pcr purification kit  (Qiagen)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    MinElute PCR Purification Kit
    Description:
    For purification of up to 5 μg PCR products 70 bp to 4 kb in low elution volumes Kit contents Qiagen MinElute PCR Purification Kit 50 MinElute Spin Columns 5g Binding Capacity 10L Elution Volume Tube Format Silica Technology 70 bp to 4 kb Fragment Size Manual Processing DNA Sample Fast Procedure and Easy Handling High Reproducible Recoveries For Purification of up to 5μg PCR Products in Low Elution Volumes Includes 50 MinElute Spin Columns Buffers 2mL Collection Tubes Benefits Very small elution volumes Fast procedure and easy handling High reproducible recoveries Gel loading dye for convenient sample analysis
    Catalog Number:
    28004
    Price:
    134
    Category:
    MinElute PCR Purification Kit
    Buy from Supplier


    Structured Review

    Qiagen pcr purification kit
    MinElute PCR Purification Kit
    For purification of up to 5 μg PCR products 70 bp to 4 kb in low elution volumes Kit contents Qiagen MinElute PCR Purification Kit 50 MinElute Spin Columns 5g Binding Capacity 10L Elution Volume Tube Format Silica Technology 70 bp to 4 kb Fragment Size Manual Processing DNA Sample Fast Procedure and Easy Handling High Reproducible Recoveries For Purification of up to 5μg PCR Products in Low Elution Volumes Includes 50 MinElute Spin Columns Buffers 2mL Collection Tubes Benefits Very small elution volumes Fast procedure and easy handling High reproducible recoveries Gel loading dye for convenient sample analysis
    https://www.bioz.com/result/pcr purification kit/product/Qiagen
    Average 99 stars, based on 11072 article reviews
    Price from $9.99 to $1999.99
    pcr purification kit - by Bioz Stars, 2020-07
    99/100 stars

    Images

    1) Product Images from "Mitochondrial DNA copy number is regulated in a tissue specific manner by DNA methylation of the nuclear-encoded DNA polymerase gamma A"

    Article Title: Mitochondrial DNA copy number is regulated in a tissue specific manner by DNA methylation of the nuclear-encoded DNA polymerase gamma A

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gks770

    Intragenic methylation of PolgA in reprogrammed and mtDNA divergent ESCs. Bisulphite sequencing analysis of CpG methylation in ( A ) CC9 mus , ( B ) CC9 dunni , ( C ) iPS QS , ( D ) iPS NGFP2 ( E ) NT-ES, ( F ) iPS NFGPinj pluripotent stem cells. ( G ) The percentage CpG methylation per sequence determined by bisulphite sequencing (percentage mean ± SEM). ( H ) Real time PCR quantification of PolgA expression in cultured CC9 mus , CC9 spretus , CC9 dunni , iPS QS/R26 (iPS QS ), iPS NGFP , NT-ES, iPS NGFPin j pluripotent stem cells expressed relative to ESD3 cells. ( J ) Cumulative analysis of the relationship between DNA methylation levels ( Figures 1 L and 3 G) and the expression of PolgA ( Figures 2 A and 3 H) performed using Pearson correlation coefficient (R 2 ). ( K ) MtDNA copies/cell in cultured CC9 mus , CC9 spretus , CC9 dunni , iPS QS/R26 , iPS NGFP , NT-ES, iPS NGFPinj pluripotent stem cells. Values represent mean ± SEM and significant differences between cell types are: * P
    Figure Legend Snippet: Intragenic methylation of PolgA in reprogrammed and mtDNA divergent ESCs. Bisulphite sequencing analysis of CpG methylation in ( A ) CC9 mus , ( B ) CC9 dunni , ( C ) iPS QS , ( D ) iPS NGFP2 ( E ) NT-ES, ( F ) iPS NFGPinj pluripotent stem cells. ( G ) The percentage CpG methylation per sequence determined by bisulphite sequencing (percentage mean ± SEM). ( H ) Real time PCR quantification of PolgA expression in cultured CC9 mus , CC9 spretus , CC9 dunni , iPS QS/R26 (iPS QS ), iPS NGFP , NT-ES, iPS NGFPin j pluripotent stem cells expressed relative to ESD3 cells. ( J ) Cumulative analysis of the relationship between DNA methylation levels ( Figures 1 L and 3 G) and the expression of PolgA ( Figures 2 A and 3 H) performed using Pearson correlation coefficient (R 2 ). ( K ) MtDNA copies/cell in cultured CC9 mus , CC9 spretus , CC9 dunni , iPS QS/R26 , iPS NGFP , NT-ES, iPS NGFPinj pluripotent stem cells. Values represent mean ± SEM and significant differences between cell types are: * P

    Techniques Used: Methylation, Bisulfite Sequencing, CpG Methylation Assay, Sequencing, Real-time Polymerase Chain Reaction, Expressing, Cell Culture, DNA Methylation Assay

    DNA methylation at the Exon 2 loci is associated with reduced RNApII transcriptional elongation. ( A ) Diagrammatic representation of the PolgA gene and primers sites used for ChIP. Numbers correspond to the centre nucleotide of each primer amplicon, relative to the transcription start site (TSS). Enrichment for (RNApII) and RNApII phosphorylated on serine 2 of the carboxy-terminal domain (RNApIIS2) was analysed by real time PCR at the exon 2 methylation site of PolgA and at downstream and upstream regions in: ( B ) CC9 mus ; ( C ) MEF; ( D ) NSC-CC9 mus and ( E ) heart samples. Values represent mean ± SEM. Significant differences between cell types are: * P
    Figure Legend Snippet: DNA methylation at the Exon 2 loci is associated with reduced RNApII transcriptional elongation. ( A ) Diagrammatic representation of the PolgA gene and primers sites used for ChIP. Numbers correspond to the centre nucleotide of each primer amplicon, relative to the transcription start site (TSS). Enrichment for (RNApII) and RNApII phosphorylated on serine 2 of the carboxy-terminal domain (RNApIIS2) was analysed by real time PCR at the exon 2 methylation site of PolgA and at downstream and upstream regions in: ( B ) CC9 mus ; ( C ) MEF; ( D ) NSC-CC9 mus and ( E ) heart samples. Values represent mean ± SEM. Significant differences between cell types are: * P

    Techniques Used: DNA Methylation Assay, Chromatin Immunoprecipitation, Amplification, Real-time Polymerase Chain Reaction, Methylation

    Analysis of PolgA and mtDNA enrichment in 5mC and 5hmC MeDIP of ESCs and somatic tissues. DNA samples from cultured CC9 mus , CC9 spretus and CC9 dunni cells; liver, spleen, heart and brain samples were immunoprecipitated using antibodies against ( A ) 5mC and ( B ) 5hmC, and analysed using real time PCR for PolgA (exon 2) enrichment. Bars represent means ± SEM. Significant differences between cell types are indicated (** P
    Figure Legend Snippet: Analysis of PolgA and mtDNA enrichment in 5mC and 5hmC MeDIP of ESCs and somatic tissues. DNA samples from cultured CC9 mus , CC9 spretus and CC9 dunni cells; liver, spleen, heart and brain samples were immunoprecipitated using antibodies against ( A ) 5mC and ( B ) 5hmC, and analysed using real time PCR for PolgA (exon 2) enrichment. Bars represent means ± SEM. Significant differences between cell types are indicated (** P

    Techniques Used: Methylated DNA Immunoprecipitation, Cell Culture, Immunoprecipitation, Real-time Polymerase Chain Reaction

    DNA Methylation of exon 2 correlates with reduced steady state mRNA levels of PolgA . ( A ) Real time PCR quantification of PolgA expression in cultured ESD3 and MEF cells, and in liver, spleen, heart, muscle, kidney and brain samples, expressed relative to ESD3. ( B ) The relationship between DNA methylation levels from Figure 1 L and the corresponding PolgA expression was determined using Pearson correlation coefficient (R 2 ). ( C ) MtDNA copies/cell in cultured ESD3 and MEF cells, and liver, spleen, heart, muscle, kidney and brain, as determined by real time PCR. ( D ) The relationship between the levels of DNA methylation from Figure 1 L and the corresponding mtDNA copies/cell was determined using Pearson correlation coefficient (R 2 ). Values represent mean ± SEM and significant differences between cell types are: * P
    Figure Legend Snippet: DNA Methylation of exon 2 correlates with reduced steady state mRNA levels of PolgA . ( A ) Real time PCR quantification of PolgA expression in cultured ESD3 and MEF cells, and in liver, spleen, heart, muscle, kidney and brain samples, expressed relative to ESD3. ( B ) The relationship between DNA methylation levels from Figure 1 L and the corresponding PolgA expression was determined using Pearson correlation coefficient (R 2 ). ( C ) MtDNA copies/cell in cultured ESD3 and MEF cells, and liver, spleen, heart, muscle, kidney and brain, as determined by real time PCR. ( D ) The relationship between the levels of DNA methylation from Figure 1 L and the corresponding mtDNA copies/cell was determined using Pearson correlation coefficient (R 2 ). Values represent mean ± SEM and significant differences between cell types are: * P

    Techniques Used: DNA Methylation Assay, Real-time Polymerase Chain Reaction, Expressing, Cell Culture

    2) Product Images from "Targeting chromatin binding regulation of constitutively active AR variants to overcome prostate cancer resistance to endocrine-based therapies"

    Article Title: Targeting chromatin binding regulation of constitutively active AR variants to overcome prostate cancer resistance to endocrine-based therapies

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkv262

    ARv567es binds canonical AREs through a dimerization-dependent mechanism. ( A ) ARE point mutations introduced in FASN ARBSI-LUC. ( B ) Activities of constructs illustrated in (A) were tested in R1-AD1 and R1-D567 cells by luciferase assay. Cells were treated with 1 nM mibolerone (MIB) or ethanol (ETH) as vehicle control as indicated. ( C ) ARE point mutations introduced in TSC2 exon 37-LUC. ( D ) Activities of constructs illustrated in (C) were evaluated by luciferase assay as in (B). ( E ) Western blot of lysates from R1-AD1 cells transfected with HA-GFP and HA-AR-V7 for the ChIP experiment shown in (F). ( F ) Constitutive recruitment of HA-tagged AR-V7 to the FASN ARBS1 site in transfected R1-AD1 cells was tested by ChIP-PCR. Data represent fold enrichment of PCR signal in ChIP DNA isolated using an HA-directed antibody versus non-specific IgG control (which was arbitrarily set to 1). ( G ) Activities of constructs illustrated in (A) were tested by luciferase assay using LNCaP cells transfected with an ARv567es expression vector and treated with 1 nM mibolerone (MIB) or ethanol (ETH, vehicle) as indicated. ( H ) Activities of constructs illustrated in (A) were tested by luciferase assay using LNCaP cells transfected with an AR-V7 expression vector exactly as described in (G). ( I ) Transcriptional activities of wild-type and A596T/S597T D-box mutant versions of ARv567es and AR-V7 were tested in LNCaP cells by luciferase assay as described in (G). ( J ) DNA duplex pull-down assays were performed by incubating biotinylated FASN AREI DNA duplexes harboring core sequences shown in A with cellular extracts from R1-AD1 and R1-D567 cells.
    Figure Legend Snippet: ARv567es binds canonical AREs through a dimerization-dependent mechanism. ( A ) ARE point mutations introduced in FASN ARBSI-LUC. ( B ) Activities of constructs illustrated in (A) were tested in R1-AD1 and R1-D567 cells by luciferase assay. Cells were treated with 1 nM mibolerone (MIB) or ethanol (ETH) as vehicle control as indicated. ( C ) ARE point mutations introduced in TSC2 exon 37-LUC. ( D ) Activities of constructs illustrated in (C) were evaluated by luciferase assay as in (B). ( E ) Western blot of lysates from R1-AD1 cells transfected with HA-GFP and HA-AR-V7 for the ChIP experiment shown in (F). ( F ) Constitutive recruitment of HA-tagged AR-V7 to the FASN ARBS1 site in transfected R1-AD1 cells was tested by ChIP-PCR. Data represent fold enrichment of PCR signal in ChIP DNA isolated using an HA-directed antibody versus non-specific IgG control (which was arbitrarily set to 1). ( G ) Activities of constructs illustrated in (A) were tested by luciferase assay using LNCaP cells transfected with an ARv567es expression vector and treated with 1 nM mibolerone (MIB) or ethanol (ETH, vehicle) as indicated. ( H ) Activities of constructs illustrated in (A) were tested by luciferase assay using LNCaP cells transfected with an AR-V7 expression vector exactly as described in (G). ( I ) Transcriptional activities of wild-type and A596T/S597T D-box mutant versions of ARv567es and AR-V7 were tested in LNCaP cells by luciferase assay as described in (G). ( J ) DNA duplex pull-down assays were performed by incubating biotinylated FASN AREI DNA duplexes harboring core sequences shown in A with cellular extracts from R1-AD1 and R1-D567 cells.

    Techniques Used: Construct, Luciferase, Western Blot, Transfection, Chromatin Immunoprecipitation, Polymerase Chain Reaction, Isolation, Expressing, Plasmid Preparation, Mutagenesis

    3) Product Images from "Macrophage Infiltration into the Glomeruli in Lipoprotein Glomerulopathy"

    Article Title: Macrophage Infiltration into the Glomeruli in Lipoprotein Glomerulopathy

    Journal: Case Reports in Nephrology and Dialysis

    doi: 10.1159/000441715

    a ApoE phenotype determined by isoelectric focusing polyacrylamide gel electrophoresis (IEF). Lane 1, apoE1/2 (patient); lane 2, apoE2/3; lane 3, apoE2/2; lane 4, apoE3/3 (wild type); lane 5, apoE4/4. b ApoE genotype examined by restriction fragment length polymorphism (RFLP). PCR-amplified DNA of the apoE gene, including codons 112 and 158, was digested with HhaI. Lane 1, DNA size marker; lane 2, patient; lane 3, ε3/3; lane 4, ε2/2; lane 5, ε3/4. In lane 2, the 91-, 78-, and 36-bp fragments which are consistent with ε2, are observed. Moreover, there are also 30-bp and around 60-bp fragments that are not observed in ε2, ε3, and ε4. c , d Sequence analysis of PCR-amplified DNA of the apoE gene. c A 9-bp deletion (3-amino acid deletion) in codon 141 to codon 143 of the apoE gene is observed. There are overlaps of nucleotide peaks before codon 144, indicating that the apoE alleles are heterozygous. d Both the sequence CGC (arginine; wild type) and the sequence TGC (cysteine) are observed in codon 158 of the apoE gene, indicating that the apoE2 (Arg158Cys) alleles are heterozygous.
    Figure Legend Snippet: a ApoE phenotype determined by isoelectric focusing polyacrylamide gel electrophoresis (IEF). Lane 1, apoE1/2 (patient); lane 2, apoE2/3; lane 3, apoE2/2; lane 4, apoE3/3 (wild type); lane 5, apoE4/4. b ApoE genotype examined by restriction fragment length polymorphism (RFLP). PCR-amplified DNA of the apoE gene, including codons 112 and 158, was digested with HhaI. Lane 1, DNA size marker; lane 2, patient; lane 3, ε3/3; lane 4, ε2/2; lane 5, ε3/4. In lane 2, the 91-, 78-, and 36-bp fragments which are consistent with ε2, are observed. Moreover, there are also 30-bp and around 60-bp fragments that are not observed in ε2, ε3, and ε4. c , d Sequence analysis of PCR-amplified DNA of the apoE gene. c A 9-bp deletion (3-amino acid deletion) in codon 141 to codon 143 of the apoE gene is observed. There are overlaps of nucleotide peaks before codon 144, indicating that the apoE alleles are heterozygous. d Both the sequence CGC (arginine; wild type) and the sequence TGC (cysteine) are observed in codon 158 of the apoE gene, indicating that the apoE2 (Arg158Cys) alleles are heterozygous.

    Techniques Used: Polyacrylamide Gel Electrophoresis, Electrofocusing, Polymerase Chain Reaction, Amplification, Marker, Sequencing

    4) Product Images from "Homozygous mdm2 SNP309 cancer cells with compromised transcriptional elongation at p53 target genes are sensitive to induction of p53-independent cell death"

    Article Title: Homozygous mdm2 SNP309 cancer cells with compromised transcriptional elongation at p53 target genes are sensitive to induction of p53-independent cell death

    Journal: Oncotarget

    doi:

    Cancer cells with G/G mdm2 SNP309 have compromised transcriptional activation of p53 target genes after DNA damage ML-1, MANCA and A875 cells were treated with 8 μM etoposide (ETOP) for 6 hours. A. p21 and puma transcript was measured using quantitative RT-PCR. Samples were first normalized to DMSO for target gene expression and then to total gapdh mRNA. Results represent an average of three to five independent experiments given with standard error bars. Student t test analysis of cells treated DMSO vs ETOP for ML-1[ p21 and puma p
    Figure Legend Snippet: Cancer cells with G/G mdm2 SNP309 have compromised transcriptional activation of p53 target genes after DNA damage ML-1, MANCA and A875 cells were treated with 8 μM etoposide (ETOP) for 6 hours. A. p21 and puma transcript was measured using quantitative RT-PCR. Samples were first normalized to DMSO for target gene expression and then to total gapdh mRNA. Results represent an average of three to five independent experiments given with standard error bars. Student t test analysis of cells treated DMSO vs ETOP for ML-1[ p21 and puma p

    Techniques Used: Activation Assay, Quantitative RT-PCR, Expressing

    5) Product Images from "X-inactivation normalizes O-GlcNAc transferase levels and generates an O-GlcNAc-depleted Barr body"

    Article Title: X-inactivation normalizes O-GlcNAc transferase levels and generates an O-GlcNAc-depleted Barr body

    Journal: Frontiers in Genetics

    doi: 10.3389/fgene.2014.00256

    OGT is subject to X-inactivation in females . (A) Male (GM00468), Female (GM6111) and triple-X (GM00254) human fibroblasts show different X-inactivation profiles: no Xi in male, one Xi in female and 2 Xi in triple-X female cells. (B) XIST mRNA expression, analyzed by RT-PCR, is increased with Xi status. OGT expression remains the same in the different cell lines. (C) 5-azacytidine, a DNA methylation inhibitor, increases OGT mRNA expression according to the number of Xi, analyzed by qRT-PCR and performed in triplicate. (D) XIST mRNA expression is decreased in the presence of 5-azacytidine, showing the decrease in components required for X-inactivation. (E) XIST RNAi treatment also increases OGT mRNA expression according to the number of Xi in these human fibroblasts as detected by qRT-PCR performed in triplicate. (F) Efficiency of XIST RNAi was confirmed by a decrease in XIST mRNA expression by qRT-PCR. NS: P > 0.1; * 0.1 > P > 0.01; ** 0.01 > P > 0.001; *** 0.001 > P > 0.0001; **** 0.0001 > P .
    Figure Legend Snippet: OGT is subject to X-inactivation in females . (A) Male (GM00468), Female (GM6111) and triple-X (GM00254) human fibroblasts show different X-inactivation profiles: no Xi in male, one Xi in female and 2 Xi in triple-X female cells. (B) XIST mRNA expression, analyzed by RT-PCR, is increased with Xi status. OGT expression remains the same in the different cell lines. (C) 5-azacytidine, a DNA methylation inhibitor, increases OGT mRNA expression according to the number of Xi, analyzed by qRT-PCR and performed in triplicate. (D) XIST mRNA expression is decreased in the presence of 5-azacytidine, showing the decrease in components required for X-inactivation. (E) XIST RNAi treatment also increases OGT mRNA expression according to the number of Xi in these human fibroblasts as detected by qRT-PCR performed in triplicate. (F) Efficiency of XIST RNAi was confirmed by a decrease in XIST mRNA expression by qRT-PCR. NS: P > 0.1; * 0.1 > P > 0.01; ** 0.01 > P > 0.001; *** 0.001 > P > 0.0001; **** 0.0001 > P .

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, DNA Methylation Assay, Quantitative RT-PCR

    6) Product Images from "Emergence of carbapenem-resistant Acinetobacter baumannii as the major cause of ventilator-associated pneumonia in intensive care unit patients at an infectious disease hospital in southern Vietnam"

    Article Title: Emergence of carbapenem-resistant Acinetobacter baumannii as the major cause of ventilator-associated pneumonia in intensive care unit patients at an infectious disease hospital in southern Vietnam

    Journal: Journal of Medical Microbiology

    doi: 10.1099/jmm.0.076646-0

    The distribution of OXA genes in 34 Acinetobacter spp. isolated from tracheal aspirates in ICU patients at the Hospital for Tropical Diseases in Ho Chi Minh City, Vietnam in 2010. (a) Histogram showing the number of Acinetobacter spp. ( n = 34) producing PCR amplicons for OXA-51, OXA-58, OXA-23, OXA-24 and combinations thereof. Carbapenem-resistant isolates, dark grey; carbapenem-sensitive isolates, light grey. (b) Dendrogram created by MLVA using eight VNTR loci from 34 Acinetobacter spp. strains isolated in the ICU in 2010. The strain numbers are shown to the left of the dendrogram and the scale at the top of the diagram shows the percentage MLVA identity. Associated metadata data include the presence (black) or absence (white) of the OXA-51, OXA-58, OXA-23, OXA-24 and NDM-1 genes by PCR amplification, susceptibility to imipenem (IMP-R: susceptible, white; resistant, grey) and MLVA group ( > 90 % MLVA identity).
    Figure Legend Snippet: The distribution of OXA genes in 34 Acinetobacter spp. isolated from tracheal aspirates in ICU patients at the Hospital for Tropical Diseases in Ho Chi Minh City, Vietnam in 2010. (a) Histogram showing the number of Acinetobacter spp. ( n = 34) producing PCR amplicons for OXA-51, OXA-58, OXA-23, OXA-24 and combinations thereof. Carbapenem-resistant isolates, dark grey; carbapenem-sensitive isolates, light grey. (b) Dendrogram created by MLVA using eight VNTR loci from 34 Acinetobacter spp. strains isolated in the ICU in 2010. The strain numbers are shown to the left of the dendrogram and the scale at the top of the diagram shows the percentage MLVA identity. Associated metadata data include the presence (black) or absence (white) of the OXA-51, OXA-58, OXA-23, OXA-24 and NDM-1 genes by PCR amplification, susceptibility to imipenem (IMP-R: susceptible, white; resistant, grey) and MLVA group ( > 90 % MLVA identity).

    Techniques Used: Isolation, Polymerase Chain Reaction, Amplification

    7) Product Images from "Mutation within the hinge region of the transcription factor Nr2f2 attenuates salt-sensitive hypertension"

    Article Title: Mutation within the hinge region of the transcription factor Nr2f2 attenuates salt-sensitive hypertension

    Journal: Nature communications

    doi: 10.1038/ncomms7252

    Screening animals for ZFN-targeted mutation at the Nr2f2 locus (A) Tail DNA samples from pups born post-microinjection of custom ZFNs targeting exon 2 of the Nr2f2 locus were screened by PCR amplification with primers designed to amplify rat genomic fragments encompassing the ZFN-targeted site. Deviations from the expected product size of 360bp were inferred as genomic DNA from rats with mutations at the Nr2f2 locus. (B) Representative sequencing results from the PCR products shown in panel A detected a 15 bp deletion in the mRNA from mutant rats. Also represented are the corresponding translated peptide sequences as a result of the nucleotide variations.
    Figure Legend Snippet: Screening animals for ZFN-targeted mutation at the Nr2f2 locus (A) Tail DNA samples from pups born post-microinjection of custom ZFNs targeting exon 2 of the Nr2f2 locus were screened by PCR amplification with primers designed to amplify rat genomic fragments encompassing the ZFN-targeted site. Deviations from the expected product size of 360bp were inferred as genomic DNA from rats with mutations at the Nr2f2 locus. (B) Representative sequencing results from the PCR products shown in panel A detected a 15 bp deletion in the mRNA from mutant rats. Also represented are the corresponding translated peptide sequences as a result of the nucleotide variations.

    Techniques Used: Mutagenesis, Polymerase Chain Reaction, Amplification, Sequencing

    8) Product Images from "Promoter Hypermethylation and Decreased Expression of Syncytin-1 in Pancreatic Adenocarcinomas"

    Article Title: Promoter Hypermethylation and Decreased Expression of Syncytin-1 in Pancreatic Adenocarcinomas

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0134412

    Bisulfite sequencing of the syncytin-1 gene 5’ LTR promoter region. Bisulfite-converted DNA from pancreatic normal (n = 4) and carcinoma (n = 4) tissues were PCR amplified, subcloned, and sequenced. A. Upper panel: Schematic map of HERV-W gene. Arrows show the location of PCR primers. Lower panel: The solid lollipops indicate the seven CpG sites in the PCR fragments and the numbers indicate the CpG positions. A triangle points to the second CpG site that was used for COBRA. TSE, a trophoblast-specific enhancer region, is directly upstream of 5’ LTR U3 region. Important cis-elements are highlighted below the PCR fragment. The angled arrow indicates the transcription start site. B. The sequencing result of syncytin-1 gene 5’ LTR promoter region. The solid and open circles represent the methylated or unmethylated cytosines, respectively, in CpGs dinucleotide contexts. The average methylation levels for each CpG site were shown in columns below. C. and D. Quantitative comparison of the syncytin-1 DNA methylation levels between pancreatic normal and carcinoma tissues. C. There was a significant increased methylation in the second and third CpG sites in pancreatic carcinomas than normal tissues. D. DNA methylation index of seven CpG sites showed a trend for increased methylation in pancreatic carcinomas compared to normal tissues, but the difference did not reach a statistical significance (P > 0.05). Data are expressed as Mean ± SEM. *: P
    Figure Legend Snippet: Bisulfite sequencing of the syncytin-1 gene 5’ LTR promoter region. Bisulfite-converted DNA from pancreatic normal (n = 4) and carcinoma (n = 4) tissues were PCR amplified, subcloned, and sequenced. A. Upper panel: Schematic map of HERV-W gene. Arrows show the location of PCR primers. Lower panel: The solid lollipops indicate the seven CpG sites in the PCR fragments and the numbers indicate the CpG positions. A triangle points to the second CpG site that was used for COBRA. TSE, a trophoblast-specific enhancer region, is directly upstream of 5’ LTR U3 region. Important cis-elements are highlighted below the PCR fragment. The angled arrow indicates the transcription start site. B. The sequencing result of syncytin-1 gene 5’ LTR promoter region. The solid and open circles represent the methylated or unmethylated cytosines, respectively, in CpGs dinucleotide contexts. The average methylation levels for each CpG site were shown in columns below. C. and D. Quantitative comparison of the syncytin-1 DNA methylation levels between pancreatic normal and carcinoma tissues. C. There was a significant increased methylation in the second and third CpG sites in pancreatic carcinomas than normal tissues. D. DNA methylation index of seven CpG sites showed a trend for increased methylation in pancreatic carcinomas compared to normal tissues, but the difference did not reach a statistical significance (P > 0.05). Data are expressed as Mean ± SEM. *: P

    Techniques Used: Methylation Sequencing, Polymerase Chain Reaction, Amplification, Combined Bisulfite Restriction Analysis Assay, Sequencing, Methylation, DNA Methylation Assay

    DNA methylation of syncytin-1 gene measured by COBRA. A. Using bisulfite-treated genomic DNA as template, PCR amplicon representing a 456 bp of the 5’ LTR promoter region of syncytin-1 gene were treated with an excess of restriction enzyme Acl I. The digested PCR products were separated in 2.0% agarose gel electrophoresis and DNA bands were visualized by ethidium bromide staining. The 134 bp and 322 bp cleavage products represent methylated syncytin-1 promoter, while the 456 bp band represents the unmethylated syncytin-1 promoter. B. The methylation index was calculated by densitometry analyses of the electrophoresis images. COBRA results indicated an increased methylation in pancreatic adenocarcinoma compared to normal pancreatic tissues. Data were presented as Mean ± SEM.*: P
    Figure Legend Snippet: DNA methylation of syncytin-1 gene measured by COBRA. A. Using bisulfite-treated genomic DNA as template, PCR amplicon representing a 456 bp of the 5’ LTR promoter region of syncytin-1 gene were treated with an excess of restriction enzyme Acl I. The digested PCR products were separated in 2.0% agarose gel electrophoresis and DNA bands were visualized by ethidium bromide staining. The 134 bp and 322 bp cleavage products represent methylated syncytin-1 promoter, while the 456 bp band represents the unmethylated syncytin-1 promoter. B. The methylation index was calculated by densitometry analyses of the electrophoresis images. COBRA results indicated an increased methylation in pancreatic adenocarcinoma compared to normal pancreatic tissues. Data were presented as Mean ± SEM.*: P

    Techniques Used: DNA Methylation Assay, Combined Bisulfite Restriction Analysis Assay, Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Staining, Methylation, Electrophoresis

    9) Product Images from "Clustered LAG-1 binding sites in lag-1/CSL are involved in regulating lag-1 expression during lin-12/Notch-dependent cell-fate specification"

    Article Title: Clustered LAG-1 binding sites in lag-1/CSL are involved in regulating lag-1 expression during lin-12/Notch-dependent cell-fate specification

    Journal: BMB Reports

    doi: 10.5483/BMBRep.2013.46.4.269

    In vivo LAG-1 binding to a lag-1 regulatory region. ChIP was performed with the extracts from worms expressing SEL-8::GFP . PCR analysis was performed with primers described in MATERIALS AND METHODS. LAG-1 binding sites are in the first (1s st to 4 th LAG-1 binding sites in Fig. 1 , as well as in the in vitro DNA binding assay section in MATERIALS AND METHODS), third (5 th to 9 th ), and fourth (10 th to 13 th ) sections, but not in the second section. Pre-IP represents the input extracts subjected to IP. IgG and anti-HLH-2 antibodies were used as negative controls, and anti-LAG-3 and anti-GFP antibodies were used to detect the in vivo binding of LAG-1/LAG-3 complex to LAG-1 binding sites in lag-1 .
    Figure Legend Snippet: In vivo LAG-1 binding to a lag-1 regulatory region. ChIP was performed with the extracts from worms expressing SEL-8::GFP . PCR analysis was performed with primers described in MATERIALS AND METHODS. LAG-1 binding sites are in the first (1s st to 4 th LAG-1 binding sites in Fig. 1 , as well as in the in vitro DNA binding assay section in MATERIALS AND METHODS), third (5 th to 9 th ), and fourth (10 th to 13 th ) sections, but not in the second section. Pre-IP represents the input extracts subjected to IP. IgG and anti-HLH-2 antibodies were used as negative controls, and anti-LAG-3 and anti-GFP antibodies were used to detect the in vivo binding of LAG-1/LAG-3 complex to LAG-1 binding sites in lag-1 .

    Techniques Used: In Vivo, Binding Assay, Chromatin Immunoprecipitation, Expressing, Polymerase Chain Reaction, In Vitro, DNA Binding Assay

    10) Product Images from "BMP4 depletion by miR-200 inhibits tumorigenesis and metastasis of lung adenocarcinoma cells"

    Article Title: BMP4 depletion by miR-200 inhibits tumorigenesis and metastasis of lung adenocarcinoma cells

    Journal: Molecular Cancer

    doi: 10.1186/s12943-015-0441-y

    BMP4 is down-regulated in 344SQ_miR-200 cells. a The expression profile of immune-related genes in 344SQ_vector (vec) or 344SQ_miR-200 cells. Yellow: genes up-regulated by miR-200 overexpression; blue: genes down-regulated by miR-200 overexpression. b Quantitative RT-PCR (qRT-PCR) of Bmp4 and miR-200c in 13 murine lung adenocarcinoma cells. Cells were grouped into epithelial- or mesenchymal-like cells on the basis of the expression of EMT markers [ 13 ]. r and p, one-tailed Spearman’s rank correlation test. c qRT-PCR of Bmp4 in 393P, 344SQ, 344SQ_miR-200, 393P_Zeb1, and their control cells (vec). Expression levels were normalized to that of 393P (=1.0). Mean + SD, n = 3; p, two-tailed Student’s t -test. d BMP4 Western blot in 393P, 344SQ, 344SQ_vec, and 344SQ_miR-200 cells. Actin was used as a loading control. e RNA polymerase II (Pol-II) chromatin immunoprecipitation assay on the Bmp4 promoter region in 344SQ_vec and 344SQ_miR-200 cells. Bars denote DNA precipitation (% of input) from each sample. IgG was used as a negative control. Mean + SD, n = 3; p, two-tailed Student’s t -test
    Figure Legend Snippet: BMP4 is down-regulated in 344SQ_miR-200 cells. a The expression profile of immune-related genes in 344SQ_vector (vec) or 344SQ_miR-200 cells. Yellow: genes up-regulated by miR-200 overexpression; blue: genes down-regulated by miR-200 overexpression. b Quantitative RT-PCR (qRT-PCR) of Bmp4 and miR-200c in 13 murine lung adenocarcinoma cells. Cells were grouped into epithelial- or mesenchymal-like cells on the basis of the expression of EMT markers [ 13 ]. r and p, one-tailed Spearman’s rank correlation test. c qRT-PCR of Bmp4 in 393P, 344SQ, 344SQ_miR-200, 393P_Zeb1, and their control cells (vec). Expression levels were normalized to that of 393P (=1.0). Mean + SD, n = 3; p, two-tailed Student’s t -test. d BMP4 Western blot in 393P, 344SQ, 344SQ_vec, and 344SQ_miR-200 cells. Actin was used as a loading control. e RNA polymerase II (Pol-II) chromatin immunoprecipitation assay on the Bmp4 promoter region in 344SQ_vec and 344SQ_miR-200 cells. Bars denote DNA precipitation (% of input) from each sample. IgG was used as a negative control. Mean + SD, n = 3; p, two-tailed Student’s t -test

    Techniques Used: Expressing, Plasmid Preparation, Over Expression, Quantitative RT-PCR, One-tailed Test, Two Tailed Test, Western Blot, Chromatin Immunoprecipitation, Negative Control

    11) Product Images from "Efficient Co-Replication of Defective Novirhabdovirus"

    Article Title: Efficient Co-Replication of Defective Novirhabdovirus

    Journal: Viruses

    doi: 10.3390/v8030069

    Schematic representation of the various recombinant VHSV genomes and RT-PCR products analysis. A schematic representation of rVHSV, rVHSV-ΔN-Red (mKate), rVHSV-ΔP-Green (GFP) or rVHSV-GFP genomes is shown. Part of the genomes containing mKate or GFP genes was amplified through RT-PCR with specific primers ( Table 1 ). The black line above genomes indicates the parts of the genomes amplified ( A ). Agarose gel analysis of the PCR or RT-PCR products amplified from either the plasmid constructs pVHSV-ΔP-Green (1) and pVHSV-ΔN-Red (2) or from supernatant of yellow infected-cell foci (3), respectively ( B ). M: DNA molecular weight marker (ThermoFisher scientific).
    Figure Legend Snippet: Schematic representation of the various recombinant VHSV genomes and RT-PCR products analysis. A schematic representation of rVHSV, rVHSV-ΔN-Red (mKate), rVHSV-ΔP-Green (GFP) or rVHSV-GFP genomes is shown. Part of the genomes containing mKate or GFP genes was amplified through RT-PCR with specific primers ( Table 1 ). The black line above genomes indicates the parts of the genomes amplified ( A ). Agarose gel analysis of the PCR or RT-PCR products amplified from either the plasmid constructs pVHSV-ΔP-Green (1) and pVHSV-ΔN-Red (2) or from supernatant of yellow infected-cell foci (3), respectively ( B ). M: DNA molecular weight marker (ThermoFisher scientific).

    Techniques Used: Recombinant, Reverse Transcription Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Plasmid Preparation, Construct, Infection, Molecular Weight, Marker

    12) Product Images from "Telomere and ribosomal DNA repeats are chromosomal targets of the bloom syndrome DNA helicase"

    Article Title: Telomere and ribosomal DNA repeats are chromosomal targets of the bloom syndrome DNA helicase

    Journal: BMC Cell Biology

    doi: 10.1186/1471-2121-4-15

    Map of sequence elements in the human rDNA repeat unit and identification of the BLM association domains. A. The human rDNA repeat unit (U13369) sequence features and the location of the region isolated with a polyclonal BLM antibody. The orange arrows indicate sites of primer sets. The dotted lines indicate the direction of DNA replication origins [ 30 ]. B. ChIP mapping of BLM association with the rDNA repeat and mapping of BLM domains required for rDNA association. Equivalent amounts of DNA recovered from the induced cell lines were amplified with Taq DNA polymerase and one of eight primer sets, denatured and transferred to a nylon membrane. The PCR products were hybridized with the radiolabeled forward primer in each set and quantitated using a phosphorimager. Hybridization units were calculated relative to the cell line expressing EGF alone. C. A simple model for the BLM-binding region of the rDNA repeat.
    Figure Legend Snippet: Map of sequence elements in the human rDNA repeat unit and identification of the BLM association domains. A. The human rDNA repeat unit (U13369) sequence features and the location of the region isolated with a polyclonal BLM antibody. The orange arrows indicate sites of primer sets. The dotted lines indicate the direction of DNA replication origins [ 30 ]. B. ChIP mapping of BLM association with the rDNA repeat and mapping of BLM domains required for rDNA association. Equivalent amounts of DNA recovered from the induced cell lines were amplified with Taq DNA polymerase and one of eight primer sets, denatured and transferred to a nylon membrane. The PCR products were hybridized with the radiolabeled forward primer in each set and quantitated using a phosphorimager. Hybridization units were calculated relative to the cell line expressing EGF alone. C. A simple model for the BLM-binding region of the rDNA repeat.

    Techniques Used: Sequencing, Isolation, Chromatin Immunoprecipitation, Amplification, Polymerase Chain Reaction, Hybridization, Expressing, Binding Assay

    13) Product Images from "Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application"

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application

    Journal: BMC Genomics

    doi: 10.1186/s12864-017-4371-5

    DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown
    Figure Legend Snippet: DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown

    Techniques Used: DNA Purification, Chromatin Immunoprecipitation, Purification, Generated, Derivative Assay, Polymerase Chain Reaction, Amplification, Real-time Polymerase Chain Reaction

    14) Product Images from "Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application"

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application

    Journal: BMC Genomics

    doi: 10.1186/s12864-017-4371-5

    DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown
    Figure Legend Snippet: DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown

    Techniques Used: DNA Purification, Chromatin Immunoprecipitation, Purification, Generated, Derivative Assay, Polymerase Chain Reaction, Amplification, Real-time Polymerase Chain Reaction

    15) Product Images from "Melatonin inhibits TPA-induced oral cancer cell migration by suppressing matrix metalloproteinase-9 activation through the histone acetylation"

    Article Title: Melatonin inhibits TPA-induced oral cancer cell migration by suppressing matrix metalloproteinase-9 activation through the histone acetylation

    Journal: Oncotarget

    doi: 10.18632/oncotarget.8009

    Critical role of CREBBP and EP300 in TPA-induced transcriptional inhibition of MMP-9 in HSC-3 and OECM-1 cells ( A ) HSC-3 and OECM-1 cells were transfected with the CREBBP and EP300 siRNA, and then treated with TPA (50 ng/mL) for 24 h. MMP-9 mRNA levels were determined by RT-PCR and real-time PCR. ( B ) Cell migration was measured using transwell for 24 h (OECM-1 cell) and 48 h (HSC-3 cell) with polycarbonate filters, respectively. The values represented the means ± SD of at least three independent experiments. * p
    Figure Legend Snippet: Critical role of CREBBP and EP300 in TPA-induced transcriptional inhibition of MMP-9 in HSC-3 and OECM-1 cells ( A ) HSC-3 and OECM-1 cells were transfected with the CREBBP and EP300 siRNA, and then treated with TPA (50 ng/mL) for 24 h. MMP-9 mRNA levels were determined by RT-PCR and real-time PCR. ( B ) Cell migration was measured using transwell for 24 h (OECM-1 cell) and 48 h (HSC-3 cell) with polycarbonate filters, respectively. The values represented the means ± SD of at least three independent experiments. * p

    Techniques Used: Inhibition, Transfection, Reverse Transcription Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, Migration

    16) Product Images from "Microchimeric fetal cells play a role in maternal wound healing after pregnancy"

    Article Title: Microchimeric fetal cells play a role in maternal wound healing after pregnancy

    Journal: Chimerism

    doi: 10.4161/chim.28746

    Figure 5. Nested PCR products of 345bp assessed by electrophoresis in a 1.2% Agarose gel. L = 100bp DNA ladder (Promega, UK), (2–6) CS-scars, (7) Positive control using placental tissue and (8) Negative control using nulliparous skin.
    Figure Legend Snippet: Figure 5. Nested PCR products of 345bp assessed by electrophoresis in a 1.2% Agarose gel. L = 100bp DNA ladder (Promega, UK), (2–6) CS-scars, (7) Positive control using placental tissue and (8) Negative control using nulliparous skin.

    Techniques Used: Nested PCR, Electrophoresis, Agarose Gel Electrophoresis, Positive Control, Negative Control

    17) Product Images from "Genome-wide mapping of 8-oxo-7,8-dihydro-2′-deoxyguanosine reveals accumulation of oxidatively-generated damage at DNA replication origins within transcribed long genes of mammalian cells"

    Article Title: Genome-wide mapping of 8-oxo-7,8-dihydro-2′-deoxyguanosine reveals accumulation of oxidatively-generated damage at DNA replication origins within transcribed long genes of mammalian cells

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gky1152

    ( A ) Number of 8-oxodGs per million of dGs (8-oxodg/10 6 dG) measured by LC-MS/MS in untreated (NT), UV-irradiated (UV) and NAC-treated (NAC) MCF10A cells, as indicated. ( B ) Efficiency of polyclonal anti-8-oxodG from Millipore (Ab M), or monoclonal anti-8-oxodG from Trevigen (Ab T), and of anti-IgG antibodies in immuno-precipitation assays of 8-oxodG-containing synthetic ssDNA or G4 structures, as indicated. ( C ) Anti-8oxodG immuno-precipitation assay (% of input DNA, measured by qPCR; y axis) with equal amount (64 pg) of both synthetic oligonucleotides (8-oxodG-100mer and dG-100mer) added to 1 μg of NAC-treated genomic DNA. C1 and C2 indicate the same genomic negative control regions as in panel G. ( D ) Screenshot from the UCSC genome browser of 3.7 Mb from human chromosome 19 showing (top to bottom): OxiDIP-Seq signal profile, 8-oxodG peaks (dots), Input DNA, CG%, and RefSeq genes. ( E ) Screenshot from the UCSC genome browser of 2.1 Mb from human chromosome 19 showing OxiDIP-Seq signal profiles of two independent experiments (Exp #1 and #2) and Input DNA. ( F ) Scatter plot showing the correlation of the OxiDIP-Seq signals obtained in two independent experiments (Exp #1 and #2). Pearson's correlation coefficient (r), as indicated. Figure inset shows magnification of the high-density region. ( G ) OxiDIP-qPCR showing 8-oxodG enrichments (% of Input DNA) at eight different positive (#1–8) and two negative (C1, C2) regions, in untreated (black bar), UV- (gray), or NAC-treated (white) MCF10A cells. Screenshots from the UCSC genome browser show genomic position, 8-oxodG signal intensity, and qPCR probes (black box) of the selected regions. Data from two independent OxiDIP-qPCR assays are shown (±S.D.; P
    Figure Legend Snippet: ( A ) Number of 8-oxodGs per million of dGs (8-oxodg/10 6 dG) measured by LC-MS/MS in untreated (NT), UV-irradiated (UV) and NAC-treated (NAC) MCF10A cells, as indicated. ( B ) Efficiency of polyclonal anti-8-oxodG from Millipore (Ab M), or monoclonal anti-8-oxodG from Trevigen (Ab T), and of anti-IgG antibodies in immuno-precipitation assays of 8-oxodG-containing synthetic ssDNA or G4 structures, as indicated. ( C ) Anti-8oxodG immuno-precipitation assay (% of input DNA, measured by qPCR; y axis) with equal amount (64 pg) of both synthetic oligonucleotides (8-oxodG-100mer and dG-100mer) added to 1 μg of NAC-treated genomic DNA. C1 and C2 indicate the same genomic negative control regions as in panel G. ( D ) Screenshot from the UCSC genome browser of 3.7 Mb from human chromosome 19 showing (top to bottom): OxiDIP-Seq signal profile, 8-oxodG peaks (dots), Input DNA, CG%, and RefSeq genes. ( E ) Screenshot from the UCSC genome browser of 2.1 Mb from human chromosome 19 showing OxiDIP-Seq signal profiles of two independent experiments (Exp #1 and #2) and Input DNA. ( F ) Scatter plot showing the correlation of the OxiDIP-Seq signals obtained in two independent experiments (Exp #1 and #2). Pearson's correlation coefficient (r), as indicated. Figure inset shows magnification of the high-density region. ( G ) OxiDIP-qPCR showing 8-oxodG enrichments (% of Input DNA) at eight different positive (#1–8) and two negative (C1, C2) regions, in untreated (black bar), UV- (gray), or NAC-treated (white) MCF10A cells. Screenshots from the UCSC genome browser show genomic position, 8-oxodG signal intensity, and qPCR probes (black box) of the selected regions. Data from two independent OxiDIP-qPCR assays are shown (±S.D.; P

    Techniques Used: Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry, Irradiation, Immunoprecipitation, Real-time Polymerase Chain Reaction, Negative Control

    18) Product Images from "High-resolution genome-wide functional dissection of transcriptional regulatory regions and nucleotides in human"

    Article Title: High-resolution genome-wide functional dissection of transcriptional regulatory regions and nucleotides in human

    Journal: Nature Communications

    doi: 10.1038/s41467-018-07746-1

    Overview of HiDRA. a Cells with the desired genotype and open chormatin patterns are selected for library construction. Tn5 transposase is used to preferentially fragment genomic DNA at regions of open chromatin. Fragments are then size-selected on an agarose gel and mtDNA contamination is removed by selective CRISPR-Cas9 degradation. The fragment library is amplified by PCR and cloned into an enhancer reporter vector. Gel image adapted from Buenrostro et al. 21 . Fragments are cloned into the STARR-seq vector backbone, introduced into target cells (which can differ from cells used to construct the library), and RNA is collected and sequenced. After data processing, the activity of partially-overlapping fragments is compared to identify driver nucleotides using the SHARPR-RE algorithm. b Size distribution of HiDRA library fragments (blue) and tiled regions (green). Bimodal shape for library fragment sizes is due to Tn5 preference to cut adjacent to nucleosomes. Fragment bin size = 20 nt, region bin size = 50 nt. c Number of ChromHMM-predicted active enhancer, active TSS and ATAC-seq peaks covered by multiple unique HiDRA fragments. d HiDRA plasmid library recapitulates the genomic coverage of a conventional ATAC-seq experiment
    Figure Legend Snippet: Overview of HiDRA. a Cells with the desired genotype and open chormatin patterns are selected for library construction. Tn5 transposase is used to preferentially fragment genomic DNA at regions of open chromatin. Fragments are then size-selected on an agarose gel and mtDNA contamination is removed by selective CRISPR-Cas9 degradation. The fragment library is amplified by PCR and cloned into an enhancer reporter vector. Gel image adapted from Buenrostro et al. 21 . Fragments are cloned into the STARR-seq vector backbone, introduced into target cells (which can differ from cells used to construct the library), and RNA is collected and sequenced. After data processing, the activity of partially-overlapping fragments is compared to identify driver nucleotides using the SHARPR-RE algorithm. b Size distribution of HiDRA library fragments (blue) and tiled regions (green). Bimodal shape for library fragment sizes is due to Tn5 preference to cut adjacent to nucleosomes. Fragment bin size = 20 nt, region bin size = 50 nt. c Number of ChromHMM-predicted active enhancer, active TSS and ATAC-seq peaks covered by multiple unique HiDRA fragments. d HiDRA plasmid library recapitulates the genomic coverage of a conventional ATAC-seq experiment

    Techniques Used: Agarose Gel Electrophoresis, CRISPR, Amplification, Polymerase Chain Reaction, Clone Assay, Plasmid Preparation, Construct, Activity Assay

    19) Product Images from "A Molecular Epidemiology Survey of Respiratory Adenoviruses Circulating in Children Residing in Southern Palestine"

    Article Title: A Molecular Epidemiology Survey of Respiratory Adenoviruses Circulating in Children Residing in Southern Palestine

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0042732

    Circulating HAdV types in southern Palestine. HAdV types circulating in Southern Palestine from 2005 to 2010 were detected using nested PCR and DNA sequencing assay of the HAdV hexon gene HVR1–6 followed by sequencing and sequence analysis. The 44 sequences were assigned the GenBank accession numbers [JQ796022–JQ796065]. The percentage of each serotype was calculated relatively to the number of total sequenced samples (44 samples).
    Figure Legend Snippet: Circulating HAdV types in southern Palestine. HAdV types circulating in Southern Palestine from 2005 to 2010 were detected using nested PCR and DNA sequencing assay of the HAdV hexon gene HVR1–6 followed by sequencing and sequence analysis. The 44 sequences were assigned the GenBank accession numbers [JQ796022–JQ796065]. The percentage of each serotype was calculated relatively to the number of total sequenced samples (44 samples).

    Techniques Used: Nested PCR, DNA Sequencing, Sequencing

    20) Product Images from "The usefulness of biotyping in the determination of selected pathogenicity determinants in Streptococcus mutans"

    Article Title: The usefulness of biotyping in the determination of selected pathogenicity determinants in Streptococcus mutans

    Journal: BMC Microbiology

    doi: 10.1186/1471-2180-14-194

    16s rDNA sequencing strategy. A . NC_004350.2 – Streptococcus mutans UA159 genome, SMU_r04 - 16S ribosomal RNA gene (length 1552 bp), grey arrow – forward primer (CGCTGGCGGCGTGCCTAATA), white arrow – reverse primer (TGCAAAGCAGGCGCTCTCCC). B . PCR product (length 1620 bp). C . Average sequencing read length for forward (grey stripe) and reverse (white stripe) primer.
    Figure Legend Snippet: 16s rDNA sequencing strategy. A . NC_004350.2 – Streptococcus mutans UA159 genome, SMU_r04 - 16S ribosomal RNA gene (length 1552 bp), grey arrow – forward primer (CGCTGGCGGCGTGCCTAATA), white arrow – reverse primer (TGCAAAGCAGGCGCTCTCCC). B . PCR product (length 1620 bp). C . Average sequencing read length for forward (grey stripe) and reverse (white stripe) primer.

    Techniques Used: Sequencing, Polymerase Chain Reaction

    21) Product Images from "Dysregulated immune system networks in war veterans with PTSD is an outcome of altered miRNA expression and DNA methylation"

    Article Title: Dysregulated immune system networks in war veterans with PTSD is an outcome of altered miRNA expression and DNA methylation

    Journal: Scientific Reports

    doi: 10.1038/srep31209

    DNA methylation level has a trend that corroborates gene expression. There is a clear trend showing higher DNA methylation and lowered mRNA levels and vice-versa for the corresponding gene. (a) DNA methylation levels of the select genes presented as box plot. On x-axis, the names of gene are provided and y-axis provides the average β- values of DNA methylation. The two bars corresponding to each gene represent the DNA methylation level for control followed by PTSD patient in a left to right direction. (b) Transcript levels (y-axis: log 2 fold change values) of genes, after RNA-Seq analysis, listed in Fig. 4a. (c) Real time PCR validation of differentially expressed genes. To validate the RNA-Seq results, qRT-PCR was performed for seven representative genes with cDNA prepared from total RNA obtained from PBMCs of 24 control and 24 PTSD patients. The values are relative abundance (RA) values after qRT-PCR. The table inside the figure provides log 2 fold change values of the respective genes after RNA-Seq analysis. The error bars indicate standard error.
    Figure Legend Snippet: DNA methylation level has a trend that corroborates gene expression. There is a clear trend showing higher DNA methylation and lowered mRNA levels and vice-versa for the corresponding gene. (a) DNA methylation levels of the select genes presented as box plot. On x-axis, the names of gene are provided and y-axis provides the average β- values of DNA methylation. The two bars corresponding to each gene represent the DNA methylation level for control followed by PTSD patient in a left to right direction. (b) Transcript levels (y-axis: log 2 fold change values) of genes, after RNA-Seq analysis, listed in Fig. 4a. (c) Real time PCR validation of differentially expressed genes. To validate the RNA-Seq results, qRT-PCR was performed for seven representative genes with cDNA prepared from total RNA obtained from PBMCs of 24 control and 24 PTSD patients. The values are relative abundance (RA) values after qRT-PCR. The table inside the figure provides log 2 fold change values of the respective genes after RNA-Seq analysis. The error bars indicate standard error.

    Techniques Used: DNA Methylation Assay, Expressing, RNA Sequencing Assay, Real-time Polymerase Chain Reaction, Quantitative RT-PCR

    22) Product Images from "A retrospective study of community-acquired Clostridium difficile infection in southwest China"

    Article Title: A retrospective study of community-acquired Clostridium difficile infection in southwest China

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-21762-7

    The toxin profiles and PCR ribotyping characters of C. difficile between children and adults in this study. ( A ) The toxin profile of isolated strains. ( B ) RT constituent ratio of C. difficile strains. Left: children group; right: adults group. ( C ) RT distribu tion characters of C. difficile for different hospitals in children group. ( D ) RT distribution characters of C. difficile for different hospitals in adults group. ( E ). RT distribution characters of C. difficile for fecal property in children group. ( F ) RT distribution characters of C. difficile for fecal property in adults group.
    Figure Legend Snippet: The toxin profiles and PCR ribotyping characters of C. difficile between children and adults in this study. ( A ) The toxin profile of isolated strains. ( B ) RT constituent ratio of C. difficile strains. Left: children group; right: adults group. ( C ) RT distribu tion characters of C. difficile for different hospitals in children group. ( D ) RT distribution characters of C. difficile for different hospitals in adults group. ( E ). RT distribution characters of C. difficile for fecal property in children group. ( F ) RT distribution characters of C. difficile for fecal property in adults group.

    Techniques Used: Polymerase Chain Reaction, Isolation

    23) Product Images from "Catalysts from synthetic genetic polymers"

    Article Title: Catalysts from synthetic genetic polymers

    Journal: Nature

    doi: 10.1038/nature13982

    Selection scheme for RNA endonuclease XNAzymes a , XNA library preparation using DNA-dependent XNA polymerases, primed by a biotinylated chimeric DNA-RNA primer (NucPrim), which serves as substrate for RNA cleavage in cis . Libraries are captured by streptavidin beads, allowing denaturation and removal of DNA templates. b , Single-stranded libraries are annealed and incubated in reaction buffer (see Methods ), successful XNAzymes cleave the biotinylated RNA substrate in cis . c , Size separation of reacted XNA pools using denaturing polyacrylamide electrophoresis (Urea-PAGE). Cleaved XNA pools are gel-extracted from the gel and incubated with streptavidin beads to deplete any uncleaved carry-over. d , Reverse transcription of isolated, cleaved XNA pools using XNA-dependent DNA polymerase RT521L (i.e. XNA - > cDNA). e , Amplification of transcribed cDNA by successive PCR reactions. f , PCR reaction generating templates for XNA synthesis for further rounds of selection.
    Figure Legend Snippet: Selection scheme for RNA endonuclease XNAzymes a , XNA library preparation using DNA-dependent XNA polymerases, primed by a biotinylated chimeric DNA-RNA primer (NucPrim), which serves as substrate for RNA cleavage in cis . Libraries are captured by streptavidin beads, allowing denaturation and removal of DNA templates. b , Single-stranded libraries are annealed and incubated in reaction buffer (see Methods ), successful XNAzymes cleave the biotinylated RNA substrate in cis . c , Size separation of reacted XNA pools using denaturing polyacrylamide electrophoresis (Urea-PAGE). Cleaved XNA pools are gel-extracted from the gel and incubated with streptavidin beads to deplete any uncleaved carry-over. d , Reverse transcription of isolated, cleaved XNA pools using XNA-dependent DNA polymerase RT521L (i.e. XNA - > cDNA). e , Amplification of transcribed cDNA by successive PCR reactions. f , PCR reaction generating templates for XNA synthesis for further rounds of selection.

    Techniques Used: Selection, Incubation, Electrophoresis, Polyacrylamide Gel Electrophoresis, Isolation, Amplification, Polymerase Chain Reaction

    Selection scheme for XNA ligase XNAzymes a , XNA library preparation using DNA-dependent XNA polymerases, primed by an all-XNA (FANA) primer (LigS2 F ), which serves as one of the substrates for FANA ligation in cis . Libraries are synthesized with 3′ biotinylated DNA template, allowing capture and removal by streptavidin beads. b , Single-stranded libraries (unbiotinylated) are annealed and incubated in reaction buffer (see Methods ) together with a biotinylated chimeric DNA-XNA (FANA) substrate (tag1_LigS1 F ), activated with a 3′ phosphorylimidazolide ( Extended Data Fig. 10 ), which successful XNAzymes ligate to XNA (FANA) substrate LigS2 F in cis . c , Size separation of reacted XNA pools using Urea-PAGE. Ligated XNA pools are gel-extracted and captured by streptavidin beads. d , Reverse transcription of XNA pools using XNA-dependent DNA polymerase RT521L (i.e. XNA - > cDNA). e , Amplification of transcribed cDNA by successive PCR reactions; out-nest reaction depends on priming site (tag1) from ligated substrate tag1_LigS1 F . f , PCR reaction generating templates for XNA synthesis (now 5′ biotinylated) for further rounds of selection.
    Figure Legend Snippet: Selection scheme for XNA ligase XNAzymes a , XNA library preparation using DNA-dependent XNA polymerases, primed by an all-XNA (FANA) primer (LigS2 F ), which serves as one of the substrates for FANA ligation in cis . Libraries are synthesized with 3′ biotinylated DNA template, allowing capture and removal by streptavidin beads. b , Single-stranded libraries (unbiotinylated) are annealed and incubated in reaction buffer (see Methods ) together with a biotinylated chimeric DNA-XNA (FANA) substrate (tag1_LigS1 F ), activated with a 3′ phosphorylimidazolide ( Extended Data Fig. 10 ), which successful XNAzymes ligate to XNA (FANA) substrate LigS2 F in cis . c , Size separation of reacted XNA pools using Urea-PAGE. Ligated XNA pools are gel-extracted and captured by streptavidin beads. d , Reverse transcription of XNA pools using XNA-dependent DNA polymerase RT521L (i.e. XNA - > cDNA). e , Amplification of transcribed cDNA by successive PCR reactions; out-nest reaction depends on priming site (tag1) from ligated substrate tag1_LigS1 F . f , PCR reaction generating templates for XNA synthesis (now 5′ biotinylated) for further rounds of selection.

    Techniques Used: Selection, Ligation, Synthesized, Incubation, Polyacrylamide Gel Electrophoresis, Amplification, Polymerase Chain Reaction

    Selection scheme for RNA ligase XNAzymes a , XNA library preparation using DNA-dependent XNA polymerases, primed by a 5′ triphosphorylated (5′ppp) RNA primer (LigS2 R ), which serves as one of the substrates for RNA ligation in cis . Libraries are synthesized with 3′ biotinylated DNA template, allowing capture and removal by streptavidin beads. b , Single-stranded libraries (unbiotinylated) are annealed and incubated in reaction buffer (see Method) together with a biotinylated chimeric DNA-RNA substrate (tag1_LigS1 R ), which successful XNAzymes ligate to RNA substrate LigS2 R in cis . c , Size separation of reacted XNA pools using Urea-PAGE. Ligated XNA pools are gel-extracted and captured by streptavidin beads. d , Reverse transcription of XNA pools using XNA-dependent DNA polymerase RT521L, which is also able to transcribe RNA across the ligation junction (i.e. [RNA-RNA-XNA] - > cDNA). e , Amplification of transcribed cDNA by successive PCR reactions; out-nest reaction depends on priming site (tag1) from ligated substrate tag1_LigS1 R . f , PCR reaction generating templates for XNA synthesis (now 5′ biotinylated) for further rounds of selection.
    Figure Legend Snippet: Selection scheme for RNA ligase XNAzymes a , XNA library preparation using DNA-dependent XNA polymerases, primed by a 5′ triphosphorylated (5′ppp) RNA primer (LigS2 R ), which serves as one of the substrates for RNA ligation in cis . Libraries are synthesized with 3′ biotinylated DNA template, allowing capture and removal by streptavidin beads. b , Single-stranded libraries (unbiotinylated) are annealed and incubated in reaction buffer (see Method) together with a biotinylated chimeric DNA-RNA substrate (tag1_LigS1 R ), which successful XNAzymes ligate to RNA substrate LigS2 R in cis . c , Size separation of reacted XNA pools using Urea-PAGE. Ligated XNA pools are gel-extracted and captured by streptavidin beads. d , Reverse transcription of XNA pools using XNA-dependent DNA polymerase RT521L, which is also able to transcribe RNA across the ligation junction (i.e. [RNA-RNA-XNA] - > cDNA). e , Amplification of transcribed cDNA by successive PCR reactions; out-nest reaction depends on priming site (tag1) from ligated substrate tag1_LigS1 R . f , PCR reaction generating templates for XNA synthesis (now 5′ biotinylated) for further rounds of selection.

    Techniques Used: Selection, Ligation, Synthesized, Incubation, Polyacrylamide Gel Electrophoresis, Amplification, Polymerase Chain Reaction

    24) Product Images from "Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application"

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application

    Journal: BMC Genomics

    doi: 10.1186/s12864-017-4371-5

    DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown
    Figure Legend Snippet: DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown

    Techniques Used: DNA Purification, Chromatin Immunoprecipitation, Purification, Generated, Derivative Assay, Polymerase Chain Reaction, Amplification, Real-time Polymerase Chain Reaction

    25) Product Images from "Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application"

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application

    Journal: BMC Genomics

    doi: 10.1186/s12864-017-4371-5

    DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown
    Figure Legend Snippet: DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown

    Techniques Used: DNA Purification, Chromatin Immunoprecipitation, Purification, Generated, Derivative Assay, Polymerase Chain Reaction, Amplification, Real-time Polymerase Chain Reaction

    26) Product Images from "Dysregulated immune system networks in war veterans with PTSD is an outcome of altered miRNA expression and DNA methylation"

    Article Title: Dysregulated immune system networks in war veterans with PTSD is an outcome of altered miRNA expression and DNA methylation

    Journal: Scientific Reports

    doi: 10.1038/srep31209

    DNA methylation level has a trend that corroborates gene expression. There is a clear trend showing higher DNA methylation and lowered mRNA levels and vice-versa for the corresponding gene. (a) DNA methylation levels of the select genes presented as box plot. On x-axis, the names of gene are provided and y-axis provides the average β- values of DNA methylation. The two bars corresponding to each gene represent the DNA methylation level for control followed by PTSD patient in a left to right direction. (b) Transcript levels (y-axis: log 2 fold change values) of genes, after RNA-Seq analysis, listed in Fig. 4a. (c) Real time PCR validation of differentially expressed genes. To validate the RNA-Seq results, qRT-PCR was performed for seven representative genes with cDNA prepared from total RNA obtained from PBMCs of 24 control and 24 PTSD patients. The values are relative abundance (RA) values after qRT-PCR. The table inside the figure provides log 2 fold change values of the respective genes after RNA-Seq analysis. The error bars indicate standard error.
    Figure Legend Snippet: DNA methylation level has a trend that corroborates gene expression. There is a clear trend showing higher DNA methylation and lowered mRNA levels and vice-versa for the corresponding gene. (a) DNA methylation levels of the select genes presented as box plot. On x-axis, the names of gene are provided and y-axis provides the average β- values of DNA methylation. The two bars corresponding to each gene represent the DNA methylation level for control followed by PTSD patient in a left to right direction. (b) Transcript levels (y-axis: log 2 fold change values) of genes, after RNA-Seq analysis, listed in Fig. 4a. (c) Real time PCR validation of differentially expressed genes. To validate the RNA-Seq results, qRT-PCR was performed for seven representative genes with cDNA prepared from total RNA obtained from PBMCs of 24 control and 24 PTSD patients. The values are relative abundance (RA) values after qRT-PCR. The table inside the figure provides log 2 fold change values of the respective genes after RNA-Seq analysis. The error bars indicate standard error.

    Techniques Used: DNA Methylation Assay, Expressing, RNA Sequencing Assay, Real-time Polymerase Chain Reaction, Quantitative RT-PCR

    27) Product Images from "SABER enables amplified and multiplexed imaging of RNA and DNA in cells and tissues"

    Article Title: SABER enables amplified and multiplexed imaging of RNA and DNA in cells and tissues

    Journal: Nature methods

    doi: 10.1038/s41592-019-0404-0

    Sequential imaging of chromosomal targets using Exchange-SABER. a , Schematic of 17 targeted regions along the human X chromosome (width to scale). Each set of probes per spot had different 42mer barcode sequences appended to their 3’ ends ( Fig. 1d ). Seventeen 42mer bridge sequences concatemerized with 17 different PER primers were co-hybridized. b , Individual color channels on DAPI. 6 hybridizations, targeting 3, 3, 3, 3, 3, and 2 spots, respectively, that took course over a single day were used to image the 17 colors. c , 17-color overlays on DAPI. The representative metaphase spread from part (B) is shown overlaid on DAPI at two length scales (top left, top right). Interphase cells showing the X chromosome territories were also captured (bottom). d , Combinatorial 6-color SABER imaging. As a step toward increasing multiplexing with SABER amplification further, we demonstrated mapping six of the spots on the chromosome to 4 different 6-color combinations. Scale bars: 5 μm (spreads), 20 μm (fields of view).
    Figure Legend Snippet: Sequential imaging of chromosomal targets using Exchange-SABER. a , Schematic of 17 targeted regions along the human X chromosome (width to scale). Each set of probes per spot had different 42mer barcode sequences appended to their 3’ ends ( Fig. 1d ). Seventeen 42mer bridge sequences concatemerized with 17 different PER primers were co-hybridized. b , Individual color channels on DAPI. 6 hybridizations, targeting 3, 3, 3, 3, 3, and 2 spots, respectively, that took course over a single day were used to image the 17 colors. c , 17-color overlays on DAPI. The representative metaphase spread from part (B) is shown overlaid on DAPI at two length scales (top left, top right). Interphase cells showing the X chromosome territories were also captured (bottom). d , Combinatorial 6-color SABER imaging. As a step toward increasing multiplexing with SABER amplification further, we demonstrated mapping six of the spots on the chromosome to 4 different 6-color combinations. Scale bars: 5 μm (spreads), 20 μm (fields of view).

    Techniques Used: Imaging, Multiplexing, Amplification

    28) Product Images from "A Molecular Epidemiology Survey of Respiratory Adenoviruses Circulating in Children Residing in Southern Palestine"

    Article Title: A Molecular Epidemiology Survey of Respiratory Adenoviruses Circulating in Children Residing in Southern Palestine

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0042732

    Circulating HAdV types in southern Palestine. HAdV types circulating in Southern Palestine from 2005 to 2010 were detected using nested PCR and DNA sequencing assay of the HAdV hexon gene HVR1–6 followed by sequencing and sequence analysis. The 44 sequences were assigned the GenBank accession numbers [JQ796022–JQ796065]. The percentage of each serotype was calculated relatively to the number of total sequenced samples (44 samples).
    Figure Legend Snippet: Circulating HAdV types in southern Palestine. HAdV types circulating in Southern Palestine from 2005 to 2010 were detected using nested PCR and DNA sequencing assay of the HAdV hexon gene HVR1–6 followed by sequencing and sequence analysis. The 44 sequences were assigned the GenBank accession numbers [JQ796022–JQ796065]. The percentage of each serotype was calculated relatively to the number of total sequenced samples (44 samples).

    Techniques Used: Nested PCR, DNA Sequencing, Sequencing

    29) Product Images from "Processing of the Escherichia coli leuX tRNA transcript, encoding tRNALeu5, requires either the 3?- > 5? exoribonuclease polynucleotide phosphorylase or RNase P to remove the Rho-independent transcription terminator"

    Article Title: Processing of the Escherichia coli leuX tRNA transcript, encoding tRNALeu5, requires either the 3?- > 5? exoribonuclease polynucleotide phosphorylase or RNase P to remove the Rho-independent transcription terminator

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkp997

    Primer extension analysis of the 5′ upstream region of leuX transcript. The reverse transcription products of total RNA (10 μg/lane) isolated from wild-type (MG1693), rne-1 (SK5665), rnpA49 (SK2525) and rne-1 rnpA49 (SK2534) strains using the primer b ( Figure 1 A) was separated on a 6% PAGE as described in the ‘Materials and Methods’ section. The CTAG sequencing reactions were carried out using the same primer and a leuX PCR DNA fragment as template. The transcription start site (I) and the 5′ mature terminus (II) of leuX transcript are indicated. The nucleotide sequences between transcription start ( G ) and the 5′ mature terminus ( G ) are shown to the left of the autoradiogram. Asterisk indicates the 5′-ends arising from RNase E cleavages.
    Figure Legend Snippet: Primer extension analysis of the 5′ upstream region of leuX transcript. The reverse transcription products of total RNA (10 μg/lane) isolated from wild-type (MG1693), rne-1 (SK5665), rnpA49 (SK2525) and rne-1 rnpA49 (SK2534) strains using the primer b ( Figure 1 A) was separated on a 6% PAGE as described in the ‘Materials and Methods’ section. The CTAG sequencing reactions were carried out using the same primer and a leuX PCR DNA fragment as template. The transcription start site (I) and the 5′ mature terminus (II) of leuX transcript are indicated. The nucleotide sequences between transcription start ( G ) and the 5′ mature terminus ( G ) are shown to the left of the autoradiogram. Asterisk indicates the 5′-ends arising from RNase E cleavages.

    Techniques Used: Isolation, Polyacrylamide Gel Electrophoresis, Sequencing, Polymerase Chain Reaction

    30) Product Images from "Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application"

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application

    Journal: BMC Genomics

    doi: 10.1186/s12864-017-4371-5

    DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown
    Figure Legend Snippet: DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown

    Techniques Used: DNA Purification, Chromatin Immunoprecipitation, Purification, Generated, Derivative Assay, Polymerase Chain Reaction, Amplification, Real-time Polymerase Chain Reaction

    31) Product Images from "Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application"

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application

    Journal: BMC Genomics

    doi: 10.1186/s12864-017-4371-5

    DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown
    Figure Legend Snippet: DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown

    Techniques Used: DNA Purification, Chromatin Immunoprecipitation, Purification, Generated, Derivative Assay, Polymerase Chain Reaction, Amplification, Real-time Polymerase Chain Reaction

    32) Product Images from "Dynamics of BAF- Polycomb Complex Opposition on Heterochromatin in Normal and Oncogenic States"

    Article Title: Dynamics of BAF- Polycomb Complex Opposition on Heterochromatin in Normal and Oncogenic States

    Journal: Nature genetics

    doi: 10.1038/ng.3734

    BAF complexes displace PcG repression upon recruitment (a) Schematic for rapamycin-induced recruitment of Frb-V5-Ss18 BAF complexes. (b-c) BAF complex recruitment results in (b) Ezh2 displacement within 10 min followed by H3K27me3 removal within 20 min, and (c) Ring1b displacement within 5 min followed by H2AK119ub1 removal within 7.5min (at -443bp ZFHD1 site). (d) Total histone (H3) occupancy and non-PcG histone marks (H3K9me3, H2A.Z) are unaffected by BAF complex recruitment (left). Comparison of H3 levels to PcG marks shows removal of PRC1 repression followed by removal of PRC2 repression, with H3 unchanged (right). (e) ATAC-qPCR at ZFHD recruitment site (-443bp) shows increase in DNA accessibility upon BAF complex recruitment. (f) The HELLS (LSH) chromatin remodeler shows rapid recruitment via rapamycin-recruitment system (left), however PRC1 and PRC1-placed repressive marks are not displaced (right), nor are H3K9me3 or total H3. All ChIP-qPCR measurements are at the -443bp ZFHD1 site. Error bars = Mean ± SD for n=3 experiments except (c) for n=2 experiments.
    Figure Legend Snippet: BAF complexes displace PcG repression upon recruitment (a) Schematic for rapamycin-induced recruitment of Frb-V5-Ss18 BAF complexes. (b-c) BAF complex recruitment results in (b) Ezh2 displacement within 10 min followed by H3K27me3 removal within 20 min, and (c) Ring1b displacement within 5 min followed by H2AK119ub1 removal within 7.5min (at -443bp ZFHD1 site). (d) Total histone (H3) occupancy and non-PcG histone marks (H3K9me3, H2A.Z) are unaffected by BAF complex recruitment (left). Comparison of H3 levels to PcG marks shows removal of PRC1 repression followed by removal of PRC2 repression, with H3 unchanged (right). (e) ATAC-qPCR at ZFHD recruitment site (-443bp) shows increase in DNA accessibility upon BAF complex recruitment. (f) The HELLS (LSH) chromatin remodeler shows rapid recruitment via rapamycin-recruitment system (left), however PRC1 and PRC1-placed repressive marks are not displaced (right), nor are H3K9me3 or total H3. All ChIP-qPCR measurements are at the -443bp ZFHD1 site. Error bars = Mean ± SD for n=3 experiments except (c) for n=2 experiments.

    Techniques Used: Real-time Polymerase Chain Reaction, Chromatin Immunoprecipitation

    33) Product Images from "Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application"

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application

    Journal: BMC Genomics

    doi: 10.1186/s12864-017-4371-5

    DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown
    Figure Legend Snippet: DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown

    Techniques Used: DNA Purification, Chromatin Immunoprecipitation, Purification, Generated, Derivative Assay, Polymerase Chain Reaction, Amplification, Real-time Polymerase Chain Reaction

    34) Product Images from "Germline transformation of the stalk-eyed fly, Teleopsis dalmanni"

    Article Title: Germline transformation of the stalk-eyed fly, Teleopsis dalmanni

    Journal: BMC Molecular Biology

    doi: 10.1186/1471-2199-11-86

    PCR-based assays for transposon excision in T. dalmanni embryos . (A) Schematic representation of a PCR-based excision assay. Donor plasmids contain the terminal inverted repeats (TIRs), from the piggyBac, mariner or Minos transposon, flanking a transgene. In the presence of transposase, donor plasmids undergo excision of the transgene.
    Figure Legend Snippet: PCR-based assays for transposon excision in T. dalmanni embryos . (A) Schematic representation of a PCR-based excision assay. Donor plasmids contain the terminal inverted repeats (TIRs), from the piggyBac, mariner or Minos transposon, flanking a transgene. In the presence of transposase, donor plasmids undergo excision of the transgene. "Excision primers" (red arrows) flank the entire construct including the TIRs. PCR of the unexcised construct will give rise to a product too large to be amplified efficiently (2-10 kb) under standard conditions. Amplification post-excision produces a smaller product (0.1-1 kb). Excision primers are validated using modified donor plasmids, from which the element had been excised by digestion with an appropriate restriction enzyme, as control templates. "Extraction primers" (blue arrows) amplify part of the donor plasmid backbone to demonstrate successful extraction of the donor plasmid from injected embryos. PCR with these primers produces the same size product (0.1-1 kb) both pre-and post-excision. (B-E) Results of the excision assay using piggyBac (B), mariner (C) and Minos (D and E). Templates for PCR were: DNA extracted from embryos injected with donor plasmid and a source of transposase (with transposase); DNA extracted from embryos with donor plasmid without a source of transposase (without transposase); donor plasmid control templates (+ve control); water (-ve control). PCR reactions either used excision primers (red lettering) to test for excision of the transposable element, or extraction primers (blue lettering) to test for successful extraction of the plasmids from injected embryos (see Additional file 2 : Table S1). White triangles denote the expected size of the excision primer PCR product post-excision of the element. For the piggyBac (B) and mariner (C) assays, a DNA source of transposase was used. For the Minos assays both a DNA source of transposase (D) and an mRNA source of transposase were tested (E). Excision was detected for piggyBac and both Minos assays when the donor plasmid was injected with a source of transposase but not in the mariner assay. No excision was detected when donor plasmids were injected without a source of transposase indicating a lack of endogenous transposase activity in the embryos. In all cases donor plasmids were successfully extracted from embryos.

    Techniques Used: Polymerase Chain Reaction, Excision Assay, Construct, Amplification, Modification, Plasmid Preparation, Injection, Activity Assay

    35) Product Images from "Components of the interleukin-33/ST2 system are differentially expressed and regulated in human cardiac cells and in cells of the cardiac vasculature"

    Article Title: Components of the interleukin-33/ST2 system are differentially expressed and regulated in human cardiac cells and in cells of the cardiac vasculature

    Journal: Journal of Molecular and Cellular Cardiology

    doi: 10.1016/j.yjmcc.2013.03.020

    Expression of ST2 receptor isoforms in human cardiac cells and in vascular cells. Human adult cardiac fibroblasts (HACF), human adult cardiac myocytes (HACM), human aortic smooth muscle cells (HASMC), human coronary artery smooth muscle cells (HCASMC), human umbilical vein endothelial cells (HUVEC), human coronary artery endothelial cells (HCAEC), human aortic endothelial cells (HAEC), and human heart microvascular endothelial cells (HHMEC) were left untreated. mRNA was prepared, cDNA was additionally eluted with MinElute PCR Purification Kit and equal amount of cDNA was used for RealTime-PCR with primers specific for totalST2 (A), ST2L (B), or sST2 (C) as described in “ Materials and methods ”. Values are given as x-fold of HAEC, which was set as 1 and represent mean ± SD. Experiments were performed with cells obtained from at least 3 different donors for each type of cells.
    Figure Legend Snippet: Expression of ST2 receptor isoforms in human cardiac cells and in vascular cells. Human adult cardiac fibroblasts (HACF), human adult cardiac myocytes (HACM), human aortic smooth muscle cells (HASMC), human coronary artery smooth muscle cells (HCASMC), human umbilical vein endothelial cells (HUVEC), human coronary artery endothelial cells (HCAEC), human aortic endothelial cells (HAEC), and human heart microvascular endothelial cells (HHMEC) were left untreated. mRNA was prepared, cDNA was additionally eluted with MinElute PCR Purification Kit and equal amount of cDNA was used for RealTime-PCR with primers specific for totalST2 (A), ST2L (B), or sST2 (C) as described in “ Materials and methods ”. Values are given as x-fold of HAEC, which was set as 1 and represent mean ± SD. Experiments were performed with cells obtained from at least 3 different donors for each type of cells.

    Techniques Used: Expressing, Polymerase Chain Reaction, Purification

    36) Product Images from "Protocol for Metagenomic Virus Detection in Clinical Specimens 1"

    Article Title: Protocol for Metagenomic Virus Detection in Clinical Specimens 1

    Journal: Emerging Infectious Diseases

    doi: 10.3201/eid2101.140766

    Comparison of extraction methods used for development of tissue-based universal virus detection for viral metagenomics protocol. Copy numbers were measured by quantitative PCR in duplicate. RQ, relative quantification: RQ (2 – ΔΔCt); (ΔΔCt = Δ purified – Δ unprocessed). Lower panel left y-axis indicates signal-to-noise ratio (RQ) for all viruses tested. The method with the highest score was used to establish the protocol and is shaded in yellow. Red stars indicate highest scores. Diagonally striped area indicates not significant. Ct, cycle threshold. Numbers along baseline indicate method used. 1, Nucleospin RNA II (Macherey Nagel, Dueren, Germany); 2, Nucleospin DNA (Macherey Nagel); 3, RTP DNA/RNA Virus Ultra Sense (Invitek, Berlin Germany); 4, RTP DNA/RNA Virus Mini Kit (Invitek); 5, QIAmp UltraSens Virus Kit (QIAGEN, Hilden, Germany); 6, Viral Mini Kit (QIAGEN); 7, QIAmp MinElute Virus Spin Kit (QIAGEN); 8, PureLink Viral RNA/DNA (Invitrogen Life Technologies, Grand Island, NY, USA); 9, TRIzol LS; 10, phenol chloroform.
    Figure Legend Snippet: Comparison of extraction methods used for development of tissue-based universal virus detection for viral metagenomics protocol. Copy numbers were measured by quantitative PCR in duplicate. RQ, relative quantification: RQ (2 – ΔΔCt); (ΔΔCt = Δ purified – Δ unprocessed). Lower panel left y-axis indicates signal-to-noise ratio (RQ) for all viruses tested. The method with the highest score was used to establish the protocol and is shaded in yellow. Red stars indicate highest scores. Diagonally striped area indicates not significant. Ct, cycle threshold. Numbers along baseline indicate method used. 1, Nucleospin RNA II (Macherey Nagel, Dueren, Germany); 2, Nucleospin DNA (Macherey Nagel); 3, RTP DNA/RNA Virus Ultra Sense (Invitek, Berlin Germany); 4, RTP DNA/RNA Virus Mini Kit (Invitek); 5, QIAmp UltraSens Virus Kit (QIAGEN, Hilden, Germany); 6, Viral Mini Kit (QIAGEN); 7, QIAmp MinElute Virus Spin Kit (QIAGEN); 8, PureLink Viral RNA/DNA (Invitrogen Life Technologies, Grand Island, NY, USA); 9, TRIzol LS; 10, phenol chloroform.

    Techniques Used: Real-time Polymerase Chain Reaction, Purification

    37) Product Images from "Genome-wide mapping of 8-oxo-7,8-dihydro-2′-deoxyguanosine reveals accumulation of oxidatively-generated damage at DNA replication origins within transcribed long genes of mammalian cells"

    Article Title: Genome-wide mapping of 8-oxo-7,8-dihydro-2′-deoxyguanosine reveals accumulation of oxidatively-generated damage at DNA replication origins within transcribed long genes of mammalian cells

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gky1152

    ( A ) Number of 8-oxodGs per million of dGs (8-oxodg/10 6 dG) measured by LC-MS/MS in untreated (NT), UV-irradiated (UV) and NAC-treated (NAC) MCF10A cells, as indicated. ( B ) Efficiency of polyclonal anti-8-oxodG from Millipore (Ab M), or monoclonal anti-8-oxodG from Trevigen (Ab T), and of anti-IgG antibodies in immuno-precipitation assays of 8-oxodG-containing synthetic ssDNA or G4 structures, as indicated. ( C ) Anti-8oxodG immuno-precipitation assay (% of input DNA, measured by qPCR; y axis) with equal amount (64 pg) of both synthetic oligonucleotides (8-oxodG-100mer and dG-100mer) added to 1 μg of NAC-treated genomic DNA. C1 and C2 indicate the same genomic negative control regions as in panel G. ( D ) Screenshot from the UCSC genome browser of 3.7 Mb from human chromosome 19 showing (top to bottom): OxiDIP-Seq signal profile, 8-oxodG peaks (dots), Input DNA, CG%, and RefSeq genes. ( E ) Screenshot from the UCSC genome browser of 2.1 Mb from human chromosome 19 showing OxiDIP-Seq signal profiles of two independent experiments (Exp #1 and #2) and Input DNA. ( F ) Scatter plot showing the correlation of the OxiDIP-Seq signals obtained in two independent experiments (Exp #1 and #2). Pearson's correlation coefficient (r), as indicated. Figure inset shows magnification of the high-density region. ( G ) OxiDIP-qPCR showing 8-oxodG enrichments (% of Input DNA) at eight different positive (#1–8) and two negative (C1, C2) regions, in untreated (black bar), UV- (gray), or NAC-treated (white) MCF10A cells. Screenshots from the UCSC genome browser show genomic position, 8-oxodG signal intensity, and qPCR probes (black box) of the selected regions. Data from two independent OxiDIP-qPCR assays are shown (±S.D.; P
    Figure Legend Snippet: ( A ) Number of 8-oxodGs per million of dGs (8-oxodg/10 6 dG) measured by LC-MS/MS in untreated (NT), UV-irradiated (UV) and NAC-treated (NAC) MCF10A cells, as indicated. ( B ) Efficiency of polyclonal anti-8-oxodG from Millipore (Ab M), or monoclonal anti-8-oxodG from Trevigen (Ab T), and of anti-IgG antibodies in immuno-precipitation assays of 8-oxodG-containing synthetic ssDNA or G4 structures, as indicated. ( C ) Anti-8oxodG immuno-precipitation assay (% of input DNA, measured by qPCR; y axis) with equal amount (64 pg) of both synthetic oligonucleotides (8-oxodG-100mer and dG-100mer) added to 1 μg of NAC-treated genomic DNA. C1 and C2 indicate the same genomic negative control regions as in panel G. ( D ) Screenshot from the UCSC genome browser of 3.7 Mb from human chromosome 19 showing (top to bottom): OxiDIP-Seq signal profile, 8-oxodG peaks (dots), Input DNA, CG%, and RefSeq genes. ( E ) Screenshot from the UCSC genome browser of 2.1 Mb from human chromosome 19 showing OxiDIP-Seq signal profiles of two independent experiments (Exp #1 and #2) and Input DNA. ( F ) Scatter plot showing the correlation of the OxiDIP-Seq signals obtained in two independent experiments (Exp #1 and #2). Pearson's correlation coefficient (r), as indicated. Figure inset shows magnification of the high-density region. ( G ) OxiDIP-qPCR showing 8-oxodG enrichments (% of Input DNA) at eight different positive (#1–8) and two negative (C1, C2) regions, in untreated (black bar), UV- (gray), or NAC-treated (white) MCF10A cells. Screenshots from the UCSC genome browser show genomic position, 8-oxodG signal intensity, and qPCR probes (black box) of the selected regions. Data from two independent OxiDIP-qPCR assays are shown (±S.D.; P

    Techniques Used: Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry, Irradiation, Immunoprecipitation, Real-time Polymerase Chain Reaction, Negative Control

    38) Product Images from "Immuno-SABER enables highly multiplexed and amplified protein imaging in tissues"

    Article Title: Immuno-SABER enables highly multiplexed and amplified protein imaging in tissues

    Journal: Nature biotechnology

    doi: 10.1038/s41587-019-0207-y

    Immuno-SABER schematic. (a) PER mechanism 29 : (1) A 9-mer primer of sequence a binds to the single stranded a* sequence on the hairpin (* denotes complementarity). (2) The primer is extended by a strand displacing polymerase (e.g. Bst) isothermally and autonomously. The hairpin features a stopper sequence that halts polymerization, which releases the polymerase. (3) The newly synthesized a is displaced from the hairpin through branch migration. (4) The extended primer and the hairpin autonomously dissociate. (5) Repetition of this copy-and-release process produces a long concatemer of a . (b) Immuno-SABER schematic: (1a) Antibodies conjugated with bridge strands are used to simultaneously stain multiple targets. (1b) Primer sequences (green) are independently extended to a controlled length using PER. (2) Concatemers hybridize to the bridge sequence (blue) on the antibody. (3) Fluorophore (purple star)-labeled 20-mer DNA “imager” strands hybridize to the repeated binding sites on the concatemers. Each imager is designed to bind to a dimer of the unit primer sequence. (c) Exchange-SABER schematic: (1) Different biological targets (t.1 to t.n) are labeled with antibodies conjugated to orthogonal bridge strands (b.1 to b.n). (2) Orthogonal pre-extended concatemers are hybridized (via bridge complements b.1* to b.n*) to the bridge strands on the antibodies simultaneously. (3) Target t.1 is visualized by hybridization of imager i.1* to the i.1 sites on the concatemer bound to b.1 on the corresponding antibody, (4) Multiple targets can be imaged sequentially hybridization and dehybridization of orthogonal imagers in multiple rapid exchange cycles. (5) The images are computationally aligned and pseudo-colorized to overlay different targets.
    Figure Legend Snippet: Immuno-SABER schematic. (a) PER mechanism 29 : (1) A 9-mer primer of sequence a binds to the single stranded a* sequence on the hairpin (* denotes complementarity). (2) The primer is extended by a strand displacing polymerase (e.g. Bst) isothermally and autonomously. The hairpin features a stopper sequence that halts polymerization, which releases the polymerase. (3) The newly synthesized a is displaced from the hairpin through branch migration. (4) The extended primer and the hairpin autonomously dissociate. (5) Repetition of this copy-and-release process produces a long concatemer of a . (b) Immuno-SABER schematic: (1a) Antibodies conjugated with bridge strands are used to simultaneously stain multiple targets. (1b) Primer sequences (green) are independently extended to a controlled length using PER. (2) Concatemers hybridize to the bridge sequence (blue) on the antibody. (3) Fluorophore (purple star)-labeled 20-mer DNA “imager” strands hybridize to the repeated binding sites on the concatemers. Each imager is designed to bind to a dimer of the unit primer sequence. (c) Exchange-SABER schematic: (1) Different biological targets (t.1 to t.n) are labeled with antibodies conjugated to orthogonal bridge strands (b.1 to b.n). (2) Orthogonal pre-extended concatemers are hybridized (via bridge complements b.1* to b.n*) to the bridge strands on the antibodies simultaneously. (3) Target t.1 is visualized by hybridization of imager i.1* to the i.1 sites on the concatemer bound to b.1 on the corresponding antibody, (4) Multiple targets can be imaged sequentially hybridization and dehybridization of orthogonal imagers in multiple rapid exchange cycles. (5) The images are computationally aligned and pseudo-colorized to overlay different targets.

    Techniques Used: Sequencing, Synthesized, Migration, Staining, Labeling, Binding Assay, Hybridization

    Exchange-SABER in mouse retina cryosections. (a) 10 protein targets labeling various retinal cell types were visualized in 40 μm mouse retina cryosections. The markers targeted with Immuno-SABER were Rhodopsin (rod photoreceptors), GFAP (astrocytes), Vimentin (Muller cells 9 ), Collagen IV (blood vessels), three calcium binding proteins 49 , 50 VLP1, Calretinin (found in a subset of amacrine and ganglion cells) and Calbindin (note that although Calbindin was suggested to be also found in a subset of amacrine and ganglion cells, the Calbindin antibody used here mostly labels horizontal cells 50 ), and PKCα (blue cone cells and rod bipolar cells 50 ). The sections were first incubated with all DNA-conjugated antibodies simultaneously. All SABER concatemers were then added simultaneously to the sample, followed by washing and sequential incorporation of the imager strands and multi-round imaging. A z-stack of images was acquired for each target, and DAPI was imaged in every exchange cycle to monitor sample drift. The maximum projected images of each stack were computationally aligned using a subpixel registration algorithm using DAPI as the drift marker 9 , and pseudo-colored for the overlay presentation. (b) Zoom-in view of the area marked by the white rectangle in a . Three cell subtypes (marked with arrows, I: VLP1 + and Calretinin + , II: VLP1 − and Calretinin + , III: VLP1 + and Calretinin − ) can be differentiated based on VLP1 and Calretinin expression.
    Figure Legend Snippet: Exchange-SABER in mouse retina cryosections. (a) 10 protein targets labeling various retinal cell types were visualized in 40 μm mouse retina cryosections. The markers targeted with Immuno-SABER were Rhodopsin (rod photoreceptors), GFAP (astrocytes), Vimentin (Muller cells 9 ), Collagen IV (blood vessels), three calcium binding proteins 49 , 50 VLP1, Calretinin (found in a subset of amacrine and ganglion cells) and Calbindin (note that although Calbindin was suggested to be also found in a subset of amacrine and ganglion cells, the Calbindin antibody used here mostly labels horizontal cells 50 ), and PKCα (blue cone cells and rod bipolar cells 50 ). The sections were first incubated with all DNA-conjugated antibodies simultaneously. All SABER concatemers were then added simultaneously to the sample, followed by washing and sequential incorporation of the imager strands and multi-round imaging. A z-stack of images was acquired for each target, and DAPI was imaged in every exchange cycle to monitor sample drift. The maximum projected images of each stack were computationally aligned using a subpixel registration algorithm using DAPI as the drift marker 9 , and pseudo-colored for the overlay presentation. (b) Zoom-in view of the area marked by the white rectangle in a . Three cell subtypes (marked with arrows, I: VLP1 + and Calretinin + , II: VLP1 − and Calretinin + , III: VLP1 + and Calretinin − ) can be differentiated based on VLP1 and Calretinin expression.

    Techniques Used: Labeling, Binding Assay, Incubation, Imaging, Marker, Expressing

    Multiplexed super-resolution imaging using Expansion-SABER. (a) 40 μm mouse retina cryosections were stained for SV2 using DNA-conjugated SV2 antibodies, followed by SABER concatemer hybridization. Before and after images were respectively acquired before hydrogel formation, or after hydrogel formation and expansion (~3-fold), using the original expansion protocol 31 , 39 . (b) Images of pre- and post-synaptic sites of neuronal synapses in fixed primary mouse hippocampal neuron culture samples with and without expansion (different fields of view are shown). The pre-synaptic sites were labeled with anti-Bassoon antibodies and the post-synaptic sites were labeled with anti-Homer1 antibodies. DNA-conjugated secondary antibodies were used to target Bassoon and Homer1 primary antibodies, followed by SABER concatemers application. (c) ExM imaging of 6 protein targets in the originally 40 μm-thick mouse retina section (expanded ~3-folds) with Exchange-SABER. 2 exchange rounds with Atto488-, Atto565- and Alexa647- conjugated imager strands were performed to visualize all 6 targets in the expanded samples. DAPI was imaged in both rounds to serve as a registration marker. The images are maximum projections of z-stacks, drift-corrected using DAPI channels, and pseudo-colored for presentation. A zoom-in view of the boxed region is available in Supplementary Fig. 9b .
    Figure Legend Snippet: Multiplexed super-resolution imaging using Expansion-SABER. (a) 40 μm mouse retina cryosections were stained for SV2 using DNA-conjugated SV2 antibodies, followed by SABER concatemer hybridization. Before and after images were respectively acquired before hydrogel formation, or after hydrogel formation and expansion (~3-fold), using the original expansion protocol 31 , 39 . (b) Images of pre- and post-synaptic sites of neuronal synapses in fixed primary mouse hippocampal neuron culture samples with and without expansion (different fields of view are shown). The pre-synaptic sites were labeled with anti-Bassoon antibodies and the post-synaptic sites were labeled with anti-Homer1 antibodies. DNA-conjugated secondary antibodies were used to target Bassoon and Homer1 primary antibodies, followed by SABER concatemers application. (c) ExM imaging of 6 protein targets in the originally 40 μm-thick mouse retina section (expanded ~3-folds) with Exchange-SABER. 2 exchange rounds with Atto488-, Atto565- and Alexa647- conjugated imager strands were performed to visualize all 6 targets in the expanded samples. DAPI was imaged in both rounds to serve as a registration marker. The images are maximum projections of z-stacks, drift-corrected using DAPI channels, and pseudo-colored for presentation. A zoom-in view of the boxed region is available in Supplementary Fig. 9b .

    Techniques Used: Imaging, Staining, Hybridization, Labeling, Marker

    39) Product Images from "A Phase-Variable Surface Layer from the Gut Symbiont Bacteroides thetaiotaomicron"

    Article Title: A Phase-Variable Surface Layer from the Gut Symbiont Bacteroides thetaiotaomicron

    Journal: mBio

    doi: 10.1128/mBio.01339-15

    A phase-variable surface layer protein in B. thetaiotaomicron . (A) Proteins were precipitated from filtered culture supernatants of B. thetaiotaomicron ( Bt ) with trichloroacetic acid and subjected to SDS-PAGE. The Δ BT1954 strain culture supernatant harbors an abundant, high-molecular-mass band that is absent in B. thetaiotaomicron (see also Fig. S1 in the supplemental material). (B) B. thetaiotaomicron cells were fixed, cut into ultrathin sections, negative stained, and imaged through the use of a transmission electron microscope. The Δ BT1954 mutant (upper right and lower right) harbors a tessellated surface layer, adjacent to the outer membrane, which is absent in the parental strain (upper left and lower left). Each scale bar represents 100 nm. (C) Schematic of the BT1927 -to- BT1929 locus, showing inverted repeat elements flanking the predicted BT1927 promoter. SS, site specific. (D) Schematic of the promoter orientation assay. DrdI-digested PCR products were separated by agarose gel electrophoresis. The inverted repeat element harboring the predicted BT1927 promoter is in opposite orientations in the parental strain and the Δ BT1954 mutant (see also Fig. S1 ).
    Figure Legend Snippet: A phase-variable surface layer protein in B. thetaiotaomicron . (A) Proteins were precipitated from filtered culture supernatants of B. thetaiotaomicron ( Bt ) with trichloroacetic acid and subjected to SDS-PAGE. The Δ BT1954 strain culture supernatant harbors an abundant, high-molecular-mass band that is absent in B. thetaiotaomicron (see also Fig. S1 in the supplemental material). (B) B. thetaiotaomicron cells were fixed, cut into ultrathin sections, negative stained, and imaged through the use of a transmission electron microscope. The Δ BT1954 mutant (upper right and lower right) harbors a tessellated surface layer, adjacent to the outer membrane, which is absent in the parental strain (upper left and lower left). Each scale bar represents 100 nm. (C) Schematic of the BT1927 -to- BT1929 locus, showing inverted repeat elements flanking the predicted BT1927 promoter. SS, site specific. (D) Schematic of the promoter orientation assay. DrdI-digested PCR products were separated by agarose gel electrophoresis. The inverted repeat element harboring the predicted BT1927 promoter is in opposite orientations in the parental strain and the Δ BT1954 mutant (see also Fig. S1 ).

    Techniques Used: SDS Page, Staining, Transmission Assay, Microscopy, Mutagenesis, Polymerase Chain Reaction, Agarose Gel Electrophoresis

    40) Product Images from "Hypoxia inducible factors regulate the transcription of the sprouty2 gene and expression of the sprouty2 protein"

    Article Title: Hypoxia inducible factors regulate the transcription of the sprouty2 gene and expression of the sprouty2 protein

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0171616

    HIF1α and HIF2α do not regulate the stability of SPRY2 mRNA, but they bind to the proximal promoter and intron of SPRY2 . (A) Hep3B cells transfected with control or HIF1α/HIF2α siRNAs were incubated in hypoxia for 24 hours and then treated with actinomycin D (3 μg/mL). Total RNA was extracted at the indicated times and the mRNA levels of SPRY2 were monitored using qRT-PCR. (B) Schematic of SPRY2 from -3850 to 3395 encompassing the promoter, transcription start site (+1), exon 1 (Ex1), intron, and exon 2 (Ex2). Each grey rectangle labeled with a letter represents a putative HRE and the location of each HRE is labeled underneath. Each numbered line above shows the location of a primer pair designed to amplify a region of DNA with specific putative HREs in a ChIP. (C) Hep3B cells transfected with control or HIF1α and HIF2α siRNAs were incubated in hypoxia for 32 hours. Proteins, cross-linked to DNA, were immunoprecipitated with control rabbit IgG or HIF1β antibody. The DNA was sheared and the amounts of co-immunoprecipitated DNA were examined by qRT-PCR with the indicated primer sets. Graphs are the mean + SEM from five independent experiments. (D) Hep3B cells transfected with control, HIF1α, HIF2α, or HIF1α and HIF2α siRNAs were incubated in hypoxia for 32 hours. ChIP assays were performed as stated in (C) except primers were used that encompass the HREs located in the promoter of the HIF1α-responsive gene PFK-1 or the HIF2α-responsive gene EPO . Graph shows the mean + SEM from three independent experiments. Statistical significance was assessed using one-way ANOVA with Dunnett’s multiple comparison test (C D) *: p
    Figure Legend Snippet: HIF1α and HIF2α do not regulate the stability of SPRY2 mRNA, but they bind to the proximal promoter and intron of SPRY2 . (A) Hep3B cells transfected with control or HIF1α/HIF2α siRNAs were incubated in hypoxia for 24 hours and then treated with actinomycin D (3 μg/mL). Total RNA was extracted at the indicated times and the mRNA levels of SPRY2 were monitored using qRT-PCR. (B) Schematic of SPRY2 from -3850 to 3395 encompassing the promoter, transcription start site (+1), exon 1 (Ex1), intron, and exon 2 (Ex2). Each grey rectangle labeled with a letter represents a putative HRE and the location of each HRE is labeled underneath. Each numbered line above shows the location of a primer pair designed to amplify a region of DNA with specific putative HREs in a ChIP. (C) Hep3B cells transfected with control or HIF1α and HIF2α siRNAs were incubated in hypoxia for 32 hours. Proteins, cross-linked to DNA, were immunoprecipitated with control rabbit IgG or HIF1β antibody. The DNA was sheared and the amounts of co-immunoprecipitated DNA were examined by qRT-PCR with the indicated primer sets. Graphs are the mean + SEM from five independent experiments. (D) Hep3B cells transfected with control, HIF1α, HIF2α, or HIF1α and HIF2α siRNAs were incubated in hypoxia for 32 hours. ChIP assays were performed as stated in (C) except primers were used that encompass the HREs located in the promoter of the HIF1α-responsive gene PFK-1 or the HIF2α-responsive gene EPO . Graph shows the mean + SEM from three independent experiments. Statistical significance was assessed using one-way ANOVA with Dunnett’s multiple comparison test (C D) *: p

    Techniques Used: Transfection, Incubation, Quantitative RT-PCR, Labeling, Chromatin Immunoprecipitation, Immunoprecipitation

    HIF1α and HIF2α repress SPRY2 mRNA levels by enhancing the methylation of the SPRY2 promoter. (A) Upper panel : Hep3B cells treated with vehicle (V) or decitabine (DAC) were incubated in hypoxia for 24 hours. DNA was extracted, bisulfite-converted, and the methylation status was assessed with methylation specific (M) and unmethylated specific (U) PCR primers. The amount of β-actin DNA was monitored to control for DNA amount loaded into each PCR. The amounts of methylated and unmethylated SPRY2 promoter DNA were quantified by densitometry and normalized to β-actin. Graph shows the mean + SEM for three independent experiments. Lower panel : Schematic of hSPRY2 promoter and gene showing the positions of PCR primers for both methylation specific and unmethylated specific PCRs. The arrow shows the transcription start site. Grey rectangles depict putative HREs. (B) Hep3B cells were treated with vehicle or decitabine (DAC, 5 μM), transfected with control or HIF1α and HIF2α siRNAs and incubated in hypoxia for 24 hours. RNA was isolated and the mRNA amounts of SPRY2 (left panel), HIF1α and HIF2α (right panels) were monitored by qRT-PCR and normalized with 18S rRNA. Graphs show the mean + SEM from three independent experiments repeated in duplicate or triplicate. (C) Hep3B cells transfected with control or HIF1α and HIF2α siRNAs were incubated in hypoxia for 24 hours. The methylation status of the SPRY2 promoter was analyzed as in (A). Graph shows the mean + SEM from five independent experiments. Statistical significance was assessed using unpaired student t-tests (A, B C) *: p
    Figure Legend Snippet: HIF1α and HIF2α repress SPRY2 mRNA levels by enhancing the methylation of the SPRY2 promoter. (A) Upper panel : Hep3B cells treated with vehicle (V) or decitabine (DAC) were incubated in hypoxia for 24 hours. DNA was extracted, bisulfite-converted, and the methylation status was assessed with methylation specific (M) and unmethylated specific (U) PCR primers. The amount of β-actin DNA was monitored to control for DNA amount loaded into each PCR. The amounts of methylated and unmethylated SPRY2 promoter DNA were quantified by densitometry and normalized to β-actin. Graph shows the mean + SEM for three independent experiments. Lower panel : Schematic of hSPRY2 promoter and gene showing the positions of PCR primers for both methylation specific and unmethylated specific PCRs. The arrow shows the transcription start site. Grey rectangles depict putative HREs. (B) Hep3B cells were treated with vehicle or decitabine (DAC, 5 μM), transfected with control or HIF1α and HIF2α siRNAs and incubated in hypoxia for 24 hours. RNA was isolated and the mRNA amounts of SPRY2 (left panel), HIF1α and HIF2α (right panels) were monitored by qRT-PCR and normalized with 18S rRNA. Graphs show the mean + SEM from three independent experiments repeated in duplicate or triplicate. (C) Hep3B cells transfected with control or HIF1α and HIF2α siRNAs were incubated in hypoxia for 24 hours. The methylation status of the SPRY2 promoter was analyzed as in (A). Graph shows the mean + SEM from five independent experiments. Statistical significance was assessed using unpaired student t-tests (A, B C) *: p

    Techniques Used: Methylation, Incubation, Polymerase Chain Reaction, Transfection, Isolation, Quantitative RT-PCR

    DNMT1 contributes toward the suppression of SPRY2 mRNA expression by HIF1α and HIF2α. (A) Hep3B cells were treated with vehicle or laccaic acid A (LCA, 50 μg/mL), transfected with control or HIF1α and HIF2α siRNAs and incubated in hypoxia for 24 hours. RNA was isolated and mRNA amounts of SPRY2 (left panel), HIF1α , and HIF2α (right panels) were quantified by qRT-PCR and normalized with 18S rRNA. Graphs show the mean + SEM from three independent experiments in duplicate. (B) Hep3B cells transfected with control or HIF1α and HIF2α siRNAs were incubated in hypoxia for 32 hours. Proteins, cross-linked to DNA, were immunoprecipitated with control mouse IgG or a DNMT1 antibody. The DNA was sheared and the amounts of co-immunoprecipitated DNA were examined by qRT-PCR with the indicated primer sets. Location of binding of primers is indicated in Fig 2B . Graphs show the mean + SEM from three independent experiments performed in singles or duplicates. Statistical significance was assessed using unpaired student t-tests (A) or one-way ANOVA with Dunnett’s multiple comparison test (B). *: p
    Figure Legend Snippet: DNMT1 contributes toward the suppression of SPRY2 mRNA expression by HIF1α and HIF2α. (A) Hep3B cells were treated with vehicle or laccaic acid A (LCA, 50 μg/mL), transfected with control or HIF1α and HIF2α siRNAs and incubated in hypoxia for 24 hours. RNA was isolated and mRNA amounts of SPRY2 (left panel), HIF1α , and HIF2α (right panels) were quantified by qRT-PCR and normalized with 18S rRNA. Graphs show the mean + SEM from three independent experiments in duplicate. (B) Hep3B cells transfected with control or HIF1α and HIF2α siRNAs were incubated in hypoxia for 32 hours. Proteins, cross-linked to DNA, were immunoprecipitated with control mouse IgG or a DNMT1 antibody. The DNA was sheared and the amounts of co-immunoprecipitated DNA were examined by qRT-PCR with the indicated primer sets. Location of binding of primers is indicated in Fig 2B . Graphs show the mean + SEM from three independent experiments performed in singles or duplicates. Statistical significance was assessed using unpaired student t-tests (A) or one-way ANOVA with Dunnett’s multiple comparison test (B). *: p

    Techniques Used: Expressing, Transfection, Incubation, Isolation, Quantitative RT-PCR, Immunoprecipitation, Binding Assay

    Related Articles

    Amplification:

    Article Title: Macrophage Infiltration into the Glomeruli in Lipoprotein Glomerulopathy
    Article Snippet: .. The amplified DNA fragments were purified by PCR purification Kit (Qiagen, Germany) and directly sequenced with Genetic Analyzer 3130xl DNA sequencer (Thermo Fisher, USA) by using a BigDye Terminator Cycle Sequencing Kit (Thermo Fisher). ..

    Article Title: Homozygous mdm2 SNP309 cancer cells with compromised transcriptional elongation at p53 target genes are sensitive to induction of p53-independent cell death
    Article Snippet: .. The DNA fragments were purified using the PCR Purification kit (Qiagen) according to manufacturer's protocol and amplified by quantitative PCR. .. Primer probe mixes used with Taqman Universal Master Mix as described in [ , ]: p21 p53RE (5′): Forward- GTGGCTCTGATTGGCTTTCTG Reverse- CTGAAAACAGGCAGCCCAAG Probe- TGGCATAGAAGAGGCTGGTGGC TATTTTG p21 TATA box: Forward- CGCGAGGATGCGTGTTC Reverse CATTCACCTGCCGCAGAAA Probe - CGGGTGTGTGC puma p53RE: Forward-GCGAGACTGTGGCCTTGTGT Reverse- CGTTCCAGGGTCCACAAAGT Probe- TGTGAGTACATCCTCTGGGCTC TGCCTG Primers used with SYBR Green PCR Master Mix (Applied Biosystems) as described in [ , ]: p21 +7011 F- CCTGGCTGACTTCTGCTGTCT p21 +7011 R- CGGCGTTTGGAGTGGTAGA puma +6014 F-AGGTGCTGCTCCGCCA puma +6014 R- CCCTCTGCCTCTCCAAGGTC

    TA Cloning:

    Article Title: Promoter Hypermethylation and Decreased Expression of Syncytin-1 in Pancreatic Adenocarcinomas
    Article Snippet: .. For DNA sequencing, the PCR-amplified DNA fragments were purified with PCR purification Kit (Qiagen, Valencia, CA, USA) and subcloned into the pCR2.1 TA cloning vector (Invitrogen, Carlsbad, CA, USA). ..

    Purification:

    Article Title: Macrophage Infiltration into the Glomeruli in Lipoprotein Glomerulopathy
    Article Snippet: .. The amplified DNA fragments were purified by PCR purification Kit (Qiagen, Germany) and directly sequenced with Genetic Analyzer 3130xl DNA sequencer (Thermo Fisher, USA) by using a BigDye Terminator Cycle Sequencing Kit (Thermo Fisher). ..

    Article Title: Mutation within the hinge region of the transcription factor Nr2f2 attenuates salt-sensitive hypertension
    Article Snippet: .. Chromatin was treated with RNase A, proteinase K, and the DNA was column purified (PCR Purification kit, Qiagen). .. Purified DNA was PCR amplified using primers ( ) targeting the Anf , Renin and Apob promoter regions, and Hbb used as a negative control.

    Article Title: Targeting chromatin binding regulation of constitutively active AR variants to overcome prostate cancer resistance to endocrine-based therapies
    Article Snippet: .. DNA was purified using a PCR purification kit (Qiagen). .. Alternatively, immunoprecipitated complexes were boiled in sodium dodecyl sulphate (SDS) loading buffer and subjected to western blot using a mouse monoclonal antibody specific for the AR NTD (A441, Santa Cruz).

    Article Title: Promoter Hypermethylation and Decreased Expression of Syncytin-1 in Pancreatic Adenocarcinomas
    Article Snippet: .. For DNA sequencing, the PCR-amplified DNA fragments were purified with PCR purification Kit (Qiagen, Valencia, CA, USA) and subcloned into the pCR2.1 TA cloning vector (Invitrogen, Carlsbad, CA, USA). ..

    Article Title: Emergence of carbapenem-resistant Acinetobacter baumannii as the major cause of ventilator-associated pneumonia in intensive care unit patients at an infectious disease hospital in southern Vietnam
    Article Snippet: .. PCR amplicons were purified using a PCR purification kit (Qiagen) and sequenced using a BigDye Terminator Sequencing kit (Applied Biosystems). .. All data were analysed using a numeric coefficient in BioNumerics software (Applied Maths) and phylogenetic trees were reconstructed in Dendroscope v2.3.

    Article Title: X-inactivation normalizes O-GlcNAc transferase levels and generates an O-GlcNAc-depleted Barr body
    Article Snippet: .. Samples were then boiled at 95°C for 10 min and DNA fragments were purified with PCR purification kit (Quiagen). .. PCR was performed as described previously for cDNA.

    Article Title: Mitochondrial DNA copy number is regulated in a tissue specific manner by DNA methylation of the nuclear-encoded DNA polymerase gamma A
    Article Snippet: .. Cross-links were reversed by incubating samples with 200 mM NaCl and 10 ul proteinase K ( > 600 mAU/ml) at 65°C for 16 h. DNA was purified using the Qiagen PCR purification kit, according to the manufacturer’s instructions. .. Purified immunoprecipitated DNA and input DNA (1:100) were analysed using real-time PCR in triplicate, as described above.

    Article Title: Homozygous mdm2 SNP309 cancer cells with compromised transcriptional elongation at p53 target genes are sensitive to induction of p53-independent cell death
    Article Snippet: .. The DNA fragments were purified using the PCR Purification kit (Qiagen) according to manufacturer's protocol and amplified by quantitative PCR. .. Primer probe mixes used with Taqman Universal Master Mix as described in [ , ]: p21 p53RE (5′): Forward- GTGGCTCTGATTGGCTTTCTG Reverse- CTGAAAACAGGCAGCCCAAG Probe- TGGCATAGAAGAGGCTGGTGGC TATTTTG p21 TATA box: Forward- CGCGAGGATGCGTGTTC Reverse CATTCACCTGCCGCAGAAA Probe - CGGGTGTGTGC puma p53RE: Forward-GCGAGACTGTGGCCTTGTGT Reverse- CGTTCCAGGGTCCACAAAGT Probe- TGTGAGTACATCCTCTGGGCTC TGCCTG Primers used with SYBR Green PCR Master Mix (Applied Biosystems) as described in [ , ]: p21 +7011 F- CCTGGCTGACTTCTGCTGTCT p21 +7011 R- CGGCGTTTGGAGTGGTAGA puma +6014 F-AGGTGCTGCTCCGCCA puma +6014 R- CCCTCTGCCTCTCCAAGGTC

    Real-time Polymerase Chain Reaction:

    Article Title: Homozygous mdm2 SNP309 cancer cells with compromised transcriptional elongation at p53 target genes are sensitive to induction of p53-independent cell death
    Article Snippet: .. The DNA fragments were purified using the PCR Purification kit (Qiagen) according to manufacturer's protocol and amplified by quantitative PCR. .. Primer probe mixes used with Taqman Universal Master Mix as described in [ , ]: p21 p53RE (5′): Forward- GTGGCTCTGATTGGCTTTCTG Reverse- CTGAAAACAGGCAGCCCAAG Probe- TGGCATAGAAGAGGCTGGTGGC TATTTTG p21 TATA box: Forward- CGCGAGGATGCGTGTTC Reverse CATTCACCTGCCGCAGAAA Probe - CGGGTGTGTGC puma p53RE: Forward-GCGAGACTGTGGCCTTGTGT Reverse- CGTTCCAGGGTCCACAAAGT Probe- TGTGAGTACATCCTCTGGGCTC TGCCTG Primers used with SYBR Green PCR Master Mix (Applied Biosystems) as described in [ , ]: p21 +7011 F- CCTGGCTGACTTCTGCTGTCT p21 +7011 R- CGGCGTTTGGAGTGGTAGA puma +6014 F-AGGTGCTGCTCCGCCA puma +6014 R- CCCTCTGCCTCTCCAAGGTC

    Polymerase Chain Reaction:

    Article Title: Macrophage Infiltration into the Glomeruli in Lipoprotein Glomerulopathy
    Article Snippet: .. The amplified DNA fragments were purified by PCR purification Kit (Qiagen, Germany) and directly sequenced with Genetic Analyzer 3130xl DNA sequencer (Thermo Fisher, USA) by using a BigDye Terminator Cycle Sequencing Kit (Thermo Fisher). ..

    Article Title: Mutation within the hinge region of the transcription factor Nr2f2 attenuates salt-sensitive hypertension
    Article Snippet: .. Chromatin was treated with RNase A, proteinase K, and the DNA was column purified (PCR Purification kit, Qiagen). .. Purified DNA was PCR amplified using primers ( ) targeting the Anf , Renin and Apob promoter regions, and Hbb used as a negative control.

    Article Title: Targeting chromatin binding regulation of constitutively active AR variants to overcome prostate cancer resistance to endocrine-based therapies
    Article Snippet: .. DNA was purified using a PCR purification kit (Qiagen). .. Alternatively, immunoprecipitated complexes were boiled in sodium dodecyl sulphate (SDS) loading buffer and subjected to western blot using a mouse monoclonal antibody specific for the AR NTD (A441, Santa Cruz).

    Article Title: Promoter Hypermethylation and Decreased Expression of Syncytin-1 in Pancreatic Adenocarcinomas
    Article Snippet: .. For DNA sequencing, the PCR-amplified DNA fragments were purified with PCR purification Kit (Qiagen, Valencia, CA, USA) and subcloned into the pCR2.1 TA cloning vector (Invitrogen, Carlsbad, CA, USA). ..

    Article Title: Emergence of carbapenem-resistant Acinetobacter baumannii as the major cause of ventilator-associated pneumonia in intensive care unit patients at an infectious disease hospital in southern Vietnam
    Article Snippet: .. PCR amplicons were purified using a PCR purification kit (Qiagen) and sequenced using a BigDye Terminator Sequencing kit (Applied Biosystems). .. All data were analysed using a numeric coefficient in BioNumerics software (Applied Maths) and phylogenetic trees were reconstructed in Dendroscope v2.3.

    Article Title: X-inactivation normalizes O-GlcNAc transferase levels and generates an O-GlcNAc-depleted Barr body
    Article Snippet: .. Samples were then boiled at 95°C for 10 min and DNA fragments were purified with PCR purification kit (Quiagen). .. PCR was performed as described previously for cDNA.

    Article Title: Mitochondrial DNA copy number is regulated in a tissue specific manner by DNA methylation of the nuclear-encoded DNA polymerase gamma A
    Article Snippet: .. Cross-links were reversed by incubating samples with 200 mM NaCl and 10 ul proteinase K ( > 600 mAU/ml) at 65°C for 16 h. DNA was purified using the Qiagen PCR purification kit, according to the manufacturer’s instructions. .. Purified immunoprecipitated DNA and input DNA (1:100) were analysed using real-time PCR in triplicate, as described above.

    Article Title: Homozygous mdm2 SNP309 cancer cells with compromised transcriptional elongation at p53 target genes are sensitive to induction of p53-independent cell death
    Article Snippet: .. The DNA fragments were purified using the PCR Purification kit (Qiagen) according to manufacturer's protocol and amplified by quantitative PCR. .. Primer probe mixes used with Taqman Universal Master Mix as described in [ , ]: p21 p53RE (5′): Forward- GTGGCTCTGATTGGCTTTCTG Reverse- CTGAAAACAGGCAGCCCAAG Probe- TGGCATAGAAGAGGCTGGTGGC TATTTTG p21 TATA box: Forward- CGCGAGGATGCGTGTTC Reverse CATTCACCTGCCGCAGAAA Probe - CGGGTGTGTGC puma p53RE: Forward-GCGAGACTGTGGCCTTGTGT Reverse- CGTTCCAGGGTCCACAAAGT Probe- TGTGAGTACATCCTCTGGGCTC TGCCTG Primers used with SYBR Green PCR Master Mix (Applied Biosystems) as described in [ , ]: p21 +7011 F- CCTGGCTGACTTCTGCTGTCT p21 +7011 R- CGGCGTTTGGAGTGGTAGA puma +6014 F-AGGTGCTGCTCCGCCA puma +6014 R- CCCTCTGCCTCTCCAAGGTC

    DNA Sequencing:

    Article Title: Promoter Hypermethylation and Decreased Expression of Syncytin-1 in Pancreatic Adenocarcinomas
    Article Snippet: .. For DNA sequencing, the PCR-amplified DNA fragments were purified with PCR purification Kit (Qiagen, Valencia, CA, USA) and subcloned into the pCR2.1 TA cloning vector (Invitrogen, Carlsbad, CA, USA). ..

    Sequencing:

    Article Title: Macrophage Infiltration into the Glomeruli in Lipoprotein Glomerulopathy
    Article Snippet: .. The amplified DNA fragments were purified by PCR purification Kit (Qiagen, Germany) and directly sequenced with Genetic Analyzer 3130xl DNA sequencer (Thermo Fisher, USA) by using a BigDye Terminator Cycle Sequencing Kit (Thermo Fisher). ..

    Article Title: Emergence of carbapenem-resistant Acinetobacter baumannii as the major cause of ventilator-associated pneumonia in intensive care unit patients at an infectious disease hospital in southern Vietnam
    Article Snippet: .. PCR amplicons were purified using a PCR purification kit (Qiagen) and sequenced using a BigDye Terminator Sequencing kit (Applied Biosystems). .. All data were analysed using a numeric coefficient in BioNumerics software (Applied Maths) and phylogenetic trees were reconstructed in Dendroscope v2.3.

    Plasmid Preparation:

    Article Title: Promoter Hypermethylation and Decreased Expression of Syncytin-1 in Pancreatic Adenocarcinomas
    Article Snippet: .. For DNA sequencing, the PCR-amplified DNA fragments were purified with PCR purification Kit (Qiagen, Valencia, CA, USA) and subcloned into the pCR2.1 TA cloning vector (Invitrogen, Carlsbad, CA, USA). ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Qiagen pcr purification kit
    Intragenic methylation of PolgA in reprogrammed and mtDNA divergent ESCs. Bisulphite sequencing analysis of CpG methylation in ( A ) CC9 mus , ( B ) CC9 dunni , ( C ) iPS QS , ( D ) iPS NGFP2 ( E ) NT-ES, ( F ) iPS NFGPinj pluripotent stem cells. ( G ) The percentage CpG methylation per sequence determined by bisulphite sequencing (percentage mean ± SEM). ( H ) Real time <t>PCR</t> quantification of PolgA expression in cultured CC9 mus , CC9 spretus , CC9 dunni , iPS QS/R26 (iPS QS ), iPS NGFP , NT-ES, iPS NGFPin j pluripotent stem cells expressed relative to ESD3 cells. ( J ) Cumulative analysis of the relationship between <t>DNA</t> methylation levels ( Figures 1 L and 3 G) and the expression of PolgA ( Figures 2 A and 3 H) performed using Pearson correlation coefficient (R 2 ). ( K ) MtDNA copies/cell in cultured CC9 mus , CC9 spretus , CC9 dunni , iPS QS/R26 , iPS NGFP , NT-ES, iPS NGFPinj pluripotent stem cells. Values represent mean ± SEM and significant differences between cell types are: * P
    Pcr Purification Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 5771 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr purification kit/product/Qiagen
    Average 99 stars, based on 5771 article reviews
    Price from $9.99 to $1999.99
    pcr purification kit - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    Image Search Results


    Intragenic methylation of PolgA in reprogrammed and mtDNA divergent ESCs. Bisulphite sequencing analysis of CpG methylation in ( A ) CC9 mus , ( B ) CC9 dunni , ( C ) iPS QS , ( D ) iPS NGFP2 ( E ) NT-ES, ( F ) iPS NFGPinj pluripotent stem cells. ( G ) The percentage CpG methylation per sequence determined by bisulphite sequencing (percentage mean ± SEM). ( H ) Real time PCR quantification of PolgA expression in cultured CC9 mus , CC9 spretus , CC9 dunni , iPS QS/R26 (iPS QS ), iPS NGFP , NT-ES, iPS NGFPin j pluripotent stem cells expressed relative to ESD3 cells. ( J ) Cumulative analysis of the relationship between DNA methylation levels ( Figures 1 L and 3 G) and the expression of PolgA ( Figures 2 A and 3 H) performed using Pearson correlation coefficient (R 2 ). ( K ) MtDNA copies/cell in cultured CC9 mus , CC9 spretus , CC9 dunni , iPS QS/R26 , iPS NGFP , NT-ES, iPS NGFPinj pluripotent stem cells. Values represent mean ± SEM and significant differences between cell types are: * P

    Journal: Nucleic Acids Research

    Article Title: Mitochondrial DNA copy number is regulated in a tissue specific manner by DNA methylation of the nuclear-encoded DNA polymerase gamma A

    doi: 10.1093/nar/gks770

    Figure Lengend Snippet: Intragenic methylation of PolgA in reprogrammed and mtDNA divergent ESCs. Bisulphite sequencing analysis of CpG methylation in ( A ) CC9 mus , ( B ) CC9 dunni , ( C ) iPS QS , ( D ) iPS NGFP2 ( E ) NT-ES, ( F ) iPS NFGPinj pluripotent stem cells. ( G ) The percentage CpG methylation per sequence determined by bisulphite sequencing (percentage mean ± SEM). ( H ) Real time PCR quantification of PolgA expression in cultured CC9 mus , CC9 spretus , CC9 dunni , iPS QS/R26 (iPS QS ), iPS NGFP , NT-ES, iPS NGFPin j pluripotent stem cells expressed relative to ESD3 cells. ( J ) Cumulative analysis of the relationship between DNA methylation levels ( Figures 1 L and 3 G) and the expression of PolgA ( Figures 2 A and 3 H) performed using Pearson correlation coefficient (R 2 ). ( K ) MtDNA copies/cell in cultured CC9 mus , CC9 spretus , CC9 dunni , iPS QS/R26 , iPS NGFP , NT-ES, iPS NGFPinj pluripotent stem cells. Values represent mean ± SEM and significant differences between cell types are: * P

    Article Snippet: Cross-links were reversed by incubating samples with 200 mM NaCl and 10 ul proteinase K ( > 600 mAU/ml) at 65°C for 16 h. DNA was purified using the Qiagen PCR purification kit, according to the manufacturer’s instructions.

    Techniques: Methylation, Bisulfite Sequencing, CpG Methylation Assay, Sequencing, Real-time Polymerase Chain Reaction, Expressing, Cell Culture, DNA Methylation Assay

    DNA methylation at the Exon 2 loci is associated with reduced RNApII transcriptional elongation. ( A ) Diagrammatic representation of the PolgA gene and primers sites used for ChIP. Numbers correspond to the centre nucleotide of each primer amplicon, relative to the transcription start site (TSS). Enrichment for (RNApII) and RNApII phosphorylated on serine 2 of the carboxy-terminal domain (RNApIIS2) was analysed by real time PCR at the exon 2 methylation site of PolgA and at downstream and upstream regions in: ( B ) CC9 mus ; ( C ) MEF; ( D ) NSC-CC9 mus and ( E ) heart samples. Values represent mean ± SEM. Significant differences between cell types are: * P

    Journal: Nucleic Acids Research

    Article Title: Mitochondrial DNA copy number is regulated in a tissue specific manner by DNA methylation of the nuclear-encoded DNA polymerase gamma A

    doi: 10.1093/nar/gks770

    Figure Lengend Snippet: DNA methylation at the Exon 2 loci is associated with reduced RNApII transcriptional elongation. ( A ) Diagrammatic representation of the PolgA gene and primers sites used for ChIP. Numbers correspond to the centre nucleotide of each primer amplicon, relative to the transcription start site (TSS). Enrichment for (RNApII) and RNApII phosphorylated on serine 2 of the carboxy-terminal domain (RNApIIS2) was analysed by real time PCR at the exon 2 methylation site of PolgA and at downstream and upstream regions in: ( B ) CC9 mus ; ( C ) MEF; ( D ) NSC-CC9 mus and ( E ) heart samples. Values represent mean ± SEM. Significant differences between cell types are: * P

    Article Snippet: Cross-links were reversed by incubating samples with 200 mM NaCl and 10 ul proteinase K ( > 600 mAU/ml) at 65°C for 16 h. DNA was purified using the Qiagen PCR purification kit, according to the manufacturer’s instructions.

    Techniques: DNA Methylation Assay, Chromatin Immunoprecipitation, Amplification, Real-time Polymerase Chain Reaction, Methylation

    Analysis of PolgA and mtDNA enrichment in 5mC and 5hmC MeDIP of ESCs and somatic tissues. DNA samples from cultured CC9 mus , CC9 spretus and CC9 dunni cells; liver, spleen, heart and brain samples were immunoprecipitated using antibodies against ( A ) 5mC and ( B ) 5hmC, and analysed using real time PCR for PolgA (exon 2) enrichment. Bars represent means ± SEM. Significant differences between cell types are indicated (** P

    Journal: Nucleic Acids Research

    Article Title: Mitochondrial DNA copy number is regulated in a tissue specific manner by DNA methylation of the nuclear-encoded DNA polymerase gamma A

    doi: 10.1093/nar/gks770

    Figure Lengend Snippet: Analysis of PolgA and mtDNA enrichment in 5mC and 5hmC MeDIP of ESCs and somatic tissues. DNA samples from cultured CC9 mus , CC9 spretus and CC9 dunni cells; liver, spleen, heart and brain samples were immunoprecipitated using antibodies against ( A ) 5mC and ( B ) 5hmC, and analysed using real time PCR for PolgA (exon 2) enrichment. Bars represent means ± SEM. Significant differences between cell types are indicated (** P

    Article Snippet: Cross-links were reversed by incubating samples with 200 mM NaCl and 10 ul proteinase K ( > 600 mAU/ml) at 65°C for 16 h. DNA was purified using the Qiagen PCR purification kit, according to the manufacturer’s instructions.

    Techniques: Methylated DNA Immunoprecipitation, Cell Culture, Immunoprecipitation, Real-time Polymerase Chain Reaction

    DNA Methylation of exon 2 correlates with reduced steady state mRNA levels of PolgA . ( A ) Real time PCR quantification of PolgA expression in cultured ESD3 and MEF cells, and in liver, spleen, heart, muscle, kidney and brain samples, expressed relative to ESD3. ( B ) The relationship between DNA methylation levels from Figure 1 L and the corresponding PolgA expression was determined using Pearson correlation coefficient (R 2 ). ( C ) MtDNA copies/cell in cultured ESD3 and MEF cells, and liver, spleen, heart, muscle, kidney and brain, as determined by real time PCR. ( D ) The relationship between the levels of DNA methylation from Figure 1 L and the corresponding mtDNA copies/cell was determined using Pearson correlation coefficient (R 2 ). Values represent mean ± SEM and significant differences between cell types are: * P

    Journal: Nucleic Acids Research

    Article Title: Mitochondrial DNA copy number is regulated in a tissue specific manner by DNA methylation of the nuclear-encoded DNA polymerase gamma A

    doi: 10.1093/nar/gks770

    Figure Lengend Snippet: DNA Methylation of exon 2 correlates with reduced steady state mRNA levels of PolgA . ( A ) Real time PCR quantification of PolgA expression in cultured ESD3 and MEF cells, and in liver, spleen, heart, muscle, kidney and brain samples, expressed relative to ESD3. ( B ) The relationship between DNA methylation levels from Figure 1 L and the corresponding PolgA expression was determined using Pearson correlation coefficient (R 2 ). ( C ) MtDNA copies/cell in cultured ESD3 and MEF cells, and liver, spleen, heart, muscle, kidney and brain, as determined by real time PCR. ( D ) The relationship between the levels of DNA methylation from Figure 1 L and the corresponding mtDNA copies/cell was determined using Pearson correlation coefficient (R 2 ). Values represent mean ± SEM and significant differences between cell types are: * P

    Article Snippet: Cross-links were reversed by incubating samples with 200 mM NaCl and 10 ul proteinase K ( > 600 mAU/ml) at 65°C for 16 h. DNA was purified using the Qiagen PCR purification kit, according to the manufacturer’s instructions.

    Techniques: DNA Methylation Assay, Real-time Polymerase Chain Reaction, Expressing, Cell Culture

    ARv567es binds canonical AREs through a dimerization-dependent mechanism. ( A ) ARE point mutations introduced in FASN ARBSI-LUC. ( B ) Activities of constructs illustrated in (A) were tested in R1-AD1 and R1-D567 cells by luciferase assay. Cells were treated with 1 nM mibolerone (MIB) or ethanol (ETH) as vehicle control as indicated. ( C ) ARE point mutations introduced in TSC2 exon 37-LUC. ( D ) Activities of constructs illustrated in (C) were evaluated by luciferase assay as in (B). ( E ) Western blot of lysates from R1-AD1 cells transfected with HA-GFP and HA-AR-V7 for the ChIP experiment shown in (F). ( F ) Constitutive recruitment of HA-tagged AR-V7 to the FASN ARBS1 site in transfected R1-AD1 cells was tested by ChIP-PCR. Data represent fold enrichment of PCR signal in ChIP DNA isolated using an HA-directed antibody versus non-specific IgG control (which was arbitrarily set to 1). ( G ) Activities of constructs illustrated in (A) were tested by luciferase assay using LNCaP cells transfected with an ARv567es expression vector and treated with 1 nM mibolerone (MIB) or ethanol (ETH, vehicle) as indicated. ( H ) Activities of constructs illustrated in (A) were tested by luciferase assay using LNCaP cells transfected with an AR-V7 expression vector exactly as described in (G). ( I ) Transcriptional activities of wild-type and A596T/S597T D-box mutant versions of ARv567es and AR-V7 were tested in LNCaP cells by luciferase assay as described in (G). ( J ) DNA duplex pull-down assays were performed by incubating biotinylated FASN AREI DNA duplexes harboring core sequences shown in A with cellular extracts from R1-AD1 and R1-D567 cells.

    Journal: Nucleic Acids Research

    Article Title: Targeting chromatin binding regulation of constitutively active AR variants to overcome prostate cancer resistance to endocrine-based therapies

    doi: 10.1093/nar/gkv262

    Figure Lengend Snippet: ARv567es binds canonical AREs through a dimerization-dependent mechanism. ( A ) ARE point mutations introduced in FASN ARBSI-LUC. ( B ) Activities of constructs illustrated in (A) were tested in R1-AD1 and R1-D567 cells by luciferase assay. Cells were treated with 1 nM mibolerone (MIB) or ethanol (ETH) as vehicle control as indicated. ( C ) ARE point mutations introduced in TSC2 exon 37-LUC. ( D ) Activities of constructs illustrated in (C) were evaluated by luciferase assay as in (B). ( E ) Western blot of lysates from R1-AD1 cells transfected with HA-GFP and HA-AR-V7 for the ChIP experiment shown in (F). ( F ) Constitutive recruitment of HA-tagged AR-V7 to the FASN ARBS1 site in transfected R1-AD1 cells was tested by ChIP-PCR. Data represent fold enrichment of PCR signal in ChIP DNA isolated using an HA-directed antibody versus non-specific IgG control (which was arbitrarily set to 1). ( G ) Activities of constructs illustrated in (A) were tested by luciferase assay using LNCaP cells transfected with an ARv567es expression vector and treated with 1 nM mibolerone (MIB) or ethanol (ETH, vehicle) as indicated. ( H ) Activities of constructs illustrated in (A) were tested by luciferase assay using LNCaP cells transfected with an AR-V7 expression vector exactly as described in (G). ( I ) Transcriptional activities of wild-type and A596T/S597T D-box mutant versions of ARv567es and AR-V7 were tested in LNCaP cells by luciferase assay as described in (G). ( J ) DNA duplex pull-down assays were performed by incubating biotinylated FASN AREI DNA duplexes harboring core sequences shown in A with cellular extracts from R1-AD1 and R1-D567 cells.

    Article Snippet: DNA was purified using a PCR purification kit (Qiagen).

    Techniques: Construct, Luciferase, Western Blot, Transfection, Chromatin Immunoprecipitation, Polymerase Chain Reaction, Isolation, Expressing, Plasmid Preparation, Mutagenesis

    a ApoE phenotype determined by isoelectric focusing polyacrylamide gel electrophoresis (IEF). Lane 1, apoE1/2 (patient); lane 2, apoE2/3; lane 3, apoE2/2; lane 4, apoE3/3 (wild type); lane 5, apoE4/4. b ApoE genotype examined by restriction fragment length polymorphism (RFLP). PCR-amplified DNA of the apoE gene, including codons 112 and 158, was digested with HhaI. Lane 1, DNA size marker; lane 2, patient; lane 3, ε3/3; lane 4, ε2/2; lane 5, ε3/4. In lane 2, the 91-, 78-, and 36-bp fragments which are consistent with ε2, are observed. Moreover, there are also 30-bp and around 60-bp fragments that are not observed in ε2, ε3, and ε4. c , d Sequence analysis of PCR-amplified DNA of the apoE gene. c A 9-bp deletion (3-amino acid deletion) in codon 141 to codon 143 of the apoE gene is observed. There are overlaps of nucleotide peaks before codon 144, indicating that the apoE alleles are heterozygous. d Both the sequence CGC (arginine; wild type) and the sequence TGC (cysteine) are observed in codon 158 of the apoE gene, indicating that the apoE2 (Arg158Cys) alleles are heterozygous.

    Journal: Case Reports in Nephrology and Dialysis

    Article Title: Macrophage Infiltration into the Glomeruli in Lipoprotein Glomerulopathy

    doi: 10.1159/000441715

    Figure Lengend Snippet: a ApoE phenotype determined by isoelectric focusing polyacrylamide gel electrophoresis (IEF). Lane 1, apoE1/2 (patient); lane 2, apoE2/3; lane 3, apoE2/2; lane 4, apoE3/3 (wild type); lane 5, apoE4/4. b ApoE genotype examined by restriction fragment length polymorphism (RFLP). PCR-amplified DNA of the apoE gene, including codons 112 and 158, was digested with HhaI. Lane 1, DNA size marker; lane 2, patient; lane 3, ε3/3; lane 4, ε2/2; lane 5, ε3/4. In lane 2, the 91-, 78-, and 36-bp fragments which are consistent with ε2, are observed. Moreover, there are also 30-bp and around 60-bp fragments that are not observed in ε2, ε3, and ε4. c , d Sequence analysis of PCR-amplified DNA of the apoE gene. c A 9-bp deletion (3-amino acid deletion) in codon 141 to codon 143 of the apoE gene is observed. There are overlaps of nucleotide peaks before codon 144, indicating that the apoE alleles are heterozygous. d Both the sequence CGC (arginine; wild type) and the sequence TGC (cysteine) are observed in codon 158 of the apoE gene, indicating that the apoE2 (Arg158Cys) alleles are heterozygous.

    Article Snippet: The amplified DNA fragments were purified by PCR purification Kit (Qiagen, Germany) and directly sequenced with Genetic Analyzer 3130xl DNA sequencer (Thermo Fisher, USA) by using a BigDye Terminator Cycle Sequencing Kit (Thermo Fisher).

    Techniques: Polyacrylamide Gel Electrophoresis, Electrofocusing, Polymerase Chain Reaction, Amplification, Marker, Sequencing

    Cancer cells with G/G mdm2 SNP309 have compromised transcriptional activation of p53 target genes after DNA damage ML-1, MANCA and A875 cells were treated with 8 μM etoposide (ETOP) for 6 hours. A. p21 and puma transcript was measured using quantitative RT-PCR. Samples were first normalized to DMSO for target gene expression and then to total gapdh mRNA. Results represent an average of three to five independent experiments given with standard error bars. Student t test analysis of cells treated DMSO vs ETOP for ML-1[ p21 and puma p

    Journal: Oncotarget

    Article Title: Homozygous mdm2 SNP309 cancer cells with compromised transcriptional elongation at p53 target genes are sensitive to induction of p53-independent cell death

    doi:

    Figure Lengend Snippet: Cancer cells with G/G mdm2 SNP309 have compromised transcriptional activation of p53 target genes after DNA damage ML-1, MANCA and A875 cells were treated with 8 μM etoposide (ETOP) for 6 hours. A. p21 and puma transcript was measured using quantitative RT-PCR. Samples were first normalized to DMSO for target gene expression and then to total gapdh mRNA. Results represent an average of three to five independent experiments given with standard error bars. Student t test analysis of cells treated DMSO vs ETOP for ML-1[ p21 and puma p

    Article Snippet: The DNA fragments were purified using the PCR Purification kit (Qiagen) according to manufacturer's protocol and amplified by quantitative PCR.

    Techniques: Activation Assay, Quantitative RT-PCR, Expressing