Review





Similar Products

95
Chem Impex International camphorquinone cq
Camphorquinone Cq, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/camphorquinone cq/product/Chem Impex International
Average 95 stars, based on 1 article reviews
camphorquinone cq - by Bioz Stars, 2026-05
95/100 stars
  Buy from Supplier

94
Santa Cruz Biotechnology lentiviral particles
Lentiviral Particles, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lentiviral particles/product/Santa Cruz Biotechnology
Average 94 stars, based on 1 article reviews
lentiviral particles - by Bioz Stars, 2026-05
94/100 stars
  Buy from Supplier

94
Santa Cruz Biotechnology smarca4 shrna
<t>SMARCA4</t> Modulates Mesenchymal Stromal Cell-Mediated Glioblastoma Progression. (A) Volcano plots illustrating differentially expressed genes (DEGs) in mesenchymal stromal cells (MSCs) derived from IDH-wildtype and IDH-mutant glioblastoma (GBM) tissues compared to MSCs from healthy donors (HD). Upregulated genes are shown in red, and downregulated genes are shown in blue. (B) Heatmap displaying the expression of mitochondria-related genes across HD-MSCs, IDH-wildtype GBM-MSCs, and IDH-mutant GBM-MSCs. (C) UMAP clustering of MSCs from HD, IDH-wildtype GBM, and IDH-mutant GBM samples. (D) Expression of SMARCA4 and associated chromatin remodeling genes (*p < 0.05, **p < 0.01). (E) Schematic representation of SMARCA4 knockdown in HD-MSCs using shRNA and subsequent co-culture experiments with glioblastoma cells. (F) Quantification of CFU formation in glioblastoma cells co-cultured with HD-MSCs or SMARCA4-KD MSCs (***p < 0.001). (G) Cell count analysis showing the number of glioblastoma cells (U87 IDH-wildtype and U87 IDH-mutant) following co-culture with MSCs (**p < 0.01, ***p < 0.001). (H) Proliferation index quantification, demonstrating that SMARCA4 knockdown in MSCs promotes glioblastoma cell proliferation in both IDH-wildtype and IDH-mutant contexts (**p < 0.01, ***p < 0.001).
Smarca4 Shrna, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/smarca4 shrna/product/Santa Cruz Biotechnology
Average 94 stars, based on 1 article reviews
smarca4 shrna - by Bioz Stars, 2026-05
94/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology sirna products
<t>SMARCA4</t> Modulates Mesenchymal Stromal Cell-Mediated Glioblastoma Progression. (A) Volcano plots illustrating differentially expressed genes (DEGs) in mesenchymal stromal cells (MSCs) derived from IDH-wildtype and IDH-mutant glioblastoma (GBM) tissues compared to MSCs from healthy donors (HD). Upregulated genes are shown in red, and downregulated genes are shown in blue. (B) Heatmap displaying the expression of mitochondria-related genes across HD-MSCs, IDH-wildtype GBM-MSCs, and IDH-mutant GBM-MSCs. (C) UMAP clustering of MSCs from HD, IDH-wildtype GBM, and IDH-mutant GBM samples. (D) Expression of SMARCA4 and associated chromatin remodeling genes (*p < 0.05, **p < 0.01). (E) Schematic representation of SMARCA4 knockdown in HD-MSCs using shRNA and subsequent co-culture experiments with glioblastoma cells. (F) Quantification of CFU formation in glioblastoma cells co-cultured with HD-MSCs or SMARCA4-KD MSCs (***p < 0.001). (G) Cell count analysis showing the number of glioblastoma cells (U87 IDH-wildtype and U87 IDH-mutant) following co-culture with MSCs (**p < 0.01, ***p < 0.001). (H) Proliferation index quantification, demonstrating that SMARCA4 knockdown in MSCs promotes glioblastoma cell proliferation in both IDH-wildtype and IDH-mutant contexts (**p < 0.01, ***p < 0.001).
Sirna Products, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sirna products/product/Santa Cruz Biotechnology
Average 93 stars, based on 1 article reviews
sirna products - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology sc 44287
<t>SMARCA4</t> Modulates Mesenchymal Stromal Cell-Mediated Glioblastoma Progression. (A) Volcano plots illustrating differentially expressed genes (DEGs) in mesenchymal stromal cells (MSCs) derived from IDH-wildtype and IDH-mutant glioblastoma (GBM) tissues compared to MSCs from healthy donors (HD). Upregulated genes are shown in red, and downregulated genes are shown in blue. (B) Heatmap displaying the expression of mitochondria-related genes across HD-MSCs, IDH-wildtype GBM-MSCs, and IDH-mutant GBM-MSCs. (C) UMAP clustering of MSCs from HD, IDH-wildtype GBM, and IDH-mutant GBM samples. (D) Expression of SMARCA4 and associated chromatin remodeling genes (*p < 0.05, **p < 0.01). (E) Schematic representation of SMARCA4 knockdown in HD-MSCs using shRNA and subsequent co-culture experiments with glioblastoma cells. (F) Quantification of CFU formation in glioblastoma cells co-cultured with HD-MSCs or SMARCA4-KD MSCs (***p < 0.001). (G) Cell count analysis showing the number of glioblastoma cells (U87 IDH-wildtype and U87 IDH-mutant) following co-culture with MSCs (**p < 0.01, ***p < 0.001). (H) Proliferation index quantification, demonstrating that SMARCA4 knockdown in MSCs promotes glioblastoma cell proliferation in both IDH-wildtype and IDH-mutant contexts (**p < 0.01, ***p < 0.001).
Sc 44287, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sc 44287/product/Santa Cruz Biotechnology
Average 93 stars, based on 1 article reviews
sc 44287 - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology brg1 knockdown
<t>SMARCA4</t> Modulates Mesenchymal Stromal Cell-Mediated Glioblastoma Progression. (A) Volcano plots illustrating differentially expressed genes (DEGs) in mesenchymal stromal cells (MSCs) derived from IDH-wildtype and IDH-mutant glioblastoma (GBM) tissues compared to MSCs from healthy donors (HD). Upregulated genes are shown in red, and downregulated genes are shown in blue. (B) Heatmap displaying the expression of mitochondria-related genes across HD-MSCs, IDH-wildtype GBM-MSCs, and IDH-mutant GBM-MSCs. (C) UMAP clustering of MSCs from HD, IDH-wildtype GBM, and IDH-mutant GBM samples. (D) Expression of SMARCA4 and associated chromatin remodeling genes (*p < 0.05, **p < 0.01). (E) Schematic representation of SMARCA4 knockdown in HD-MSCs using shRNA and subsequent co-culture experiments with glioblastoma cells. (F) Quantification of CFU formation in glioblastoma cells co-cultured with HD-MSCs or SMARCA4-KD MSCs (***p < 0.001). (G) Cell count analysis showing the number of glioblastoma cells (U87 IDH-wildtype and U87 IDH-mutant) following co-culture with MSCs (**p < 0.01, ***p < 0.001). (H) Proliferation index quantification, demonstrating that SMARCA4 knockdown in MSCs promotes glioblastoma cell proliferation in both IDH-wildtype and IDH-mutant contexts (**p < 0.01, ***p < 0.001).
Brg1 Knockdown, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/brg1 knockdown/product/Santa Cruz Biotechnology
Average 93 stars, based on 1 article reviews
brg1 knockdown - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology sirnas
<t>SMARCA4</t> Modulates Mesenchymal Stromal Cell-Mediated Glioblastoma Progression. (A) Volcano plots illustrating differentially expressed genes (DEGs) in mesenchymal stromal cells (MSCs) derived from IDH-wildtype and IDH-mutant glioblastoma (GBM) tissues compared to MSCs from healthy donors (HD). Upregulated genes are shown in red, and downregulated genes are shown in blue. (B) Heatmap displaying the expression of mitochondria-related genes across HD-MSCs, IDH-wildtype GBM-MSCs, and IDH-mutant GBM-MSCs. (C) UMAP clustering of MSCs from HD, IDH-wildtype GBM, and IDH-mutant GBM samples. (D) Expression of SMARCA4 and associated chromatin remodeling genes (*p < 0.05, **p < 0.01). (E) Schematic representation of SMARCA4 knockdown in HD-MSCs using shRNA and subsequent co-culture experiments with glioblastoma cells. (F) Quantification of CFU formation in glioblastoma cells co-cultured with HD-MSCs or SMARCA4-KD MSCs (***p < 0.001). (G) Cell count analysis showing the number of glioblastoma cells (U87 IDH-wildtype and U87 IDH-mutant) following co-culture with MSCs (**p < 0.01, ***p < 0.001). (H) Proliferation index quantification, demonstrating that SMARCA4 knockdown in MSCs promotes glioblastoma cell proliferation in both IDH-wildtype and IDH-mutant contexts (**p < 0.01, ***p < 0.001).
Sirnas, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sirnas/product/Santa Cruz Biotechnology
Average 93 stars, based on 1 article reviews
sirnas - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology arid1a gcccugaacaauaaccuca ugagguuauuguucagggc brm guccuggaccuccaagugucu agacacuuggagguccaggac brg1 santa cruz biotechnology
<t>SMARCA4</t> Modulates Mesenchymal Stromal Cell-Mediated Glioblastoma Progression. (A) Volcano plots illustrating differentially expressed genes (DEGs) in mesenchymal stromal cells (MSCs) derived from IDH-wildtype and IDH-mutant glioblastoma (GBM) tissues compared to MSCs from healthy donors (HD). Upregulated genes are shown in red, and downregulated genes are shown in blue. (B) Heatmap displaying the expression of mitochondria-related genes across HD-MSCs, IDH-wildtype GBM-MSCs, and IDH-mutant GBM-MSCs. (C) UMAP clustering of MSCs from HD, IDH-wildtype GBM, and IDH-mutant GBM samples. (D) Expression of SMARCA4 and associated chromatin remodeling genes (*p < 0.05, **p < 0.01). (E) Schematic representation of SMARCA4 knockdown in HD-MSCs using shRNA and subsequent co-culture experiments with glioblastoma cells. (F) Quantification of CFU formation in glioblastoma cells co-cultured with HD-MSCs or SMARCA4-KD MSCs (***p < 0.001). (G) Cell count analysis showing the number of glioblastoma cells (U87 IDH-wildtype and U87 IDH-mutant) following co-culture with MSCs (**p < 0.01, ***p < 0.001). (H) Proliferation index quantification, demonstrating that SMARCA4 knockdown in MSCs promotes glioblastoma cell proliferation in both IDH-wildtype and IDH-mutant contexts (**p < 0.01, ***p < 0.001).
Arid1a Gcccugaacaauaaccuca Ugagguuauuguucagggc Brm Guccuggaccuccaagugucu Agacacuuggagguccaggac Brg1 Santa Cruz Biotechnology, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/arid1a gcccugaacaauaaccuca ugagguuauuguucagggc brm guccuggaccuccaagugucu agacacuuggagguccaggac brg1 santa cruz biotechnology/product/Santa Cruz Biotechnology
Average 93 stars, based on 1 article reviews
arid1a gcccugaacaauaaccuca ugagguuauuguucagggc brm guccuggaccuccaagugucu agacacuuggagguccaggac brg1 santa cruz biotechnology - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

Image Search Results


SMARCA4 Modulates Mesenchymal Stromal Cell-Mediated Glioblastoma Progression. (A) Volcano plots illustrating differentially expressed genes (DEGs) in mesenchymal stromal cells (MSCs) derived from IDH-wildtype and IDH-mutant glioblastoma (GBM) tissues compared to MSCs from healthy donors (HD). Upregulated genes are shown in red, and downregulated genes are shown in blue. (B) Heatmap displaying the expression of mitochondria-related genes across HD-MSCs, IDH-wildtype GBM-MSCs, and IDH-mutant GBM-MSCs. (C) UMAP clustering of MSCs from HD, IDH-wildtype GBM, and IDH-mutant GBM samples. (D) Expression of SMARCA4 and associated chromatin remodeling genes (*p < 0.05, **p < 0.01). (E) Schematic representation of SMARCA4 knockdown in HD-MSCs using shRNA and subsequent co-culture experiments with glioblastoma cells. (F) Quantification of CFU formation in glioblastoma cells co-cultured with HD-MSCs or SMARCA4-KD MSCs (***p < 0.001). (G) Cell count analysis showing the number of glioblastoma cells (U87 IDH-wildtype and U87 IDH-mutant) following co-culture with MSCs (**p < 0.01, ***p < 0.001). (H) Proliferation index quantification, demonstrating that SMARCA4 knockdown in MSCs promotes glioblastoma cell proliferation in both IDH-wildtype and IDH-mutant contexts (**p < 0.01, ***p < 0.001).

Journal: Neoplasia (New York, N.Y.)

Article Title: SMARCA4 deficiency in glioblastoma: Mitochondrial transfer from MSCs and the clinical dilemma in targeting the tumor microenvironment

doi: 10.1016/j.neo.2026.101288

Figure Lengend Snippet: SMARCA4 Modulates Mesenchymal Stromal Cell-Mediated Glioblastoma Progression. (A) Volcano plots illustrating differentially expressed genes (DEGs) in mesenchymal stromal cells (MSCs) derived from IDH-wildtype and IDH-mutant glioblastoma (GBM) tissues compared to MSCs from healthy donors (HD). Upregulated genes are shown in red, and downregulated genes are shown in blue. (B) Heatmap displaying the expression of mitochondria-related genes across HD-MSCs, IDH-wildtype GBM-MSCs, and IDH-mutant GBM-MSCs. (C) UMAP clustering of MSCs from HD, IDH-wildtype GBM, and IDH-mutant GBM samples. (D) Expression of SMARCA4 and associated chromatin remodeling genes (*p < 0.05, **p < 0.01). (E) Schematic representation of SMARCA4 knockdown in HD-MSCs using shRNA and subsequent co-culture experiments with glioblastoma cells. (F) Quantification of CFU formation in glioblastoma cells co-cultured with HD-MSCs or SMARCA4-KD MSCs (***p < 0.001). (G) Cell count analysis showing the number of glioblastoma cells (U87 IDH-wildtype and U87 IDH-mutant) following co-culture with MSCs (**p < 0.01, ***p < 0.001). (H) Proliferation index quantification, demonstrating that SMARCA4 knockdown in MSCs promotes glioblastoma cell proliferation in both IDH-wildtype and IDH-mutant contexts (**p < 0.01, ***p < 0.001).

Article Snippet: Human MSCs were transduced with lentiviral particles carrying either SMARCA4 shRNA (sc-29827-V, Santa Cruz) or scrambled control shRNA (sc-108080, Santa Cruz).

Techniques: Derivative Assay, Mutagenesis, Expressing, Knockdown, shRNA, Co-Culture Assay, Cell Culture, Cell Characterization

SMARCA4 KD MSCs Facilitate Glioblastoma Progression by Enhancing Mitochondrial Transfer. (A) Heatmap showing differentially expressed genes (DEGs) between healthy donor (HD) and SMARCA4 knockdown (KD) MSCs. (B) Gene set enrichment analysis (GSEA) showing significant enrichment of metabolic pathways, including mitochondrial respiration, oxidative phosphorylation, gluconeogenesis, and nucleotide metabolism, in SMARCA4 KD MSCs compared to healthy donor (HD) MSCs. (C) Seahorse extracellular flux analysis measuring oxygen consumption rates (OCR) in WT and SMARCA4 KD MSCs (n = 3; *p<0.05, two-way ANOVA). Data are presented as mean ± SD. (D) Representative plot illustrating ROS levels measured by flow cytometry using DCFDA in WT and SMARCA4 KD MSCs. (E) Quantification of ROS levels from flow cytometry data. Data are normalized to the mean ROS level of WT MSCs (n = 3; ***p < 0.001, Student's t-test). Each dot represents an individual replicate. (F-G) Representative flow cytometry plots showing mitochondrial transfer (MitoTracker+ Hoechst+) from WT or KD MSCs to recipient IDH-wildtype (F) and IDH-mutant (G) GBM cells at 0h and 36h. (H–I) Quantification of mitochondrial transfer rates. SMARCA4 KD MSCs show a significantly higher percentage of mitochondrial acquisition in both IDH-wildtype (H) and IDH-mutant (I) models at the 36h plateau period compared to HD MSCs (n = 5; ***p < 0.001). Data are presented as mean ± SD.

Journal: Neoplasia (New York, N.Y.)

Article Title: SMARCA4 deficiency in glioblastoma: Mitochondrial transfer from MSCs and the clinical dilemma in targeting the tumor microenvironment

doi: 10.1016/j.neo.2026.101288

Figure Lengend Snippet: SMARCA4 KD MSCs Facilitate Glioblastoma Progression by Enhancing Mitochondrial Transfer. (A) Heatmap showing differentially expressed genes (DEGs) between healthy donor (HD) and SMARCA4 knockdown (KD) MSCs. (B) Gene set enrichment analysis (GSEA) showing significant enrichment of metabolic pathways, including mitochondrial respiration, oxidative phosphorylation, gluconeogenesis, and nucleotide metabolism, in SMARCA4 KD MSCs compared to healthy donor (HD) MSCs. (C) Seahorse extracellular flux analysis measuring oxygen consumption rates (OCR) in WT and SMARCA4 KD MSCs (n = 3; *p<0.05, two-way ANOVA). Data are presented as mean ± SD. (D) Representative plot illustrating ROS levels measured by flow cytometry using DCFDA in WT and SMARCA4 KD MSCs. (E) Quantification of ROS levels from flow cytometry data. Data are normalized to the mean ROS level of WT MSCs (n = 3; ***p < 0.001, Student's t-test). Each dot represents an individual replicate. (F-G) Representative flow cytometry plots showing mitochondrial transfer (MitoTracker+ Hoechst+) from WT or KD MSCs to recipient IDH-wildtype (F) and IDH-mutant (G) GBM cells at 0h and 36h. (H–I) Quantification of mitochondrial transfer rates. SMARCA4 KD MSCs show a significantly higher percentage of mitochondrial acquisition in both IDH-wildtype (H) and IDH-mutant (I) models at the 36h plateau period compared to HD MSCs (n = 5; ***p < 0.001). Data are presented as mean ± SD.

Article Snippet: Human MSCs were transduced with lentiviral particles carrying either SMARCA4 shRNA (sc-29827-V, Santa Cruz) or scrambled control shRNA (sc-108080, Santa Cruz).

Techniques: Knockdown, Phospho-proteomics, Flow Cytometry, Mutagenesis

Persistence of Mitochondrial Transfer-Induced Proliferative Advantage in Glioblastoma Cells. (A) Cell viability analysis by CCK-8 assay showing that GBM cells co-cultured with SMARCA4 KD MSCs exhibit significantly higher normalized cell viability compared to those co-cultured with HD MSCs. Data are presented as mean ± SD (n = 4; *p < 0.05, Student's t-test). (B) Colony formation assay showing a significant increase in colony formation by GBM cells co-cultured with SMARCA4 KD MSCs compared to those co-cultured with HD MSCs. Data are presented as mean ± SD (n = 3; **p < 0.01, ***p < 0.001, Student's t-test). (C) Representative images of colony formation assays from GBM cells exposed to mitochondria from HD and SMARCA4 KD MSCs. (D) Wound healing assay measuring tumor cell migration at 0, 24, 48, and 72 h post-co-culture with HD or SMARCA4 KD MSCs (n = 4; *p < 0.05, **p < 0.01, Student's t-test). (E) MitoTracker staining of GBM cells at 12 and 36 h after mitochondrial transfer from HD or SMARCA4 KD MSCs. No significant differences in microtubule integrity (α-tubulin staining) were observed between groups, indicating that mitochondrial transfer does not alter microtubule structure (n = 4; *p < 0.05, **p < 0.01, Student's t-test). Scale bar: 150 µm.

Journal: Neoplasia (New York, N.Y.)

Article Title: SMARCA4 deficiency in glioblastoma: Mitochondrial transfer from MSCs and the clinical dilemma in targeting the tumor microenvironment

doi: 10.1016/j.neo.2026.101288

Figure Lengend Snippet: Persistence of Mitochondrial Transfer-Induced Proliferative Advantage in Glioblastoma Cells. (A) Cell viability analysis by CCK-8 assay showing that GBM cells co-cultured with SMARCA4 KD MSCs exhibit significantly higher normalized cell viability compared to those co-cultured with HD MSCs. Data are presented as mean ± SD (n = 4; *p < 0.05, Student's t-test). (B) Colony formation assay showing a significant increase in colony formation by GBM cells co-cultured with SMARCA4 KD MSCs compared to those co-cultured with HD MSCs. Data are presented as mean ± SD (n = 3; **p < 0.01, ***p < 0.001, Student's t-test). (C) Representative images of colony formation assays from GBM cells exposed to mitochondria from HD and SMARCA4 KD MSCs. (D) Wound healing assay measuring tumor cell migration at 0, 24, 48, and 72 h post-co-culture with HD or SMARCA4 KD MSCs (n = 4; *p < 0.05, **p < 0.01, Student's t-test). (E) MitoTracker staining of GBM cells at 12 and 36 h after mitochondrial transfer from HD or SMARCA4 KD MSCs. No significant differences in microtubule integrity (α-tubulin staining) were observed between groups, indicating that mitochondrial transfer does not alter microtubule structure (n = 4; *p < 0.05, **p < 0.01, Student's t-test). Scale bar: 150 µm.

Article Snippet: Human MSCs were transduced with lentiviral particles carrying either SMARCA4 shRNA (sc-29827-V, Santa Cruz) or scrambled control shRNA (sc-108080, Santa Cruz).

Techniques: CCK-8 Assay, Cell Culture, Colony Assay, Wound Healing Assay, Migration, Co-Culture Assay, Staining

SMARCA4 Modulates Mitochondrial Transfer in MSCs Through the ROCK1/2 Signaling Axis. (A) Bar graph showing the normalized mitochondrial transfer rate in MSCs treated with various inhibitors (n = 6; **p < 0.01, ***p < 0.001, one-way ANOVA). (B) Seahorse XF Cell Mito Stress Test measuring oxygen consumption rate (OCR) in MSCs treated with Y27632, a ROCK inhibitor (n = 6; *p < 0.05, two-way ANOVA). (C) Western blot analysis confirming SMARCA4 knockdown in MSCs using antisense shRNA. (D) Western blot analysis of MSCs with SMARCA4 overexpression. (E) Flow cytometric and quantitative analysis of mitochondrial transfer from donor MSCs to recipient U87 cells following overnight MitoTracker washing protocols. Representative histograms show mitochondrial positivity in U87 cells co-cultured system. Data represent mean ± SD (n = 5; *p < 0.05, ****p < 0.0001 by one-way ANOVA). (F) Representative confocal images of U87 cells co-cultured with SMARCA4-KD MSCs. Cells were stained for DNA (blue), mitochondria (green), and tubulin (red). Yellow arrows in enlarged panel indicate transferred MitoTracker-positive mitochondria co-localized with tubulin structures in recipient cells, confirming genuine mitochondrial transfer rather than dye diffusion. Scale bar = 50 μm. Images representative of three independent experiments.

Journal: Neoplasia (New York, N.Y.)

Article Title: SMARCA4 deficiency in glioblastoma: Mitochondrial transfer from MSCs and the clinical dilemma in targeting the tumor microenvironment

doi: 10.1016/j.neo.2026.101288

Figure Lengend Snippet: SMARCA4 Modulates Mitochondrial Transfer in MSCs Through the ROCK1/2 Signaling Axis. (A) Bar graph showing the normalized mitochondrial transfer rate in MSCs treated with various inhibitors (n = 6; **p < 0.01, ***p < 0.001, one-way ANOVA). (B) Seahorse XF Cell Mito Stress Test measuring oxygen consumption rate (OCR) in MSCs treated with Y27632, a ROCK inhibitor (n = 6; *p < 0.05, two-way ANOVA). (C) Western blot analysis confirming SMARCA4 knockdown in MSCs using antisense shRNA. (D) Western blot analysis of MSCs with SMARCA4 overexpression. (E) Flow cytometric and quantitative analysis of mitochondrial transfer from donor MSCs to recipient U87 cells following overnight MitoTracker washing protocols. Representative histograms show mitochondrial positivity in U87 cells co-cultured system. Data represent mean ± SD (n = 5; *p < 0.05, ****p < 0.0001 by one-way ANOVA). (F) Representative confocal images of U87 cells co-cultured with SMARCA4-KD MSCs. Cells were stained for DNA (blue), mitochondria (green), and tubulin (red). Yellow arrows in enlarged panel indicate transferred MitoTracker-positive mitochondria co-localized with tubulin structures in recipient cells, confirming genuine mitochondrial transfer rather than dye diffusion. Scale bar = 50 μm. Images representative of three independent experiments.

Article Snippet: Human MSCs were transduced with lentiviral particles carrying either SMARCA4 shRNA (sc-29827-V, Santa Cruz) or scrambled control shRNA (sc-108080, Santa Cruz).

Techniques: Western Blot, Knockdown, shRNA, Over Expression, Cell Culture, Staining, Diffusion-based Assay

ROCK Inhibition Enhances GBM Cell Proliferation and Colony Formation. (A, B) Bar graphs quantifying the number of U87 cells (IDH-wildtype and IDH-mutant) after co-culture with HD-MSCs, SMARCA4-KD MSCs (n = 6; ***p < 0.001, Student's t-test). (C, D) Colony formation assays showing that ROCK inhibition enhances clonogenic capacity in GBM cells, mimicking the effects of SMARCA4 knockdown. This effect was observed in both IDH-wildtype and IDH-mutant GBM cells (n = 6; *p < 0.05, ***p < 0.001, Student's t-test). (E) Colony formation assays after negative sorting of GBM cells post-co-culture.

Journal: Neoplasia (New York, N.Y.)

Article Title: SMARCA4 deficiency in glioblastoma: Mitochondrial transfer from MSCs and the clinical dilemma in targeting the tumor microenvironment

doi: 10.1016/j.neo.2026.101288

Figure Lengend Snippet: ROCK Inhibition Enhances GBM Cell Proliferation and Colony Formation. (A, B) Bar graphs quantifying the number of U87 cells (IDH-wildtype and IDH-mutant) after co-culture with HD-MSCs, SMARCA4-KD MSCs (n = 6; ***p < 0.001, Student's t-test). (C, D) Colony formation assays showing that ROCK inhibition enhances clonogenic capacity in GBM cells, mimicking the effects of SMARCA4 knockdown. This effect was observed in both IDH-wildtype and IDH-mutant GBM cells (n = 6; *p < 0.05, ***p < 0.001, Student's t-test). (E) Colony formation assays after negative sorting of GBM cells post-co-culture.

Article Snippet: Human MSCs were transduced with lentiviral particles carrying either SMARCA4 shRNA (sc-29827-V, Santa Cruz) or scrambled control shRNA (sc-108080, Santa Cruz).

Techniques: Inhibition, Mutagenesis, Co-Culture Assay, Knockdown

SMARCA4 Inhibition in MSCs Promotes Glioblastoma Growth In Vivo . (A) Bioluminescence imaging (BLI) of intracranial glioblastoma xenografts in immunodeficient mice (n = 5 per group). (B) Quantification of total photon flux from BLI images. Mice co-injected with KD-MSCs show a significant increase in tumor burden, as indicated by the higher photon flux (n = 5 per group; **p < 0.01, Two-way Repeated Measures ANOVA analysis (Time × Group interaction). (C) Kaplan-Meier survival analysis showing significantly shorter survival times for mice in the KD-MSC group compared to the HD-MSC group (n = 7, p = 0.0201, log-rank test). (D) Flow cytometric quantification of Ki67⁺ human MSCs (CD44⁺CD105⁺) in brain tissue at Day 21 post-intracranial injection. No significant difference was observed between groups (n = 5 per group, p > 0.05, unpaired Student's t-test). (E) H&E staining of brain sections.

Journal: Neoplasia (New York, N.Y.)

Article Title: SMARCA4 deficiency in glioblastoma: Mitochondrial transfer from MSCs and the clinical dilemma in targeting the tumor microenvironment

doi: 10.1016/j.neo.2026.101288

Figure Lengend Snippet: SMARCA4 Inhibition in MSCs Promotes Glioblastoma Growth In Vivo . (A) Bioluminescence imaging (BLI) of intracranial glioblastoma xenografts in immunodeficient mice (n = 5 per group). (B) Quantification of total photon flux from BLI images. Mice co-injected with KD-MSCs show a significant increase in tumor burden, as indicated by the higher photon flux (n = 5 per group; **p < 0.01, Two-way Repeated Measures ANOVA analysis (Time × Group interaction). (C) Kaplan-Meier survival analysis showing significantly shorter survival times for mice in the KD-MSC group compared to the HD-MSC group (n = 7, p = 0.0201, log-rank test). (D) Flow cytometric quantification of Ki67⁺ human MSCs (CD44⁺CD105⁺) in brain tissue at Day 21 post-intracranial injection. No significant difference was observed between groups (n = 5 per group, p > 0.05, unpaired Student's t-test). (E) H&E staining of brain sections.

Article Snippet: Human MSCs were transduced with lentiviral particles carrying either SMARCA4 shRNA (sc-29827-V, Santa Cruz) or scrambled control shRNA (sc-108080, Santa Cruz).

Techniques: Inhibition, In Vivo, Imaging, Injection, Staining