 conjugated donkey anti-rabbit antibody (BioLegend).

Techniques: Inhibition, Standard Deviation

Journal: Nature Communications

Article Title: Regulation of endothelial intracellular adenosine via adenosine kinase epigenetically modulates vascular inflammation

doi: 10.1038/s41467-017-00986-7

Figure Lengend Snippet: Adenosine-induced suppression of endothelial inflammation requires adenosine uptake. a Western blot detection and densitometric quantification of adhesion molecule expression in HUVECs. HUVECs, pretreated for 30 min with both 5 µM ZM 241385 and 5 µM MRS 1754 were incubated with 100 µM adenosine for 30 min and then stimulated with TNF-α at 10 ng/ml for 4 h ( n = 4). b Western blot detection and densitometric quantification of adhesion molecule expression in HUVECs. HUVECs, transiently transfected with control or A 2A R siRNA, were pretreated for 30 min with 100 µM adenosine and then stimulated with 10 ng/ml TNF-α for 4 h ( n = 4). c Western blot detection and densitometric quantification of adhesion molecule expression in HUVECs. HUVECs, transiently transfected with control or A 2B R siRNA, were pretreated for 30 min with 100 µM adenosine and then stimulated with 10 ng/ml TNF-α for 4 h ( n = 4). d Quantification of intracellular adenosine by HPLC in adenosine (100 µM for 1 h)-treated HUVECs and in adenosine (100 µM for 1 h)-treated HUVECs preincubated with NBMPR at 10 µM for 30 min ( n = 4). e Real-time-PCR (RT-PCR) analysis of mRNA levels of adhesion molecules in HUVECs. HUVECs, pretreated for 30 min with 10 µM NBMPR, were incubated with 100 µM adenosine for 30 min and then stimulated with TNF-α at 10 ng/ml for 2 h ( n = 3). f Western blot detection and densitometric quantification of adhesion molecule expression in HUVECs. HUVECs, pretreated for 30 min with 10 µM NBMPR, were incubated with 100 µM adenosine for 30 min and then stimulated with TNF-α at 10 ng/ml for 4 h ( n = 4). All images are representative. For all bar graphs , data are the mean ± SEM, * P < 0.05 and ** P < 0.01 (one-way ANOVA with Tukey’s post hoc test)

Article Snippet: The A 2A R (sc-39850), A 2B R (sc-29642), WDR5 (sc-61798) and the control (sc-37007) siRNAs were purchased from Santa Cruz Biotechnology (Dallas, Texas, USA).

Techniques: Western Blot, Expressing, Incubation, Transfection, Real-time Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction

Journal: Nature Communications

Article Title: Regulation of endothelial intracellular adenosine via adenosine kinase epigenetically modulates vascular inflammation

doi: 10.1038/s41467-017-00986-7

Figure Lengend Snippet: Intracellular adenosine decreases the methylation level of H3K4. a Western blot detection of adhesion molecules and H3K4 methylation in TNF-α (10 ng/ml for 4 h)-treated ADK KD or Ctrl HUVECs pretreated with 2 mM MTA for 30 min ( n = 4). b Western blot detection of methylation levels of H3K4, H3K9, and H3K27 in TNF-α (10 ng/ml for 12 h)-treated HUVECs pretreated with 100 µM adenosine for 30 min ( n = 5). c ChIP assay showing H3K4 methylation on promoters of adhesion molecules in TNF-α (10 ng/ml for 4 h)-treated ADK KD or Ctrl HUVECs ( n = 3). d Western blot detection of H3K4me2 in HUVEC whole-protein lysate supplemented with 1 mg/ml SAM or SAM together with 10 µM adenosine for 60 min ( n = 4). e Western blot detection of adhesion molecules and H3K4 methylation in TNF-α (10 ng/ml for 4 h)-treated ADK KD or Ctrl HUVECs transiently transfected with control or WDR5 siRNA ( n = 3). f Immunofluorescent ( IF ) staining of H3K4me2 on aortic endothelium (areas indicated with CD31 staining, red ) from TNF-α-treated ADK WT and ADK VEC-KO mice. L indicates luminal area of aorta ( scale bar , 100 µm). g Quantification of H3K4me2 on aortic endothelium from TNF-α-treated ADK WT and ADK VEC-KO mice ( n = 5 mice per group). h Western blot detection and densitometric quantification of H3K4 methylation in TNF-α (10 ng/ml for 4 h)-treated MAECs isolated from ADK WT and ADK VEC-KO mice ( n = 4). i Western blot detection of H3K4 methylation in HUVECs. HUVECs, pretreated for 30 min with 10 µM NBMPR, were incubated with 100 µM adenosine for 30 min and then stimulated with TNF-α at 10 ng/ml for 4 h ( n = 3). j Western blot detection of H3K4 methylation in TNF-α (10 ng/ml for 4 h)-treated A 2A R KD or Ctrl HUVECs pretreated with 100 µM adenosine for 30 min ( n = 4). k Western blot detection of H3K4 methylation in TNF-α (10 ng/ml for 4 h)-treated ADK KD or Ctrl HUVECs transiently transfected with control or A 2A R siRNA ( n = 4). For all bar graphs , data are the mean ± SEM, * P < 0.05 and ** P < 0.01 (unpaired, two-tailed Student’s t -test)

Article Snippet: The A 2A R (sc-39850), A 2B R (sc-29642), WDR5 (sc-61798) and the control (sc-37007) siRNAs were purchased from Santa Cruz Biotechnology (Dallas, Texas, USA).

Techniques: Methylation, Western Blot, Transfection, Staining, Isolation, Incubation, Two Tailed Test