pcr purification kit  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    MinElute PCR Purification Kit
    Description:
    For purification of up to 5 μg PCR products 70 bp to 4 kb in low elution volumes Kit contents Qiagen MinElute PCR Purification Kit 50 MinElute Spin Columns 5g Binding Capacity 10L Elution Volume Tube Format Silica Technology 70 bp to 4 kb Fragment Size Manual Processing DNA Sample Fast Procedure and Easy Handling High Reproducible Recoveries For Purification of up to 5μg PCR Products in Low Elution Volumes Includes 50 MinElute Spin Columns Buffers 2mL Collection Tubes Benefits Very small elution volumes Fast procedure and easy handling High reproducible recoveries Gel loading dye for convenient sample analysis
    Catalog Number:
    28004
    Price:
    134
    Category:
    MinElute PCR Purification Kit
    Buy from Supplier


    Structured Review

    Qiagen pcr purification kit
    MinElute PCR Purification Kit
    For purification of up to 5 μg PCR products 70 bp to 4 kb in low elution volumes Kit contents Qiagen MinElute PCR Purification Kit 50 MinElute Spin Columns 5g Binding Capacity 10L Elution Volume Tube Format Silica Technology 70 bp to 4 kb Fragment Size Manual Processing DNA Sample Fast Procedure and Easy Handling High Reproducible Recoveries For Purification of up to 5μg PCR Products in Low Elution Volumes Includes 50 MinElute Spin Columns Buffers 2mL Collection Tubes Benefits Very small elution volumes Fast procedure and easy handling High reproducible recoveries Gel loading dye for convenient sample analysis
    https://www.bioz.com/result/pcr purification kit/product/Qiagen
    Average 99 stars, based on 8854 article reviews
    Price from $9.99 to $1999.99
    pcr purification kit - by Bioz Stars, 2020-04
    99/100 stars

    Images

    1) Product Images from "Local Knockdown of ERK2 in the Adult Mouse Brain Via Adeno-Associated Virus-Mediated RNA Interference"

    Article Title: Local Knockdown of ERK2 in the Adult Mouse Brain Via Adeno-Associated Virus-Mediated RNA Interference

    Journal: Molecular Biotechnology

    doi: 10.1007/s12033-008-9125-9

    Western blot and qRT-PCR analysis of downregulation efficiency of shRNA vectors. a ShRNA vectors were tested in ES cells, as described in section “Materials and Methods” ; Western blot analysis revealed that Erksh4 and Erksh6 downregulated specifically ERK2, as compared to control samples (“Ctrl”). b Erksh4 and Erksh6 were further analyzed with qRT-PCR; the results confirmed the specific and significant reduction in ERK2 expression for Erksh4, while Erksh6 reduced ERK2, but affected also Erk1 mRNA level, and was therefore excluded from further experiments. Error bars show minimal and maximal results from triplicate measurements
    Figure Legend Snippet: Western blot and qRT-PCR analysis of downregulation efficiency of shRNA vectors. a ShRNA vectors were tested in ES cells, as described in section “Materials and Methods” ; Western blot analysis revealed that Erksh4 and Erksh6 downregulated specifically ERK2, as compared to control samples (“Ctrl”). b Erksh4 and Erksh6 were further analyzed with qRT-PCR; the results confirmed the specific and significant reduction in ERK2 expression for Erksh4, while Erksh6 reduced ERK2, but affected also Erk1 mRNA level, and was therefore excluded from further experiments. Error bars show minimal and maximal results from triplicate measurements

    Techniques Used: Western Blot, Quantitative RT-PCR, shRNA, Expressing

    2) Product Images from "Mutation within the hinge region of the transcription factor Nr2f2 attenuates salt-sensitive hypertension"

    Article Title: Mutation within the hinge region of the transcription factor Nr2f2 attenuates salt-sensitive hypertension

    Journal: Nature communications

    doi: 10.1038/ncomms7252

    Screening animals for ZFN-targeted mutation at the Nr2f2 locus (A) Tail DNA samples from pups born post-microinjection of custom ZFNs targeting exon 2 of the Nr2f2 locus were screened by PCR amplification with primers designed to amplify rat genomic fragments encompassing the ZFN-targeted site. Deviations from the expected product size of 360bp were inferred as genomic DNA from rats with mutations at the Nr2f2 locus. (B) Representative sequencing results from the PCR products shown in panel A detected a 15 bp deletion in the mRNA from mutant rats. Also represented are the corresponding translated peptide sequences as a result of the nucleotide variations.
    Figure Legend Snippet: Screening animals for ZFN-targeted mutation at the Nr2f2 locus (A) Tail DNA samples from pups born post-microinjection of custom ZFNs targeting exon 2 of the Nr2f2 locus were screened by PCR amplification with primers designed to amplify rat genomic fragments encompassing the ZFN-targeted site. Deviations from the expected product size of 360bp were inferred as genomic DNA from rats with mutations at the Nr2f2 locus. (B) Representative sequencing results from the PCR products shown in panel A detected a 15 bp deletion in the mRNA from mutant rats. Also represented are the corresponding translated peptide sequences as a result of the nucleotide variations.

    Techniques Used: Mutagenesis, Polymerase Chain Reaction, Amplification, Sequencing

    3) Product Images from "Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application"

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application

    Journal: BMC Genomics

    doi: 10.1186/s12864-017-4371-5

    DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown
    Figure Legend Snippet: DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown

    Techniques Used: DNA Purification, Chromatin Immunoprecipitation, Purification, Generated, Derivative Assay, Polymerase Chain Reaction, Amplification, Real-time Polymerase Chain Reaction

    4) Product Images from "Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application"

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application

    Journal: BMC Genomics

    doi: 10.1186/s12864-017-4371-5

    DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown
    Figure Legend Snippet: DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown

    Techniques Used: DNA Purification, Chromatin Immunoprecipitation, Purification, Generated, Derivative Assay, Polymerase Chain Reaction, Amplification, Real-time Polymerase Chain Reaction

    5) Product Images from "Microchimeric fetal cells play a role in maternal wound healing after pregnancy"

    Article Title: Microchimeric fetal cells play a role in maternal wound healing after pregnancy

    Journal: Chimerism

    doi: 10.4161/chim.28746

    Figure 5. Nested PCR products of 345bp assessed by electrophoresis in a 1.2% Agarose gel. L = 100bp DNA ladder (Promega, UK), (2–6) CS-scars, (7) Positive control using placental tissue and (8) Negative control using nulliparous skin.
    Figure Legend Snippet: Figure 5. Nested PCR products of 345bp assessed by electrophoresis in a 1.2% Agarose gel. L = 100bp DNA ladder (Promega, UK), (2–6) CS-scars, (7) Positive control using placental tissue and (8) Negative control using nulliparous skin.

    Techniques Used: Nested PCR, Electrophoresis, Agarose Gel Electrophoresis, Positive Control, Negative Control

    6) Product Images from "A Molecular Epidemiology Survey of Respiratory Adenoviruses Circulating in Children Residing in Southern Palestine"

    Article Title: A Molecular Epidemiology Survey of Respiratory Adenoviruses Circulating in Children Residing in Southern Palestine

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0042732

    Circulating HAdV types in southern Palestine. HAdV types circulating in Southern Palestine from 2005 to 2010 were detected using nested PCR and DNA sequencing assay of the HAdV hexon gene HVR1–6 followed by sequencing and sequence analysis. The 44 sequences were assigned the GenBank accession numbers [JQ796022–JQ796065]. The percentage of each serotype was calculated relatively to the number of total sequenced samples (44 samples).
    Figure Legend Snippet: Circulating HAdV types in southern Palestine. HAdV types circulating in Southern Palestine from 2005 to 2010 were detected using nested PCR and DNA sequencing assay of the HAdV hexon gene HVR1–6 followed by sequencing and sequence analysis. The 44 sequences were assigned the GenBank accession numbers [JQ796022–JQ796065]. The percentage of each serotype was calculated relatively to the number of total sequenced samples (44 samples).

    Techniques Used: Nested PCR, DNA Sequencing, Sequencing

    7) Product Images from "Genome-wide mapping of 8-oxo-7,8-dihydro-2′-deoxyguanosine reveals accumulation of oxidatively-generated damage at DNA replication origins within transcribed long genes of mammalian cells"

    Article Title: Genome-wide mapping of 8-oxo-7,8-dihydro-2′-deoxyguanosine reveals accumulation of oxidatively-generated damage at DNA replication origins within transcribed long genes of mammalian cells

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gky1152

    ( A ) Number of 8-oxodGs per million of dGs (8-oxodg/10 6 dG) measured by LC-MS/MS in untreated (NT), UV-irradiated (UV) and NAC-treated (NAC) MCF10A cells, as indicated. ( B ) Efficiency of polyclonal anti-8-oxodG from Millipore (Ab M), or monoclonal anti-8-oxodG from Trevigen (Ab T), and of anti-IgG antibodies in immuno-precipitation assays of 8-oxodG-containing synthetic ssDNA or G4 structures, as indicated. ( C ) Anti-8oxodG immuno-precipitation assay (% of input DNA, measured by qPCR; y axis) with equal amount (64 pg) of both synthetic oligonucleotides (8-oxodG-100mer and dG-100mer) added to 1 μg of NAC-treated genomic DNA. C1 and C2 indicate the same genomic negative control regions as in panel G. ( D ) Screenshot from the UCSC genome browser of 3.7 Mb from human chromosome 19 showing (top to bottom): OxiDIP-Seq signal profile, 8-oxodG peaks (dots), Input DNA, CG%, and RefSeq genes. ( E ) Screenshot from the UCSC genome browser of 2.1 Mb from human chromosome 19 showing OxiDIP-Seq signal profiles of two independent experiments (Exp #1 and #2) and Input DNA. ( F ) Scatter plot showing the correlation of the OxiDIP-Seq signals obtained in two independent experiments (Exp #1 and #2). Pearson's correlation coefficient (r), as indicated. Figure inset shows magnification of the high-density region. ( G ) OxiDIP-qPCR showing 8-oxodG enrichments (% of Input DNA) at eight different positive (#1–8) and two negative (C1, C2) regions, in untreated (black bar), UV- (gray), or NAC-treated (white) MCF10A cells. Screenshots from the UCSC genome browser show genomic position, 8-oxodG signal intensity, and qPCR probes (black box) of the selected regions. Data from two independent OxiDIP-qPCR assays are shown (±S.D.; P
    Figure Legend Snippet: ( A ) Number of 8-oxodGs per million of dGs (8-oxodg/10 6 dG) measured by LC-MS/MS in untreated (NT), UV-irradiated (UV) and NAC-treated (NAC) MCF10A cells, as indicated. ( B ) Efficiency of polyclonal anti-8-oxodG from Millipore (Ab M), or monoclonal anti-8-oxodG from Trevigen (Ab T), and of anti-IgG antibodies in immuno-precipitation assays of 8-oxodG-containing synthetic ssDNA or G4 structures, as indicated. ( C ) Anti-8oxodG immuno-precipitation assay (% of input DNA, measured by qPCR; y axis) with equal amount (64 pg) of both synthetic oligonucleotides (8-oxodG-100mer and dG-100mer) added to 1 μg of NAC-treated genomic DNA. C1 and C2 indicate the same genomic negative control regions as in panel G. ( D ) Screenshot from the UCSC genome browser of 3.7 Mb from human chromosome 19 showing (top to bottom): OxiDIP-Seq signal profile, 8-oxodG peaks (dots), Input DNA, CG%, and RefSeq genes. ( E ) Screenshot from the UCSC genome browser of 2.1 Mb from human chromosome 19 showing OxiDIP-Seq signal profiles of two independent experiments (Exp #1 and #2) and Input DNA. ( F ) Scatter plot showing the correlation of the OxiDIP-Seq signals obtained in two independent experiments (Exp #1 and #2). Pearson's correlation coefficient (r), as indicated. Figure inset shows magnification of the high-density region. ( G ) OxiDIP-qPCR showing 8-oxodG enrichments (% of Input DNA) at eight different positive (#1–8) and two negative (C1, C2) regions, in untreated (black bar), UV- (gray), or NAC-treated (white) MCF10A cells. Screenshots from the UCSC genome browser show genomic position, 8-oxodG signal intensity, and qPCR probes (black box) of the selected regions. Data from two independent OxiDIP-qPCR assays are shown (±S.D.; P

    Techniques Used: Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry, Irradiation, Immunoprecipitation, Real-time Polymerase Chain Reaction, Negative Control

    8) Product Images from "High-resolution genome-wide functional dissection of transcriptional regulatory regions and nucleotides in human"

    Article Title: High-resolution genome-wide functional dissection of transcriptional regulatory regions and nucleotides in human

    Journal: Nature Communications

    doi: 10.1038/s41467-018-07746-1

    Overview of HiDRA. a Cells with the desired genotype and open chormatin patterns are selected for library construction. Tn5 transposase is used to preferentially fragment genomic DNA at regions of open chromatin. Fragments are then size-selected on an agarose gel and mtDNA contamination is removed by selective CRISPR-Cas9 degradation. The fragment library is amplified by PCR and cloned into an enhancer reporter vector. Gel image adapted from Buenrostro et al. 21 . Fragments are cloned into the STARR-seq vector backbone, introduced into target cells (which can differ from cells used to construct the library), and RNA is collected and sequenced. After data processing, the activity of partially-overlapping fragments is compared to identify driver nucleotides using the SHARPR-RE algorithm. b Size distribution of HiDRA library fragments (blue) and tiled regions (green). Bimodal shape for library fragment sizes is due to Tn5 preference to cut adjacent to nucleosomes. Fragment bin size = 20 nt, region bin size = 50 nt. c Number of ChromHMM-predicted active enhancer, active TSS and ATAC-seq peaks covered by multiple unique HiDRA fragments. d HiDRA plasmid library recapitulates the genomic coverage of a conventional ATAC-seq experiment
    Figure Legend Snippet: Overview of HiDRA. a Cells with the desired genotype and open chormatin patterns are selected for library construction. Tn5 transposase is used to preferentially fragment genomic DNA at regions of open chromatin. Fragments are then size-selected on an agarose gel and mtDNA contamination is removed by selective CRISPR-Cas9 degradation. The fragment library is amplified by PCR and cloned into an enhancer reporter vector. Gel image adapted from Buenrostro et al. 21 . Fragments are cloned into the STARR-seq vector backbone, introduced into target cells (which can differ from cells used to construct the library), and RNA is collected and sequenced. After data processing, the activity of partially-overlapping fragments is compared to identify driver nucleotides using the SHARPR-RE algorithm. b Size distribution of HiDRA library fragments (blue) and tiled regions (green). Bimodal shape for library fragment sizes is due to Tn5 preference to cut adjacent to nucleosomes. Fragment bin size = 20 nt, region bin size = 50 nt. c Number of ChromHMM-predicted active enhancer, active TSS and ATAC-seq peaks covered by multiple unique HiDRA fragments. d HiDRA plasmid library recapitulates the genomic coverage of a conventional ATAC-seq experiment

    Techniques Used: Agarose Gel Electrophoresis, CRISPR, Amplification, Polymerase Chain Reaction, Clone Assay, Plasmid Preparation, Construct, Activity Assay

    9) Product Images from "Dysregulated immune system networks in war veterans with PTSD is an outcome of altered miRNA expression and DNA methylation"

    Article Title: Dysregulated immune system networks in war veterans with PTSD is an outcome of altered miRNA expression and DNA methylation

    Journal: Scientific Reports

    doi: 10.1038/srep31209

    DNA methylation level has a trend that corroborates gene expression. There is a clear trend showing higher DNA methylation and lowered mRNA levels and vice-versa for the corresponding gene. (a) DNA methylation levels of the select genes presented as box plot. On x-axis, the names of gene are provided and y-axis provides the average β- values of DNA methylation. The two bars corresponding to each gene represent the DNA methylation level for control followed by PTSD patient in a left to right direction. (b) Transcript levels (y-axis: log 2 fold change values) of genes, after RNA-Seq analysis, listed in Fig. 4a. (c) Real time PCR validation of differentially expressed genes. To validate the RNA-Seq results, qRT-PCR was performed for seven representative genes with cDNA prepared from total RNA obtained from PBMCs of 24 control and 24 PTSD patients. The values are relative abundance (RA) values after qRT-PCR. The table inside the figure provides log 2 fold change values of the respective genes after RNA-Seq analysis. The error bars indicate standard error.
    Figure Legend Snippet: DNA methylation level has a trend that corroborates gene expression. There is a clear trend showing higher DNA methylation and lowered mRNA levels and vice-versa for the corresponding gene. (a) DNA methylation levels of the select genes presented as box plot. On x-axis, the names of gene are provided and y-axis provides the average β- values of DNA methylation. The two bars corresponding to each gene represent the DNA methylation level for control followed by PTSD patient in a left to right direction. (b) Transcript levels (y-axis: log 2 fold change values) of genes, after RNA-Seq analysis, listed in Fig. 4a. (c) Real time PCR validation of differentially expressed genes. To validate the RNA-Seq results, qRT-PCR was performed for seven representative genes with cDNA prepared from total RNA obtained from PBMCs of 24 control and 24 PTSD patients. The values are relative abundance (RA) values after qRT-PCR. The table inside the figure provides log 2 fold change values of the respective genes after RNA-Seq analysis. The error bars indicate standard error.

    Techniques Used: DNA Methylation Assay, Expressing, RNA Sequencing Assay, Real-time Polymerase Chain Reaction, Quantitative RT-PCR

    10) Product Images from "A retrospective study of community-acquired Clostridium difficile infection in southwest China"

    Article Title: A retrospective study of community-acquired Clostridium difficile infection in southwest China

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-21762-7

    The toxin profiles and PCR ribotyping characters of C. difficile between children and adults in this study. ( A ) The toxin profile of isolated strains. ( B ) RT constituent ratio of C. difficile strains. Left: children group; right: adults group. ( C ) RT distribu tion characters of C. difficile for different hospitals in children group. ( D ) RT distribution characters of C. difficile for different hospitals in adults group. ( E ). RT distribution characters of C. difficile for fecal property in children group. ( F ) RT distribution characters of C. difficile for fecal property in adults group.
    Figure Legend Snippet: The toxin profiles and PCR ribotyping characters of C. difficile between children and adults in this study. ( A ) The toxin profile of isolated strains. ( B ) RT constituent ratio of C. difficile strains. Left: children group; right: adults group. ( C ) RT distribu tion characters of C. difficile for different hospitals in children group. ( D ) RT distribution characters of C. difficile for different hospitals in adults group. ( E ). RT distribution characters of C. difficile for fecal property in children group. ( F ) RT distribution characters of C. difficile for fecal property in adults group.

    Techniques Used: Polymerase Chain Reaction, Isolation

    11) Product Images from "The usefulness of biotyping in the determination of selected pathogenicity determinants in Streptococcus mutans"

    Article Title: The usefulness of biotyping in the determination of selected pathogenicity determinants in Streptococcus mutans

    Journal: BMC Microbiology

    doi: 10.1186/1471-2180-14-194

    16s rDNA sequencing strategy. A . NC_004350.2 – Streptococcus mutans UA159 genome, SMU_r04 - 16S ribosomal RNA gene (length 1552 bp), grey arrow – forward primer (CGCTGGCGGCGTGCCTAATA), white arrow – reverse primer (TGCAAAGCAGGCGCTCTCCC). B . PCR product (length 1620 bp). C . Average sequencing read length for forward (grey stripe) and reverse (white stripe) primer.
    Figure Legend Snippet: 16s rDNA sequencing strategy. A . NC_004350.2 – Streptococcus mutans UA159 genome, SMU_r04 - 16S ribosomal RNA gene (length 1552 bp), grey arrow – forward primer (CGCTGGCGGCGTGCCTAATA), white arrow – reverse primer (TGCAAAGCAGGCGCTCTCCC). B . PCR product (length 1620 bp). C . Average sequencing read length for forward (grey stripe) and reverse (white stripe) primer.

    Techniques Used: Sequencing, Polymerase Chain Reaction

    12) Product Images from "Dysregulated immune system networks in war veterans with PTSD is an outcome of altered miRNA expression and DNA methylation"

    Article Title: Dysregulated immune system networks in war veterans with PTSD is an outcome of altered miRNA expression and DNA methylation

    Journal: Scientific Reports

    doi: 10.1038/srep31209

    DNA methylation level has a trend that corroborates gene expression. There is a clear trend showing higher DNA methylation and lowered mRNA levels and vice-versa for the corresponding gene. (a) DNA methylation levels of the select genes presented as box plot. On x-axis, the names of gene are provided and y-axis provides the average β- values of DNA methylation. The two bars corresponding to each gene represent the DNA methylation level for control followed by PTSD patient in a left to right direction. (b) Transcript levels (y-axis: log 2 fold change values) of genes, after RNA-Seq analysis, listed in Fig. 4a. (c) Real time PCR validation of differentially expressed genes. To validate the RNA-Seq results, qRT-PCR was performed for seven representative genes with cDNA prepared from total RNA obtained from PBMCs of 24 control and 24 PTSD patients. The values are relative abundance (RA) values after qRT-PCR. The table inside the figure provides log 2 fold change values of the respective genes after RNA-Seq analysis. The error bars indicate standard error.
    Figure Legend Snippet: DNA methylation level has a trend that corroborates gene expression. There is a clear trend showing higher DNA methylation and lowered mRNA levels and vice-versa for the corresponding gene. (a) DNA methylation levels of the select genes presented as box plot. On x-axis, the names of gene are provided and y-axis provides the average β- values of DNA methylation. The two bars corresponding to each gene represent the DNA methylation level for control followed by PTSD patient in a left to right direction. (b) Transcript levels (y-axis: log 2 fold change values) of genes, after RNA-Seq analysis, listed in Fig. 4a. (c) Real time PCR validation of differentially expressed genes. To validate the RNA-Seq results, qRT-PCR was performed for seven representative genes with cDNA prepared from total RNA obtained from PBMCs of 24 control and 24 PTSD patients. The values are relative abundance (RA) values after qRT-PCR. The table inside the figure provides log 2 fold change values of the respective genes after RNA-Seq analysis. The error bars indicate standard error.

    Techniques Used: DNA Methylation Assay, Expressing, RNA Sequencing Assay, Real-time Polymerase Chain Reaction, Quantitative RT-PCR

    13) Product Images from "Expression and Activity of a Novel Cathelicidin from Domestic Cats"

    Article Title: Expression and Activity of a Novel Cathelicidin from Domestic Cats

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0018756

    3′ RACE Analysis and Identification of feCath. (A) Schematic of 3′ RACE strategy targeting the signal sequence region and the propeptide (cathelin) domain with sense primers and using antisense adaptor primer, AP1. Feline bone marrow RNA was reverse transcribed with oligo-dT conjugated to adaptor primer 1/2 (AP1/2). Sense primers (sequences found in Table 1 ) were used to amplify cathelicidin related sequences in the pool of bone marrow cDNA. (B) Agarose gel electrophoresis analysis of 3′ RACE PCR products from (A). HaeIII digested Phi-X174 phage DNA used as the marker.
    Figure Legend Snippet: 3′ RACE Analysis and Identification of feCath. (A) Schematic of 3′ RACE strategy targeting the signal sequence region and the propeptide (cathelin) domain with sense primers and using antisense adaptor primer, AP1. Feline bone marrow RNA was reverse transcribed with oligo-dT conjugated to adaptor primer 1/2 (AP1/2). Sense primers (sequences found in Table 1 ) were used to amplify cathelicidin related sequences in the pool of bone marrow cDNA. (B) Agarose gel electrophoresis analysis of 3′ RACE PCR products from (A). HaeIII digested Phi-X174 phage DNA used as the marker.

    Techniques Used: Sequencing, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Marker

    14) Product Images from "Conservative site-specific and single-copy transgenesis in human LINE-1 elements"

    Article Title: Conservative site-specific and single-copy transgenesis in human LINE-1 elements

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkv1345

    Targeting endogenous att H4X in HT1080 cells. ( A ) Diagram showing the 21 nucleotide sequences comprising the core binding and spacer sequences of various att sites and features of the LINE -1 retrotransposon. Wild type att B and att P sequences aligned to show the respective core binding and spacer sequences. The query sequence was used in a bioinformatics search for targets resembling core att sites. Sequence logo analysis was performed for the 18 bp att H4X sequences in LINE-1 elements in the targeted cell lines including additional three nucleotides at the 5′ end in order to compare with the 21 bp att B sequence. A LINE -1 retrotransposon diagram with the position and orientation of att H4X is shown at the bottom. See text for details. ( B ) Schematic drawing showing pattP4X-PGKssPuro target vector and predicted recombination between att P4X and genomic att H4X. Positions of relevant primers (Puro rev24, Puro rev303, Puro fw318, Puro fw509 and pr21), restriction sites and the probe used for Southern blotting are indicated. ( C ) Screening for att H4X × att P4X recombination events in HT1080 clones. PCR was performed with genomic DNA and primers cs_ att H4X_F1 and Puro rev24 (for att L junction) and cs_ att H4X_R1 and pr21 (for att R junction). PCR amplified products of the expected size (1100 bp; for the left junction) were detected in clones 3, 19 and 21 (top two panels) and (∼375 bp; for the right junction) in clones 11, 19 and 21 (bottom two panels). W, no DNA template control; HT, negative control (genomic DNA from parental cells); Ina, genomic DNA from puromycin resistant clones obtained through co-transfection of pattP4X-PGKssPuro and pCMVssIna , the latter expressed inactive Int as negative control; +, positive control (genomic DNA from a HT1080 clone carrying an att H4X x att P4X integration event); M, 100 bp DNA ladder; 1 to 33, genomic DNA from puromycin resistant HT1080 clones obtained through co-transfection of pattP4X-PGKssPuro and pCMVssInt-C3CNLS . ( D ) Southern blot analysis. Genomic DNA purified from five targeted HT1080 clones, as indicated, and parental HT1080 cell line was subjected to digestion with PstI or XbaI. A PCR-derived digoxigenin-labeled probe complementary to the puromycin resistance gene was used. Lanes: M1, 1 kb DNA ladder; HT, genomic DNA from HT1080; 3, 11, 18*, 19 and 21, genomic DNA from targeted clones; pP4X (10 7 , 10 8 , 10 9 ), copies of linearized pattP4X-PGKssPuro loaded as positive control. The arrows indicate fragments of expected size for clones 3 and 11. *HT 1080 Clone 18 (carrying a single-copy transgene) was obtained from a screen of puromycin-resistant HT1080 clones that resulted from a previous co-transfection of pattP4X-PGKssPuro and pCMVssInt-h/218 . White arrow heads indicate fragments of the expected size and black arrow heads indicate extra or unexpected fragments in the targeted clones.
    Figure Legend Snippet: Targeting endogenous att H4X in HT1080 cells. ( A ) Diagram showing the 21 nucleotide sequences comprising the core binding and spacer sequences of various att sites and features of the LINE -1 retrotransposon. Wild type att B and att P sequences aligned to show the respective core binding and spacer sequences. The query sequence was used in a bioinformatics search for targets resembling core att sites. Sequence logo analysis was performed for the 18 bp att H4X sequences in LINE-1 elements in the targeted cell lines including additional three nucleotides at the 5′ end in order to compare with the 21 bp att B sequence. A LINE -1 retrotransposon diagram with the position and orientation of att H4X is shown at the bottom. See text for details. ( B ) Schematic drawing showing pattP4X-PGKssPuro target vector and predicted recombination between att P4X and genomic att H4X. Positions of relevant primers (Puro rev24, Puro rev303, Puro fw318, Puro fw509 and pr21), restriction sites and the probe used for Southern blotting are indicated. ( C ) Screening for att H4X × att P4X recombination events in HT1080 clones. PCR was performed with genomic DNA and primers cs_ att H4X_F1 and Puro rev24 (for att L junction) and cs_ att H4X_R1 and pr21 (for att R junction). PCR amplified products of the expected size (1100 bp; for the left junction) were detected in clones 3, 19 and 21 (top two panels) and (∼375 bp; for the right junction) in clones 11, 19 and 21 (bottom two panels). W, no DNA template control; HT, negative control (genomic DNA from parental cells); Ina, genomic DNA from puromycin resistant clones obtained through co-transfection of pattP4X-PGKssPuro and pCMVssIna , the latter expressed inactive Int as negative control; +, positive control (genomic DNA from a HT1080 clone carrying an att H4X x att P4X integration event); M, 100 bp DNA ladder; 1 to 33, genomic DNA from puromycin resistant HT1080 clones obtained through co-transfection of pattP4X-PGKssPuro and pCMVssInt-C3CNLS . ( D ) Southern blot analysis. Genomic DNA purified from five targeted HT1080 clones, as indicated, and parental HT1080 cell line was subjected to digestion with PstI or XbaI. A PCR-derived digoxigenin-labeled probe complementary to the puromycin resistance gene was used. Lanes: M1, 1 kb DNA ladder; HT, genomic DNA from HT1080; 3, 11, 18*, 19 and 21, genomic DNA from targeted clones; pP4X (10 7 , 10 8 , 10 9 ), copies of linearized pattP4X-PGKssPuro loaded as positive control. The arrows indicate fragments of expected size for clones 3 and 11. *HT 1080 Clone 18 (carrying a single-copy transgene) was obtained from a screen of puromycin-resistant HT1080 clones that resulted from a previous co-transfection of pattP4X-PGKssPuro and pCMVssInt-h/218 . White arrow heads indicate fragments of the expected size and black arrow heads indicate extra or unexpected fragments in the targeted clones.

    Techniques Used: Binding Assay, Sequencing, Plasmid Preparation, Southern Blot, Clone Assay, Polymerase Chain Reaction, Amplification, Negative Control, Cotransfection, Positive Control, Purification, Derivative Assay, Labeling

    Targeting att H4X in hESCs with pattP4X-PGKssPuro-UTF1-eGFP . ( A ) Schematic diagram of pattP4X-PGKssPuro-UTF1-eGFP targeting vector after integration. Locations of primers (Puro rev24, PGK rev, pr111 and pr22) and the Southern probe are indicated. ( B ) Screening for att H4X x att P4X recombination events in selected hESC clones. Semi-nested PCR with primers cs_ att H4X_F1 and PGK rev (for the left junction) using templates obtained with primary PCR (primers cs_ att H4X_F1 and Puro rev24). PCR products of the expected size (∼900 bp) were detected in hESC clone E3 (left panel). Confirmatory PCR with genomic locus specific primers were performed for clone E3. PCR products of expected size (∼1100 bp) were obtained in a semi-nested PCR with primer PGK rev and genomic locus-specific forward primer E3-GF2 using templates from a primary PCR (primers Puro rev24 and primer E3-GF2; middle panel). PCR products of expected size (∼1000 bp) were obtained in a semi-nested PCR with primer pr111 and genomic locus specific reverse primer E3-GR2 (for the right junction) using templates from a primary PCR (primers pr22 and E3-GR2; right panel). W, no DNA template control; ES, negative control (genomic DNA from parental cells); M, 100 bp DNA ladder; M1, 1 kb DNA ladder; E2, E3, G1, G9, H2, J4, B16, A20, genomic DNA from puromycin resistant and GFP-positive hESC clones obtained through co-transfection of pattP4X-PGKssPuro-UTF1-eGFP and pEF1α-ss-Int-C3CNLS . ( C ) Southern blot analysis. Genomic DNA from three hESC clones and parental hESC cells were digested with NdeI or XbaI. Digoxigenin-labeled probe to EGFP was employed. Lanes: M1, 1 kb DNA ladder; 10 8 , 10 9 , copies of linearized targeting vector as positive control; ES, parental DNA; A3, E3 and K3, genomic DNA from targeted hESC clones. White arrow heads indicate fragments of the expected size and black arrow heads indicate extra or unexpected fragments in the targeted clones. ( D ) Functional test for UTF1 promoter-driven EGFP expression in targeted hESC clones. Fluorescence microscopic analysis of undifferentiated and RA-induced, differentiated parental hES-047 cells and clones A3, E3 and K3. EGFP expression was detected with the undifferentiated hESC clones A3, E3 and K3 (column 2, panels 2, 3 and 4) but disappeared in differentiated progenies (column 4, panels 2, 3 and 4) respectively. Panels in columns 1 and 3 are phase-contrast light micrographs of undifferentiated and differentiated cells, respectively. Magnification 5×; Scale bars 100 μm. ( E ) FACS analysis for undifferentiated and differentiated hESCs clones Dot plots representing GFP + cells (upper right quadrant) and GFP − cells (lower right quadrant) for the untargeted hESCs, undifferentiated targeted hESC clones (A3, E3, K3) after 3 weeks (early) and 8 weeks (late) of culturing the cells (left and middle panel) and their differentiated progenies (right panel).
    Figure Legend Snippet: Targeting att H4X in hESCs with pattP4X-PGKssPuro-UTF1-eGFP . ( A ) Schematic diagram of pattP4X-PGKssPuro-UTF1-eGFP targeting vector after integration. Locations of primers (Puro rev24, PGK rev, pr111 and pr22) and the Southern probe are indicated. ( B ) Screening for att H4X x att P4X recombination events in selected hESC clones. Semi-nested PCR with primers cs_ att H4X_F1 and PGK rev (for the left junction) using templates obtained with primary PCR (primers cs_ att H4X_F1 and Puro rev24). PCR products of the expected size (∼900 bp) were detected in hESC clone E3 (left panel). Confirmatory PCR with genomic locus specific primers were performed for clone E3. PCR products of expected size (∼1100 bp) were obtained in a semi-nested PCR with primer PGK rev and genomic locus-specific forward primer E3-GF2 using templates from a primary PCR (primers Puro rev24 and primer E3-GF2; middle panel). PCR products of expected size (∼1000 bp) were obtained in a semi-nested PCR with primer pr111 and genomic locus specific reverse primer E3-GR2 (for the right junction) using templates from a primary PCR (primers pr22 and E3-GR2; right panel). W, no DNA template control; ES, negative control (genomic DNA from parental cells); M, 100 bp DNA ladder; M1, 1 kb DNA ladder; E2, E3, G1, G9, H2, J4, B16, A20, genomic DNA from puromycin resistant and GFP-positive hESC clones obtained through co-transfection of pattP4X-PGKssPuro-UTF1-eGFP and pEF1α-ss-Int-C3CNLS . ( C ) Southern blot analysis. Genomic DNA from three hESC clones and parental hESC cells were digested with NdeI or XbaI. Digoxigenin-labeled probe to EGFP was employed. Lanes: M1, 1 kb DNA ladder; 10 8 , 10 9 , copies of linearized targeting vector as positive control; ES, parental DNA; A3, E3 and K3, genomic DNA from targeted hESC clones. White arrow heads indicate fragments of the expected size and black arrow heads indicate extra or unexpected fragments in the targeted clones. ( D ) Functional test for UTF1 promoter-driven EGFP expression in targeted hESC clones. Fluorescence microscopic analysis of undifferentiated and RA-induced, differentiated parental hES-047 cells and clones A3, E3 and K3. EGFP expression was detected with the undifferentiated hESC clones A3, E3 and K3 (column 2, panels 2, 3 and 4) but disappeared in differentiated progenies (column 4, panels 2, 3 and 4) respectively. Panels in columns 1 and 3 are phase-contrast light micrographs of undifferentiated and differentiated cells, respectively. Magnification 5×; Scale bars 100 μm. ( E ) FACS analysis for undifferentiated and differentiated hESCs clones Dot plots representing GFP + cells (upper right quadrant) and GFP − cells (lower right quadrant) for the untargeted hESCs, undifferentiated targeted hESC clones (A3, E3, K3) after 3 weeks (early) and 8 weeks (late) of culturing the cells (left and middle panel) and their differentiated progenies (right panel).

    Techniques Used: Plasmid Preparation, Clone Assay, Nested PCR, Polymerase Chain Reaction, Negative Control, Cotransfection, Southern Blot, Labeling, Positive Control, Functional Assay, Expressing, Fluorescence, FACS

    att H4X targeting in human embryonic stem cell (hESCs). ( A ) Schematic diagram of pTZ-attP4X-UN-EF1α-eGFP targeting vector after integration into att H4X. Positions of relevant primers, the Southern probe targeting EGFP and HindIII and XbaI restriction sites are indicated. ( B ) Western blot showing Integrase expression in hESCs. Lysates from hESCs transfected with plasmids expressing Int-C3CNLS ( pCMVssInt-C3C ), 6xHIS-tagged Int-C3CNLS ( pCMVssInt-C3C-H, pEF-Int-C3C-H, pEFssInt-C3C-H ) and untransfected control cells were analyzed by western blotting with an anti-HIS tag antibody (top panel). Purified HIS-tagged Integrase C3 was employed as positive control. β-actin was used as loading control (bottom panel). ( C ) Example of screening for att H4X × att P4X recombination events in hESCs. PCR was performed with genomic DNA (extracted from neomycin-resistant, EGFP-positive hESC recombinants) and primers cs_ att H4X_F2 and att P rev (for the left junction; top left panel) and cs_ att H4X_R2 and pr21 (for the right junction; bottom left panel). PCR amplified products of the expected sizes (278 and 439 bp) were detected in clone #24. The right panel shows a PCR analysis to confirm site-specific recombination in clone #24 using different genomic locus-specific primers. PCR-amplified products of the expected sizes (∼1.25 kb with primers att P rev and 24G-F2, and ∼750 bp with primers pr21 and 24G-R1) were obtained and confirmed by sequencing. W, no DNA template control; ES, negative control (genomic DNA from parental hESCs); +, positive control (genomic DNA from HT1080 clone #19); M, 100 bp DNA ladder; M1, 1 kb DNA ladder; 16 to 27, genomic DNA from neomycin resistant hESC clones obtained through co-transfection of pTZ-attP4X-UN-EF1α-eGFP and pEF1α-ssInt-C3CNLS . ( D ) Southern blot analysis. Genomic DNA purified from three targeted hESC clones and parental hESC cell lines were digested with HindIII or XbaI. A probe complementary to EGFP was employed. Lanes: M1, 1 kb DNA ladder; m, DNA ladder (TeloTAGGG Telomere Length Assay kit, Roche); ES, parental DNA; 3, 24, 59, genomic DNA from targeted hESC clones; pUN4X (10 7 , 10 8 ), copies of linearized targeting vector pTZ-attP4X-UN-EF1α-eGFP . White arrow heads indicate fragments of the expected size in the targeted clones.
    Figure Legend Snippet: att H4X targeting in human embryonic stem cell (hESCs). ( A ) Schematic diagram of pTZ-attP4X-UN-EF1α-eGFP targeting vector after integration into att H4X. Positions of relevant primers, the Southern probe targeting EGFP and HindIII and XbaI restriction sites are indicated. ( B ) Western blot showing Integrase expression in hESCs. Lysates from hESCs transfected with plasmids expressing Int-C3CNLS ( pCMVssInt-C3C ), 6xHIS-tagged Int-C3CNLS ( pCMVssInt-C3C-H, pEF-Int-C3C-H, pEFssInt-C3C-H ) and untransfected control cells were analyzed by western blotting with an anti-HIS tag antibody (top panel). Purified HIS-tagged Integrase C3 was employed as positive control. β-actin was used as loading control (bottom panel). ( C ) Example of screening for att H4X × att P4X recombination events in hESCs. PCR was performed with genomic DNA (extracted from neomycin-resistant, EGFP-positive hESC recombinants) and primers cs_ att H4X_F2 and att P rev (for the left junction; top left panel) and cs_ att H4X_R2 and pr21 (for the right junction; bottom left panel). PCR amplified products of the expected sizes (278 and 439 bp) were detected in clone #24. The right panel shows a PCR analysis to confirm site-specific recombination in clone #24 using different genomic locus-specific primers. PCR-amplified products of the expected sizes (∼1.25 kb with primers att P rev and 24G-F2, and ∼750 bp with primers pr21 and 24G-R1) were obtained and confirmed by sequencing. W, no DNA template control; ES, negative control (genomic DNA from parental hESCs); +, positive control (genomic DNA from HT1080 clone #19); M, 100 bp DNA ladder; M1, 1 kb DNA ladder; 16 to 27, genomic DNA from neomycin resistant hESC clones obtained through co-transfection of pTZ-attP4X-UN-EF1α-eGFP and pEF1α-ssInt-C3CNLS . ( D ) Southern blot analysis. Genomic DNA purified from three targeted hESC clones and parental hESC cell lines were digested with HindIII or XbaI. A probe complementary to EGFP was employed. Lanes: M1, 1 kb DNA ladder; m, DNA ladder (TeloTAGGG Telomere Length Assay kit, Roche); ES, parental DNA; 3, 24, 59, genomic DNA from targeted hESC clones; pUN4X (10 7 , 10 8 ), copies of linearized targeting vector pTZ-attP4X-UN-EF1α-eGFP . White arrow heads indicate fragments of the expected size in the targeted clones.

    Techniques Used: Plasmid Preparation, Western Blot, Expressing, Transfection, Purification, Positive Control, Polymerase Chain Reaction, Amplification, Sequencing, Negative Control, Clone Assay, Cotransfection, Southern Blot

    Off-target analysis in NEB-1 and HeLa cell lines. ( A ) Schematic drawing showing self-ligation of PstI digested genomic DNA consisting of integrated pattP4X-PGKssPuro target vector. Positions of relevant primers (Puro rev24, Puro rev303, pr21, attP fwd) used for inverse nested PCR to determine the potential att R site are indicated. ( B ) Screening for off-targeting events in NEB-1 clones. Inverse nested PCR was performed using genomic DNA from 26 puromycin-resistant NEB-1 clones which were obtained from two independent transfections. PCR products that were not present in control PCRs (with genomic DNA of NEB-1 parental cells as template) and were larger than 200 bp (fragments marked with black arrows) were detected in clones N1-C7, N1-C14, N2-C1, N2-C2, N2-C3, N2-C4, N2-C6, N2-C10, N2-C11 (upper two panels). They were extracted and re-amplified (bottom panel) for sequencing. W, no DNA template control; NEB, negative control (genomic DNA from parental cells); Bulk 1 bulk 2, genomic DNA template from all puromycin resistant colonies obtained through two independent co-transfections of pattP4X-PGKssPuro and pCMVssInt-h/218CNL; N1(C1-C14) and N2 (C1-C12), genomic DNA from puromycin resistant NEB-1 clones obtained through two independent co-transfections of pattP4X-PGKssPuro and pCMVssInt-C3CNLS ; +, positive control (genomic DNA from a NEB-1 clone carrying an att H4X × att P4X integration event); M, 100 bp DNA ladder; M1, 1 kb DNA ladder. ( C ) Table showing sequence analysis of NEB-1 targeted clones (nature, possible mechanism and chromosomal location of genomic integration of target vector). ( D ) Table showing the observed off-target sequences based on att P4X targeting in NEB-1 and HeLa cell lines. ( E ) Sequence logo analysis for the 21bp off-target att H (HOH‘) sequences found based on att P4X targeting in NEB-1 and HeLa cell lines.
    Figure Legend Snippet: Off-target analysis in NEB-1 and HeLa cell lines. ( A ) Schematic drawing showing self-ligation of PstI digested genomic DNA consisting of integrated pattP4X-PGKssPuro target vector. Positions of relevant primers (Puro rev24, Puro rev303, pr21, attP fwd) used for inverse nested PCR to determine the potential att R site are indicated. ( B ) Screening for off-targeting events in NEB-1 clones. Inverse nested PCR was performed using genomic DNA from 26 puromycin-resistant NEB-1 clones which were obtained from two independent transfections. PCR products that were not present in control PCRs (with genomic DNA of NEB-1 parental cells as template) and were larger than 200 bp (fragments marked with black arrows) were detected in clones N1-C7, N1-C14, N2-C1, N2-C2, N2-C3, N2-C4, N2-C6, N2-C10, N2-C11 (upper two panels). They were extracted and re-amplified (bottom panel) for sequencing. W, no DNA template control; NEB, negative control (genomic DNA from parental cells); Bulk 1 bulk 2, genomic DNA template from all puromycin resistant colonies obtained through two independent co-transfections of pattP4X-PGKssPuro and pCMVssInt-h/218CNL; N1(C1-C14) and N2 (C1-C12), genomic DNA from puromycin resistant NEB-1 clones obtained through two independent co-transfections of pattP4X-PGKssPuro and pCMVssInt-C3CNLS ; +, positive control (genomic DNA from a NEB-1 clone carrying an att H4X × att P4X integration event); M, 100 bp DNA ladder; M1, 1 kb DNA ladder. ( C ) Table showing sequence analysis of NEB-1 targeted clones (nature, possible mechanism and chromosomal location of genomic integration of target vector). ( D ) Table showing the observed off-target sequences based on att P4X targeting in NEB-1 and HeLa cell lines. ( E ) Sequence logo analysis for the 21bp off-target att H (HOH‘) sequences found based on att P4X targeting in NEB-1 and HeLa cell lines.

    Techniques Used: Ligation, Plasmid Preparation, Nested PCR, Clone Assay, Transfection, Polymerase Chain Reaction, Amplification, Sequencing, Negative Control, Positive Control

    15) Product Images from "SABER enables amplified and multiplexed imaging of RNA and DNA in cells and tissues"

    Article Title: SABER enables amplified and multiplexed imaging of RNA and DNA in cells and tissues

    Journal: Nature methods

    doi: 10.1038/s41592-019-0404-0

    Sequential imaging of chromosomal targets using Exchange-SABER. a , Schematic of 17 targeted regions along the human X chromosome (width to scale). Each set of probes per spot had different 42mer barcode sequences appended to their 3’ ends ( Fig. 1d ). Seventeen 42mer bridge sequences concatemerized with 17 different PER primers were co-hybridized. b , Individual color channels on DAPI. 6 hybridizations, targeting 3, 3, 3, 3, 3, and 2 spots, respectively, that took course over a single day were used to image the 17 colors. c , 17-color overlays on DAPI. The representative metaphase spread from part (B) is shown overlaid on DAPI at two length scales (top left, top right). Interphase cells showing the X chromosome territories were also captured (bottom). d , Combinatorial 6-color SABER imaging. As a step toward increasing multiplexing with SABER amplification further, we demonstrated mapping six of the spots on the chromosome to 4 different 6-color combinations. Scale bars: 5 μm (spreads), 20 μm (fields of view).
    Figure Legend Snippet: Sequential imaging of chromosomal targets using Exchange-SABER. a , Schematic of 17 targeted regions along the human X chromosome (width to scale). Each set of probes per spot had different 42mer barcode sequences appended to their 3’ ends ( Fig. 1d ). Seventeen 42mer bridge sequences concatemerized with 17 different PER primers were co-hybridized. b , Individual color channels on DAPI. 6 hybridizations, targeting 3, 3, 3, 3, 3, and 2 spots, respectively, that took course over a single day were used to image the 17 colors. c , 17-color overlays on DAPI. The representative metaphase spread from part (B) is shown overlaid on DAPI at two length scales (top left, top right). Interphase cells showing the X chromosome territories were also captured (bottom). d , Combinatorial 6-color SABER imaging. As a step toward increasing multiplexing with SABER amplification further, we demonstrated mapping six of the spots on the chromosome to 4 different 6-color combinations. Scale bars: 5 μm (spreads), 20 μm (fields of view).

    Techniques Used: Imaging, Multiplexing, Amplification

    16) Product Images from "Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application"

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application

    Journal: BMC Genomics

    doi: 10.1186/s12864-017-4371-5

    DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown
    Figure Legend Snippet: DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown

    Techniques Used: DNA Purification, Chromatin Immunoprecipitation, Purification, Generated, Derivative Assay, Polymerase Chain Reaction, Amplification, Real-time Polymerase Chain Reaction

    17) Product Images from "Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application"

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application

    Journal: BMC Genomics

    doi: 10.1186/s12864-017-4371-5

    DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown
    Figure Legend Snippet: DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown

    Techniques Used: DNA Purification, Chromatin Immunoprecipitation, Purification, Generated, Derivative Assay, Polymerase Chain Reaction, Amplification, Real-time Polymerase Chain Reaction

    18) Product Images from "A Molecular Epidemiology Survey of Respiratory Adenoviruses Circulating in Children Residing in Southern Palestine"

    Article Title: A Molecular Epidemiology Survey of Respiratory Adenoviruses Circulating in Children Residing in Southern Palestine

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0042732

    Circulating HAdV types in southern Palestine. HAdV types circulating in Southern Palestine from 2005 to 2010 were detected using nested PCR and DNA sequencing assay of the HAdV hexon gene HVR1–6 followed by sequencing and sequence analysis. The 44 sequences were assigned the GenBank accession numbers [JQ796022–JQ796065]. The percentage of each serotype was calculated relatively to the number of total sequenced samples (44 samples).
    Figure Legend Snippet: Circulating HAdV types in southern Palestine. HAdV types circulating in Southern Palestine from 2005 to 2010 were detected using nested PCR and DNA sequencing assay of the HAdV hexon gene HVR1–6 followed by sequencing and sequence analysis. The 44 sequences were assigned the GenBank accession numbers [JQ796022–JQ796065]. The percentage of each serotype was calculated relatively to the number of total sequenced samples (44 samples).

    Techniques Used: Nested PCR, DNA Sequencing, Sequencing

    19) Product Images from "Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application"

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application

    Journal: BMC Genomics

    doi: 10.1186/s12864-017-4371-5

    DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown
    Figure Legend Snippet: DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown

    Techniques Used: DNA Purification, Chromatin Immunoprecipitation, Purification, Generated, Derivative Assay, Polymerase Chain Reaction, Amplification, Real-time Polymerase Chain Reaction

    20) Product Images from "Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application"

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application

    Journal: BMC Genomics

    doi: 10.1186/s12864-017-4371-5

    DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown
    Figure Legend Snippet: DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown

    Techniques Used: DNA Purification, Chromatin Immunoprecipitation, Purification, Generated, Derivative Assay, Polymerase Chain Reaction, Amplification, Real-time Polymerase Chain Reaction

    21) Product Images from "Dynamics of BAF- Polycomb Complex Opposition on Heterochromatin in Normal and Oncogenic States"

    Article Title: Dynamics of BAF- Polycomb Complex Opposition on Heterochromatin in Normal and Oncogenic States

    Journal: Nature genetics

    doi: 10.1038/ng.3734

    BAF complexes displace PcG repression upon recruitment (a) Schematic for rapamycin-induced recruitment of Frb-V5-Ss18 BAF complexes. (b-c) BAF complex recruitment results in (b) Ezh2 displacement within 10 min followed by H3K27me3 removal within 20 min, and (c) Ring1b displacement within 5 min followed by H2AK119ub1 removal within 7.5min (at -443bp ZFHD1 site). (d) Total histone (H3) occupancy and non-PcG histone marks (H3K9me3, H2A.Z) are unaffected by BAF complex recruitment (left). Comparison of H3 levels to PcG marks shows removal of PRC1 repression followed by removal of PRC2 repression, with H3 unchanged (right). (e) ATAC-qPCR at ZFHD recruitment site (-443bp) shows increase in DNA accessibility upon BAF complex recruitment. (f) The HELLS (LSH) chromatin remodeler shows rapid recruitment via rapamycin-recruitment system (left), however PRC1 and PRC1-placed repressive marks are not displaced (right), nor are H3K9me3 or total H3. All ChIP-qPCR measurements are at the -443bp ZFHD1 site. Error bars = Mean ± SD for n=3 experiments except (c) for n=2 experiments.
    Figure Legend Snippet: BAF complexes displace PcG repression upon recruitment (a) Schematic for rapamycin-induced recruitment of Frb-V5-Ss18 BAF complexes. (b-c) BAF complex recruitment results in (b) Ezh2 displacement within 10 min followed by H3K27me3 removal within 20 min, and (c) Ring1b displacement within 5 min followed by H2AK119ub1 removal within 7.5min (at -443bp ZFHD1 site). (d) Total histone (H3) occupancy and non-PcG histone marks (H3K9me3, H2A.Z) are unaffected by BAF complex recruitment (left). Comparison of H3 levels to PcG marks shows removal of PRC1 repression followed by removal of PRC2 repression, with H3 unchanged (right). (e) ATAC-qPCR at ZFHD recruitment site (-443bp) shows increase in DNA accessibility upon BAF complex recruitment. (f) The HELLS (LSH) chromatin remodeler shows rapid recruitment via rapamycin-recruitment system (left), however PRC1 and PRC1-placed repressive marks are not displaced (right), nor are H3K9me3 or total H3. All ChIP-qPCR measurements are at the -443bp ZFHD1 site. Error bars = Mean ± SD for n=3 experiments except (c) for n=2 experiments.

    Techniques Used: Real-time Polymerase Chain Reaction, Chromatin Immunoprecipitation

    22) Product Images from "Protocol for Metagenomic Virus Detection in Clinical Specimens 1"

    Article Title: Protocol for Metagenomic Virus Detection in Clinical Specimens 1

    Journal: Emerging Infectious Diseases

    doi: 10.3201/eid2101.140766

    Comparison of extraction methods used for development of tissue-based universal virus detection for viral metagenomics protocol. Copy numbers were measured by quantitative PCR in duplicate. RQ, relative quantification: RQ (2 – ΔΔCt); (ΔΔCt = Δ purified – Δ unprocessed). Lower panel left y-axis indicates signal-to-noise ratio (RQ) for all viruses tested. The method with the highest score was used to establish the protocol and is shaded in yellow. Red stars indicate highest scores. Diagonally striped area indicates not significant. Ct, cycle threshold. Numbers along baseline indicate method used. 1, Nucleospin RNA II (Macherey Nagel, Dueren, Germany); 2, Nucleospin DNA (Macherey Nagel); 3, RTP DNA/RNA Virus Ultra Sense (Invitek, Berlin Germany); 4, RTP DNA/RNA Virus Mini Kit (Invitek); 5, QIAmp UltraSens Virus Kit (QIAGEN, Hilden, Germany); 6, Viral Mini Kit (QIAGEN); 7, QIAmp MinElute Virus Spin Kit (QIAGEN); 8, PureLink Viral RNA/DNA (Invitrogen Life Technologies, Grand Island, NY, USA); 9, TRIzol LS; 10, phenol chloroform.
    Figure Legend Snippet: Comparison of extraction methods used for development of tissue-based universal virus detection for viral metagenomics protocol. Copy numbers were measured by quantitative PCR in duplicate. RQ, relative quantification: RQ (2 – ΔΔCt); (ΔΔCt = Δ purified – Δ unprocessed). Lower panel left y-axis indicates signal-to-noise ratio (RQ) for all viruses tested. The method with the highest score was used to establish the protocol and is shaded in yellow. Red stars indicate highest scores. Diagonally striped area indicates not significant. Ct, cycle threshold. Numbers along baseline indicate method used. 1, Nucleospin RNA II (Macherey Nagel, Dueren, Germany); 2, Nucleospin DNA (Macherey Nagel); 3, RTP DNA/RNA Virus Ultra Sense (Invitek, Berlin Germany); 4, RTP DNA/RNA Virus Mini Kit (Invitek); 5, QIAmp UltraSens Virus Kit (QIAGEN, Hilden, Germany); 6, Viral Mini Kit (QIAGEN); 7, QIAmp MinElute Virus Spin Kit (QIAGEN); 8, PureLink Viral RNA/DNA (Invitrogen Life Technologies, Grand Island, NY, USA); 9, TRIzol LS; 10, phenol chloroform.

    Techniques Used: Real-time Polymerase Chain Reaction, Purification

    23) Product Images from "Components of the interleukin-33/ST2 system are differentially expressed and regulated in human cardiac cells and in cells of the cardiac vasculature"

    Article Title: Components of the interleukin-33/ST2 system are differentially expressed and regulated in human cardiac cells and in cells of the cardiac vasculature

    Journal: Journal of Molecular and Cellular Cardiology

    doi: 10.1016/j.yjmcc.2013.03.020

    Expression of ST2 receptor isoforms in human cardiac cells and in vascular cells. Human adult cardiac fibroblasts (HACF), human adult cardiac myocytes (HACM), human aortic smooth muscle cells (HASMC), human coronary artery smooth muscle cells (HCASMC), human umbilical vein endothelial cells (HUVEC), human coronary artery endothelial cells (HCAEC), human aortic endothelial cells (HAEC), and human heart microvascular endothelial cells (HHMEC) were left untreated. mRNA was prepared, cDNA was additionally eluted with MinElute PCR Purification Kit and equal amount of cDNA was used for RealTime-PCR with primers specific for totalST2 (A), ST2L (B), or sST2 (C) as described in “ Materials and methods ”. Values are given as x-fold of HAEC, which was set as 1 and represent mean ± SD. Experiments were performed with cells obtained from at least 3 different donors for each type of cells.
    Figure Legend Snippet: Expression of ST2 receptor isoforms in human cardiac cells and in vascular cells. Human adult cardiac fibroblasts (HACF), human adult cardiac myocytes (HACM), human aortic smooth muscle cells (HASMC), human coronary artery smooth muscle cells (HCASMC), human umbilical vein endothelial cells (HUVEC), human coronary artery endothelial cells (HCAEC), human aortic endothelial cells (HAEC), and human heart microvascular endothelial cells (HHMEC) were left untreated. mRNA was prepared, cDNA was additionally eluted with MinElute PCR Purification Kit and equal amount of cDNA was used for RealTime-PCR with primers specific for totalST2 (A), ST2L (B), or sST2 (C) as described in “ Materials and methods ”. Values are given as x-fold of HAEC, which was set as 1 and represent mean ± SD. Experiments were performed with cells obtained from at least 3 different donors for each type of cells.

    Techniques Used: Expressing, Polymerase Chain Reaction, Purification

    24) Product Images from "Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application"

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application

    Journal: BMC Genomics

    doi: 10.1186/s12864-017-4371-5

    DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown
    Figure Legend Snippet: DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown

    Techniques Used: DNA Purification, Chromatin Immunoprecipitation, Purification, Generated, Derivative Assay, Polymerase Chain Reaction, Amplification, Real-time Polymerase Chain Reaction

    25) Product Images from "Germline transformation of the stalk-eyed fly, Teleopsis dalmanni"

    Article Title: Germline transformation of the stalk-eyed fly, Teleopsis dalmanni

    Journal: BMC Molecular Biology

    doi: 10.1186/1471-2199-11-86

    PCR-based assays for transposon excision in T. dalmanni embryos . (A) Schematic representation of a PCR-based excision assay. Donor plasmids contain the terminal inverted repeats (TIRs), from the piggyBac, mariner or Minos transposon, flanking a transgene. In the presence of transposase, donor plasmids undergo excision of the transgene.
    Figure Legend Snippet: PCR-based assays for transposon excision in T. dalmanni embryos . (A) Schematic representation of a PCR-based excision assay. Donor plasmids contain the terminal inverted repeats (TIRs), from the piggyBac, mariner or Minos transposon, flanking a transgene. In the presence of transposase, donor plasmids undergo excision of the transgene. "Excision primers" (red arrows) flank the entire construct including the TIRs. PCR of the unexcised construct will give rise to a product too large to be amplified efficiently (2-10 kb) under standard conditions. Amplification post-excision produces a smaller product (0.1-1 kb). Excision primers are validated using modified donor plasmids, from which the element had been excised by digestion with an appropriate restriction enzyme, as control templates. "Extraction primers" (blue arrows) amplify part of the donor plasmid backbone to demonstrate successful extraction of the donor plasmid from injected embryos. PCR with these primers produces the same size product (0.1-1 kb) both pre-and post-excision. (B-E) Results of the excision assay using piggyBac (B), mariner (C) and Minos (D and E). Templates for PCR were: DNA extracted from embryos injected with donor plasmid and a source of transposase (with transposase); DNA extracted from embryos with donor plasmid without a source of transposase (without transposase); donor plasmid control templates (+ve control); water (-ve control). PCR reactions either used excision primers (red lettering) to test for excision of the transposable element, or extraction primers (blue lettering) to test for successful extraction of the plasmids from injected embryos (see Additional file 2 : Table S1). White triangles denote the expected size of the excision primer PCR product post-excision of the element. For the piggyBac (B) and mariner (C) assays, a DNA source of transposase was used. For the Minos assays both a DNA source of transposase (D) and an mRNA source of transposase were tested (E). Excision was detected for piggyBac and both Minos assays when the donor plasmid was injected with a source of transposase but not in the mariner assay. No excision was detected when donor plasmids were injected without a source of transposase indicating a lack of endogenous transposase activity in the embryos. In all cases donor plasmids were successfully extracted from embryos.

    Techniques Used: Polymerase Chain Reaction, Excision Assay, Construct, Amplification, Modification, Plasmid Preparation, Injection, Activity Assay

    26) Product Images from "Methylation of H2AR29 is a novel repressive PRMT6 target"

    Article Title: Methylation of H2AR29 is a novel repressive PRMT6 target

    Journal: Epigenetics & Chromatin

    doi: 10.1186/1756-8935-4-11

    H2AR29me2 is enriched at genes repressed by protein arginine methyltransferase (PRMT)6 . (A) H2AR29me2 was found to be enriched in less accessible chromatin fractions. Kinetic of micrococcal digestion of chromatin [ 28 ]. Kinetic of micrococcal digestion of chromatin [ 28 ] is shown. The abundance of the indicated histones modifications in the fractions was tested by western blotting with specific antibodies. (B) PRMT6 was overexpressed in HEK293 cells. Expression levels of the indicated genes were measured by real-time PCR and normalized to β-actin. The relative expression of the normalized genes in control and PRMT6-overexpressing cells was quantified using the ΔCt method, and the resulting relative quantification (RQ) values were plotted in a bar graph on a logarithmic scale. The cross indicates genes not expressed in HEK293 (GEO: record GSE11892; [ 20 ]). (C) Chromatin immunoprecipitation assay with H2AR29me2 antibody. Purified DNA from immunoprecipitated chromatin fragments from HEK293 cells was amplified by real-time PCR with specific primer sets for indicated gene promoters (see Additional file 6, Table S1). The enrichment of precipitated chromatin relative to an intergenic region was determined and plotted in a bar graph. Error (standard deviation) bars are shown.
    Figure Legend Snippet: H2AR29me2 is enriched at genes repressed by protein arginine methyltransferase (PRMT)6 . (A) H2AR29me2 was found to be enriched in less accessible chromatin fractions. Kinetic of micrococcal digestion of chromatin [ 28 ]. Kinetic of micrococcal digestion of chromatin [ 28 ] is shown. The abundance of the indicated histones modifications in the fractions was tested by western blotting with specific antibodies. (B) PRMT6 was overexpressed in HEK293 cells. Expression levels of the indicated genes were measured by real-time PCR and normalized to β-actin. The relative expression of the normalized genes in control and PRMT6-overexpressing cells was quantified using the ΔCt method, and the resulting relative quantification (RQ) values were plotted in a bar graph on a logarithmic scale. The cross indicates genes not expressed in HEK293 (GEO: record GSE11892; [ 20 ]). (C) Chromatin immunoprecipitation assay with H2AR29me2 antibody. Purified DNA from immunoprecipitated chromatin fragments from HEK293 cells was amplified by real-time PCR with specific primer sets for indicated gene promoters (see Additional file 6, Table S1). The enrichment of precipitated chromatin relative to an intergenic region was determined and plotted in a bar graph. Error (standard deviation) bars are shown.

    Techniques Used: Western Blot, Expressing, Real-time Polymerase Chain Reaction, Chromatin Immunoprecipitation, Purification, Immunoprecipitation, Amplification, Standard Deviation

    27) Product Images from "Genome-wide mapping of 8-oxo-7,8-dihydro-2′-deoxyguanosine reveals accumulation of oxidatively-generated damage at DNA replication origins within transcribed long genes of mammalian cells"

    Article Title: Genome-wide mapping of 8-oxo-7,8-dihydro-2′-deoxyguanosine reveals accumulation of oxidatively-generated damage at DNA replication origins within transcribed long genes of mammalian cells

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gky1152

    ( A ) Number of 8-oxodGs per million of dGs (8-oxodg/10 6 dG) measured by LC-MS/MS in untreated (NT), UV-irradiated (UV) and NAC-treated (NAC) MCF10A cells, as indicated. ( B ) Efficiency of polyclonal anti-8-oxodG from Millipore (Ab M), or monoclonal anti-8-oxodG from Trevigen (Ab T), and of anti-IgG antibodies in immuno-precipitation assays of 8-oxodG-containing synthetic ssDNA or G4 structures, as indicated. ( C ) Anti-8oxodG immuno-precipitation assay (% of input DNA, measured by qPCR; y axis) with equal amount (64 pg) of both synthetic oligonucleotides (8-oxodG-100mer and dG-100mer) added to 1 μg of NAC-treated genomic DNA. C1 and C2 indicate the same genomic negative control regions as in panel G. ( D ) Screenshot from the UCSC genome browser of 3.7 Mb from human chromosome 19 showing (top to bottom): OxiDIP-Seq signal profile, 8-oxodG peaks (dots), Input DNA, CG%, and RefSeq genes. ( E ) Screenshot from the UCSC genome browser of 2.1 Mb from human chromosome 19 showing OxiDIP-Seq signal profiles of two independent experiments (Exp #1 and #2) and Input DNA. ( F ) Scatter plot showing the correlation of the OxiDIP-Seq signals obtained in two independent experiments (Exp #1 and #2). Pearson's correlation coefficient (r), as indicated. Figure inset shows magnification of the high-density region. ( G ) OxiDIP-qPCR showing 8-oxodG enrichments (% of Input DNA) at eight different positive (#1–8) and two negative (C1, C2) regions, in untreated (black bar), UV- (gray), or NAC-treated (white) MCF10A cells. Screenshots from the UCSC genome browser show genomic position, 8-oxodG signal intensity, and qPCR probes (black box) of the selected regions. Data from two independent OxiDIP-qPCR assays are shown (±S.D.; P
    Figure Legend Snippet: ( A ) Number of 8-oxodGs per million of dGs (8-oxodg/10 6 dG) measured by LC-MS/MS in untreated (NT), UV-irradiated (UV) and NAC-treated (NAC) MCF10A cells, as indicated. ( B ) Efficiency of polyclonal anti-8-oxodG from Millipore (Ab M), or monoclonal anti-8-oxodG from Trevigen (Ab T), and of anti-IgG antibodies in immuno-precipitation assays of 8-oxodG-containing synthetic ssDNA or G4 structures, as indicated. ( C ) Anti-8oxodG immuno-precipitation assay (% of input DNA, measured by qPCR; y axis) with equal amount (64 pg) of both synthetic oligonucleotides (8-oxodG-100mer and dG-100mer) added to 1 μg of NAC-treated genomic DNA. C1 and C2 indicate the same genomic negative control regions as in panel G. ( D ) Screenshot from the UCSC genome browser of 3.7 Mb from human chromosome 19 showing (top to bottom): OxiDIP-Seq signal profile, 8-oxodG peaks (dots), Input DNA, CG%, and RefSeq genes. ( E ) Screenshot from the UCSC genome browser of 2.1 Mb from human chromosome 19 showing OxiDIP-Seq signal profiles of two independent experiments (Exp #1 and #2) and Input DNA. ( F ) Scatter plot showing the correlation of the OxiDIP-Seq signals obtained in two independent experiments (Exp #1 and #2). Pearson's correlation coefficient (r), as indicated. Figure inset shows magnification of the high-density region. ( G ) OxiDIP-qPCR showing 8-oxodG enrichments (% of Input DNA) at eight different positive (#1–8) and two negative (C1, C2) regions, in untreated (black bar), UV- (gray), or NAC-treated (white) MCF10A cells. Screenshots from the UCSC genome browser show genomic position, 8-oxodG signal intensity, and qPCR probes (black box) of the selected regions. Data from two independent OxiDIP-qPCR assays are shown (±S.D.; P

    Techniques Used: Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry, Irradiation, Immunoprecipitation, Real-time Polymerase Chain Reaction, Negative Control

    28) Product Images from "Immuno-SABER enables highly multiplexed and amplified protein imaging in tissues"

    Article Title: Immuno-SABER enables highly multiplexed and amplified protein imaging in tissues

    Journal: Nature biotechnology

    doi: 10.1038/s41587-019-0207-y

    Immuno-SABER schematic. (a) PER mechanism 29 : (1) A 9-mer primer of sequence a binds to the single stranded a* sequence on the hairpin (* denotes complementarity). (2) The primer is extended by a strand displacing polymerase (e.g. Bst) isothermally and autonomously. The hairpin features a stopper sequence that halts polymerization, which releases the polymerase. (3) The newly synthesized a is displaced from the hairpin through branch migration. (4) The extended primer and the hairpin autonomously dissociate. (5) Repetition of this copy-and-release process produces a long concatemer of a . (b) Immuno-SABER schematic: (1a) Antibodies conjugated with bridge strands are used to simultaneously stain multiple targets. (1b) Primer sequences (green) are independently extended to a controlled length using PER. (2) Concatemers hybridize to the bridge sequence (blue) on the antibody. (3) Fluorophore (purple star)-labeled 20-mer DNA “imager” strands hybridize to the repeated binding sites on the concatemers. Each imager is designed to bind to a dimer of the unit primer sequence. (c) Exchange-SABER schematic: (1) Different biological targets (t.1 to t.n) are labeled with antibodies conjugated to orthogonal bridge strands (b.1 to b.n). (2) Orthogonal pre-extended concatemers are hybridized (via bridge complements b.1* to b.n*) to the bridge strands on the antibodies simultaneously. (3) Target t.1 is visualized by hybridization of imager i.1* to the i.1 sites on the concatemer bound to b.1 on the corresponding antibody, (4) Multiple targets can be imaged sequentially hybridization and dehybridization of orthogonal imagers in multiple rapid exchange cycles. (5) The images are computationally aligned and pseudo-colorized to overlay different targets.
    Figure Legend Snippet: Immuno-SABER schematic. (a) PER mechanism 29 : (1) A 9-mer primer of sequence a binds to the single stranded a* sequence on the hairpin (* denotes complementarity). (2) The primer is extended by a strand displacing polymerase (e.g. Bst) isothermally and autonomously. The hairpin features a stopper sequence that halts polymerization, which releases the polymerase. (3) The newly synthesized a is displaced from the hairpin through branch migration. (4) The extended primer and the hairpin autonomously dissociate. (5) Repetition of this copy-and-release process produces a long concatemer of a . (b) Immuno-SABER schematic: (1a) Antibodies conjugated with bridge strands are used to simultaneously stain multiple targets. (1b) Primer sequences (green) are independently extended to a controlled length using PER. (2) Concatemers hybridize to the bridge sequence (blue) on the antibody. (3) Fluorophore (purple star)-labeled 20-mer DNA “imager” strands hybridize to the repeated binding sites on the concatemers. Each imager is designed to bind to a dimer of the unit primer sequence. (c) Exchange-SABER schematic: (1) Different biological targets (t.1 to t.n) are labeled with antibodies conjugated to orthogonal bridge strands (b.1 to b.n). (2) Orthogonal pre-extended concatemers are hybridized (via bridge complements b.1* to b.n*) to the bridge strands on the antibodies simultaneously. (3) Target t.1 is visualized by hybridization of imager i.1* to the i.1 sites on the concatemer bound to b.1 on the corresponding antibody, (4) Multiple targets can be imaged sequentially hybridization and dehybridization of orthogonal imagers in multiple rapid exchange cycles. (5) The images are computationally aligned and pseudo-colorized to overlay different targets.

    Techniques Used: Sequencing, Synthesized, Migration, Staining, Labeling, Binding Assay, Hybridization

    Exchange-SABER in mouse retina cryosections. (a) 10 protein targets labeling various retinal cell types were visualized in 40 μm mouse retina cryosections. The markers targeted with Immuno-SABER were Rhodopsin (rod photoreceptors), GFAP (astrocytes), Vimentin (Muller cells 9 ), Collagen IV (blood vessels), three calcium binding proteins 49 , 50 VLP1, Calretinin (found in a subset of amacrine and ganglion cells) and Calbindin (note that although Calbindin was suggested to be also found in a subset of amacrine and ganglion cells, the Calbindin antibody used here mostly labels horizontal cells 50 ), and PKCα (blue cone cells and rod bipolar cells 50 ). The sections were first incubated with all DNA-conjugated antibodies simultaneously. All SABER concatemers were then added simultaneously to the sample, followed by washing and sequential incorporation of the imager strands and multi-round imaging. A z-stack of images was acquired for each target, and DAPI was imaged in every exchange cycle to monitor sample drift. The maximum projected images of each stack were computationally aligned using a subpixel registration algorithm using DAPI as the drift marker 9 , and pseudo-colored for the overlay presentation. (b) Zoom-in view of the area marked by the white rectangle in a . Three cell subtypes (marked with arrows, I: VLP1 + and Calretinin + , II: VLP1 − and Calretinin + , III: VLP1 + and Calretinin − ) can be differentiated based on VLP1 and Calretinin expression.
    Figure Legend Snippet: Exchange-SABER in mouse retina cryosections. (a) 10 protein targets labeling various retinal cell types were visualized in 40 μm mouse retina cryosections. The markers targeted with Immuno-SABER were Rhodopsin (rod photoreceptors), GFAP (astrocytes), Vimentin (Muller cells 9 ), Collagen IV (blood vessels), three calcium binding proteins 49 , 50 VLP1, Calretinin (found in a subset of amacrine and ganglion cells) and Calbindin (note that although Calbindin was suggested to be also found in a subset of amacrine and ganglion cells, the Calbindin antibody used here mostly labels horizontal cells 50 ), and PKCα (blue cone cells and rod bipolar cells 50 ). The sections were first incubated with all DNA-conjugated antibodies simultaneously. All SABER concatemers were then added simultaneously to the sample, followed by washing and sequential incorporation of the imager strands and multi-round imaging. A z-stack of images was acquired for each target, and DAPI was imaged in every exchange cycle to monitor sample drift. The maximum projected images of each stack were computationally aligned using a subpixel registration algorithm using DAPI as the drift marker 9 , and pseudo-colored for the overlay presentation. (b) Zoom-in view of the area marked by the white rectangle in a . Three cell subtypes (marked with arrows, I: VLP1 + and Calretinin + , II: VLP1 − and Calretinin + , III: VLP1 + and Calretinin − ) can be differentiated based on VLP1 and Calretinin expression.

    Techniques Used: Labeling, Binding Assay, Incubation, Imaging, Marker, Expressing

    Multiplexed super-resolution imaging using Expansion-SABER. (a) 40 μm mouse retina cryosections were stained for SV2 using DNA-conjugated SV2 antibodies, followed by SABER concatemer hybridization. Before and after images were respectively acquired before hydrogel formation, or after hydrogel formation and expansion (~3-fold), using the original expansion protocol 31 , 39 . (b) Images of pre- and post-synaptic sites of neuronal synapses in fixed primary mouse hippocampal neuron culture samples with and without expansion (different fields of view are shown). The pre-synaptic sites were labeled with anti-Bassoon antibodies and the post-synaptic sites were labeled with anti-Homer1 antibodies. DNA-conjugated secondary antibodies were used to target Bassoon and Homer1 primary antibodies, followed by SABER concatemers application. (c) ExM imaging of 6 protein targets in the originally 40 μm-thick mouse retina section (expanded ~3-folds) with Exchange-SABER. 2 exchange rounds with Atto488-, Atto565- and Alexa647- conjugated imager strands were performed to visualize all 6 targets in the expanded samples. DAPI was imaged in both rounds to serve as a registration marker. The images are maximum projections of z-stacks, drift-corrected using DAPI channels, and pseudo-colored for presentation. A zoom-in view of the boxed region is available in Supplementary Fig. 9b .
    Figure Legend Snippet: Multiplexed super-resolution imaging using Expansion-SABER. (a) 40 μm mouse retina cryosections were stained for SV2 using DNA-conjugated SV2 antibodies, followed by SABER concatemer hybridization. Before and after images were respectively acquired before hydrogel formation, or after hydrogel formation and expansion (~3-fold), using the original expansion protocol 31 , 39 . (b) Images of pre- and post-synaptic sites of neuronal synapses in fixed primary mouse hippocampal neuron culture samples with and without expansion (different fields of view are shown). The pre-synaptic sites were labeled with anti-Bassoon antibodies and the post-synaptic sites were labeled with anti-Homer1 antibodies. DNA-conjugated secondary antibodies were used to target Bassoon and Homer1 primary antibodies, followed by SABER concatemers application. (c) ExM imaging of 6 protein targets in the originally 40 μm-thick mouse retina section (expanded ~3-folds) with Exchange-SABER. 2 exchange rounds with Atto488-, Atto565- and Alexa647- conjugated imager strands were performed to visualize all 6 targets in the expanded samples. DAPI was imaged in both rounds to serve as a registration marker. The images are maximum projections of z-stacks, drift-corrected using DAPI channels, and pseudo-colored for presentation. A zoom-in view of the boxed region is available in Supplementary Fig. 9b .

    Techniques Used: Imaging, Staining, Hybridization, Labeling, Marker

    29) Product Images from "A linear plasmid truncation induces unidirectional flagellar phase change in H:z66 positive Salmonella Typhi"

    Article Title: A linear plasmid truncation induces unidirectional flagellar phase change in H:z66 positive Salmonella Typhi

    Journal: Molecular Microbiology

    doi: 10.1111/j.1365-2958.2007.05995.x

    Molecular basis of fljB z66 to fliC phase change. A. Agarose gel electrophoresis of alkaline lysis plasmid preparation from S. Typhi strains pre- and post-phase switch. Lane 1, S. Typhi 403ty -fliC (j) (j); Lane 2, 403tya; Lane 3, 403tyb; Lane 4, 403tyc; Lane 5, 403tyd; Lane 6, S. Typhi 404ty -fliC (d); Lane 7, 404tya; Lane 8, 404tyb; Lane 4, 404tyc; Lane 5, 404tyd. Sizes are estimated with respect to pBSSB1 (27, 037 kbp) isolated from S. Typhi 403ty(j) and S. Typhi 404ty -fliC (d). B. Agarose gel of PCR amplicons produced to identify the nature of the deletion produced post phase change in strains derived from S. Typhi 403ty- fliC (j). The target for the PCR primers are; (i) fliC , primers fliC_F/R; (ii) fljB z66 , primers z66flag_F/R; (iii) terminal inverted repeat (tir), primers tir_a, tir_d and tir_e. Each panel represents template genomic DNA from: 1, S. Typhi 403ty -fliC (j); 2, 403tya; 3, 403tyb; 4, 403tyc and 5, 403tyd. Sizes are compared with migration of Hyperladder I (Bioline). C. PCR amplifications as B using genomic template DNA from: 1, S. Typhi 404ty -fliC (d); 2, 404tya; 3, 404tyb; 4, 404tyc and 5, 404tyd.
    Figure Legend Snippet: Molecular basis of fljB z66 to fliC phase change. A. Agarose gel electrophoresis of alkaline lysis plasmid preparation from S. Typhi strains pre- and post-phase switch. Lane 1, S. Typhi 403ty -fliC (j) (j); Lane 2, 403tya; Lane 3, 403tyb; Lane 4, 403tyc; Lane 5, 403tyd; Lane 6, S. Typhi 404ty -fliC (d); Lane 7, 404tya; Lane 8, 404tyb; Lane 4, 404tyc; Lane 5, 404tyd. Sizes are estimated with respect to pBSSB1 (27, 037 kbp) isolated from S. Typhi 403ty(j) and S. Typhi 404ty -fliC (d). B. Agarose gel of PCR amplicons produced to identify the nature of the deletion produced post phase change in strains derived from S. Typhi 403ty- fliC (j). The target for the PCR primers are; (i) fliC , primers fliC_F/R; (ii) fljB z66 , primers z66flag_F/R; (iii) terminal inverted repeat (tir), primers tir_a, tir_d and tir_e. Each panel represents template genomic DNA from: 1, S. Typhi 403ty -fliC (j); 2, 403tya; 3, 403tyb; 4, 403tyc and 5, 403tyd. Sizes are compared with migration of Hyperladder I (Bioline). C. PCR amplifications as B using genomic template DNA from: 1, S. Typhi 404ty -fliC (d); 2, 404tya; 3, 404tyb; 4, 404tyc and 5, 404tyd.

    Techniques Used: Agarose Gel Electrophoresis, Alkaline Lysis, Plasmid Preparation, Isolation, Polymerase Chain Reaction, Produced, Derivative Assay, Migration

    Sothern blotting investigation of truncated linear plasmid. A. Analysis of tir region of pBSSB1 and derivatives using labelled DNA prepared from a PCR amplicon (primers tir_f and tir_g) generated with template DNA from S. Typhi 404ty -fliC (d) as probe against genomic DNA digested with EcoRV. Lanes: 1, S. Typhi 403ty -fliC (j); 2, 403tya; 3, 403tyb; 4, 403tyc; 5, 403tyd; 6, S. Typhi 404ty -fliC (d); 7, 404tya; 8, 404tyb; 9, 404tyc and 10, 404tyd. Sizes estimated to migration of Hyperladder I (Bioline). B. Analysis of new right terminus of the truncated plasmids. Genomic DNA digested with SacI and probed with a PCR amplicon specific for the 5′ region of the fljB z66 gene generated with template DNA from S. Typhi 404ty -fliC (d). Lanes as Fig. 5A .
    Figure Legend Snippet: Sothern blotting investigation of truncated linear plasmid. A. Analysis of tir region of pBSSB1 and derivatives using labelled DNA prepared from a PCR amplicon (primers tir_f and tir_g) generated with template DNA from S. Typhi 404ty -fliC (d) as probe against genomic DNA digested with EcoRV. Lanes: 1, S. Typhi 403ty -fliC (j); 2, 403tya; 3, 403tyb; 4, 403tyc; 5, 403tyd; 6, S. Typhi 404ty -fliC (d); 7, 404tya; 8, 404tyb; 9, 404tyc and 10, 404tyd. Sizes estimated to migration of Hyperladder I (Bioline). B. Analysis of new right terminus of the truncated plasmids. Genomic DNA digested with SacI and probed with a PCR amplicon specific for the 5′ region of the fljB z66 gene generated with template DNA from S. Typhi 404ty -fliC (d). Lanes as Fig. 5A .

    Techniques Used: Plasmid Preparation, Polymerase Chain Reaction, Amplification, Generated, Migration

    Indentification of S. Typhi flagellar antigens. A. Western blotting of various S. Typhi mid-log phase whole-cell lysates with anti-z66 flagellar antibody. Lane 1, S. Typhi Ty2; Lane 2, S. Typhi Ty2(Δ fliC ); Lane 3, S. Typhi 403ty- fliC (j); Lane 4, S. Typhi 404ty -fliC (d); Lane 5, S. Typhi 404ty Δ fljB z66 ; Lane 6, S. Typhi 404ty Δ fljA z66 ; Lane 7, S. Typhi 404ty Δ fljB z66 , Δ fljA z66 ; Lane 8, S. Typhi 403tya -fliC (j) (post-phase switch); Lane 9, S. Typhi 404tya -fliC (d) (post-phase switch). Protein sizes were estimated on SDS-PAGE gels prior to transfer with seeblue2 protein ladder (Invitrogen). B. Western blotting of various S. Typhi whole-cell lysates with anti-d flagellar antibody. Lanes as A. C. Western blotting of various S. Typhi whole-cell lysates with non-specific Salmonella flagellar antibody. Lanes as A. D. RT-PCR detecting mRNA transcription of aroC (lanes a, primers aroC_RT_F/R, 100 bp), fliC (lanes b, primers fliC_RT_F/R 150, bp), fljB z66 (lanes c, primers fljB_RT_F/R, 200 bp) and fljA z66 (lanes d, primers fljA_RT_F/R, 250 bp). Panel 1, genomic DNA from S. Typhi 404ty -fliC (d); panel 2, cDNA from S. Typhi Ty2; panel 3, cDNA from S. Typhi 404ty -fliC (d); panel 4, cDNA from S. Typhi 404ty -fliC (d)Δ fljB z66 ; panel 5, cDNA from S. Typhi 404ty -fliC (d) Δ fljA z66 and panel 6, cDNA from S. Typhi 404ty -fliC (d) Δ fljB z66 , Δ fljA z66 . Sizes are compared with the migration of Hyperladder IV (Bioline).
    Figure Legend Snippet: Indentification of S. Typhi flagellar antigens. A. Western blotting of various S. Typhi mid-log phase whole-cell lysates with anti-z66 flagellar antibody. Lane 1, S. Typhi Ty2; Lane 2, S. Typhi Ty2(Δ fliC ); Lane 3, S. Typhi 403ty- fliC (j); Lane 4, S. Typhi 404ty -fliC (d); Lane 5, S. Typhi 404ty Δ fljB z66 ; Lane 6, S. Typhi 404ty Δ fljA z66 ; Lane 7, S. Typhi 404ty Δ fljB z66 , Δ fljA z66 ; Lane 8, S. Typhi 403tya -fliC (j) (post-phase switch); Lane 9, S. Typhi 404tya -fliC (d) (post-phase switch). Protein sizes were estimated on SDS-PAGE gels prior to transfer with seeblue2 protein ladder (Invitrogen). B. Western blotting of various S. Typhi whole-cell lysates with anti-d flagellar antibody. Lanes as A. C. Western blotting of various S. Typhi whole-cell lysates with non-specific Salmonella flagellar antibody. Lanes as A. D. RT-PCR detecting mRNA transcription of aroC (lanes a, primers aroC_RT_F/R, 100 bp), fliC (lanes b, primers fliC_RT_F/R 150, bp), fljB z66 (lanes c, primers fljB_RT_F/R, 200 bp) and fljA z66 (lanes d, primers fljA_RT_F/R, 250 bp). Panel 1, genomic DNA from S. Typhi 404ty -fliC (d); panel 2, cDNA from S. Typhi Ty2; panel 3, cDNA from S. Typhi 404ty -fliC (d); panel 4, cDNA from S. Typhi 404ty -fliC (d)Δ fljB z66 ; panel 5, cDNA from S. Typhi 404ty -fliC (d) Δ fljA z66 and panel 6, cDNA from S. Typhi 404ty -fliC (d) Δ fljB z66 , Δ fljA z66 . Sizes are compared with the migration of Hyperladder IV (Bioline).

    Techniques Used: Western Blot, SDS Page, Reverse Transcription Polymerase Chain Reaction, Migration

    30) Product Images from "Chromosomal instability in enterohaemorrhagic Escherichia coli O157:H7: impact on adherence, tellurite resistance and colony phenotype"

    Article Title: Chromosomal instability in enterohaemorrhagic Escherichia coli O157:H7: impact on adherence, tellurite resistance and colony phenotype

    Journal: Molecular Microbiology

    doi: 10.1111/j.1365-2958.2010.07499.x

    Amplification of serW , serX and the upstream (UJ) and downstream (DJ) junctions of OIs 43 and 48 in L and S variants of EHEC O157:H7 strains. Strains tested, PCR targets and lengths of PCR amplicons are listed across the top and to the left and right of the rows of amplicons respectively. Purified chromosomal DNA (20 ng) was used as a template in all PCRs. In PCRs targeting serW and serX , the presence of an amplicon of the same intensity as that from the positive control strain 493/89 (sorbitol-fermenting, ter -negative EHEC O157:NM that has intact serW and serX , as determined by sequence analysis in this study) indicates that the target locus is intact; the absence of an amplicon combined with amplification of UJ and DJ of the respective OI indicates that the locus is occupied by this OI. Amplification of UJs of OI 43 and OI 48 in strain 95S is hindered by the absence of the 5′ end of each OI in this strain ( Fig. 2 ).
    Figure Legend Snippet: Amplification of serW , serX and the upstream (UJ) and downstream (DJ) junctions of OIs 43 and 48 in L and S variants of EHEC O157:H7 strains. Strains tested, PCR targets and lengths of PCR amplicons are listed across the top and to the left and right of the rows of amplicons respectively. Purified chromosomal DNA (20 ng) was used as a template in all PCRs. In PCRs targeting serW and serX , the presence of an amplicon of the same intensity as that from the positive control strain 493/89 (sorbitol-fermenting, ter -negative EHEC O157:NM that has intact serW and serX , as determined by sequence analysis in this study) indicates that the target locus is intact; the absence of an amplicon combined with amplification of UJ and DJ of the respective OI indicates that the locus is occupied by this OI. Amplification of UJs of OI 43 and OI 48 in strain 95S is hindered by the absence of the 5′ end of each OI in this strain ( Fig. 2 ).

    Techniques Used: Amplification, Polymerase Chain Reaction, Purification, Positive Control, Sequencing

    31) Product Images from "Unfolded Protein Response (UPR) Regulator Cib1 Controls Expression of Genes Encoding Secreted Virulence Factors in Ustilago maydis"

    Article Title: Unfolded Protein Response (UPR) Regulator Cib1 Controls Expression of Genes Encoding Secreted Virulence Factors in Ustilago maydis

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0153861

    qChIP analysis of Cib1 binding to the pit1/2 - and tin1-1 -promoter. (A) Schematic overview of promoter organization and probe regions used for qChIP experiments. Sequence of the predicted Cib1 binding sites (UPRE) in the pit1/2 and tin1-1 promoter region is given in bold in case of identical nucleotides in pit1/2 and tin1-1 UPREs. (B) qChIP analysis of Cib1 binding to the pit1/2 and tin1-1 promoter in strain SG200 cib1-3xHA 3 h after DTT (3 mM) treatment. The HA-tagged Cib1 protein was immunoprecipitated with anti HA-antibody coupled agarose beads (Sigma). Enrichment of immunoprecipitated DNA is shown relative to the input control. PCR-amplicons corresponding to the pit1/2 and tin1-1 promoter are significantly enriched compared to ORF controls. No significant enrichment was observed for PCR-amplicons corresponding to pit1 , pit2 and tin1-1 ORFs in comparison to the eIF2b control. Given are the mean values of four independent experiments. Error bars represent the standard error (SE). Statistical significance was tested using Student's t -test. *indicates p-value
    Figure Legend Snippet: qChIP analysis of Cib1 binding to the pit1/2 - and tin1-1 -promoter. (A) Schematic overview of promoter organization and probe regions used for qChIP experiments. Sequence of the predicted Cib1 binding sites (UPRE) in the pit1/2 and tin1-1 promoter region is given in bold in case of identical nucleotides in pit1/2 and tin1-1 UPREs. (B) qChIP analysis of Cib1 binding to the pit1/2 and tin1-1 promoter in strain SG200 cib1-3xHA 3 h after DTT (3 mM) treatment. The HA-tagged Cib1 protein was immunoprecipitated with anti HA-antibody coupled agarose beads (Sigma). Enrichment of immunoprecipitated DNA is shown relative to the input control. PCR-amplicons corresponding to the pit1/2 and tin1-1 promoter are significantly enriched compared to ORF controls. No significant enrichment was observed for PCR-amplicons corresponding to pit1 , pit2 and tin1-1 ORFs in comparison to the eIF2b control. Given are the mean values of four independent experiments. Error bars represent the standard error (SE). Statistical significance was tested using Student's t -test. *indicates p-value

    Techniques Used: Binding Assay, Sequencing, Immunoprecipitation, Polymerase Chain Reaction

    32) Product Images from "Variable Episomal Silencing of a Recombinant Herpesvirus Renders Its Encoded GFP an Unreliable Marker of Infection in Primary Cells"

    Article Title: Variable Episomal Silencing of a Recombinant Herpesvirus Renders Its Encoded GFP an Unreliable Marker of Infection in Primary Cells

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0111502

    Reversal of MM7.219 GFP silencing by valproic acid treatment. At 79 days post-infection, MM7.219 (dark gray bars) and MM36.219 cultures (light gray bars) were exposed to valproic acid (VPA) at the listed concentrations for 54 hours. The percent cells that were GFP + are shown for the listed doses of VPA (A). The percentage of cells scoring positive for RFP at these doses is also shown (B). In a separate experiment performed 32 days post infection, silenced MM7.219 cultures were treated with 5 mM VPA for 2 days. Enrichment of the active H3K4me3 histone mark across four positions on the rKSHV.219 episome are shown as % of input DNA (C). Similarly, repressive H3K27me3 association is shown for the same four regions (D). Values represent the mean +/- S.D. of 4 to 5 PCR replicates (see Methods ).
    Figure Legend Snippet: Reversal of MM7.219 GFP silencing by valproic acid treatment. At 79 days post-infection, MM7.219 (dark gray bars) and MM36.219 cultures (light gray bars) were exposed to valproic acid (VPA) at the listed concentrations for 54 hours. The percent cells that were GFP + are shown for the listed doses of VPA (A). The percentage of cells scoring positive for RFP at these doses is also shown (B). In a separate experiment performed 32 days post infection, silenced MM7.219 cultures were treated with 5 mM VPA for 2 days. Enrichment of the active H3K4me3 histone mark across four positions on the rKSHV.219 episome are shown as % of input DNA (C). Similarly, repressive H3K27me3 association is shown for the same four regions (D). Values represent the mean +/- S.D. of 4 to 5 PCR replicates (see Methods ).

    Techniques Used: Infection, Polymerase Chain Reaction

    33) Product Images from "DSBCapture: in situ capture and direct sequencing of dsDNA breaks"

    Article Title: DSBCapture: in situ capture and direct sequencing of dsDNA breaks

    Journal: Nature methods

    doi: 10.1038/nmeth.3960

    DSBCapture methodology and validation ( a ) DSBCapture workflow. (1) DSBs in fixed nuclei were blunt-end repaired, (2) A-tailed and (3) ligated to a biotinylated (black ball) modified P5 Illumina adapter (orange lines). (4) Excess adapters were removed by lambda exonuclease digestion; (5) DNA extracted from lysed nuclei was fragmented by sonication, (6) bead-captured (hollow ball) and blunted-end repaired, (7) A-tailed, and (8) ligated to a modified P7 Illumina adapter (purple lines). (9) Captured break sites were PCR amplified, (10) size selected, (11) quantified and (12) sequenced. Sequences of the DSBCapture adapters: modified P5 Illumina adapter and modified P7 Illumina adapter (B = biotin; P = phosphorylated; * = phosphorothioate bond). ( b ) DSBs created by EcoRV cleavage in fixed nuclei (N = 1). PCR duplicates have been removed. Data range is shown in square brackets and black boxes illustrate the genomic location of EcoRV sites. A 20 kb region and a 110 bp region are shown. Pink and purple lines: reads from the sense and antisense strand, respectively. As EcoRV is a blunt cutter, reads originate directly from the cleavage site. ( c ) AsiSI cleavage sites (black boxes) detected by DSBCapture (N = 1). Cleavage by AsiSI generates a 2 bp 3’ overhang; end processing removes this overhang generating the 2 bp gap in the center of the peak. A 2 kb and a 200 bp region are shown. ( d ) Venn diagram illustrating the overlap of DSBs detected at AsiSI sites by DSBCapture and γH2AX ChIP-seq 9 .
    Figure Legend Snippet: DSBCapture methodology and validation ( a ) DSBCapture workflow. (1) DSBs in fixed nuclei were blunt-end repaired, (2) A-tailed and (3) ligated to a biotinylated (black ball) modified P5 Illumina adapter (orange lines). (4) Excess adapters were removed by lambda exonuclease digestion; (5) DNA extracted from lysed nuclei was fragmented by sonication, (6) bead-captured (hollow ball) and blunted-end repaired, (7) A-tailed, and (8) ligated to a modified P7 Illumina adapter (purple lines). (9) Captured break sites were PCR amplified, (10) size selected, (11) quantified and (12) sequenced. Sequences of the DSBCapture adapters: modified P5 Illumina adapter and modified P7 Illumina adapter (B = biotin; P = phosphorylated; * = phosphorothioate bond). ( b ) DSBs created by EcoRV cleavage in fixed nuclei (N = 1). PCR duplicates have been removed. Data range is shown in square brackets and black boxes illustrate the genomic location of EcoRV sites. A 20 kb region and a 110 bp region are shown. Pink and purple lines: reads from the sense and antisense strand, respectively. As EcoRV is a blunt cutter, reads originate directly from the cleavage site. ( c ) AsiSI cleavage sites (black boxes) detected by DSBCapture (N = 1). Cleavage by AsiSI generates a 2 bp 3’ overhang; end processing removes this overhang generating the 2 bp gap in the center of the peak. A 2 kb and a 200 bp region are shown. ( d ) Venn diagram illustrating the overlap of DSBs detected at AsiSI sites by DSBCapture and γH2AX ChIP-seq 9 .

    Techniques Used: Modification, Sonication, Polymerase Chain Reaction, Amplification, Chromatin Immunoprecipitation

    34) Product Images from "Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application"

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application

    Journal: BMC Genomics

    doi: 10.1186/s12864-017-4371-5

    DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown
    Figure Legend Snippet: DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown

    Techniques Used: DNA Purification, Chromatin Immunoprecipitation, Purification, Generated, Derivative Assay, Polymerase Chain Reaction, Amplification, Real-time Polymerase Chain Reaction

    35) Product Images from "A retrospective study of community-acquired Clostridium difficile infection in southwest China"

    Article Title: A retrospective study of community-acquired Clostridium difficile infection in southwest China

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-21762-7

    The toxin profiles and PCR ribotyping characters of C. difficile between children and adults in this study. ( A ) The toxin profile of isolated strains. ( B ) RT constituent ratio of C. difficile strains. Left: children group; right: adults group. ( C ) RT distribution characters of C. difficile for different hospitals in children group. ( D ) RT distribution characters of C. difficile for different hospitals in adults group. ( E ). RT distribution characters of C. difficile for fecal property in children group. ( F ) RT distribution characters of C. difficile for fecal property in adults group.
    Figure Legend Snippet: The toxin profiles and PCR ribotyping characters of C. difficile between children and adults in this study. ( A ) The toxin profile of isolated strains. ( B ) RT constituent ratio of C. difficile strains. Left: children group; right: adults group. ( C ) RT distribution characters of C. difficile for different hospitals in children group. ( D ) RT distribution characters of C. difficile for different hospitals in adults group. ( E ). RT distribution characters of C. difficile for fecal property in children group. ( F ) RT distribution characters of C. difficile for fecal property in adults group.

    Techniques Used: Polymerase Chain Reaction, Isolation

    Related Articles

    Amplification:

    Article Title: Protocol for Metagenomic Virus Detection in Clinical Specimens 1
    Article Snippet: Second-strand synthesis was performed by using the NEBNext mRNA Second Strand Synthesis Module (New England Biolabs) and purified by using the MinElute PCR Purification Kit (QIAGEN). .. The sequencing library was then amplified by using an emulsion-based clonal amplification PCR in the Ion OneTouch 200 Template v2 DL Kit and enriched by using an Ion OneTouch Enrichment System.

    Article Title: Dysregulated immune system networks in war veterans with PTSD is an outcome of altered miRNA expression and DNA methylation
    Article Snippet: After DNA fragments were purified using Qiagen PCR purification kit (Qiagen catalogue #28004), an “A” base was added to the 3′ end of the blunt DNA fragment by Klenow fragment. .. The libraries were then amplified by limited PCR (15 cycles) using primers provided by the kit.

    Real-time Polymerase Chain Reaction:

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application
    Article Snippet: The ChIP DNA Clean & Concentrator™ (Zymo Research; Zy), the Monarch® PCR & DNA Cleanup Kit (New England Biolabs; Ne), the MinElute PCR Purification Kit (Qiagen, Qm), the QIAquick PCR Purification Kit (Qiagen; Qp), the Agencourt AMPure XP kit (Beckman; Ba) and the RNAClean™ XP kit (Beckman; Br), and phenol/chloroform extraction (Invitrogen; PC) performed well with de-crosslinked chromatin. .. We utilized qPCR approach to check the potential interference of each purification reagent in the downstream application.

    Incubation:

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application
    Article Snippet: After adding 30 μl of prewashed protein G-magnetic beads, the reaction was further incubated for 3 h. The beads were extensively washed with ChIP buffer, high salt buffer, LiCl2 buffer, and TE buffer. .. After treatment with RNase A and proteinase K, DNA was purified by Qiagen MinElute PCR Purification Kit (Cat. # 28006, Valencia, CA) and quantified using Qubit dsDNA High Sensitivity assay (Invitrogen, Q32851).

    Expressing:

    Article Title: Components of the interleukin-33/ST2 system are differentially expressed and regulated in human cardiac cells and in cells of the cardiac vasculature
    Article Snippet: 2.4 Total RNA purification and cDNA preparation Cells were treated as described (for IL-33 mRNA determination) or left untreated (for measurement of basal total ST2, ST2L, or sST2 mRNA expression), supernatants were removed and total cellular RNA was isolated using High Pure RNA Isolation Kit (Roche, Basel, Switzerland) according to the manufacturer's instructions. .. For PCR of ST2 isoforms, cDNA was additionally eluted with MinElute PCR Purification Kit (QIAGEN GmbH, Hilden, Germany).

    Derivative Assay:

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application
    Article Snippet: Similarly, DNAs were purified from de-crosslinked chromatin estimated to include 1 ng, 5 ng, 10 ng, and 50 ng of DNA after treatment of RNase A and proteinase K. The following reagents were used in the experiment: ChIP DNA Clean & Concentrator™ (Cat. # D5205) from Zymo Research (Zy) (Irvine, CA); Wizard® SV Gel and PCR Clean-Up System (Cat. # A9281) from Promega (Pr) (Fitchburg, WI); GeneJET PCR Purification Kit (Cat. # K0701) from Thermo Fisher Scientific (Th) (Waltham, MA); PureLink® PCR Purification Kit (Cat. # K310001) from Invitrogen (In) (Carlsbad, CA); Monarch® PCR & DNA Cleanup Kit (Cat. # T1030S) from New England Biolabs (Ne) (Ipswich, MA); Chromatin IP DNA Purification Kit (Cat. # 58002) from Active Motif (Am) (Carlsbad, CA); QIAquick PCR Purification Kit (Cat. # 28106) from Qiagen (Qp) (Valencia, CA), MinElute PCR Purification Kit (Cat. # 28006) from Qiagen (Qm); Agencourt AMPure XP (Cat. # A63881) from Beckman (Ba) (Indianapolis, IN), RNAClean™ XP (Cat. # A63987) from Beckman (Br), and phenol/chloroform extraction (PC) (Additional file ). .. Each purification reagent was tested in triplicate DNA samples derived from 3 independent experiments.

    Generated:

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application
    Article Snippet: The anti-H3K27me3 antibody (Cat. #9733, Lot #8) was purchased from Cell Signaling Technology (Danvers, MA) and the purified anti-H3K4me3 antibody was generated in-house (EDL Lot 1). .. After treatment with RNase A and proteinase K, DNA was purified by Qiagen MinElute PCR Purification Kit (Cat. # 28006, Valencia, CA) and quantified using Qubit dsDNA High Sensitivity assay (Invitrogen, Q32851).

    Polymerase Chain Reaction:

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application
    Article Snippet: .. Similarly, DNAs were purified from de-crosslinked chromatin estimated to include 1 ng, 5 ng, 10 ng, and 50 ng of DNA after treatment of RNase A and proteinase K. The following reagents were used in the experiment: ChIP DNA Clean & Concentrator™ (Cat. # D5205) from Zymo Research (Zy) (Irvine, CA); Wizard® SV Gel and PCR Clean-Up System (Cat. # A9281) from Promega (Pr) (Fitchburg, WI); GeneJET PCR Purification Kit (Cat. # K0701) from Thermo Fisher Scientific (Th) (Waltham, MA); PureLink® PCR Purification Kit (Cat. # K310001) from Invitrogen (In) (Carlsbad, CA); Monarch® PCR & DNA Cleanup Kit (Cat. # T1030S) from New England Biolabs (Ne) (Ipswich, MA); Chromatin IP DNA Purification Kit (Cat. # 58002) from Active Motif (Am) (Carlsbad, CA); QIAquick PCR Purification Kit (Cat. # 28106) from Qiagen (Qp) (Valencia, CA), MinElute PCR Purification Kit (Cat. # 28006) from Qiagen (Qm); Agencourt AMPure XP (Cat. # A63881) from Beckman (Ba) (Indianapolis, IN), RNAClean™ XP (Cat. # A63987) from Beckman (Br), and phenol/chloroform extraction (PC) (Additional file ). ..

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application
    Article Snippet: .. Lane 1 (EDL St), the library from 1 ng of purified ChIP DNA from aliquot A; Lane 2 (1 ng QmM), the library from stored DNA in MaxyClear tube after purification by MinElute PCR Purification Kit from aliquot B; Lane 3 (1 ng QmP), the library from stored DNA in Premium Tube after purification by MinElute PCR Purification Kit from aliquot B; Lane 4 (Input), the library from 1 ng of purified input DNA from the aliquot A. .. Left panel is the profile of H3K4me3 libraries, and right panel is the profile of H3K27me3 libraries. (PDF 123 kb) Mapping results of ChIP-seq reads generated through different purification reagents. (PDF 94 kb) Measuring global ChIP enrichment by FRiP (fraction of reads in peaks).

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application
    Article Snippet: .. DNA was purified using MinElute PCR Purification Kit after treatment of RNase A and proteinase K. DNA was quantified using Qubit dsDNA High Sensitivity assay and adjusted to 1 ng/μL with TE buffer. .. DNAs were prepared to final 1 ng, 5 ng, 10 ng and 50 ng in 100 μL ChIP elution buffer and were purified by 11 different purification reagents as suggested by the manufacturer except for the elution volume, which was fixed at 16 μL.

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application
    Article Snippet: .. The ChIP DNA Clean & Concentrator™ (Zymo Research; Zy), the Monarch® PCR & DNA Cleanup Kit (New England Biolabs; Ne), the MinElute PCR Purification Kit (Qiagen, Qm), the QIAquick PCR Purification Kit (Qiagen; Qp), the Agencourt AMPure XP kit (Beckman; Ba) and the RNAClean™ XP kit (Beckman; Br), and phenol/chloroform extraction (Invitrogen; PC) performed well with de-crosslinked chromatin. .. These reagents recovered 78.1% to 95.7% with 10–50 ng of purified DNA, 81.7% to 96.8% with 5 ng of DNA, and 68.1% to 82.9% with 1 ng of DNA except phenol/chloroform extraction with over 100%.

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application
    Article Snippet: .. For the MinElute PCR Purification Kit, DNA was eluted in Maxyclear and Premium tubes. ..

    Article Title: A retrospective study of community-acquired Clostridium difficile infection in southwest China
    Article Snippet: .. PCR ribotyping reaction products were concentrated using a Qiagen Min-Elute PCR purification kit (QIAGEN) and run on a QIAxcel capillary electrophoresis platform (QIAGEN). .. Visualization of PCR products was performed with QIAxcel ScreenGel software (v1.3.0; QIAGEN).

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application
    Article Snippet: .. Aliquot A was purified by the lab standard protocol using MinElute PCR Purification Kit in a MaxyClear tube. .. The ChIP enrichment was analyzed by quantitative real-time PCR in positive and negative genomic loci (Additional file ).

    Article Title: Components of the interleukin-33/ST2 system are differentially expressed and regulated in human cardiac cells and in cells of the cardiac vasculature
    Article Snippet: .. For PCR of ST2 isoforms, cDNA was additionally eluted with MinElute PCR Purification Kit (QIAGEN GmbH, Hilden, Germany). .. 2.5 RealTime-PCR RealTime-PCR was performed using LightCycler® TaqMan® Master (Roche) according to the manufacturer's instructions.

    Article Title: Protocol for Metagenomic Virus Detection in Clinical Specimens 1
    Article Snippet: .. Second-strand synthesis was performed by using the NEBNext mRNA Second Strand Synthesis Module (New England Biolabs) and purified by using the MinElute PCR Purification Kit (QIAGEN). .. Double-stranded cDNA, DNA, and random PCR products were quantified by using the Qubit HS dsDNA Kit (Invitrogen Life Technologies).

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application
    Article Snippet: .. After treatment with RNase A and proteinase K, DNA was purified by Qiagen MinElute PCR Purification Kit (Cat. # 28006, Valencia, CA) and quantified using Qubit dsDNA High Sensitivity assay (Invitrogen, Q32851). .. To check the size of input chromatin, purified input DNA was analyzed by Fragment Analyzer (Advanced Analytical Technologies; AATI; Ankeny, IA) using the High Sensitivity NGS Fragment Analysis Kit (Cat. # DNF-486).

    Article Title: Dysregulated immune system networks in war veterans with PTSD is an outcome of altered miRNA expression and DNA methylation
    Article Snippet: .. After DNA fragments were purified using Qiagen PCR purification kit (Qiagen catalogue #28004), an “A” base was added to the 3′ end of the blunt DNA fragment by Klenow fragment. .. Sequencing adapters were ligated to the ends of DNA fragments using DNA ligase.

    Sonication:

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application
    Article Snippet: After adding the same volume of sonication buffer (100 mM Tris-HCl, pH 8.1, 20 mM EDTA, 200 mM NaCl, 2% Triton X-100, 0.2% sodium deoxycholate), the lysate was sonicated for 15 cycles (30 s on, 30 s off) using a Diagenode Bioruptor and centrifuged at 15,000 rpm for 10 min. .. After treatment with RNase A and proteinase K, DNA was purified by Qiagen MinElute PCR Purification Kit (Cat. # 28006, Valencia, CA) and quantified using Qubit dsDNA High Sensitivity assay (Invitrogen, Q32851).

    DNA Extraction:

    Article Title: A retrospective study of community-acquired Clostridium difficile infection in southwest China
    Article Snippet: Paragraph title: Bacterial DNA isolation, PCR-ribotyping and toxin gene profiling ... PCR ribotyping reaction products were concentrated using a Qiagen Min-Elute PCR purification kit (QIAGEN) and run on a QIAxcel capillary electrophoresis platform (QIAGEN).

    RNA Sequencing Assay:

    Article Title: Dysregulated immune system networks in war veterans with PTSD is an outcome of altered miRNA expression and DNA methylation
    Article Snippet: Paragraph title: RNA-sequencing (RNA-Seq) ... After DNA fragments were purified using Qiagen PCR purification kit (Qiagen catalogue #28004), an “A” base was added to the 3′ end of the blunt DNA fragment by Klenow fragment.

    Sensitive Assay:

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application
    Article Snippet: DNA was purified using MinElute PCR Purification Kit after treatment of RNase A and proteinase K. DNA was quantified using Qubit dsDNA High Sensitivity assay and adjusted to 1 ng/μL with TE buffer. .. Similarly, DNAs were purified from de-crosslinked chromatin estimated to include 1 ng, 5 ng, 10 ng, and 50 ng of DNA after treatment of RNase A and proteinase K. The following reagents were used in the experiment: ChIP DNA Clean & Concentrator™ (Cat. # D5205) from Zymo Research (Zy) (Irvine, CA); Wizard® SV Gel and PCR Clean-Up System (Cat. # A9281) from Promega (Pr) (Fitchburg, WI); GeneJET PCR Purification Kit (Cat. # K0701) from Thermo Fisher Scientific (Th) (Waltham, MA); PureLink® PCR Purification Kit (Cat. # K310001) from Invitrogen (In) (Carlsbad, CA); Monarch® PCR & DNA Cleanup Kit (Cat. # T1030S) from New England Biolabs (Ne) (Ipswich, MA); Chromatin IP DNA Purification Kit (Cat. # 58002) from Active Motif (Am) (Carlsbad, CA); QIAquick PCR Purification Kit (Cat. # 28106) from Qiagen (Qp) (Valencia, CA), MinElute PCR Purification Kit (Cat. # 28006) from Qiagen (Qm); Agencourt AMPure XP (Cat. # A63881) from Beckman (Ba) (Indianapolis, IN), RNAClean™ XP (Cat. # A63987) from Beckman (Br), and phenol/chloroform extraction (PC) (Additional file ).

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application
    Article Snippet: .. DNA was purified using MinElute PCR Purification Kit after treatment of RNase A and proteinase K. DNA was quantified using Qubit dsDNA High Sensitivity assay and adjusted to 1 ng/μL with TE buffer. .. DNAs were prepared to final 1 ng, 5 ng, 10 ng and 50 ng in 100 μL ChIP elution buffer and were purified by 11 different purification reagents as suggested by the manufacturer except for the elution volume, which was fixed at 16 μL.

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application
    Article Snippet: .. After treatment with RNase A and proteinase K, DNA was purified by Qiagen MinElute PCR Purification Kit (Cat. # 28006, Valencia, CA) and quantified using Qubit dsDNA High Sensitivity assay (Invitrogen, Q32851). .. To check the size of input chromatin, purified input DNA was analyzed by Fragment Analyzer (Advanced Analytical Technologies; AATI; Ankeny, IA) using the High Sensitivity NGS Fragment Analysis Kit (Cat. # DNF-486).

    Isolation:

    Article Title: Components of the interleukin-33/ST2 system are differentially expressed and regulated in human cardiac cells and in cells of the cardiac vasculature
    Article Snippet: Frozen human myocardial tissue was homogenized using a ball mill (Retsch, Haan, Germany), and mRNA was isolated using High Pure RNA Tissue Kit (Roche). .. For PCR of ST2 isoforms, cDNA was additionally eluted with MinElute PCR Purification Kit (QIAGEN GmbH, Hilden, Germany).

    Purification:

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application
    Article Snippet: .. Similarly, DNAs were purified from de-crosslinked chromatin estimated to include 1 ng, 5 ng, 10 ng, and 50 ng of DNA after treatment of RNase A and proteinase K. The following reagents were used in the experiment: ChIP DNA Clean & Concentrator™ (Cat. # D5205) from Zymo Research (Zy) (Irvine, CA); Wizard® SV Gel and PCR Clean-Up System (Cat. # A9281) from Promega (Pr) (Fitchburg, WI); GeneJET PCR Purification Kit (Cat. # K0701) from Thermo Fisher Scientific (Th) (Waltham, MA); PureLink® PCR Purification Kit (Cat. # K310001) from Invitrogen (In) (Carlsbad, CA); Monarch® PCR & DNA Cleanup Kit (Cat. # T1030S) from New England Biolabs (Ne) (Ipswich, MA); Chromatin IP DNA Purification Kit (Cat. # 58002) from Active Motif (Am) (Carlsbad, CA); QIAquick PCR Purification Kit (Cat. # 28106) from Qiagen (Qp) (Valencia, CA), MinElute PCR Purification Kit (Cat. # 28006) from Qiagen (Qm); Agencourt AMPure XP (Cat. # A63881) from Beckman (Ba) (Indianapolis, IN), RNAClean™ XP (Cat. # A63987) from Beckman (Br), and phenol/chloroform extraction (PC) (Additional file ). ..

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application
    Article Snippet: .. Lane 1 (EDL St), the library from 1 ng of purified ChIP DNA from aliquot A; Lane 2 (1 ng QmM), the library from stored DNA in MaxyClear tube after purification by MinElute PCR Purification Kit from aliquot B; Lane 3 (1 ng QmP), the library from stored DNA in Premium Tube after purification by MinElute PCR Purification Kit from aliquot B; Lane 4 (Input), the library from 1 ng of purified input DNA from the aliquot A. .. Left panel is the profile of H3K4me3 libraries, and right panel is the profile of H3K27me3 libraries. (PDF 123 kb) Mapping results of ChIP-seq reads generated through different purification reagents. (PDF 94 kb) Measuring global ChIP enrichment by FRiP (fraction of reads in peaks).

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application
    Article Snippet: .. DNA was purified using MinElute PCR Purification Kit after treatment of RNase A and proteinase K. DNA was quantified using Qubit dsDNA High Sensitivity assay and adjusted to 1 ng/μL with TE buffer. .. DNAs were prepared to final 1 ng, 5 ng, 10 ng and 50 ng in 100 μL ChIP elution buffer and were purified by 11 different purification reagents as suggested by the manufacturer except for the elution volume, which was fixed at 16 μL.

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application
    Article Snippet: .. The ChIP DNA Clean & Concentrator™ (Zymo Research; Zy), the Monarch® PCR & DNA Cleanup Kit (New England Biolabs; Ne), the MinElute PCR Purification Kit (Qiagen, Qm), the QIAquick PCR Purification Kit (Qiagen; Qp), the Agencourt AMPure XP kit (Beckman; Ba) and the RNAClean™ XP kit (Beckman; Br), and phenol/chloroform extraction (Invitrogen; PC) performed well with de-crosslinked chromatin. .. These reagents recovered 78.1% to 95.7% with 10–50 ng of purified DNA, 81.7% to 96.8% with 5 ng of DNA, and 68.1% to 82.9% with 1 ng of DNA except phenol/chloroform extraction with over 100%.

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application
    Article Snippet: .. For the MinElute PCR Purification Kit, DNA was eluted in Maxyclear and Premium tubes. ..

    Article Title: A retrospective study of community-acquired Clostridium difficile infection in southwest China
    Article Snippet: .. PCR ribotyping reaction products were concentrated using a Qiagen Min-Elute PCR purification kit (QIAGEN) and run on a QIAxcel capillary electrophoresis platform (QIAGEN). .. Visualization of PCR products was performed with QIAxcel ScreenGel software (v1.3.0; QIAGEN).

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application
    Article Snippet: .. Aliquot A was purified by the lab standard protocol using MinElute PCR Purification Kit in a MaxyClear tube. .. The ChIP enrichment was analyzed by quantitative real-time PCR in positive and negative genomic loci (Additional file ).

    Article Title: Components of the interleukin-33/ST2 system are differentially expressed and regulated in human cardiac cells and in cells of the cardiac vasculature
    Article Snippet: .. For PCR of ST2 isoforms, cDNA was additionally eluted with MinElute PCR Purification Kit (QIAGEN GmbH, Hilden, Germany). .. 2.5 RealTime-PCR RealTime-PCR was performed using LightCycler® TaqMan® Master (Roche) according to the manufacturer's instructions.

    Article Title: Protocol for Metagenomic Virus Detection in Clinical Specimens 1
    Article Snippet: .. Second-strand synthesis was performed by using the NEBNext mRNA Second Strand Synthesis Module (New England Biolabs) and purified by using the MinElute PCR Purification Kit (QIAGEN). .. Double-stranded cDNA, DNA, and random PCR products were quantified by using the Qubit HS dsDNA Kit (Invitrogen Life Technologies).

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application
    Article Snippet: .. After treatment with RNase A and proteinase K, DNA was purified by Qiagen MinElute PCR Purification Kit (Cat. # 28006, Valencia, CA) and quantified using Qubit dsDNA High Sensitivity assay (Invitrogen, Q32851). .. To check the size of input chromatin, purified input DNA was analyzed by Fragment Analyzer (Advanced Analytical Technologies; AATI; Ankeny, IA) using the High Sensitivity NGS Fragment Analysis Kit (Cat. # DNF-486).

    Article Title: Dysregulated immune system networks in war veterans with PTSD is an outcome of altered miRNA expression and DNA methylation
    Article Snippet: .. After DNA fragments were purified using Qiagen PCR purification kit (Qiagen catalogue #28004), an “A” base was added to the 3′ end of the blunt DNA fragment by Klenow fragment. .. Sequencing adapters were ligated to the ends of DNA fragments using DNA ligase.

    Sequencing:

    Article Title: Protocol for Metagenomic Virus Detection in Clinical Specimens 1
    Article Snippet: Second-strand synthesis was performed by using the NEBNext mRNA Second Strand Synthesis Module (New England Biolabs) and purified by using the MinElute PCR Purification Kit (QIAGEN). .. Sequencing libraries were established by Ion Xpress Plus Fragment Library Kit (without chemical fragmentation) with indices (Ion Xpress Barcode Adapters 1–16 Kit).

    Article Title: Dysregulated immune system networks in war veterans with PTSD is an outcome of altered miRNA expression and DNA methylation
    Article Snippet: After DNA fragments were purified using Qiagen PCR purification kit (Qiagen catalogue #28004), an “A” base was added to the 3′ end of the blunt DNA fragment by Klenow fragment. .. Sequencing adapters were ligated to the ends of DNA fragments using DNA ligase.

    IA:

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application
    Article Snippet: After treatment with RNase A and proteinase K, DNA was purified by Qiagen MinElute PCR Purification Kit (Cat. # 28006, Valencia, CA) and quantified using Qubit dsDNA High Sensitivity assay (Invitrogen, Q32851). .. To check the size of input chromatin, purified input DNA was analyzed by Fragment Analyzer (Advanced Analytical Technologies; AATI; Ankeny, IA) using the High Sensitivity NGS Fragment Analysis Kit (Cat. # DNF-486).

    Chromatin Immunoprecipitation:

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application
    Article Snippet: .. Similarly, DNAs were purified from de-crosslinked chromatin estimated to include 1 ng, 5 ng, 10 ng, and 50 ng of DNA after treatment of RNase A and proteinase K. The following reagents were used in the experiment: ChIP DNA Clean & Concentrator™ (Cat. # D5205) from Zymo Research (Zy) (Irvine, CA); Wizard® SV Gel and PCR Clean-Up System (Cat. # A9281) from Promega (Pr) (Fitchburg, WI); GeneJET PCR Purification Kit (Cat. # K0701) from Thermo Fisher Scientific (Th) (Waltham, MA); PureLink® PCR Purification Kit (Cat. # K310001) from Invitrogen (In) (Carlsbad, CA); Monarch® PCR & DNA Cleanup Kit (Cat. # T1030S) from New England Biolabs (Ne) (Ipswich, MA); Chromatin IP DNA Purification Kit (Cat. # 58002) from Active Motif (Am) (Carlsbad, CA); QIAquick PCR Purification Kit (Cat. # 28106) from Qiagen (Qp) (Valencia, CA), MinElute PCR Purification Kit (Cat. # 28006) from Qiagen (Qm); Agencourt AMPure XP (Cat. # A63881) from Beckman (Ba) (Indianapolis, IN), RNAClean™ XP (Cat. # A63987) from Beckman (Br), and phenol/chloroform extraction (PC) (Additional file ). ..

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application
    Article Snippet: .. Lane 1 (EDL St), the library from 1 ng of purified ChIP DNA from aliquot A; Lane 2 (1 ng QmM), the library from stored DNA in MaxyClear tube after purification by MinElute PCR Purification Kit from aliquot B; Lane 3 (1 ng QmP), the library from stored DNA in Premium Tube after purification by MinElute PCR Purification Kit from aliquot B; Lane 4 (Input), the library from 1 ng of purified input DNA from the aliquot A. .. Left panel is the profile of H3K4me3 libraries, and right panel is the profile of H3K27me3 libraries. (PDF 123 kb) Mapping results of ChIP-seq reads generated through different purification reagents. (PDF 94 kb) Measuring global ChIP enrichment by FRiP (fraction of reads in peaks).

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application
    Article Snippet: .. The ChIP DNA Clean & Concentrator™ (Zymo Research; Zy), the Monarch® PCR & DNA Cleanup Kit (New England Biolabs; Ne), the MinElute PCR Purification Kit (Qiagen, Qm), the QIAquick PCR Purification Kit (Qiagen; Qp), the Agencourt AMPure XP kit (Beckman; Ba) and the RNAClean™ XP kit (Beckman; Br), and phenol/chloroform extraction (Invitrogen; PC) performed well with de-crosslinked chromatin. .. These reagents recovered 78.1% to 95.7% with 10–50 ng of purified DNA, 81.7% to 96.8% with 5 ng of DNA, and 68.1% to 82.9% with 1 ng of DNA except phenol/chloroform extraction with over 100%.

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application
    Article Snippet: Paragraph title: Chromatin immunoprecipitation ... After treatment with RNase A and proteinase K, DNA was purified by Qiagen MinElute PCR Purification Kit (Cat. # 28006, Valencia, CA) and quantified using Qubit dsDNA High Sensitivity assay (Invitrogen, Q32851).

    Software:

    Article Title: A retrospective study of community-acquired Clostridium difficile infection in southwest China
    Article Snippet: PCR ribotyping reaction products were concentrated using a Qiagen Min-Elute PCR purification kit (QIAGEN) and run on a QIAxcel capillary electrophoresis platform (QIAGEN). .. Visualization of PCR products was performed with QIAxcel ScreenGel software (v1.3.0; QIAGEN).

    Electrophoresis:

    Article Title: A retrospective study of community-acquired Clostridium difficile infection in southwest China
    Article Snippet: .. PCR ribotyping reaction products were concentrated using a Qiagen Min-Elute PCR purification kit (QIAGEN) and run on a QIAxcel capillary electrophoresis platform (QIAGEN). .. Visualization of PCR products was performed with QIAxcel ScreenGel software (v1.3.0; QIAGEN).

    Agarose Gel Electrophoresis:

    Article Title: Dysregulated immune system networks in war veterans with PTSD is an outcome of altered miRNA expression and DNA methylation
    Article Snippet: After DNA fragments were purified using Qiagen PCR purification kit (Qiagen catalogue #28004), an “A” base was added to the 3′ end of the blunt DNA fragment by Klenow fragment. .. The PCR products were then separated by 2% agarose gel electrophoresis and fragments with sizes ranging from 250 bp to 400 bp were excised and purified using the QIAquick Gel Extraction Kit (Qiagen catalogue #28704).

    Next-Generation Sequencing:

    Article Title: Protocol for Metagenomic Virus Detection in Clinical Specimens 1
    Article Snippet: Paragraph title: NGS ... Second-strand synthesis was performed by using the NEBNext mRNA Second Strand Synthesis Module (New England Biolabs) and purified by using the MinElute PCR Purification Kit (QIAGEN).

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application
    Article Snippet: After treatment with RNase A and proteinase K, DNA was purified by Qiagen MinElute PCR Purification Kit (Cat. # 28006, Valencia, CA) and quantified using Qubit dsDNA High Sensitivity assay (Invitrogen, Q32851). .. To check the size of input chromatin, purified input DNA was analyzed by Fragment Analyzer (Advanced Analytical Technologies; AATI; Ankeny, IA) using the High Sensitivity NGS Fragment Analysis Kit (Cat. # DNF-486).

    DNA Purification:

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application
    Article Snippet: .. Similarly, DNAs were purified from de-crosslinked chromatin estimated to include 1 ng, 5 ng, 10 ng, and 50 ng of DNA after treatment of RNase A and proteinase K. The following reagents were used in the experiment: ChIP DNA Clean & Concentrator™ (Cat. # D5205) from Zymo Research (Zy) (Irvine, CA); Wizard® SV Gel and PCR Clean-Up System (Cat. # A9281) from Promega (Pr) (Fitchburg, WI); GeneJET PCR Purification Kit (Cat. # K0701) from Thermo Fisher Scientific (Th) (Waltham, MA); PureLink® PCR Purification Kit (Cat. # K310001) from Invitrogen (In) (Carlsbad, CA); Monarch® PCR & DNA Cleanup Kit (Cat. # T1030S) from New England Biolabs (Ne) (Ipswich, MA); Chromatin IP DNA Purification Kit (Cat. # 58002) from Active Motif (Am) (Carlsbad, CA); QIAquick PCR Purification Kit (Cat. # 28106) from Qiagen (Qp) (Valencia, CA), MinElute PCR Purification Kit (Cat. # 28006) from Qiagen (Qm); Agencourt AMPure XP (Cat. # A63881) from Beckman (Ba) (Indianapolis, IN), RNAClean™ XP (Cat. # A63987) from Beckman (Br), and phenol/chloroform extraction (PC) (Additional file ). ..

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application
    Article Snippet: The Wizard® SV Gel and PCR Clean-Up System (Promega; Pr), the GeneJET PCR Purification Kit (Thermo Fisher Scientific; Th), the PureLink® PCR Purification Kit (Invitrogen; In) and the Chromatin IP DNA Purification Kit (Active Motif; Am) performed poorly with de-crosslinked chromatin. .. The ChIP DNA Clean & Concentrator™ (Zymo Research; Zy), the Monarch® PCR & DNA Cleanup Kit (New England Biolabs; Ne), the MinElute PCR Purification Kit (Qiagen, Qm), the QIAquick PCR Purification Kit (Qiagen; Qp), the Agencourt AMPure XP kit (Beckman; Ba) and the RNAClean™ XP kit (Beckman; Br), and phenol/chloroform extraction (Invitrogen; PC) performed well with de-crosslinked chromatin.

    Gel Extraction:

    Article Title: Dysregulated immune system networks in war veterans with PTSD is an outcome of altered miRNA expression and DNA methylation
    Article Snippet: After DNA fragments were purified using Qiagen PCR purification kit (Qiagen catalogue #28004), an “A” base was added to the 3′ end of the blunt DNA fragment by Klenow fragment. .. The PCR products were then separated by 2% agarose gel electrophoresis and fragments with sizes ranging from 250 bp to 400 bp were excised and purified using the QIAquick Gel Extraction Kit (Qiagen catalogue #28704).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Qiagen minelute pcr purification kit
    DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and <t>PCR</t> Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, <t>MinElute</t> PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown
    Minelute Pcr Purification Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 7017 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/minelute pcr purification kit/product/Qiagen
    Average 99 stars, based on 7017 article reviews
    Price from $9.99 to $1999.99
    minelute pcr purification kit - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown

    Journal: BMC Genomics

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application

    doi: 10.1186/s12864-017-4371-5

    Figure Lengend Snippet: DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown

    Article Snippet: The ChIP DNA Clean & Concentrator™ (Zymo Research; Zy), the Monarch® PCR & DNA Cleanup Kit (New England Biolabs; Ne), the MinElute PCR Purification Kit (Qiagen, Qm), the QIAquick PCR Purification Kit (Qiagen; Qp), the Agencourt AMPure XP kit (Beckman; Ba) and the RNAClean™ XP kit (Beckman; Br), and phenol/chloroform extraction (Invitrogen; PC) performed well with de-crosslinked chromatin.

    Techniques: DNA Purification, Chromatin Immunoprecipitation, Purification, Generated, Derivative Assay, Polymerase Chain Reaction, Amplification, Real-time Polymerase Chain Reaction

    The toxin profiles and PCR ribotyping characters of C. difficile between children and adults in this study. ( A ) The toxin profile of isolated strains. ( B ) RT constituent ratio of C. difficile strains. Left: children group; right: adults group. ( C ) RT distribu tion characters of C. difficile for different hospitals in children group. ( D ) RT distribution characters of C. difficile for different hospitals in adults group. ( E ). RT distribution characters of C. difficile for fecal property in children group. ( F ) RT distribution characters of C. difficile for fecal property in adults group.

    Journal: Scientific Reports

    Article Title: A retrospective study of community-acquired Clostridium difficile infection in southwest China

    doi: 10.1038/s41598-018-21762-7

    Figure Lengend Snippet: The toxin profiles and PCR ribotyping characters of C. difficile between children and adults in this study. ( A ) The toxin profile of isolated strains. ( B ) RT constituent ratio of C. difficile strains. Left: children group; right: adults group. ( C ) RT distribu tion characters of C. difficile for different hospitals in children group. ( D ) RT distribution characters of C. difficile for different hospitals in adults group. ( E ). RT distribution characters of C. difficile for fecal property in children group. ( F ) RT distribution characters of C. difficile for fecal property in adults group.

    Article Snippet: PCR ribotyping reaction products were concentrated using a Qiagen Min-Elute PCR purification kit (QIAGEN) and run on a QIAxcel capillary electrophoresis platform (QIAGEN).

    Techniques: Polymerase Chain Reaction, Isolation

    DNA methylation level has a trend that corroborates gene expression. There is a clear trend showing higher DNA methylation and lowered mRNA levels and vice-versa for the corresponding gene. (a) DNA methylation levels of the select genes presented as box plot. On x-axis, the names of gene are provided and y-axis provides the average β- values of DNA methylation. The two bars corresponding to each gene represent the DNA methylation level for control followed by PTSD patient in a left to right direction. (b) Transcript levels (y-axis: log 2 fold change values) of genes, after RNA-Seq analysis, listed in Fig. 4a. (c) Real time PCR validation of differentially expressed genes. To validate the RNA-Seq results, qRT-PCR was performed for seven representative genes with cDNA prepared from total RNA obtained from PBMCs of 24 control and 24 PTSD patients. The values are relative abundance (RA) values after qRT-PCR. The table inside the figure provides log 2 fold change values of the respective genes after RNA-Seq analysis. The error bars indicate standard error.

    Journal: Scientific Reports

    Article Title: Dysregulated immune system networks in war veterans with PTSD is an outcome of altered miRNA expression and DNA methylation

    doi: 10.1038/srep31209

    Figure Lengend Snippet: DNA methylation level has a trend that corroborates gene expression. There is a clear trend showing higher DNA methylation and lowered mRNA levels and vice-versa for the corresponding gene. (a) DNA methylation levels of the select genes presented as box plot. On x-axis, the names of gene are provided and y-axis provides the average β- values of DNA methylation. The two bars corresponding to each gene represent the DNA methylation level for control followed by PTSD patient in a left to right direction. (b) Transcript levels (y-axis: log 2 fold change values) of genes, after RNA-Seq analysis, listed in Fig. 4a. (c) Real time PCR validation of differentially expressed genes. To validate the RNA-Seq results, qRT-PCR was performed for seven representative genes with cDNA prepared from total RNA obtained from PBMCs of 24 control and 24 PTSD patients. The values are relative abundance (RA) values after qRT-PCR. The table inside the figure provides log 2 fold change values of the respective genes after RNA-Seq analysis. The error bars indicate standard error.

    Article Snippet: After DNA fragments were purified using Qiagen PCR purification kit (Qiagen catalogue #28004), an “A” base was added to the 3′ end of the blunt DNA fragment by Klenow fragment.

    Techniques: DNA Methylation Assay, Expressing, RNA Sequencing Assay, Real-time Polymerase Chain Reaction, Quantitative RT-PCR