pp4c  (Qiagen)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    QuantiTect Primer Assay
    Description:
    QuantiTect Primer Assays are genomewide bioinformatically validated primer sets for use in SYBR Green based real time RT PCR on any cycler Assays are available for all genes from human rat mouse and many other species Each assay for a specific gene is supplied as a lyophilized mix of forward and reverse primers that can be easily reconstituted to obtain a 10x assay solution reaction components for real time RT PCR need to be ordered separately When used in combination with QuantiFast QuantiTect Rotor Gene or FastLane Kits for SYBR Green detection QuantiTect Primer Assays guarantee highly specific and sensitive results in real time RT PCR that are comparable to probe based detection
    Catalog Number:
    249900
    Price:
    96.8
    Category:
    Assay PCR qPCR
    Buy from Supplier


    Structured Review

    Qiagen pp4c
    QuantiTect Primer Assay
    QuantiTect Primer Assays are genomewide bioinformatically validated primer sets for use in SYBR Green based real time RT PCR on any cycler Assays are available for all genes from human rat mouse and many other species Each assay for a specific gene is supplied as a lyophilized mix of forward and reverse primers that can be easily reconstituted to obtain a 10x assay solution reaction components for real time RT PCR need to be ordered separately When used in combination with QuantiFast QuantiTect Rotor Gene or FastLane Kits for SYBR Green detection QuantiTect Primer Assays guarantee highly specific and sensitive results in real time RT PCR that are comparable to probe based detection
    https://www.bioz.com/result/pp4c/product/Qiagen
    Average 99 stars, based on 916 article reviews
    Price from $9.99 to $1999.99
    pp4c - by Bioz Stars, 2020-07
    99/100 stars

    Images

    1) Product Images from "Overexpression of Protein Phosphatase 4 Correlates with Poor Prognosis in Patients with Stage II Pancreatic Ductal Adenocarcinoma"

    Article Title: Overexpression of Protein Phosphatase 4 Correlates with Poor Prognosis in Patients with Stage II Pancreatic Ductal Adenocarcinoma

    Journal: Cancer epidemiology, biomarkers & prevention : a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive Oncology

    doi: 10.1158/1055-9965.EPI-12-0223

    PP4C is overexpressed in pancreatic ductal adenocarcinoma (PDAC). A, Immunohistochemical staining results for PP4C expression in PDAC (N=133) and their paired benign pancreatic tissue samples (N=113). The expression of PP4C is significantly higher in PDAC samples than their paired benign pancreatic tissue (P
    Figure Legend Snippet: PP4C is overexpressed in pancreatic ductal adenocarcinoma (PDAC). A, Immunohistochemical staining results for PP4C expression in PDAC (N=133) and their paired benign pancreatic tissue samples (N=113). The expression of PP4C is significantly higher in PDAC samples than their paired benign pancreatic tissue (P

    Techniques Used: Immunohistochemistry, Staining, Expressing

    Representative micrographs show PP4C expression in pancreatic ductal adenocarcinoma (PDAC) samples and benign pancreatic tissue. A and B, strong cytoplasmic and nuclear staining for PP4C in a moderately to poorly differentiated PDAC; C and D, a moderately differentiated PDAC with weak staining for PP4C; E and F, Representative benign pancreatic tissue that is negative for PP4C (Original magnification, 40× for A, C, and E; 200× for B, D, and F).
    Figure Legend Snippet: Representative micrographs show PP4C expression in pancreatic ductal adenocarcinoma (PDAC) samples and benign pancreatic tissue. A and B, strong cytoplasmic and nuclear staining for PP4C in a moderately to poorly differentiated PDAC; C and D, a moderately differentiated PDAC with weak staining for PP4C; E and F, Representative benign pancreatic tissue that is negative for PP4C (Original magnification, 40× for A, C, and E; 200× for B, D, and F).

    Techniques Used: Expressing, Staining

    2) Product Images from "Dopamine-Mediated Autocrine Inhibitory Circuit Regulating Human Insulin Secretion in Vitro"

    Article Title: Dopamine-Mediated Autocrine Inhibitory Circuit Regulating Human Insulin Secretion in Vitro

    Journal: Molecular Endocrinology

    doi: 10.1210/me.2012-1101

    Expression of D2R transcripts in human striatum, pancreas, and purified cadaveric islets. A and B, RT-PCR semiquantitative assay using the primer pairs 4hD2_F/3hD2_R (A) and 4hD2_F/4hD2_R (B), amplifying cDNA derived from both the long and short mRNA isoform of D2R . The 234-bp and 532-bp products expected from the amplification of D2RS cDNA are not visible in A and B at 40 cycles. When the reaction in A was extended to 55 cycles, the D2RS cDNA 234-bp produce became visible. C, RT-PCR semiquantitative assay using the primer pair Long_hD2_F/Long_hD2_R, specific for the long isoform of D2R . D, RT-PCR semiquantitative assay using the primer pair Short_hD2_F/3hD2R, specific for the short isoform of D2R . The 215-bp product expected from the amplification of D2RS cDNA is not visible. When the reaction in D was extended to 55 cycles, the D2RS cDNA 215-bp product became visible. E, RT-PCR semiquantitative assay using the primer pair 2hD2_F/2hD2R, amplifying cDNA derived from all the known mRNA isoforms of D2R . F, RT-PCR semiquantitative assay using the primer pair Hs_ACTB_2_SG, amplifying β-actin-specific cDNA. This figure shows the results of one of five similar experiments. All primer pairs and primer sequences are listed in Supplemental Table 1.
    Figure Legend Snippet: Expression of D2R transcripts in human striatum, pancreas, and purified cadaveric islets. A and B, RT-PCR semiquantitative assay using the primer pairs 4hD2_F/3hD2_R (A) and 4hD2_F/4hD2_R (B), amplifying cDNA derived from both the long and short mRNA isoform of D2R . The 234-bp and 532-bp products expected from the amplification of D2RS cDNA are not visible in A and B at 40 cycles. When the reaction in A was extended to 55 cycles, the D2RS cDNA 234-bp produce became visible. C, RT-PCR semiquantitative assay using the primer pair Long_hD2_F/Long_hD2_R, specific for the long isoform of D2R . D, RT-PCR semiquantitative assay using the primer pair Short_hD2_F/3hD2R, specific for the short isoform of D2R . The 215-bp product expected from the amplification of D2RS cDNA is not visible. When the reaction in D was extended to 55 cycles, the D2RS cDNA 215-bp product became visible. E, RT-PCR semiquantitative assay using the primer pair 2hD2_F/2hD2R, amplifying cDNA derived from all the known mRNA isoforms of D2R . F, RT-PCR semiquantitative assay using the primer pair Hs_ACTB_2_SG, amplifying β-actin-specific cDNA. This figure shows the results of one of five similar experiments. All primer pairs and primer sequences are listed in Supplemental Table 1.

    Techniques Used: Expressing, Purification, Reverse Transcription Polymerase Chain Reaction, Derivative Assay, Amplification

    3) Product Images from "Runx1 Orchestrates Sphingolipid Metabolism and Glucocorticoid Resistance in Lymphomagenesis"

    Article Title: Runx1 Orchestrates Sphingolipid Metabolism and Glucocorticoid Resistance in Lymphomagenesis

    Journal: Journal of Cellular Biochemistry

    doi: 10.1002/jcb.25802

    Ectopic Runx1 promotes S1P release from T‐lymphoma cells. (A) Total protein was extracted from p/m97 or p53/184 thymic lymphoma cells transduced with the pBabeRunx1 retroviral vector or the pBabePuro vector control and probed against antibodies to Runx1 (Cell Signalling #8229) or actin (Santa Cruz sc‐1616) as a loading control. Lymphoma cells over‐expressing Runx1 (9) were included as a positive control. (B) The blot was quantified using image J software and the Runx1 fold change indicated below the histogram. (C) Long chain ceramides were extracted from cell pellets from pBabePuro vector control and pBabeRunx1‐expressing T lymphoma cells (p/m97 shown), and separated, identified, and semi‐quantitated by HPLC mass spectrometry. The data are means ± SD where n = 4 from one experiment typical of two. Solid bars represent combined levels of 16.0, 24.1, and 24.0‐Cer ( P =
    Figure Legend Snippet: Ectopic Runx1 promotes S1P release from T‐lymphoma cells. (A) Total protein was extracted from p/m97 or p53/184 thymic lymphoma cells transduced with the pBabeRunx1 retroviral vector or the pBabePuro vector control and probed against antibodies to Runx1 (Cell Signalling #8229) or actin (Santa Cruz sc‐1616) as a loading control. Lymphoma cells over‐expressing Runx1 (9) were included as a positive control. (B) The blot was quantified using image J software and the Runx1 fold change indicated below the histogram. (C) Long chain ceramides were extracted from cell pellets from pBabePuro vector control and pBabeRunx1‐expressing T lymphoma cells (p/m97 shown), and separated, identified, and semi‐quantitated by HPLC mass spectrometry. The data are means ± SD where n = 4 from one experiment typical of two. Solid bars represent combined levels of 16.0, 24.1, and 24.0‐Cer ( P =

    Techniques Used: Transduction, Plasmid Preparation, Expressing, Positive Control, Software, High Performance Liquid Chromatography, Mass Spectrometry

    Runx1 protects lymphoma cells against dexamethasone‐mediated apoptosis. (A) p53 null lymphoma cells transduced with the pBabeRunx1 retroviral vector or the pBabePuro vector control (p/m97 shown) were plated in triplicate in the presence and absence of 1.0 μM dexamethasone and monitored for live/dead counts by trypan blue exclusion over 4 days. (B) The same cells were plated at 4 × 10 5 per well in triplicate wells of a 12‐well plate and monitored for growth over 48 h. Ectopic Runx1 significantly reduced cell proliferation at 24 h ( P
    Figure Legend Snippet: Runx1 protects lymphoma cells against dexamethasone‐mediated apoptosis. (A) p53 null lymphoma cells transduced with the pBabeRunx1 retroviral vector or the pBabePuro vector control (p/m97 shown) were plated in triplicate in the presence and absence of 1.0 μM dexamethasone and monitored for live/dead counts by trypan blue exclusion over 4 days. (B) The same cells were plated at 4 × 10 5 per well in triplicate wells of a 12‐well plate and monitored for growth over 48 h. Ectopic Runx1 significantly reduced cell proliferation at 24 h ( P

    Techniques Used: Transduction, Plasmid Preparation

    Enforced deletion of Runx1 impairs S1P release in vivo. (A) PCR genotyping of 60‐day‐old splenic tissue DNA from Runx1 fl/fl Mx1Cre + mice treated with vehicle control (PBS) for background excision or pIpC to excise Runx1 . Samples: A–C, 60‐day spleen tissue samples from two groups of three Runx1 fl/fl Mx1Cre + mice treated with either PBS or pIpC; D–F DNA controls, non‐excised Runx1 fl/fl Mx1Cre − (D), a mixture of partially excised Runx1 fl/fl Mx1Cre + and Balb/c normal kidney to show all three possible PCR products (E) and Balb/c normal kidney (F). Positions of Floxed (Runx1Fl), deleted (ΔRunx1Fl), and wildtype (WT) Runx1 alleles are as shown. Quantitation to estimate relative excision was performed using image J software. Estimated background and pIpC excision rates are labeled under the blots. (B) qt‐RT‐PCR analysis of Runx1 expression in 60‐day splenic tissue RNA samples from Runx1 fl/fl Mx1Cre + mice treated with vehicle control or pIpC (dark and light green bars, respectively). Parallel samples were analyzed from Runx1 fl/fl mice lacking the Mx1Cre gene to control for PBS and pIpC treatment (black and gray bars, respectively). The data are means ± SD where n = 9 representing three technical replicates of each biological replicate (3). A significant reduction in Runx1 expression was observed between Mx1Cre + and Mx1Cre − mice indicating background excision (gray vs. light green bar; P =
    Figure Legend Snippet: Enforced deletion of Runx1 impairs S1P release in vivo. (A) PCR genotyping of 60‐day‐old splenic tissue DNA from Runx1 fl/fl Mx1Cre + mice treated with vehicle control (PBS) for background excision or pIpC to excise Runx1 . Samples: A–C, 60‐day spleen tissue samples from two groups of three Runx1 fl/fl Mx1Cre + mice treated with either PBS or pIpC; D–F DNA controls, non‐excised Runx1 fl/fl Mx1Cre − (D), a mixture of partially excised Runx1 fl/fl Mx1Cre + and Balb/c normal kidney to show all three possible PCR products (E) and Balb/c normal kidney (F). Positions of Floxed (Runx1Fl), deleted (ΔRunx1Fl), and wildtype (WT) Runx1 alleles are as shown. Quantitation to estimate relative excision was performed using image J software. Estimated background and pIpC excision rates are labeled under the blots. (B) qt‐RT‐PCR analysis of Runx1 expression in 60‐day splenic tissue RNA samples from Runx1 fl/fl Mx1Cre + mice treated with vehicle control or pIpC (dark and light green bars, respectively). Parallel samples were analyzed from Runx1 fl/fl mice lacking the Mx1Cre gene to control for PBS and pIpC treatment (black and gray bars, respectively). The data are means ± SD where n = 9 representing three technical replicates of each biological replicate (3). A significant reduction in Runx1 expression was observed between Mx1Cre + and Mx1Cre − mice indicating background excision (gray vs. light green bar; P =

    Techniques Used: In Vivo, Polymerase Chain Reaction, Mouse Assay, Quantitation Assay, Software, Labeling, Reverse Transcription Polymerase Chain Reaction, Expressing

    Enforced deletion of Runx1 promotes dexamethasone‐mediated apoptosis and Sgpp1 transcription. (A) Western blotting analysis as described in Figure 1 A to detect the deleted (ΔRunx1Fl) and full length (Runx1Fl) Runx1 proteins from in vitro excised in Runx1 fl/fl Mx1Cre + 3s B lymphoma cells. (B) Paired cell lines expressing the deleted (ΔRunx1Fl) and full length (Runx1Fl) proteins after in vitro excision of Runx1 fl/fl Mx1Cre + 3s B lymphoma cells were plated in triplicate in the presence of 1.0 μM dexamethasone and monitored for live/dead counts by trypan blue exclusion. (C) qt‐RT‐PCR analysis of steady state levels of Sgpp1 in ΔRunx1Fl and Runx1Fl 3s cells grown in the presence and absence of 1.0 μM dexamethasone for 6 h. The data are means ± SD where n = 9 representing three technical replicates of each biological replicate (3) from one experiment typical of two. (D) Runx1 schematic showing the mutated residues in the heterodimerization (T161A) and DNA‐binding (K83N) domains. qt‐RT‐PCR analysis of Sgpp1 expression in ΔRunx1Fl 3s cells transfected with full length Runx1, T161A Runx1, or K83N Runx1. Absolute levels of Sgpp1 were compared to control cultures expressing the pBabe Puro vector alone. The data were compiled as described in (C).
    Figure Legend Snippet: Enforced deletion of Runx1 promotes dexamethasone‐mediated apoptosis and Sgpp1 transcription. (A) Western blotting analysis as described in Figure 1 A to detect the deleted (ΔRunx1Fl) and full length (Runx1Fl) Runx1 proteins from in vitro excised in Runx1 fl/fl Mx1Cre + 3s B lymphoma cells. (B) Paired cell lines expressing the deleted (ΔRunx1Fl) and full length (Runx1Fl) proteins after in vitro excision of Runx1 fl/fl Mx1Cre + 3s B lymphoma cells were plated in triplicate in the presence of 1.0 μM dexamethasone and monitored for live/dead counts by trypan blue exclusion. (C) qt‐RT‐PCR analysis of steady state levels of Sgpp1 in ΔRunx1Fl and Runx1Fl 3s cells grown in the presence and absence of 1.0 μM dexamethasone for 6 h. The data are means ± SD where n = 9 representing three technical replicates of each biological replicate (3) from one experiment typical of two. (D) Runx1 schematic showing the mutated residues in the heterodimerization (T161A) and DNA‐binding (K83N) domains. qt‐RT‐PCR analysis of Sgpp1 expression in ΔRunx1Fl 3s cells transfected with full length Runx1, T161A Runx1, or K83N Runx1. Absolute levels of Sgpp1 were compared to control cultures expressing the pBabe Puro vector alone. The data were compiled as described in (C).

    Techniques Used: Western Blot, In Vitro, Expressing, Reverse Transcription Polymerase Chain Reaction, Binding Assay, Transfection, Plasmid Preparation

    shRNA knockdown of Sgpp1 reduces dexamethasone‐mediated apoptosis. (A) qt‐RT‐PCR analysis of Sgpp1 expression in p/m97 cells stably infected with viral supernatants expressing an Sgpp1 or a non‐coding (NC) control shRNA sequence. Cells were grown for 6 h in the presence of 1.0 μM dexamethasone prior to RNA extraction and qt‐RT‐PCR analysis. The data were calculated as described in Fig. 4 C. (B) The same cells were plated in triplicate and grown for 36 h in the presence (Dex) and absence (MtOH) of 1.0 μM dexamethasone and monitored for live/dead counts by trypan blue exclusion. Knockdown of Sgpp1 had no effect on cell viability under control conditions but gave a significant reduction in cell death in the presence of 1.0 μM dexamethasone. (C) Interplay between Runx1 and dexamethasone on the expression of sphingolipid metabolism enzymes involved in the synthesis and breakdown of sphingosine and ceramide and their potential contributions to cell death and survival [Bianchini et al., 2006 ; Kilbey et al., 2010 ].
    Figure Legend Snippet: shRNA knockdown of Sgpp1 reduces dexamethasone‐mediated apoptosis. (A) qt‐RT‐PCR analysis of Sgpp1 expression in p/m97 cells stably infected with viral supernatants expressing an Sgpp1 or a non‐coding (NC) control shRNA sequence. Cells were grown for 6 h in the presence of 1.0 μM dexamethasone prior to RNA extraction and qt‐RT‐PCR analysis. The data were calculated as described in Fig. 4 C. (B) The same cells were plated in triplicate and grown for 36 h in the presence (Dex) and absence (MtOH) of 1.0 μM dexamethasone and monitored for live/dead counts by trypan blue exclusion. Knockdown of Sgpp1 had no effect on cell viability under control conditions but gave a significant reduction in cell death in the presence of 1.0 μM dexamethasone. (C) Interplay between Runx1 and dexamethasone on the expression of sphingolipid metabolism enzymes involved in the synthesis and breakdown of sphingosine and ceramide and their potential contributions to cell death and survival [Bianchini et al., 2006 ; Kilbey et al., 2010 ].

    Techniques Used: shRNA, Reverse Transcription Polymerase Chain Reaction, Expressing, Stable Transfection, Infection, Sequencing, RNA Extraction

    4) Product Images from "Vaccination With a FAT1-Derived B Cell Epitope Combined With Tumor-Specific B and T Cell Epitopes Elicits Additive Protection in Cancer Mouse Models"

    Article Title: Vaccination With a FAT1-Derived B Cell Epitope Combined With Tumor-Specific B and T Cell Epitopes Elicits Additive Protection in Cancer Mouse Models

    Journal: Frontiers in Oncology

    doi: 10.3389/fonc.2018.00481

    Expression and localization of mD8-FAT1 fusion proteins. (A) Schematic representation of plasmids expressing mD8-FAT1 fusion proteins . A synthetic minigene encoding three copies of mD8-FAT1 domain was fused to the 3′ end of either E. coli Maltose binding protein (MBP) gene or S. aureus fhuD2 gene. The two fusions were inserted into pET plasmid under the control of the T7 inducible promoter. Highlighted is the DNA sequence of the mD8-FAT1 minigene. (B) Compartmentalization of mD8-FAT1 fusions in OMVs . OMVs were purified from the supernatants of BL21(DE3)Δ ompA (pET_MBP-mD8-FAT1) and BL21(DE3)Δ ompA (pET_FhuD2-mD8-FAT1) strains and 20 μg of each OMVs preparation were separated by SDS-PAGE and the gel was stained with Coomassie Blue. As control, OMVs from BL21(DE3)Δ ompA (pET) strain (“Empty” OMVs) were also loaded on the gel. Arrows indicate the bands corresponding to the protein fusions. (C) Analysis of compartmentalization of mD8-FAT1 fusions in OMVs by Triton X-114 extraction . OMVs (100 μg) from BL21(DE3)Δ ompA (pET_MBP-mD8-FAT1) and BL21(DE3)Δ ompA (pET_FhuD2-mD8-FAT1) strains were incubated in 1% Triton X-114 solution at 4°C and subsequently aqueous and hydrophobic phases were separated by bringing the temperature at 37°C. Proteins in the aqueous (A) and hydrophobic (D) phases were precipitated by standard chloroform/methanol procedure, separated by SDS-PAGE together with 20 μg of OMVs and stained with Coomassie blue (T). (D) Analysis of surface localization of mD8-FAT1 fusion proteins . Bacterial cells from BL21(DE3)Δ ompA (pET_MBP-mD8-FAT1) and BL21(DE3)Δ ompA (pET_FhuD2-mD8-FAT1) cultures were first incubated with anti-mD8-FAT1 polyclonal antibodies and subsequently with fluorescent-labeled anti-rabbit antibodies. Antibody binding was visualized by flow cytometry.
    Figure Legend Snippet: Expression and localization of mD8-FAT1 fusion proteins. (A) Schematic representation of plasmids expressing mD8-FAT1 fusion proteins . A synthetic minigene encoding three copies of mD8-FAT1 domain was fused to the 3′ end of either E. coli Maltose binding protein (MBP) gene or S. aureus fhuD2 gene. The two fusions were inserted into pET plasmid under the control of the T7 inducible promoter. Highlighted is the DNA sequence of the mD8-FAT1 minigene. (B) Compartmentalization of mD8-FAT1 fusions in OMVs . OMVs were purified from the supernatants of BL21(DE3)Δ ompA (pET_MBP-mD8-FAT1) and BL21(DE3)Δ ompA (pET_FhuD2-mD8-FAT1) strains and 20 μg of each OMVs preparation were separated by SDS-PAGE and the gel was stained with Coomassie Blue. As control, OMVs from BL21(DE3)Δ ompA (pET) strain (“Empty” OMVs) were also loaded on the gel. Arrows indicate the bands corresponding to the protein fusions. (C) Analysis of compartmentalization of mD8-FAT1 fusions in OMVs by Triton X-114 extraction . OMVs (100 μg) from BL21(DE3)Δ ompA (pET_MBP-mD8-FAT1) and BL21(DE3)Δ ompA (pET_FhuD2-mD8-FAT1) strains were incubated in 1% Triton X-114 solution at 4°C and subsequently aqueous and hydrophobic phases were separated by bringing the temperature at 37°C. Proteins in the aqueous (A) and hydrophobic (D) phases were precipitated by standard chloroform/methanol procedure, separated by SDS-PAGE together with 20 μg of OMVs and stained with Coomassie blue (T). (D) Analysis of surface localization of mD8-FAT1 fusion proteins . Bacterial cells from BL21(DE3)Δ ompA (pET_MBP-mD8-FAT1) and BL21(DE3)Δ ompA (pET_FhuD2-mD8-FAT1) cultures were first incubated with anti-mD8-FAT1 polyclonal antibodies and subsequently with fluorescent-labeled anti-rabbit antibodies. Antibody binding was visualized by flow cytometry.

    Techniques Used: Expressing, Binding Assay, Positron Emission Tomography, Plasmid Preparation, Sequencing, Purification, SDS Page, Staining, Incubation, Labeling, Flow Cytometry, Cytometry

    Protection conferred by mD8-FAT1 OMVs immunization against CT26 challenge. (A) Schematic representation of immunization and challenge schedule . BALB/c mice were immunized three times (2 weeks apart) with OMVs from either BL21(DE3)Δ ompA (pET_MBP-mD8-FAT1) or BL21(DE3)Δ ompA (pET_FhuD2-mD8-FAT1) strains and 1 week after the third immunization the animals were challenged with 2 × 10 5 CT26 cells. Tumor growth was followed over a period of 25 days. As control, a group of mice was also immunized with “Empty” OMVs. (B) anti-mD8-FAT1 titers from mice immunized with mD8-FAT1 OMVs . The day before challenge sera from immunized mice were pooled (triangles: mice immunized with MBP-mD8-FAT1-OMVs; squares: mice immunized with FhuD2-mD8-FAT1-OMVs; circles: mice immunized with “Empty” OMVs) and the anti-mD8-FAT1 titers were determined by ELISA using plates coated with synthetic mD8-FAT1 peptide. (C) Anti-tumor activity of mD8-FAT1 OMVs immunizations . After challenge tumor growth was followed by measuring tumor volume with a caliper. Animals were sacrificed 25 days after challenge. Means ± SEM are indicated. ***Indicates that the difference in tumor size between the immunized group and control group is statistically significant with P
    Figure Legend Snippet: Protection conferred by mD8-FAT1 OMVs immunization against CT26 challenge. (A) Schematic representation of immunization and challenge schedule . BALB/c mice were immunized three times (2 weeks apart) with OMVs from either BL21(DE3)Δ ompA (pET_MBP-mD8-FAT1) or BL21(DE3)Δ ompA (pET_FhuD2-mD8-FAT1) strains and 1 week after the third immunization the animals were challenged with 2 × 10 5 CT26 cells. Tumor growth was followed over a period of 25 days. As control, a group of mice was also immunized with “Empty” OMVs. (B) anti-mD8-FAT1 titers from mice immunized with mD8-FAT1 OMVs . The day before challenge sera from immunized mice were pooled (triangles: mice immunized with MBP-mD8-FAT1-OMVs; squares: mice immunized with FhuD2-mD8-FAT1-OMVs; circles: mice immunized with “Empty” OMVs) and the anti-mD8-FAT1 titers were determined by ELISA using plates coated with synthetic mD8-FAT1 peptide. (C) Anti-tumor activity of mD8-FAT1 OMVs immunizations . After challenge tumor growth was followed by measuring tumor volume with a caliper. Animals were sacrificed 25 days after challenge. Means ± SEM are indicated. ***Indicates that the difference in tumor size between the immunized group and control group is statistically significant with P

    Techniques Used: Mouse Assay, Positron Emission Tomography, Enzyme-linked Immunosorbent Assay, Activity Assay

    Protective activity of mD8-FAT1 OMVs and EGFRvIII OMVs combination. (A) Analysis of mD8-FAT1 surface expression in B16F10-EGFRvIII cell line - B16F10-EGFRvIII cells expressing the EGFRvIII human variant were incubated with anti-MD8-FAT1 antibodies and subsequently stained with a fluorescent labeled anti-rabbit antibodies. Antibody binding was followed using flow cytometry analysis. (B) Protection of C57bl6 mice challenged with EGFRvIII-B16F10 . C57bl6 mice were immunized with either mD8-FAT1-OMVs, or EGFRvIII OMVs (20 μg/dose, three doses) or with the combination of mD8-FAT1 OMVs and EGFRvIII OMVs (10 μg/dose each OMV, three doses). Animals were subsequently challenged with 5 × 10 5 B16F10-EGFRvIII cells and tumor growth was followed over a period of 25 days. The data indicate the average of tumor sizes from each group at the end of the challenge experiment. Means ± SEM are indicated. *** P
    Figure Legend Snippet: Protective activity of mD8-FAT1 OMVs and EGFRvIII OMVs combination. (A) Analysis of mD8-FAT1 surface expression in B16F10-EGFRvIII cell line - B16F10-EGFRvIII cells expressing the EGFRvIII human variant were incubated with anti-MD8-FAT1 antibodies and subsequently stained with a fluorescent labeled anti-rabbit antibodies. Antibody binding was followed using flow cytometry analysis. (B) Protection of C57bl6 mice challenged with EGFRvIII-B16F10 . C57bl6 mice were immunized with either mD8-FAT1-OMVs, or EGFRvIII OMVs (20 μg/dose, three doses) or with the combination of mD8-FAT1 OMVs and EGFRvIII OMVs (10 μg/dose each OMV, three doses). Animals were subsequently challenged with 5 × 10 5 B16F10-EGFRvIII cells and tumor growth was followed over a period of 25 days. The data indicate the average of tumor sizes from each group at the end of the challenge experiment. Means ± SEM are indicated. *** P

    Techniques Used: Activity Assay, Expressing, Variant Assay, Incubation, Staining, Labeling, Binding Assay, Flow Cytometry, Cytometry, Mouse Assay

    Analysis of FAT1 expression in murine cell lines. (A) Schematic representation of the structural organization of FAT1 ) and the corresponding sequence in murine FAT1 (mD8-FAT1). (B) Quantitative analysis of FAT1 mRNA in mouse cancer cell lines —mRNA was purified from different cancer cells lines and qRT-PCR was carried out to quantify FAT1-specific mRNA. Data are reported as fold differences with respect to FAT1 mRNA from B16F10 cell line. The bars represent the means ± SD of three independent experiments. (C) Surface exposition of mD8-FAT1 domain in B16F10 and CT26 cell lines . Cancer cells were incubated with either mAb198.3 monoclonal antibodies or with polyclonal antibodies raised against the KLM-conjugated synthetic peptide corresponding to the mD8-FAT1 (A) . Cells were subsequently incubated with fluorescent labeled secondary antibodies and analyzed by flow cytometry.
    Figure Legend Snippet: Analysis of FAT1 expression in murine cell lines. (A) Schematic representation of the structural organization of FAT1 ) and the corresponding sequence in murine FAT1 (mD8-FAT1). (B) Quantitative analysis of FAT1 mRNA in mouse cancer cell lines —mRNA was purified from different cancer cells lines and qRT-PCR was carried out to quantify FAT1-specific mRNA. Data are reported as fold differences with respect to FAT1 mRNA from B16F10 cell line. The bars represent the means ± SD of three independent experiments. (C) Surface exposition of mD8-FAT1 domain in B16F10 and CT26 cell lines . Cancer cells were incubated with either mAb198.3 monoclonal antibodies or with polyclonal antibodies raised against the KLM-conjugated synthetic peptide corresponding to the mD8-FAT1 (A) . Cells were subsequently incubated with fluorescent labeled secondary antibodies and analyzed by flow cytometry.

    Techniques Used: Expressing, Sequencing, Purification, Quantitative RT-PCR, Incubation, Labeling, Flow Cytometry, Cytometry

    5) Product Images from "Gpr83 expression is not required for the maintenance of intestinal immune homeostasis and regulation of T-cell-dependent colitis"

    Article Title: Gpr83 expression is not required for the maintenance of intestinal immune homeostasis and regulation of T-cell-dependent colitis

    Journal: Immunology

    doi: 10.1111/j.1365-2567.2008.02857.x

    Expression of the G-protein coupled receptor Gpr83 is restricted to the CD4 + T-cell compartment and is induced following T-cell activation. (a) T cells were isolated from the thymus and spleen of Foxp3 GFP mice and sorted using fluorescence-activated cell sorting (FACS) based on expression of CD4 and green fluorescent protein (GFP) (thymocytes) and CD4, CD45RB and GFP (splenocytes). RNA was isolated from the indicated populations and quantitative PCR (qPCR) used to determine the relative expression of Gpr83. Results shown are from one representative experiment from at least three independent experiments. CD3-gamma (CD3γ) chain mRNA expression was used as an internal standard and relative mRNA amounts were normalized to the GFP − population. Results are expressed as the mean of triplicate wells ± standard error of the mean (SEM). (b) Splenocytes were isolated from BALB/c mice and sorted using FACS based on expression of the indicated markers. Total splenocytes from RAG −/− spleens were also isolated. RNA was isolated from the individual cell subsets and qPCR used to assess expression of Gpr83. Hypoxanthine-guanine phosphoribosyl transferase (HPRT) mRNA expression was used as an internal standard and relative mRNA amounts were normalized to RAG −/− expression. Results are expressed as the mean of triplicate wells ± SEM. (c) CD4 + CD45RB hi GFP − T cells were sorted using FACS from spleens isolated from Foxp3 GFP mice (purity > 99%). Cells were activated with αCD3 and αCD28 coated beads. At the indicated time-points, cells were harvested and relative expression analysed by qPCR. Freshly isolated CD4 + CD45RB lo GFP − and CD4 + CD45RB lo GFP + T cells were used as indicators of relative Foxp3 and Gpr83 expression levels. CD3γ expression was used as an internal standard and relative amounts were normalized to unactivated (0 hr) T-cell expression. Results shown are the mean of triplicate wells ± SEM. Results are from one representative experiment from at least three independent experiments.
    Figure Legend Snippet: Expression of the G-protein coupled receptor Gpr83 is restricted to the CD4 + T-cell compartment and is induced following T-cell activation. (a) T cells were isolated from the thymus and spleen of Foxp3 GFP mice and sorted using fluorescence-activated cell sorting (FACS) based on expression of CD4 and green fluorescent protein (GFP) (thymocytes) and CD4, CD45RB and GFP (splenocytes). RNA was isolated from the indicated populations and quantitative PCR (qPCR) used to determine the relative expression of Gpr83. Results shown are from one representative experiment from at least three independent experiments. CD3-gamma (CD3γ) chain mRNA expression was used as an internal standard and relative mRNA amounts were normalized to the GFP − population. Results are expressed as the mean of triplicate wells ± standard error of the mean (SEM). (b) Splenocytes were isolated from BALB/c mice and sorted using FACS based on expression of the indicated markers. Total splenocytes from RAG −/− spleens were also isolated. RNA was isolated from the individual cell subsets and qPCR used to assess expression of Gpr83. Hypoxanthine-guanine phosphoribosyl transferase (HPRT) mRNA expression was used as an internal standard and relative mRNA amounts were normalized to RAG −/− expression. Results are expressed as the mean of triplicate wells ± SEM. (c) CD4 + CD45RB hi GFP − T cells were sorted using FACS from spleens isolated from Foxp3 GFP mice (purity > 99%). Cells were activated with αCD3 and αCD28 coated beads. At the indicated time-points, cells were harvested and relative expression analysed by qPCR. Freshly isolated CD4 + CD45RB lo GFP − and CD4 + CD45RB lo GFP + T cells were used as indicators of relative Foxp3 and Gpr83 expression levels. CD3γ expression was used as an internal standard and relative amounts were normalized to unactivated (0 hr) T-cell expression. Results shown are the mean of triplicate wells ± SEM. Results are from one representative experiment from at least three independent experiments.

    Techniques Used: Expressing, Activation Assay, Isolation, Mouse Assay, Fluorescence, FACS, Real-time Polymerase Chain Reaction

    Regulatory T-cell analysis in mice deficient in the G-protein coupled receptor Gpr83. (a) Thymocytes were isolated from Gpr83 −/− and age-matched wild-type (WT) BALB/c mice. The percentage of forkhead/winged helix transcription factor (Foxp3) and CD25 expression in CD4 single positive (SP) cells was determined by fluorescence-activated cell sorting (FACS). Results show the mean frequency of the indicated cell population in the total CD4 SP thymocytes ( n = 3) ± standard deviation (SD). (b) Lymphocytes from WT and Gpr83 −/− mice were isolated from the spleen ( n = 12), mesenteric lymph nodes (MLN) ( n = 12) and colonic lamina propria (LPL) ( n = 4). The percentage of Foxp3 and CD25 expression in CD4 + T cells was determined by FACS. Results show the mean frequency of the indicated cell population in CD4 + T cells ± SD. (c) Individual spleens from WT and Gpr83-deficient mice were analysed for total cellularity, total CD4 + cell numbers and CD4 + frequency. Mann–Whitney statistical analysis was performed to determine the statistical significance of differences observed. KO, knockout.
    Figure Legend Snippet: Regulatory T-cell analysis in mice deficient in the G-protein coupled receptor Gpr83. (a) Thymocytes were isolated from Gpr83 −/− and age-matched wild-type (WT) BALB/c mice. The percentage of forkhead/winged helix transcription factor (Foxp3) and CD25 expression in CD4 single positive (SP) cells was determined by fluorescence-activated cell sorting (FACS). Results show the mean frequency of the indicated cell population in the total CD4 SP thymocytes ( n = 3) ± standard deviation (SD). (b) Lymphocytes from WT and Gpr83 −/− mice were isolated from the spleen ( n = 12), mesenteric lymph nodes (MLN) ( n = 12) and colonic lamina propria (LPL) ( n = 4). The percentage of Foxp3 and CD25 expression in CD4 + T cells was determined by FACS. Results show the mean frequency of the indicated cell population in CD4 + T cells ± SD. (c) Individual spleens from WT and Gpr83-deficient mice were analysed for total cellularity, total CD4 + cell numbers and CD4 + frequency. Mann–Whitney statistical analysis was performed to determine the statistical significance of differences observed. KO, knockout.

    Techniques Used: Mouse Assay, Isolation, Expressing, Fluorescence, FACS, Standard Deviation, MANN-WHITNEY, Knock-Out

    Induction of expression of the G-protein coupled receptor Gpr83 is dependent on transforming growth factor (TGF)-β responsiveness. (a) Naïve CD4 + CD45RB hi CD25 − T cells were isolated from dnTGF-βRII or aged-matched wild-type mice by fluorescence-activated cell sorting (FACS; purity > 98%) and activated in vitro with plate-bound αCD3 and αCD28 (both 10 μg/ml). RNA was isolated at the indicated time-points and forkhead/winged helix transcription factor (Foxp3) and Gpr83 expression analysed by quantitative polymerase chain reaction (qPCR). CD3γ was used as an internal standard and relative mRNA amounts were normalized to unactivated (0 hr) expression levels. Results shown are from one of at least three independent experiments and are shown as the mean of triplicate wells ± standard error of the mean (SEM). (b) Splenic CD4 + CD45RB lo CD25 − and CD25 + populations were isolated from age-matched wild-type and dnTGF-βRII mice. RNA was isolated and qPCR used to determine the relative expression of Foxp3 and Gpr83. As previously, the CD3γ chain was used as an internal standard and relative mRNA levels normalized to the CD4 + CD45RB lo green fluorescent protein (GFP) − populations. Results shown are of one of three independent experiments and are expressed as the mean of triplicate wells ± SEM. Student’s t -test was used to determine the statistical significance of differences observed ( P
    Figure Legend Snippet: Induction of expression of the G-protein coupled receptor Gpr83 is dependent on transforming growth factor (TGF)-β responsiveness. (a) Naïve CD4 + CD45RB hi CD25 − T cells were isolated from dnTGF-βRII or aged-matched wild-type mice by fluorescence-activated cell sorting (FACS; purity > 98%) and activated in vitro with plate-bound αCD3 and αCD28 (both 10 μg/ml). RNA was isolated at the indicated time-points and forkhead/winged helix transcription factor (Foxp3) and Gpr83 expression analysed by quantitative polymerase chain reaction (qPCR). CD3γ was used as an internal standard and relative mRNA amounts were normalized to unactivated (0 hr) expression levels. Results shown are from one of at least three independent experiments and are shown as the mean of triplicate wells ± standard error of the mean (SEM). (b) Splenic CD4 + CD45RB lo CD25 − and CD25 + populations were isolated from age-matched wild-type and dnTGF-βRII mice. RNA was isolated and qPCR used to determine the relative expression of Foxp3 and Gpr83. As previously, the CD3γ chain was used as an internal standard and relative mRNA levels normalized to the CD4 + CD45RB lo green fluorescent protein (GFP) − populations. Results shown are of one of three independent experiments and are expressed as the mean of triplicate wells ± SEM. Student’s t -test was used to determine the statistical significance of differences observed ( P

    Techniques Used: Expressing, Isolation, Mouse Assay, Fluorescence, FACS, In Vitro, Real-time Polymerase Chain Reaction

    Activation-induced G-protein coupled receptor Gpr83 is restricted to forkhead/winged helix transcription factor (Foxp3)-expressing cells. (a) Naïve CD4 + CD45RB hi green fluorescent protein (GFP) − T cells were isolated from Foxp3 GFP mice by fluorescence-activated cell sorting (FACS; purity > 99%). Cells were activated with plate-bound αCD3 and αCD28 (both 10 μg/ml) for 48 hr in the presence of recombinant human transforming growth factor (TGF)-β (2 ng/ml). Cells were harvested and re-sorted based on expression of CD4 and GFP (CD4 + GFP − , > 99% purity; CD4 + GFP + , > 98% purity). (b) RNA was isolated from the sorted populations and quantitative polymerase chain reaction (qPCR) used to determine the relative expression of Foxp3 and Gpr83. CD3γ was used as an internal standard and relative mRNA levels normalized to the CD4 + CD45RB hi GFP − starting population. Results shown are representative of three independent experiments and are expressed as the mean of triplicate wells ± standard error of the mean (SEM). WT, wild type.
    Figure Legend Snippet: Activation-induced G-protein coupled receptor Gpr83 is restricted to forkhead/winged helix transcription factor (Foxp3)-expressing cells. (a) Naïve CD4 + CD45RB hi green fluorescent protein (GFP) − T cells were isolated from Foxp3 GFP mice by fluorescence-activated cell sorting (FACS; purity > 99%). Cells were activated with plate-bound αCD3 and αCD28 (both 10 μg/ml) for 48 hr in the presence of recombinant human transforming growth factor (TGF)-β (2 ng/ml). Cells were harvested and re-sorted based on expression of CD4 and GFP (CD4 + GFP − , > 99% purity; CD4 + GFP + , > 98% purity). (b) RNA was isolated from the sorted populations and quantitative polymerase chain reaction (qPCR) used to determine the relative expression of Foxp3 and Gpr83. CD3γ was used as an internal standard and relative mRNA levels normalized to the CD4 + CD45RB hi GFP − starting population. Results shown are representative of three independent experiments and are expressed as the mean of triplicate wells ± standard error of the mean (SEM). WT, wild type.

    Techniques Used: Activation Assay, Expressing, Isolation, Mouse Assay, Fluorescence, FACS, Recombinant, Real-time Polymerase Chain Reaction

    6) Product Images from "Tumor Lymphangiogenesis and Metastasis to Lymph Nodes Induced by Cancer Cell Expression of Podoplanin"

    Article Title: Tumor Lymphangiogenesis and Metastasis to Lymph Nodes Induced by Cancer Cell Expression of Podoplanin

    Journal: The American Journal of Pathology

    doi: 10.2353/ajpath.2010.090703

    Podoplanin Promotes the in Vivo Expression of Cytoskeletal and Extracellular Matrix Molecules, Including Tenascin-C and Villin-1
    Figure Legend Snippet: Podoplanin Promotes the in Vivo Expression of Cytoskeletal and Extracellular Matrix Molecules, Including Tenascin-C and Villin-1

    Techniques Used: In Vivo, Expressing

    mRNA and protein levels of tenascin-C and villin-1 are increased in MCF7 breast carcinoma xenografts that overexpress podoplanin, compared with control tumors. A: Relative mouse tenascin-C mRNA levels, measured by real-time RT-PCR in MCF7 tumors derived
    Figure Legend Snippet: mRNA and protein levels of tenascin-C and villin-1 are increased in MCF7 breast carcinoma xenografts that overexpress podoplanin, compared with control tumors. A: Relative mouse tenascin-C mRNA levels, measured by real-time RT-PCR in MCF7 tumors derived

    Techniques Used: Quantitative RT-PCR, Derivative Assay

    7) Product Images from "IFN-λ prevents influenza virus spread from the upper airways to the lungs and limits virus transmission"

    Article Title: IFN-λ prevents influenza virus spread from the upper airways to the lungs and limits virus transmission

    Journal: eLife

    doi: 10.7554/eLife.33354

    Basal expression of IFN-λ genes is reduced in Ifnar1 −/− mice. ( A ) Basal expression of type I ( Ifnb1 and Ifna4 ), type III IFNs ( Ifnl2/3 ) and Mx1 was measured by RT-qPCR in snout homogenates of WT (n = 6), Ifnar1 −/− (n = 6) and Ifnlr1 −/− (n = 6). Gene expression levels are shown relative to the housekeeping gene Hprt . Symbols represent individual mice, and bars represent means ± SEM. Statistical analysis: One-way ANOVA with Tukey’s multiple comparisons; asterisks indicate p-values: ***p
    Figure Legend Snippet: Basal expression of IFN-λ genes is reduced in Ifnar1 −/− mice. ( A ) Basal expression of type I ( Ifnb1 and Ifna4 ), type III IFNs ( Ifnl2/3 ) and Mx1 was measured by RT-qPCR in snout homogenates of WT (n = 6), Ifnar1 −/− (n = 6) and Ifnlr1 −/− (n = 6). Gene expression levels are shown relative to the housekeeping gene Hprt . Symbols represent individual mice, and bars represent means ± SEM. Statistical analysis: One-way ANOVA with Tukey’s multiple comparisons; asterisks indicate p-values: ***p

    Techniques Used: Expressing, Mouse Assay, Quantitative RT-PCR

    8) Product Images from "Effects of Monolaurin on Oral Microbe–Host Transcriptome and Metabolome"

    Article Title: Effects of Monolaurin on Oral Microbe–Host Transcriptome and Metabolome

    Journal: Frontiers in Microbiology

    doi: 10.3389/fmicb.2018.02638

    Relative expression of genes from HGF-1 cells (fibroblasts) by quantitative PCR: (A) IL-1α; (B) IL-6; (C) IL-18; (D) CASP3; (E) MMP-1; (F) TNF. Oral cell/bacteria co-culture inoculated with A. actinomycetemcomitans and treated with different doses of monolaurin (25 μM – Mono 25 or 50 μM – Mono 50). Control group is oral cell co-culture inoculated with A. actinomycetemcomitans and no treatment. The control group has their mean expressed equal to 1 and treated groups have their mean relative to the control group. Different letters (a, b, and c) indicate statistical difference between groups. The results were expressed by mean ± standard deviation; n = 6 and p
    Figure Legend Snippet: Relative expression of genes from HGF-1 cells (fibroblasts) by quantitative PCR: (A) IL-1α; (B) IL-6; (C) IL-18; (D) CASP3; (E) MMP-1; (F) TNF. Oral cell/bacteria co-culture inoculated with A. actinomycetemcomitans and treated with different doses of monolaurin (25 μM – Mono 25 or 50 μM – Mono 50). Control group is oral cell co-culture inoculated with A. actinomycetemcomitans and no treatment. The control group has their mean expressed equal to 1 and treated groups have their mean relative to the control group. Different letters (a, b, and c) indicate statistical difference between groups. The results were expressed by mean ± standard deviation; n = 6 and p

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Co-Culture Assay, Standard Deviation

    Relative expression of genes from OBA-9 cells (keratinocytes) by quantitative PCR: (A) IL-1α; (B) IL-6; (C) IL-18; (D) CASP3; (E) MMP-1; (F) TNF. Oral cell/bacteria co-culture inoculated with A. actinomycetemcomitans and treated with different doses of monolaurin (25 μM – Mono 25 or 50 μM – Mono 50). Control group is oral cell co-culture inoculated with A. actinomycetemcomitans and no treatment. The control group has their mean expressed equal to 1 and treated groups have their mean relative to the control group. Different letters (a, b, and c) indicate statistical difference between groups. The results were expressed by mean ± standard deviation; n = 6 and p
    Figure Legend Snippet: Relative expression of genes from OBA-9 cells (keratinocytes) by quantitative PCR: (A) IL-1α; (B) IL-6; (C) IL-18; (D) CASP3; (E) MMP-1; (F) TNF. Oral cell/bacteria co-culture inoculated with A. actinomycetemcomitans and treated with different doses of monolaurin (25 μM – Mono 25 or 50 μM – Mono 50). Control group is oral cell co-culture inoculated with A. actinomycetemcomitans and no treatment. The control group has their mean expressed equal to 1 and treated groups have their mean relative to the control group. Different letters (a, b, and c) indicate statistical difference between groups. The results were expressed by mean ± standard deviation; n = 6 and p

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Co-Culture Assay, Standard Deviation

    9) Product Images from "Crucial Role for Early Growth Response-1 in the Transcriptional Regulation of miR-20b in Breast Cancer"

    Article Title: Crucial Role for Early Growth Response-1 in the Transcriptional Regulation of miR-20b in Breast Cancer

    Journal: Oncotarget

    doi:

    miR-20b transcriptionally activated by EGR1 directly targets PTEN and BRCA1 in breast cancer Serum-inducible zinc finger transcription factor EGR1 is induced and activated in response to a wide range of extracellular stimuli, including growth factors, cytokines, UV light, ionizing radiation, and mechanical injury. Once activated, EGR1 translocates into nucleus and binds to the consensus motifs at miR-20b promoter, leading to miR-20b transcription. The mature miR-20b assembles with other proteins to form RNA-induced silencing complex (RISC), the later recognizes and binds to PTEN and BRCA1 mRNAs, leading to either translational suppression or degradation of those two molecules, consequently resulting in breast cancer cell proliferation and migration.
    Figure Legend Snippet: miR-20b transcriptionally activated by EGR1 directly targets PTEN and BRCA1 in breast cancer Serum-inducible zinc finger transcription factor EGR1 is induced and activated in response to a wide range of extracellular stimuli, including growth factors, cytokines, UV light, ionizing radiation, and mechanical injury. Once activated, EGR1 translocates into nucleus and binds to the consensus motifs at miR-20b promoter, leading to miR-20b transcription. The mature miR-20b assembles with other proteins to form RNA-induced silencing complex (RISC), the later recognizes and binds to PTEN and BRCA1 mRNAs, leading to either translational suppression or degradation of those two molecules, consequently resulting in breast cancer cell proliferation and migration.

    Techniques Used: Migration

    EGR1 correlates with miR-20b expression levels (A) Total RNA isolated from HMEC and breast cancer cell lines MCF7, ZR75-1, HCC1419, and HCC1806 was subjected to real-time RT-PCR with a primer set for miR-20b. (B) Whole cell lysates prepared from the above cell lines were subjected to Western blot analysis using antibodies against EGR1 and GAPDH. (C) HCC1806 cells were transiently transfected with either siEGR1 (siRNA targeting EGR1) or control siRNA; the levels of EGR1 mRNA and protein were determined by real-time RT-PCR (upper panel) and Western blot analysis (lower panel). (D) HCC1806 cells were transiently transfected with either siEGR1 or control siRNA; the levels of miR-20b were determined by real-time RT-PCR. The asterisk indicates p
    Figure Legend Snippet: EGR1 correlates with miR-20b expression levels (A) Total RNA isolated from HMEC and breast cancer cell lines MCF7, ZR75-1, HCC1419, and HCC1806 was subjected to real-time RT-PCR with a primer set for miR-20b. (B) Whole cell lysates prepared from the above cell lines were subjected to Western blot analysis using antibodies against EGR1 and GAPDH. (C) HCC1806 cells were transiently transfected with either siEGR1 (siRNA targeting EGR1) or control siRNA; the levels of EGR1 mRNA and protein were determined by real-time RT-PCR (upper panel) and Western blot analysis (lower panel). (D) HCC1806 cells were transiently transfected with either siEGR1 or control siRNA; the levels of miR-20b were determined by real-time RT-PCR. The asterisk indicates p

    Techniques Used: Expressing, Isolation, Quantitative RT-PCR, Western Blot, Transfection

    EGR1 regulates miR-20b transcription (A) The wild-type and mutant miR-20b promoter reporters used in this project. (B) HEK293 cells were transiently transfected with pGL3-WT-miR20b-Prom or pGL3-MT-miR20b-Prom and pCB6-Egr1 or pCB6; luciferase activity was detected according to the manufacturer's instruction. (C) Real-time ChIP-PCR and conventional ChIP-PCR were performed as described in “Materials and Methods”. (D) Nuclear extracts were prepared from HCC1806 cells, and EMSA was performed using ChIP-grade antibody to EGR1 according to the manufacturer's instruction. The asterisk indicates p
    Figure Legend Snippet: EGR1 regulates miR-20b transcription (A) The wild-type and mutant miR-20b promoter reporters used in this project. (B) HEK293 cells were transiently transfected with pGL3-WT-miR20b-Prom or pGL3-MT-miR20b-Prom and pCB6-Egr1 or pCB6; luciferase activity was detected according to the manufacturer's instruction. (C) Real-time ChIP-PCR and conventional ChIP-PCR were performed as described in “Materials and Methods”. (D) Nuclear extracts were prepared from HCC1806 cells, and EMSA was performed using ChIP-grade antibody to EGR1 according to the manufacturer's instruction. The asterisk indicates p

    Techniques Used: Mutagenesis, Transfection, Luciferase, Activity Assay, Chromatin Immunoprecipitation, Polymerase Chain Reaction

    EGR1 expression is correlated with miR-20b expression in breast cancer tissues (A) Representatives of EGR1 and hsa-miR-20b stainings in the same sections of breast cancer tissue arrays. (B) Statistical and correlation analyses of EGR1 and hsa-miR-20b expression in breast cancer tissues. (C) Representatives of EGR1 and hsa-miR-20b staining in the same sections of metastatic breast cancer tissue arrays. (D) Statistical and correlation analyses of EGR1 and hsa-miR-20b expression in metastatic breast cancer tissues.
    Figure Legend Snippet: EGR1 expression is correlated with miR-20b expression in breast cancer tissues (A) Representatives of EGR1 and hsa-miR-20b stainings in the same sections of breast cancer tissue arrays. (B) Statistical and correlation analyses of EGR1 and hsa-miR-20b expression in breast cancer tissues. (C) Representatives of EGR1 and hsa-miR-20b staining in the same sections of metastatic breast cancer tissue arrays. (D) Statistical and correlation analyses of EGR1 and hsa-miR-20b expression in metastatic breast cancer tissues.

    Techniques Used: Expressing, Staining

    IR induces miR-20b expression in mammary gland tissues/cells in a dose- and time-dependent manner (A and B) Total RNA isolated from the mammary gland tissues of six-week-old female Long Evans rats exposed to either 30 kVp/0.1 Gy, 80 kVp/2.5 Gy X-ray, or sham-treatment 96 hours post-irradiation was subjected to microRNA microarray; the levels of rno-miR-20b were determined by real-time RT-PCR. (C) Total RNA was isolated from the mammary gland tissues of six-week-old female Long Evans rats at different time points post-IR, and the levels of rno-miR-20b were examined by real-time RT-PCR. (D and E) Total RNA isolated from HMEC exposed to either 30 kVp/0.1 Gy or 80 kVp/2.5 Gy X-ray was subjected to real-time RT-PCR using primers for hsa-miR-20b and EGR1. The hash indicates p
    Figure Legend Snippet: IR induces miR-20b expression in mammary gland tissues/cells in a dose- and time-dependent manner (A and B) Total RNA isolated from the mammary gland tissues of six-week-old female Long Evans rats exposed to either 30 kVp/0.1 Gy, 80 kVp/2.5 Gy X-ray, or sham-treatment 96 hours post-irradiation was subjected to microRNA microarray; the levels of rno-miR-20b were determined by real-time RT-PCR. (C) Total RNA was isolated from the mammary gland tissues of six-week-old female Long Evans rats at different time points post-IR, and the levels of rno-miR-20b were examined by real-time RT-PCR. (D and E) Total RNA isolated from HMEC exposed to either 30 kVp/0.1 Gy or 80 kVp/2.5 Gy X-ray was subjected to real-time RT-PCR using primers for hsa-miR-20b and EGR1. The hash indicates p

    Techniques Used: Expressing, Isolation, Irradiation, Microarray, Quantitative RT-PCR

    10) Product Images from "Tumor Lymphangiogenesis and Metastasis to Lymph Nodes Induced by Cancer Cell Expression of Podoplanin"

    Article Title: Tumor Lymphangiogenesis and Metastasis to Lymph Nodes Induced by Cancer Cell Expression of Podoplanin

    Journal: The American Journal of Pathology

    doi: 10.2353/ajpath.2010.090703

    Podoplanin Promotes the in Vivo Expression of Cytoskeletal and Extracellular Matrix Molecules, Including Tenascin-C and Villin-1
    Figure Legend Snippet: Podoplanin Promotes the in Vivo Expression of Cytoskeletal and Extracellular Matrix Molecules, Including Tenascin-C and Villin-1

    Techniques Used: In Vivo, Expressing

    mRNA and protein levels of tenascin-C and villin-1 are increased in MCF7 breast carcinoma xenografts that overexpress podoplanin, compared with control tumors. A: Relative mouse tenascin-C mRNA levels, measured by real-time RT-PCR in MCF7 tumors derived
    Figure Legend Snippet: mRNA and protein levels of tenascin-C and villin-1 are increased in MCF7 breast carcinoma xenografts that overexpress podoplanin, compared with control tumors. A: Relative mouse tenascin-C mRNA levels, measured by real-time RT-PCR in MCF7 tumors derived

    Techniques Used: Quantitative RT-PCR, Derivative Assay

    11) Product Images from "Tumor Suppressor PDCD4 Represses Internal Ribosome Entry Site-Mediated Translation of Antiapoptotic Proteins and Is Regulated by S6 Kinase 2"

    Article Title: Tumor Suppressor PDCD4 Represses Internal Ribosome Entry Site-Mediated Translation of Antiapoptotic Proteins and Is Regulated by S6 Kinase 2

    Journal: Molecular and Cellular Biology

    doi: 10.1128/MCB.06317-11

    Activation of S6K2 leads to PDCD4 degradation, with a concomitant increase in XIAP and Bcl-x L protein levels. (A) TOKAS6K2-stable or control cells (transiently transfected with an inducible pTripz-Kate plasmid) were treated with doxycycline (Dox) (1 μg/ml)
    Figure Legend Snippet: Activation of S6K2 leads to PDCD4 degradation, with a concomitant increase in XIAP and Bcl-x L protein levels. (A) TOKAS6K2-stable or control cells (transiently transfected with an inducible pTripz-Kate plasmid) were treated with doxycycline (Dox) (1 μg/ml)

    Techniques Used: Activation Assay, Transfection, Plasmid Preparation

    Loss of PDCD4 correlates with an increase in XIAP and Bcl-x L translation through their respective IRES elements. (A) HEK293T cells were treated with PDCD4 siRNA or control (CTRL), nontargeting siRNA. Cell lysates were harvested and subjected to Western
    Figure Legend Snippet: Loss of PDCD4 correlates with an increase in XIAP and Bcl-x L translation through their respective IRES elements. (A) HEK293T cells were treated with PDCD4 siRNA or control (CTRL), nontargeting siRNA. Cell lysates were harvested and subjected to Western

    Techniques Used: Western Blot

    PDCD4 specifically binds to XIAP and Bcl-x L IRES RNA both in vitro and in vivo . (A) Recombinant His-PDCD4 was incubated in the presence of 32 P-labeled, in vitro -transcribed RNA and subjected to UV cross-linking. RNA-protein complexes were separated by
    Figure Legend Snippet: PDCD4 specifically binds to XIAP and Bcl-x L IRES RNA both in vitro and in vivo . (A) Recombinant His-PDCD4 was incubated in the presence of 32 P-labeled, in vitro -transcribed RNA and subjected to UV cross-linking. RNA-protein complexes were separated by

    Techniques Used: In Vitro, In Vivo, Recombinant, Incubation, Labeling

    12) Product Images from "Wild-type ALK and activating ALK-R1275Q and ALK-F1174L mutations upregulate Myc and initiate tumor formation in murine neural crest progenitor cells"

    Article Title: Wild-type ALK and activating ALK-R1275Q and ALK-F1174L mutations upregulate Myc and initiate tumor formation in murine neural crest progenitor cells

    Journal: Oncotarget

    doi:

    ALK-wt-, ALK-F1174L-, and ALK-R1275Q-expressing JoMa1 cells are tumorigenic in subcutaneous in vivo model A. Analyses of ALK mRNA and protein expressions in parental JoMa1 cells and in JoMa1 cells transduced with the empty vector (Migr) or vector encoding for ALF-wt, ALK-F1174L or ALK-R1275Q. Murine GAPDH and β-actin were used as control for RT-PCR (top) or immunoblotting (bottom), respectively. B. Expression levels of various NCSC and differentiation markers analyzed by RT-PCR in total RNA from JoMa1 parental and transduced cells. C. Immunoblotting analysis of ALK phosphorylation in transduced JoMa1 cells. β-actin was used as loading control. D. Tumor take (number of tumors/total implanted mouse flanks) and growth (mean tumor volumes ± SEM) of JoMa1 parental and transduced cells implanted subcutaneously in both flanks of nude mice are represented (one way Anova *=p
    Figure Legend Snippet: ALK-wt-, ALK-F1174L-, and ALK-R1275Q-expressing JoMa1 cells are tumorigenic in subcutaneous in vivo model A. Analyses of ALK mRNA and protein expressions in parental JoMa1 cells and in JoMa1 cells transduced with the empty vector (Migr) or vector encoding for ALF-wt, ALK-F1174L or ALK-R1275Q. Murine GAPDH and β-actin were used as control for RT-PCR (top) or immunoblotting (bottom), respectively. B. Expression levels of various NCSC and differentiation markers analyzed by RT-PCR in total RNA from JoMa1 parental and transduced cells. C. Immunoblotting analysis of ALK phosphorylation in transduced JoMa1 cells. β-actin was used as loading control. D. Tumor take (number of tumors/total implanted mouse flanks) and growth (mean tumor volumes ± SEM) of JoMa1 parental and transduced cells implanted subcutaneously in both flanks of nude mice are represented (one way Anova *=p

    Techniques Used: Expressing, In Vivo, Transduction, Plasmid Preparation, Reverse Transcription Polymerase Chain Reaction, Mouse Assay

    Myc expression is strongly enhanced in orthotopic tumors and in tumor-derived cell lines, and plays a strong oncogenic role in vitro A. Myc mRNA expression levels measured by semi-quantitative real-time qPCR in parental JoMa1 cells and in orthotopic tumors. Five representative samples were analyzed for JoMa1-ALK-F, and JoMa1-ALK-R tumors; 4 for JoMa1-ALK-wt tumors, t.d.JoMa1-ALK-F, and t.d.JoMa1-ALK-R cell lines; and 3 for t.d.JoMa1-ALK-wt cell line. To note: the exogenous Myc-ER T is from human origin and was not detected by the murin Myc specific primers used. Mean ratio between Myc and β-actin as measured in three independent experiments are indicated (*=p
    Figure Legend Snippet: Myc expression is strongly enhanced in orthotopic tumors and in tumor-derived cell lines, and plays a strong oncogenic role in vitro A. Myc mRNA expression levels measured by semi-quantitative real-time qPCR in parental JoMa1 cells and in orthotopic tumors. Five representative samples were analyzed for JoMa1-ALK-F, and JoMa1-ALK-R tumors; 4 for JoMa1-ALK-wt tumors, t.d.JoMa1-ALK-F, and t.d.JoMa1-ALK-R cell lines; and 3 for t.d.JoMa1-ALK-wt cell line. To note: the exogenous Myc-ER T is from human origin and was not detected by the murin Myc specific primers used. Mean ratio between Myc and β-actin as measured in three independent experiments are indicated (*=p

    Techniques Used: Expressing, Derivative Assay, In Vitro, Real-time Polymerase Chain Reaction

    ALK-F1174L impairs differentiation of MONC-1-derived tumors A. Whole cell extract of MONC-1 parental cells and MONC-1-ALK-F1174L transduced cells were analyzed by immunoblotting for the presence of human ALK. β-actin was used as loading control. B. Tumor take (number of tumor-bearing mice /total nude mice) and growth (mean tumor volumes ± SEM) of MONC-1 and MONC-1-ALK-F cells orthotopically implanted and measured by echography (unpaired t test with Welch's correction, ***=p
    Figure Legend Snippet: ALK-F1174L impairs differentiation of MONC-1-derived tumors A. Whole cell extract of MONC-1 parental cells and MONC-1-ALK-F1174L transduced cells were analyzed by immunoblotting for the presence of human ALK. β-actin was used as loading control. B. Tumor take (number of tumor-bearing mice /total nude mice) and growth (mean tumor volumes ± SEM) of MONC-1 and MONC-1-ALK-F cells orthotopically implanted and measured by echography (unpaired t test with Welch's correction, ***=p

    Techniques Used: Derivative Assay, Mouse Assay

    13) Product Images from "Nicotine stimulates collagen type I expression in lung via α7 nicotinic acetylcholine receptors"

    Article Title: Nicotine stimulates collagen type I expression in lung via α7 nicotinic acetylcholine receptors

    Journal: Respiratory Research

    doi: 10.1186/s12931-017-0596-8

    Nicotine acts through α7 nAChRs. a The absence of α7 nAChR was verified by mRNA and protein expression in the α7KO mice. b α7KO fibroblasts were exposed to nicotine for 24 h and PCR run for collagen type I mRNA expression. Nicotine failed to stimulate collagen type I mRNA expression in α7KO cells. c Nicotine-treated α7KO fibroblasts were subjected to Western blot analysis using anti-collagen type I antibody or GAPDH, followed by secondary goat anti-rabbit IgG (IRDye®). Protein bands were separated by native (collagen type 1) or SDS-PAGE (GAPDH) gel electrophoresis (8%) and quantified by densitometry. Nicotine did not stimulate increased collagen deposition in α7KO fibroblasts. Experiments were repeated at least 3 times. Significance was assessed using p values
    Figure Legend Snippet: Nicotine acts through α7 nAChRs. a The absence of α7 nAChR was verified by mRNA and protein expression in the α7KO mice. b α7KO fibroblasts were exposed to nicotine for 24 h and PCR run for collagen type I mRNA expression. Nicotine failed to stimulate collagen type I mRNA expression in α7KO cells. c Nicotine-treated α7KO fibroblasts were subjected to Western blot analysis using anti-collagen type I antibody or GAPDH, followed by secondary goat anti-rabbit IgG (IRDye®). Protein bands were separated by native (collagen type 1) or SDS-PAGE (GAPDH) gel electrophoresis (8%) and quantified by densitometry. Nicotine did not stimulate increased collagen deposition in α7KO fibroblasts. Experiments were repeated at least 3 times. Significance was assessed using p values

    Techniques Used: Expressing, Mouse Assay, Polymerase Chain Reaction, Western Blot, SDS Page, Nucleic Acid Electrophoresis

    Nicotine Stimulates Collagen Type I mRNA and Protein Expression. a Primary lung fibroblasts (1 × 10 6 cells/6 well) were treated with nicotine (1–75 μg/ml) for 24 h. Real-time PCR reactions were performed using mouse collagen type I or 18S primers. Note that nicotine induced a dose-dependent increase in collagen type I mRNA expression. mRNA levels were normalized to 18S and collagen type I levels compared to untreated controls. b Nicotine-treated fibroblasts were subjected to Western blot analysis using anti-collagen type I antibody or GAPDH, followed by secondary goat anti-rabbit IgG (IRDye®). Protein bands were separated by native (collagen type 1) or SDS-PAGE (GAPDH) gel electrophoresis (8%) and quantified by densitometry. Collagen type I levels were elevated in the presence of nicotine (50 μg/ml). c Primary lung fibroblasts were treated with nicotine (50 μg/ml) for up to 72 h. Nicotine induced a significant increase in collagen type I mRNA levels at 48 h. d Fibroblasts were treated with nicotine (50 μg/ml) for up to 72 h. Protein bands were separated by SDS-PAGE gel electrophoresis (8%) and quantified by densitometry. Collagen type I protein was increased at 48 and 72 h by Western blot analysis. e Purified rat-tail collagen c was run with 72-h protein samples for antibody validation. Quantification of 1E included in 1D. All experiments repeated at least 3 times. Significance was assessed using p values
    Figure Legend Snippet: Nicotine Stimulates Collagen Type I mRNA and Protein Expression. a Primary lung fibroblasts (1 × 10 6 cells/6 well) were treated with nicotine (1–75 μg/ml) for 24 h. Real-time PCR reactions were performed using mouse collagen type I or 18S primers. Note that nicotine induced a dose-dependent increase in collagen type I mRNA expression. mRNA levels were normalized to 18S and collagen type I levels compared to untreated controls. b Nicotine-treated fibroblasts were subjected to Western blot analysis using anti-collagen type I antibody or GAPDH, followed by secondary goat anti-rabbit IgG (IRDye®). Protein bands were separated by native (collagen type 1) or SDS-PAGE (GAPDH) gel electrophoresis (8%) and quantified by densitometry. Collagen type I levels were elevated in the presence of nicotine (50 μg/ml). c Primary lung fibroblasts were treated with nicotine (50 μg/ml) for up to 72 h. Nicotine induced a significant increase in collagen type I mRNA levels at 48 h. d Fibroblasts were treated with nicotine (50 μg/ml) for up to 72 h. Protein bands were separated by SDS-PAGE gel electrophoresis (8%) and quantified by densitometry. Collagen type I protein was increased at 48 and 72 h by Western blot analysis. e Purified rat-tail collagen c was run with 72-h protein samples for antibody validation. Quantification of 1E included in 1D. All experiments repeated at least 3 times. Significance was assessed using p values

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Western Blot, SDS Page, Nucleic Acid Electrophoresis, Purification

    Matrices Derived from Nicotine-treated Fibroblasts and Mice Stimulate IL-1β Expression in Monocytic Cells. a Lung fibroblasts (5x10 4 cells/12 well) were treated with nicotine (50 μg/ml) for 120 h. Fibroblasts were removed by osmotic lysis, the plates were washed thoroughly, and human monocytic U937 cells expressing the human interleukin-1β gene promoter connected to a luciferase reporter gene were overlaid atop the fibroblast-derived matrix. Afterwards, expression of the IL-1β promoter was analyzed by luciferase assay. We found that collagen-containing matrices derived from nicotine-treated fibroblasts stimulated monocytic cells to express the pro-inflammatory cytokine IL-1β. Furthermore, nicotine-treated fibroblast matrix induction of IL-1β was inhibited by anti-α2β1 integrin antibodies. b IL-1β gene transcription was not increased in U937 cells cultured on matrices derived from nicotine-treated α7 nAChR deficient primary lung fibroblast matrix over control. c Fibroblasts pretreated with MG 624, an α7 nAChR antagonist (10 μM), concurrently with nicotine inhibited IL-1β expression without affecting baseline expression. d The nicotine-treated fibroblast matrix IL-1β induction was inhibited by MEK-1 inhibitor PD98059 (50 μM), with PD98059 alone bringing IL-1β expression below baseline. e The lungs of mice exposed to nicotine (100 μg/ml in the drinking water for 8 weeks) were isolated for RNA analysis, which showed an increase in IL-1β gene transcription by RT-PCR. f Lungs from control and nicotine-treated mice were stained by immunohistochemistry for IL-1β. Increased staining was present in mice treated with nicotine. Experiments were repeated at least 3 times. Significance was assessed using p values
    Figure Legend Snippet: Matrices Derived from Nicotine-treated Fibroblasts and Mice Stimulate IL-1β Expression in Monocytic Cells. a Lung fibroblasts (5x10 4 cells/12 well) were treated with nicotine (50 μg/ml) for 120 h. Fibroblasts were removed by osmotic lysis, the plates were washed thoroughly, and human monocytic U937 cells expressing the human interleukin-1β gene promoter connected to a luciferase reporter gene were overlaid atop the fibroblast-derived matrix. Afterwards, expression of the IL-1β promoter was analyzed by luciferase assay. We found that collagen-containing matrices derived from nicotine-treated fibroblasts stimulated monocytic cells to express the pro-inflammatory cytokine IL-1β. Furthermore, nicotine-treated fibroblast matrix induction of IL-1β was inhibited by anti-α2β1 integrin antibodies. b IL-1β gene transcription was not increased in U937 cells cultured on matrices derived from nicotine-treated α7 nAChR deficient primary lung fibroblast matrix over control. c Fibroblasts pretreated with MG 624, an α7 nAChR antagonist (10 μM), concurrently with nicotine inhibited IL-1β expression without affecting baseline expression. d The nicotine-treated fibroblast matrix IL-1β induction was inhibited by MEK-1 inhibitor PD98059 (50 μM), with PD98059 alone bringing IL-1β expression below baseline. e The lungs of mice exposed to nicotine (100 μg/ml in the drinking water for 8 weeks) were isolated for RNA analysis, which showed an increase in IL-1β gene transcription by RT-PCR. f Lungs from control and nicotine-treated mice were stained by immunohistochemistry for IL-1β. Increased staining was present in mice treated with nicotine. Experiments were repeated at least 3 times. Significance was assessed using p values

    Techniques Used: Derivative Assay, Mouse Assay, Expressing, Lysis, Luciferase, Cell Culture, Isolation, Reverse Transcription Polymerase Chain Reaction, Staining, Immunohistochemistry

    14) Product Images from "Cytokine expression in the visceral adipose tissue after laparoscopic and conventional surgery in a rodent model"

    Article Title: Cytokine expression in the visceral adipose tissue after laparoscopic and conventional surgery in a rodent model

    Journal: European Journal of Medical Research

    doi: 10.1186/s40001-016-0199-8

    Resistin expression. Pre- and postoperative resistin expression in VAT with no significant changes in any group
    Figure Legend Snippet: Resistin expression. Pre- and postoperative resistin expression in VAT with no significant changes in any group

    Techniques Used: Expressing

    15) Product Images from "Spinophilin expression determines cellular growth, cancer stemness and 5-flourouracil resistance in colorectal cancer"

    Article Title: Spinophilin expression determines cellular growth, cancer stemness and 5-flourouracil resistance in colorectal cancer

    Journal: Oncotarget

    doi:

    Dose-response curves and IC50 values for 5-flourouracil treated Caco2 cells (A) The shRNA spinophilin silenced cells show a higher IC50 value compared to (B) the shRNA scrambled control cells.
    Figure Legend Snippet: Dose-response curves and IC50 values for 5-flourouracil treated Caco2 cells (A) The shRNA spinophilin silenced cells show a higher IC50 value compared to (B) the shRNA scrambled control cells.

    Techniques Used: shRNA

    Cellular growth, anchorage-independent growth and molecular alterations (A) In the xCELLigence system, increase in the cellular growth is observed in HCT116 shRNA spinophilin (red, upper line) compared to HCT116 shRNA scrambled control (green, lower line) cells (B) Colony numbers in soft agar plates are significantly increased in the spinophilin-silenced HCT116 cells. Numbers below the bars are representing three independent experiments. (C) In the spinophilin-silenced cells increased amount of E2F-1 was detected in Western blot analysis.
    Figure Legend Snippet: Cellular growth, anchorage-independent growth and molecular alterations (A) In the xCELLigence system, increase in the cellular growth is observed in HCT116 shRNA spinophilin (red, upper line) compared to HCT116 shRNA scrambled control (green, lower line) cells (B) Colony numbers in soft agar plates are significantly increased in the spinophilin-silenced HCT116 cells. Numbers below the bars are representing three independent experiments. (C) In the spinophilin-silenced cells increased amount of E2F-1 was detected in Western blot analysis.

    Techniques Used: shRNA, Western Blot

    Cellular growth and tumor sphere formation (A) A significant increase in cellular growth of spinophilin-silenced cells (green line) could also be detected in the Caco-2 cell line and (B) increased E2F-1 protein expression. (C-D) A significant increase in primary and secondary tumor spheres under low attachment conditions, which is indicative for increased self-renewal capacity, could be observed in the spinophilin-silenced cells.
    Figure Legend Snippet: Cellular growth and tumor sphere formation (A) A significant increase in cellular growth of spinophilin-silenced cells (green line) could also be detected in the Caco-2 cell line and (B) increased E2F-1 protein expression. (C-D) A significant increase in primary and secondary tumor spheres under low attachment conditions, which is indicative for increased self-renewal capacity, could be observed in the spinophilin-silenced cells.

    Techniques Used: Expressing

    Representative scatter dot-plot images of flow cytometry for CD133 positive total population, side population and CD133 positive side population (A-C) Caco2 shRNA scrambled control cells: (A) Hoechst side population staining: 1.6 % of total population (B) CD133-APC staining gated on side population: 1.4% of total population (C) CD133 gated on total population: 11.8% total population (D-F) Caco2 shRNA spinophilin cells: (D) Hoechst side population staining: 4.1 % of total population (E) CD133-APC staining gated on side population: 3.7% of total population (F) CD133 gated on total population: 21.8% total population.
    Figure Legend Snippet: Representative scatter dot-plot images of flow cytometry for CD133 positive total population, side population and CD133 positive side population (A-C) Caco2 shRNA scrambled control cells: (A) Hoechst side population staining: 1.6 % of total population (B) CD133-APC staining gated on side population: 1.4% of total population (C) CD133 gated on total population: 11.8% total population (D-F) Caco2 shRNA spinophilin cells: (D) Hoechst side population staining: 4.1 % of total population (E) CD133-APC staining gated on side population: 3.7% of total population (F) CD133 gated on total population: 21.8% total population.

    Techniques Used: Flow Cytometry, Cytometry, shRNA, Staining

    Spinophilin expression after de-methylation with 5-aza-dC Four different cell lines, (A) HCT-116, (B) RKO, (C) Colo320 and (D) Colo201 cells showed an increase in spinophilin expression after 96 hours of treatment with 5-aza-dC or even enhanced by the histon-deacetylase inhibitor trichostatin A. Treatment with the histon-deacetylase inhibitor trichostatin A alone had no effect on spinophilin expression.
    Figure Legend Snippet: Spinophilin expression after de-methylation with 5-aza-dC Four different cell lines, (A) HCT-116, (B) RKO, (C) Colo320 and (D) Colo201 cells showed an increase in spinophilin expression after 96 hours of treatment with 5-aza-dC or even enhanced by the histon-deacetylase inhibitor trichostatin A. Treatment with the histon-deacetylase inhibitor trichostatin A alone had no effect on spinophilin expression.

    Techniques Used: Expressing, Methylation, Histone Deacetylase Assay

    Spinophilin expression and influence on survival and cellular growth (A) In 162 available patients of The Cancer Genome Atlas data set, a low spinophilin expression is associated with poor survival. (B) Silencing of spinophilin by shRNA in HCT116 cells leads to increased cellular growth rate in the WST-1 assay (0 to 72 hours, p
    Figure Legend Snippet: Spinophilin expression and influence on survival and cellular growth (A) In 162 available patients of The Cancer Genome Atlas data set, a low spinophilin expression is associated with poor survival. (B) Silencing of spinophilin by shRNA in HCT116 cells leads to increased cellular growth rate in the WST-1 assay (0 to 72 hours, p

    Techniques Used: Expressing, shRNA, WST-1 Assay

    16) Product Images from "Proteasome-Mediated Degradation and Functions of Hematopoietic Progenitor Kinase 1 in Pancreatic Cancer"

    Article Title: Proteasome-Mediated Degradation and Functions of Hematopoietic Progenitor Kinase 1 in Pancreatic Cancer

    Journal: Cancer research

    doi: 10.1158/0008-5472.CAN-08-1751

    Wild-type HPK1 protein expression and activation inhibits pancreatic cancer cell proliferation. A and B , Panc-1 parental, vector control, c1, c2, and m1 cells were plated at an equal density and cultured under normal conditions without MG132 treatment
    Figure Legend Snippet: Wild-type HPK1 protein expression and activation inhibits pancreatic cancer cell proliferation. A and B , Panc-1 parental, vector control, c1, c2, and m1 cells were plated at an equal density and cultured under normal conditions without MG132 treatment

    Techniques Used: Expressing, Activation Assay, Plasmid Preparation, Cell Culture

    HPK1 expression in HPDE cells and human PDA cell lines. A , 150 µg of cell lysate from each cell line were resolved by 10% SDS-PAGE and immunoblotted with an anti-HPK1 antibody or anti-actin as loading control. B , RT-PCR results showing HPK1 mRNA
    Figure Legend Snippet: HPK1 expression in HPDE cells and human PDA cell lines. A , 150 µg of cell lysate from each cell line were resolved by 10% SDS-PAGE and immunoblotted with an anti-HPK1 antibody or anti-actin as loading control. B , RT-PCR results showing HPK1 mRNA

    Techniques Used: Expressing, SDS Page, Reverse Transcription Polymerase Chain Reaction

    HPK1 proteins were targeted by proteasome-mediated degradation in PDA cell lines. A , Western blots showing that MG132 treatment enhanced HPK1 protein expression in a dose-dependent manner in Panc-1 cells.Panc-1 cells were treated with 2.0 to 20.0 µmol/L
    Figure Legend Snippet: HPK1 proteins were targeted by proteasome-mediated degradation in PDA cell lines. A , Western blots showing that MG132 treatment enhanced HPK1 protein expression in a dose-dependent manner in Panc-1 cells.Panc-1 cells were treated with 2.0 to 20.0 µmol/L

    Techniques Used: Western Blot, Expressing

    HPK1 kinase activity is required for its proteasome-mediated degradation. A , after MG132 treatment, HPK1 kinase activity was present only in wild-type HPK1/Panc-1 stable clones ( c1 ), not in kinase-dead mutant HPK1/ Panc-1 stable clones ( m1 ) or in parental
    Figure Legend Snippet: HPK1 kinase activity is required for its proteasome-mediated degradation. A , after MG132 treatment, HPK1 kinase activity was present only in wild-type HPK1/Panc-1 stable clones ( c1 ), not in kinase-dead mutant HPK1/ Panc-1 stable clones ( m1 ) or in parental

    Techniques Used: Activity Assay, Clone Assay, Mutagenesis

    HPK1-mediated cell cycle arrest was associated with p21 and p27 protein stabilization in Panc-1 ( A ) and Panc-28 cells ( B ).Cells were either untreated or treated with 0.5 µmol/L MG132 for 48 h; cell extracts were subjected to immunoblotting for
    Figure Legend Snippet: HPK1-mediated cell cycle arrest was associated with p21 and p27 protein stabilization in Panc-1 ( A ) and Panc-28 cells ( B ).Cells were either untreated or treated with 0.5 µmol/L MG132 for 48 h; cell extracts were subjected to immunoblotting for

    Techniques Used:

    Representative micrographs showing HPK1 expression in benign pancreatic tissue, invasive PDA, and PanIN lesions of different grades. A , benign pancreatic ducts that were strongly positive for HPK1, but no staining present in pancreatic acinar cells.
    Figure Legend Snippet: Representative micrographs showing HPK1 expression in benign pancreatic tissue, invasive PDA, and PanIN lesions of different grades. A , benign pancreatic ducts that were strongly positive for HPK1, but no staining present in pancreatic acinar cells.

    Techniques Used: Expressing, Staining

    17) Product Images from "Aberrant Methylation of APAF-1 Gene in Acute Myeloid Leukemia Patients"

    Article Title: Aberrant Methylation of APAF-1 Gene in Acute Myeloid Leukemia Patients

    Journal: International Journal of Hematology-Oncology and Stem Cell Research

    doi:

    Agarose gel electrophoresis pattern of MSP products of the APAF-1 gene in controls and four AML Patients. NC= nonmethylated control, MC= methylated control , P= Patient. Patient 1 shows APAF-1 hemimethylated (MU) state, Patient 2 demonstrates methylated (MM) state, Patient 3 shows unmethylated (MU) state and Patient 4 indicate the hemimethylated (MU) state of APAF-1 gene.
    Figure Legend Snippet: Agarose gel electrophoresis pattern of MSP products of the APAF-1 gene in controls and four AML Patients. NC= nonmethylated control, MC= methylated control , P= Patient. Patient 1 shows APAF-1 hemimethylated (MU) state, Patient 2 demonstrates methylated (MM) state, Patient 3 shows unmethylated (MU) state and Patient 4 indicate the hemimethylated (MU) state of APAF-1 gene.

    Techniques Used: Agarose Gel Electrophoresis, Methylation

    18) Product Images from "A Novel Acylaminoimidazole Derivative, WN1316, Alleviates Disease Progression via Suppression of Glial Inflammation in ALS Mouse Model"

    Article Title: A Novel Acylaminoimidazole Derivative, WN1316, Alleviates Disease Progression via Suppression of Glial Inflammation in ALS Mouse Model

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0087728

    Nrf2 is essential for antioxidant and detoxifying enzyme gene induction by WN1316. (A–B) Effect of the expression of mRNAs and proteins, including Nrf2, ATF3, HO-1, NQO1, GCLM, p62 and p21, in WN1316-treated cells. Differentiated SH-SY5Y cells were treated with 10 µM WN1316 or DMSO for the indicated times. Total RNA and cell extracts from WN1316-treated SH-SY5Y cells were used for RT-PCR (A) and Western blot analysis (B), respectively. Peptidylprolyl isomerase A (PPIA) was used as a control for RT-PCR. β-tubulin was used as a loading control for protein. (C) Western blot analysis of proteins shown in A in a WN1316 dose-dependent manner. SH-SY5Y cells were incubated with 1 to 50 µM WN1316 for 8 h. Equal amount of protein from cell lysates were analyzed by using antibodies as indicated. β-tubulin was used as a loading control for protein. (D) Quantitative RT-PCR analysis of HO-1 mRNA from the lumbar spinal cord of wild type mice administered with WN1316 (100 µg/kg) (n = 3) or vehicle (physiological saline) (n = 3). Relative mRNA expression was acquired by normalizing HO-1 mRNA to PPIA mRNA. Data are expressed as mean ± SEM. (E–F) SH-SY5Y cells were transfected with 5 nM nonsilencing siRNA (siNC), or Nrf2 siRNA (siNrf2). At 48 h after transfection, cells were treated with 6 µM WN1316 for 8 h. The expression of Nrf2, HO-1, NQO1, and GCLM was analyzed by Western blotting (E). The cell viability after the exposure to 60 µM menadione for 4 h was measured by AlamarBlue and normalized to untreated control (F). Data are expressed as mean ± SD (n = 4). * p
    Figure Legend Snippet: Nrf2 is essential for antioxidant and detoxifying enzyme gene induction by WN1316. (A–B) Effect of the expression of mRNAs and proteins, including Nrf2, ATF3, HO-1, NQO1, GCLM, p62 and p21, in WN1316-treated cells. Differentiated SH-SY5Y cells were treated with 10 µM WN1316 or DMSO for the indicated times. Total RNA and cell extracts from WN1316-treated SH-SY5Y cells were used for RT-PCR (A) and Western blot analysis (B), respectively. Peptidylprolyl isomerase A (PPIA) was used as a control for RT-PCR. β-tubulin was used as a loading control for protein. (C) Western blot analysis of proteins shown in A in a WN1316 dose-dependent manner. SH-SY5Y cells were incubated with 1 to 50 µM WN1316 for 8 h. Equal amount of protein from cell lysates were analyzed by using antibodies as indicated. β-tubulin was used as a loading control for protein. (D) Quantitative RT-PCR analysis of HO-1 mRNA from the lumbar spinal cord of wild type mice administered with WN1316 (100 µg/kg) (n = 3) or vehicle (physiological saline) (n = 3). Relative mRNA expression was acquired by normalizing HO-1 mRNA to PPIA mRNA. Data are expressed as mean ± SEM. (E–F) SH-SY5Y cells were transfected with 5 nM nonsilencing siRNA (siNC), or Nrf2 siRNA (siNrf2). At 48 h after transfection, cells were treated with 6 µM WN1316 for 8 h. The expression of Nrf2, HO-1, NQO1, and GCLM was analyzed by Western blotting (E). The cell viability after the exposure to 60 µM menadione for 4 h was measured by AlamarBlue and normalized to untreated control (F). Data are expressed as mean ± SD (n = 4). * p

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Western Blot, Incubation, Quantitative RT-PCR, Mouse Assay, Transfection

    19) Product Images from "Inhibition of MMP-9 expression by ritonavir or saquinavir is associated with inactivation of the AKT/Fra-1 pathway in cervical intraepithelial neoplasia cells"

    Article Title: Inhibition of MMP-9 expression by ritonavir or saquinavir is associated with inactivation of the AKT/Fra-1 pathway in cervical intraepithelial neoplasia cells

    Journal: Oncology Letters

    doi: 10.3892/ol.2017.5835

    SQV and RTV counteract EGF-induced cell invasion, MMP-9 expression, AKT phosphorylation and nuclear Fra-1 protein expression in W12 cells. W12 cells were cultured for 96 h in the presence of 10 µM SQV or RTV, or in their absence (control). (A) Cells were stimulated to invade a reconstituted basement membrane in response to 20 ng/ml human recombinant EGF, or to its suspension buffer (0.1% bovine serum albumin in phosphate-buffered saline, indicated here as EGF 0 ng/ml). Results are expressed as the mean ± standard deviation from 3 experiments, each performed in duplicate chambers. (B) Representative zymography of EGF-supplemented, serum-free supernatants. The de-stained areas indicate gelatinolytic activity corresponding to MMP-9 (92 kDa) released by the cells. (C) Reverse transcription-quantitative polymerase chain reaction analysis of MMP-9 messenger RNA levels (relative to GADPH) in cells cultured in EGF-supplemented growth medium, in the absence or presence of 10 µM SQV/RTV. Results are expressed as the mean ± standard deviation from 3 experiments. (D) Representative western blot analysis and quantification by densitometry of pAKT protein levels (relative to β-actin) in W12 cells lysed following a 30-min exposure to EGF. (E) Representative western blot analysis and quantification by densitometry of nuclear Fra-1 protein levels (relative to C23) in W12 cells lysed following a 6-h exposure to EGF. *P
    Figure Legend Snippet: SQV and RTV counteract EGF-induced cell invasion, MMP-9 expression, AKT phosphorylation and nuclear Fra-1 protein expression in W12 cells. W12 cells were cultured for 96 h in the presence of 10 µM SQV or RTV, or in their absence (control). (A) Cells were stimulated to invade a reconstituted basement membrane in response to 20 ng/ml human recombinant EGF, or to its suspension buffer (0.1% bovine serum albumin in phosphate-buffered saline, indicated here as EGF 0 ng/ml). Results are expressed as the mean ± standard deviation from 3 experiments, each performed in duplicate chambers. (B) Representative zymography of EGF-supplemented, serum-free supernatants. The de-stained areas indicate gelatinolytic activity corresponding to MMP-9 (92 kDa) released by the cells. (C) Reverse transcription-quantitative polymerase chain reaction analysis of MMP-9 messenger RNA levels (relative to GADPH) in cells cultured in EGF-supplemented growth medium, in the absence or presence of 10 µM SQV/RTV. Results are expressed as the mean ± standard deviation from 3 experiments. (D) Representative western blot analysis and quantification by densitometry of pAKT protein levels (relative to β-actin) in W12 cells lysed following a 30-min exposure to EGF. (E) Representative western blot analysis and quantification by densitometry of nuclear Fra-1 protein levels (relative to C23) in W12 cells lysed following a 6-h exposure to EGF. *P

    Techniques Used: Expressing, Cell Culture, Recombinant, Standard Deviation, Zymography, Staining, Activity Assay, Real-time Polymerase Chain Reaction, Western Blot

    20) Product Images from "Reversibility of neuropathology in Tay–Sachs-related diseases"

    Article Title: Reversibility of neuropathology in Tay–Sachs-related diseases

    Journal: Human Molecular Genetics

    doi: 10.1093/hmg/ddt459

    Gene transfer reduces the number of activated microglia. IHC staining against Cd68 of brain and spinal cord from treated SD at 4w ( G – I ) and 12w ( D – F ) mice was compared with SD (UT) ( A–C and M ) and normal controls ( J–L and
    Figure Legend Snippet: Gene transfer reduces the number of activated microglia. IHC staining against Cd68 of brain and spinal cord from treated SD at 4w ( G – I ) and 12w ( D – F ) mice was compared with SD (UT) ( A–C and M ) and normal controls ( J–L and

    Techniques Used: Immunohistochemistry, Staining, Mouse Assay

    Spatial and temporal up-regulation of markers of inflammation in untreated Sandhoff and Krabbe (Twitcher) mouse models of disease by real-time PCR. Relative mRNA expression of Cd68 and Gfap , markers of activated microglia and astrocytes, respectively,
    Figure Legend Snippet: Spatial and temporal up-regulation of markers of inflammation in untreated Sandhoff and Krabbe (Twitcher) mouse models of disease by real-time PCR. Relative mRNA expression of Cd68 and Gfap , markers of activated microglia and astrocytes, respectively,

    Techniques Used: Real-time Polymerase Chain Reaction, Expressing

    21) Product Images from "SOX9 is a proliferation and stem cell factor in hepatocellular carcinoma and possess widespread prognostic significance in different cancer types"

    Article Title: SOX9 is a proliferation and stem cell factor in hepatocellular carcinoma and possess widespread prognostic significance in different cancer types

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0187814

    Prognostic significance of SOX9 across several cancer types. (A) 5-year relapse free survival rates in breast cancer patients. (B) 5-year progression free survival in ovarian cancer patients. 5-year survival rates in patients with (C) lung cancer and (D) gastric cancer.
    Figure Legend Snippet: Prognostic significance of SOX9 across several cancer types. (A) 5-year relapse free survival rates in breast cancer patients. (B) 5-year progression free survival in ovarian cancer patients. 5-year survival rates in patients with (C) lung cancer and (D) gastric cancer.

    Techniques Used:

    Representative examples of tumour spheres in hepatocellular carcinoma (HepG2)(D) and breast cancer (MCF7)(A) (D) cells. SOX9 expression has been assessed by qRT-PCR in two liver cancer cell lines (HepG2 (B) and Hep3B (C)) and in three breast cancer cell lines (MCF7 (E), BT474 (F) and SUM159 (G)) comparing parental adherent or tumour spheres. In all five tested cell lines, SOX9 was significantly higher expressed in tumour spheres (between 1.6-fold and 57-fold increased) than in parental adherent cells. Expression levels of two cancer stem cell marker (Nanog (H) and Oct4 (I)) have been determined all five cancer cell lines in adherent cells and tumour spheres. Nanog and Oct4 were significantly up-regulated in tumour spheres in comparison to normal adherent tumour cells.
    Figure Legend Snippet: Representative examples of tumour spheres in hepatocellular carcinoma (HepG2)(D) and breast cancer (MCF7)(A) (D) cells. SOX9 expression has been assessed by qRT-PCR in two liver cancer cell lines (HepG2 (B) and Hep3B (C)) and in three breast cancer cell lines (MCF7 (E), BT474 (F) and SUM159 (G)) comparing parental adherent or tumour spheres. In all five tested cell lines, SOX9 was significantly higher expressed in tumour spheres (between 1.6-fold and 57-fold increased) than in parental adherent cells. Expression levels of two cancer stem cell marker (Nanog (H) and Oct4 (I)) have been determined all five cancer cell lines in adherent cells and tumour spheres. Nanog and Oct4 were significantly up-regulated in tumour spheres in comparison to normal adherent tumour cells.

    Techniques Used: Expressing, Quantitative RT-PCR, Marker

    Kaplan-Maier plot for SOX9 expression in HCC. A: Kaplan-Maier plot for 3-year survival in patients with HCC showing immunohistochemical positive SOX9 expression versus negative SOX9 expression (n = 84). B: Kaplan-Maier plots for 3-year survival calculated from a dataset derived from the Cancer Genome Atlas in patients with HCC showing high SOX9 expression versus low SOX9 expression.
    Figure Legend Snippet: Kaplan-Maier plot for SOX9 expression in HCC. A: Kaplan-Maier plot for 3-year survival in patients with HCC showing immunohistochemical positive SOX9 expression versus negative SOX9 expression (n = 84). B: Kaplan-Maier plots for 3-year survival calculated from a dataset derived from the Cancer Genome Atlas in patients with HCC showing high SOX9 expression versus low SOX9 expression.

    Techniques Used: Expressing, Immunohistochemistry, Derivative Assay

    (A) SOX9 knock-down was assessed by expression analysis of mRNA by qRT-PCR after siRNA treatment against SOX9. The dark grey bar shows a significant decrease in SOX9 expression in HepG2 cells. (b) HepG2 cells show reduced cellular growth after SOX9 knock-down after 96 hours follow-up.
    Figure Legend Snippet: (A) SOX9 knock-down was assessed by expression analysis of mRNA by qRT-PCR after siRNA treatment against SOX9. The dark grey bar shows a significant decrease in SOX9 expression in HepG2 cells. (b) HepG2 cells show reduced cellular growth after SOX9 knock-down after 96 hours follow-up.

    Techniques Used: Expressing, Quantitative RT-PCR

    Immunohistochemical expression of SOX9 in hepatocellular carcinomas. A and B : Hepatocellular carcinoma mostly negative for SOX9 expression. SOX9 positivity only in single cells (A, overview, 4x magnification). Pronounced SOX9 expression at the invasion front oft the tumor (B, detail, 20x magnification). C and D : Hepatocellular carcinoma with SOX9 positivity in 10–20% of tumor cells (C, overview, 4x magnification). D: Detail of HCC with trabecular pattern, positivity more pronounced at the external tumor cell plates (detail of HCC, 20x magnification). E and F : Hepatocelluar carcinoma with SOX9 expression in 5% of tumor cells (E, overview, 4x magnification). Beside SOX9 positive nuclei some cells with mitotic figures are highlighted. F: Detail of HCC with few positive nuclei and one mitotic figure in the upper left corner of the picture (40x magnification).
    Figure Legend Snippet: Immunohistochemical expression of SOX9 in hepatocellular carcinomas. A and B : Hepatocellular carcinoma mostly negative for SOX9 expression. SOX9 positivity only in single cells (A, overview, 4x magnification). Pronounced SOX9 expression at the invasion front oft the tumor (B, detail, 20x magnification). C and D : Hepatocellular carcinoma with SOX9 positivity in 10–20% of tumor cells (C, overview, 4x magnification). D: Detail of HCC with trabecular pattern, positivity more pronounced at the external tumor cell plates (detail of HCC, 20x magnification). E and F : Hepatocelluar carcinoma with SOX9 expression in 5% of tumor cells (E, overview, 4x magnification). Beside SOX9 positive nuclei some cells with mitotic figures are highlighted. F: Detail of HCC with few positive nuclei and one mitotic figure in the upper left corner of the picture (40x magnification).

    Techniques Used: Immunohistochemistry, Expressing

    22) Product Images from "Expression of Inducible Nitric Oxide Synthase (iNOS) in Microglia of the Developing Quail Retina"

    Article Title: Expression of Inducible Nitric Oxide Synthase (iNOS) in Microglia of the Developing Quail Retina

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0106048

    iNOS gene expression is upregulated in LPS-treated quail embryo retina explants cultured for 12 hrs in vitro (hiv). A , B . Confocal images of QH1 (green) and anti-iNOS (red) double immunostained microglial cells in non-treated control (CTRL, A ) and LPS-treated (LPS, B ) retina explants from quail embryos at 8 days of incubation cultured for 12 hiv (E8+12hiv). The iNOS labeling is higher in LPS-treated versus control explants. C . Western blot analysis results, representative of three independent experiments, for iNOS protein levels in non-treated control (CTRL) and LPS-treated (LPS) E8+12hiv retina explants. The 135 kDa band, which corresponds to the iNOS protein, is noticeably more intense in LPS-treated versus control explants. β-tubulin antibody was used as a loading control. D . Representative gel of three independent experiments on agarose gel electrophoresis of iNOS mRNA, showing a more intense band in LPS-treated explants (LPS) than in control explants (CTRL). iNOS amplification products are referred to the corresponding 18S rRNA bands. E . Quantitative analysis of iNOS mRNA expression by real-time PCR. The histogram represents changes in the iNOS mRNA levels of LPS-treated E8+12hiv retina explants with respect to non-treated explants (mean ± SEM) obtained from three real-time PCR experiments. iNOS mRNA levels are more than two-fold higher in LPS-treated explants than non-treated explants. Scale bar, 25 µm.
    Figure Legend Snippet: iNOS gene expression is upregulated in LPS-treated quail embryo retina explants cultured for 12 hrs in vitro (hiv). A , B . Confocal images of QH1 (green) and anti-iNOS (red) double immunostained microglial cells in non-treated control (CTRL, A ) and LPS-treated (LPS, B ) retina explants from quail embryos at 8 days of incubation cultured for 12 hiv (E8+12hiv). The iNOS labeling is higher in LPS-treated versus control explants. C . Western blot analysis results, representative of three independent experiments, for iNOS protein levels in non-treated control (CTRL) and LPS-treated (LPS) E8+12hiv retina explants. The 135 kDa band, which corresponds to the iNOS protein, is noticeably more intense in LPS-treated versus control explants. β-tubulin antibody was used as a loading control. D . Representative gel of three independent experiments on agarose gel electrophoresis of iNOS mRNA, showing a more intense band in LPS-treated explants (LPS) than in control explants (CTRL). iNOS amplification products are referred to the corresponding 18S rRNA bands. E . Quantitative analysis of iNOS mRNA expression by real-time PCR. The histogram represents changes in the iNOS mRNA levels of LPS-treated E8+12hiv retina explants with respect to non-treated explants (mean ± SEM) obtained from three real-time PCR experiments. iNOS mRNA levels are more than two-fold higher in LPS-treated explants than non-treated explants. Scale bar, 25 µm.

    Techniques Used: Expressing, Cell Culture, In Vitro, Incubation, Labeling, Western Blot, Agarose Gel Electrophoresis, Amplification, Real-time Polymerase Chain Reaction

    iNOS gene is expressed in the quail retina during embryonic and post-hatching development and adulthood. A . Representative gel from three independent experiments of agarose gel electrophoresis of iNOS mRNA by RT-PCR of cDNAs prepared from quail retinas of different embryonic (E8, E9, E14 and E16) and post-hatching (P4 and adulthood) ages. iNOS RT-PCR products at each age are referred to the corresponding 18S rRNA bands. Expression of the iNOS gene is observed in retinas at all tested ages (embryonic, postnatal and adulthood). B . Quantitative analysis of iNOS mRNA expression in quail retinas of different ages, as shown by RT-PCR of six RT-PCR experiments. The histogram represents changes in the iNOS mRNA levels (mean ± SEM) at the different ages with respect to E8. No significant differences are observed between the different ages (one-way ANOVA followed by Tukey test for multiple comparisons).
    Figure Legend Snippet: iNOS gene is expressed in the quail retina during embryonic and post-hatching development and adulthood. A . Representative gel from three independent experiments of agarose gel electrophoresis of iNOS mRNA by RT-PCR of cDNAs prepared from quail retinas of different embryonic (E8, E9, E14 and E16) and post-hatching (P4 and adulthood) ages. iNOS RT-PCR products at each age are referred to the corresponding 18S rRNA bands. Expression of the iNOS gene is observed in retinas at all tested ages (embryonic, postnatal and adulthood). B . Quantitative analysis of iNOS mRNA expression in quail retinas of different ages, as shown by RT-PCR of six RT-PCR experiments. The histogram represents changes in the iNOS mRNA levels (mean ± SEM) at the different ages with respect to E8. No significant differences are observed between the different ages (one-way ANOVA followed by Tukey test for multiple comparisons).

    Techniques Used: Agarose Gel Electrophoresis, Reverse Transcription Polymerase Chain Reaction, Expressing

    23) Product Images from "Telomere dysfunction promotes transdifferentiation of human fibroblasts into myofibroblasts. Telomere dysfunction promotes transdifferentiation of human fibroblasts into myofibroblasts"

    Article Title: Telomere dysfunction promotes transdifferentiation of human fibroblasts into myofibroblasts. Telomere dysfunction promotes transdifferentiation of human fibroblasts into myofibroblasts

    Journal: Aging Cell

    doi: 10.1111/acel.12838

    Telomere dysfunction causes myofibroblast transdifferentiation in a p53‐dependent manner. (a) ChIP‐qPCR analysis of p53 binding to a control distal promoter element (distal), to the αSMA promoter element (αSMA), or the p21 promoter element (p21) of normal BJ fibroblasts that were either control treated (C), treated with TGF‐β1 (10 ng/ml) for 48 hr, or transduced with shRNA targeting TRF2. Error bars: ± SD . * p
    Figure Legend Snippet: Telomere dysfunction causes myofibroblast transdifferentiation in a p53‐dependent manner. (a) ChIP‐qPCR analysis of p53 binding to a control distal promoter element (distal), to the αSMA promoter element (αSMA), or the p21 promoter element (p21) of normal BJ fibroblasts that were either control treated (C), treated with TGF‐β1 (10 ng/ml) for 48 hr, or transduced with shRNA targeting TRF2. Error bars: ± SD . * p

    Techniques Used: Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Binding Assay, Transduction, shRNA

    24) Product Images from "Tumor Suppressor PDCD4 Represses Internal Ribosome Entry Site-Mediated Translation of Antiapoptotic Proteins and Is Regulated by S6 Kinase 2"

    Article Title: Tumor Suppressor PDCD4 Represses Internal Ribosome Entry Site-Mediated Translation of Antiapoptotic Proteins and Is Regulated by S6 Kinase 2

    Journal: Molecular and Cellular Biology

    doi: 10.1128/MCB.06317-11

    Activation of S6K2 leads to PDCD4 degradation, with a concomitant increase in XIAP and Bcl-x L protein levels. (A) TOKAS6K2-stable or control cells (transiently transfected with an inducible pTripz-Kate plasmid) were treated with doxycycline (Dox) (1 μg/ml)
    Figure Legend Snippet: Activation of S6K2 leads to PDCD4 degradation, with a concomitant increase in XIAP and Bcl-x L protein levels. (A) TOKAS6K2-stable or control cells (transiently transfected with an inducible pTripz-Kate plasmid) were treated with doxycycline (Dox) (1 μg/ml)

    Techniques Used: Activation Assay, Transfection, Plasmid Preparation

    Loss of PDCD4 correlates with an increase in XIAP and Bcl-x L translation through their respective IRES elements. (A) HEK293T cells were treated with PDCD4 siRNA or control (CTRL), nontargeting siRNA. Cell lysates were harvested and subjected to Western
    Figure Legend Snippet: Loss of PDCD4 correlates with an increase in XIAP and Bcl-x L translation through their respective IRES elements. (A) HEK293T cells were treated with PDCD4 siRNA or control (CTRL), nontargeting siRNA. Cell lysates were harvested and subjected to Western

    Techniques Used: Western Blot

    PDCD4 specifically binds to XIAP and Bcl-x L IRES RNA both in vitro and in vivo . (A) Recombinant His-PDCD4 was incubated in the presence of 32 P-labeled, in vitro -transcribed RNA and subjected to UV cross-linking. RNA-protein complexes were separated by
    Figure Legend Snippet: PDCD4 specifically binds to XIAP and Bcl-x L IRES RNA both in vitro and in vivo . (A) Recombinant His-PDCD4 was incubated in the presence of 32 P-labeled, in vitro -transcribed RNA and subjected to UV cross-linking. RNA-protein complexes were separated by

    Techniques Used: In Vitro, In Vivo, Recombinant, Incubation, Labeling

    25) Product Images from "Human Papillomavirus E7 Oncoprotein Increases Production of the Anti-Inflammatory Interleukin-18 Binding Protein in Keratinocytes"

    Article Title: Human Papillomavirus E7 Oncoprotein Increases Production of the Anti-Inflammatory Interleukin-18 Binding Protein in Keratinocytes

    Journal: Journal of Virology

    doi: 10.1128/JVI.02546-13

    E7-dependent IL-18BP transcription is mediated by a proximal GAS element in the IL-18BP promoter. (A) Primary human foreskin keratinocytes stably expressing empty plasmid (pBabe) or 16E7 were treated with IFN-γ (10 ng/ml). RNA was extracted over
    Figure Legend Snippet: E7-dependent IL-18BP transcription is mediated by a proximal GAS element in the IL-18BP promoter. (A) Primary human foreskin keratinocytes stably expressing empty plasmid (pBabe) or 16E7 were treated with IFN-γ (10 ng/ml). RNA was extracted over

    Techniques Used: Stable Transfection, Expressing, Plasmid Preparation

    E7 proteins augment IL-18BP expression in primary keratinocytes. (A) Primary human foreskin keratinocytes stably expressing vector alone (pBabe-Puro), HPV16 E7, HPV16 E6, or HPV16 E6sE7 were treated with IFN-γ (10 ng/ml) for 16 h. Following treatment,
    Figure Legend Snippet: E7 proteins augment IL-18BP expression in primary keratinocytes. (A) Primary human foreskin keratinocytes stably expressing vector alone (pBabe-Puro), HPV16 E7, HPV16 E6, or HPV16 E6sE7 were treated with IFN-γ (10 ng/ml) for 16 h. Following treatment,

    Techniques Used: Expressing, Stable Transfection, Plasmid Preparation

    Effect of increased IL-18BP expression on IL-18-induced IFN-γ production in primary human CD4 lymphocytes. Primary human foreskin keratinocytes stably expressing empty plasmid (pBabe), HPV16 E7, or HPV16 Δ2 E7 were treated with IFN-γ
    Figure Legend Snippet: Effect of increased IL-18BP expression on IL-18-induced IFN-γ production in primary human CD4 lymphocytes. Primary human foreskin keratinocytes stably expressing empty plasmid (pBabe), HPV16 E7, or HPV16 Δ2 E7 were treated with IFN-γ

    Techniques Used: Expressing, Stable Transfection, Plasmid Preparation

    Enhanced IL-18BP expression requires amino acids in the carboxyl terminus of E7. (A) Schematic of E7 and the mutations used in this study. Functional regions of E7 are highlighted. Substitutions are shown, and small deletions are indicated by “Δ”.
    Figure Legend Snippet: Enhanced IL-18BP expression requires amino acids in the carboxyl terminus of E7. (A) Schematic of E7 and the mutations used in this study. Functional regions of E7 are highlighted. Substitutions are shown, and small deletions are indicated by “Δ”.

    Techniques Used: Expressing, Functional Assay

    26) Product Images from "UVB Stimulates the Expression of Endothelin B Receptor in Human Melanocytes via a Sequential Activation of the p38/MSK1/CREB/MITF Pathway Which Can Be Interrupted by a French Maritime Pine Bark Extract through a Direct Inactivation of MSK1"

    Article Title: UVB Stimulates the Expression of Endothelin B Receptor in Human Melanocytes via a Sequential Activation of the p38/MSK1/CREB/MITF Pathway Which Can Be Interrupted by a French Maritime Pine Bark Extract through a Direct Inactivation of MSK1

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0128678

    Effect of H89 on the gene expression of MITF and EDNRB in NHMs exposed to UVB. The indicated concentration of H89 was added into the medium immediately after UVB irradiation and cells were cultured for 6h (for MITF, A) or 24 h (for EDNRB, B). Total mRNAs were purified and Real-time RT-PCR was carried out with MITF or EDNRB primer and β-actin primer as the internal control. Error bars represent S.D. from triplicate experiments. *P
    Figure Legend Snippet: Effect of H89 on the gene expression of MITF and EDNRB in NHMs exposed to UVB. The indicated concentration of H89 was added into the medium immediately after UVB irradiation and cells were cultured for 6h (for MITF, A) or 24 h (for EDNRB, B). Total mRNAs were purified and Real-time RT-PCR was carried out with MITF or EDNRB primer and β-actin primer as the internal control. Error bars represent S.D. from triplicate experiments. *P

    Techniques Used: Expressing, Concentration Assay, Irradiation, Cell Culture, Purification, Quantitative RT-PCR

    27) Product Images from "UVB Stimulates the Expression of Endothelin B Receptor in Human Melanocytes via a Sequential Activation of the p38/MSK1/CREB/MITF Pathway Which Can Be Interrupted by a French Maritime Pine Bark Extract through a Direct Inactivation of MSK1"

    Article Title: UVB Stimulates the Expression of Endothelin B Receptor in Human Melanocytes via a Sequential Activation of the p38/MSK1/CREB/MITF Pathway Which Can Be Interrupted by a French Maritime Pine Bark Extract through a Direct Inactivation of MSK1

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0128678

    Effect of treatment with UVB and/or PBE on MITF expression. (A) Time course of MITF mRNA expression in NHMs treated without UVB in the absence of PBE, without UVB in the presence of 30 μg/ml PBE, with 60 mJ/cm 2 UVB in the absence of PBE, or with 60 mJ/cm 2 UVB in the presence of 30 μg/ml PBE and cultured for the indicated periods. (B) Dose dependency of PBE for MITF mRNA expression in NHMs at 6 h after treatment with or without 60 mJ/cm 2 UVB in the presence of the indicated concentration of PBE. (C) Western blotting analysis for MITF at 12 h after treatment with or without 60 mJ/cm 2 UVB and 30 μg/ml PBE. Expression levels were detected by specific primers and antibodies for MITF and β-actin as the internal control. Error bars represent S.D. from triplicate experiments. *P
    Figure Legend Snippet: Effect of treatment with UVB and/or PBE on MITF expression. (A) Time course of MITF mRNA expression in NHMs treated without UVB in the absence of PBE, without UVB in the presence of 30 μg/ml PBE, with 60 mJ/cm 2 UVB in the absence of PBE, or with 60 mJ/cm 2 UVB in the presence of 30 μg/ml PBE and cultured for the indicated periods. (B) Dose dependency of PBE for MITF mRNA expression in NHMs at 6 h after treatment with or without 60 mJ/cm 2 UVB in the presence of the indicated concentration of PBE. (C) Western blotting analysis for MITF at 12 h after treatment with or without 60 mJ/cm 2 UVB and 30 μg/ml PBE. Expression levels were detected by specific primers and antibodies for MITF and β-actin as the internal control. Error bars represent S.D. from triplicate experiments. *P

    Techniques Used: Expressing, Cell Culture, Concentration Assay, Western Blot

    Effect of H89 on the gene expression of MITF and EDNRB in NHMs exposed to UVB. The indicated concentration of H89 was added into the medium immediately after UVB irradiation and cells were cultured for 6h (for MITF, A) or 24 h (for EDNRB, B). Total mRNAs were purified and Real-time RT-PCR was carried out with MITF or EDNRB primer and β-actin primer as the internal control. Error bars represent S.D. from triplicate experiments. *P
    Figure Legend Snippet: Effect of H89 on the gene expression of MITF and EDNRB in NHMs exposed to UVB. The indicated concentration of H89 was added into the medium immediately after UVB irradiation and cells were cultured for 6h (for MITF, A) or 24 h (for EDNRB, B). Total mRNAs were purified and Real-time RT-PCR was carried out with MITF or EDNRB primer and β-actin primer as the internal control. Error bars represent S.D. from triplicate experiments. *P

    Techniques Used: Expressing, Concentration Assay, Irradiation, Cell Culture, Purification, Quantitative RT-PCR

    Effect of treatment with UVB and/or PBE on EDNRB expression. (A) Time course of EDNRB mRNA expression in NHMs treated without UVB in the absence of PBE, without UVB in the presence of 30 μg/ml PBE, with 60 mJ/cm 2 UVB in the absence of PBE, or with 60 mJ/cm 2 UVB in the presence of 30 μg/ml PBE and cultured for the indicated periods. (B) Dose dependency of PBE for EDNRB mRNA expression in NHMs at 24 h after treatment with or without 60 mJ/cm 2 UVB in the presence of the indicated concentration of PBE. (C) Western blotting analysis for EDNRB at 24 h after treatment with or without 60 mJ/cm 2 UVB and 30 μg/ml PBE. Protein levels were detected by specific primers and antibodies for EDNRB and β-actin as the internal control. Only the bands with 50 kDa were subjected to densitometic analysis. Error bars represent S.D. from triplicate experiments. *P
    Figure Legend Snippet: Effect of treatment with UVB and/or PBE on EDNRB expression. (A) Time course of EDNRB mRNA expression in NHMs treated without UVB in the absence of PBE, without UVB in the presence of 30 μg/ml PBE, with 60 mJ/cm 2 UVB in the absence of PBE, or with 60 mJ/cm 2 UVB in the presence of 30 μg/ml PBE and cultured for the indicated periods. (B) Dose dependency of PBE for EDNRB mRNA expression in NHMs at 24 h after treatment with or without 60 mJ/cm 2 UVB in the presence of the indicated concentration of PBE. (C) Western blotting analysis for EDNRB at 24 h after treatment with or without 60 mJ/cm 2 UVB and 30 μg/ml PBE. Protein levels were detected by specific primers and antibodies for EDNRB and β-actin as the internal control. Only the bands with 50 kDa were subjected to densitometic analysis. Error bars represent S.D. from triplicate experiments. *P

    Techniques Used: Expressing, Cell Culture, Concentration Assay, Western Blot

    28) Product Images from "Nucleotide Composition of Cellular Internal Ribosome Entry Sites Defines Dependence on NF45 and Predicts a Posttranscriptional Mitotic Regulon"

    Article Title: Nucleotide Composition of Cellular Internal Ribosome Entry Sites Defines Dependence on NF45 and Predicts a Posttranscriptional Mitotic Regulon

    Journal: Molecular and Cellular Biology

    doi: 10.1128/MCB.00546-12

    NF45 regulates survivin and cyclin E expression downstream of XIAP and cIAP1. (A) Immunofluorescence images showing the multinucleation phenotype of the d5 HeLa cell line (arrow, bottom left panel) compared to the c HeLa cell line. The same phenotype can be reproduced by the transient siRNA knockdown of NF45 for 72 h (arrow, bottom right panel and inset). Cells were stained with Alexa Fluor 568 phalloidin for F-actin and with Hoechst stain for nuclei. (B) c and d5 cell phenotypes were quantified by propidium iodide staining and flow cytometry analysis. The number of multinucleated cells expressed as a percentage of the total number of viable cells was quantified and normalized to that of the control cell line (bottom). The number of cells in G 2 /M phase is also shown. (C) Western blot and densitometry analyses showing increased survivin expression in HeLa cells treated with 50 nM NF45 siRNA for 96 h compared to control siRNA. (D) survivin expression was blunted by XIAP overexpression in NF45 knocked-down HeLa cells. The HeLa cells were transfected with 50 nM NF45 or control siRNA and transfected 48 h later with GFP-XIAP for an additional 48 h. The protein extracts were analyzed by Western blotting and densitometry for survivin, XIAP, NF45, and GAPDH. (E) NF45 regulates cyclin E expression. HeLa cells were treated with 50 nM NF45 or control siRNA for 96 h, and expression of the indicated proteins was analyzed by Western blotting and densitometry. (F) NF45 controls cyclin E protein levels through its regulation of cIAP1 IRES-mediated translation. The HeLa cells were treated with 100 nM Smac mimetic (SM) or DMSO for 24 h and transfected with a pcDNA3-GFP or pcDNA3-GFP-NF45R plasmid for an additional 24 h. Protein extracts were analyzed by Western blotting for NF45, cIAP1, cyclin E, and GAPDH expression, and densitometry was performed.
    Figure Legend Snippet: NF45 regulates survivin and cyclin E expression downstream of XIAP and cIAP1. (A) Immunofluorescence images showing the multinucleation phenotype of the d5 HeLa cell line (arrow, bottom left panel) compared to the c HeLa cell line. The same phenotype can be reproduced by the transient siRNA knockdown of NF45 for 72 h (arrow, bottom right panel and inset). Cells were stained with Alexa Fluor 568 phalloidin for F-actin and with Hoechst stain for nuclei. (B) c and d5 cell phenotypes were quantified by propidium iodide staining and flow cytometry analysis. The number of multinucleated cells expressed as a percentage of the total number of viable cells was quantified and normalized to that of the control cell line (bottom). The number of cells in G 2 /M phase is also shown. (C) Western blot and densitometry analyses showing increased survivin expression in HeLa cells treated with 50 nM NF45 siRNA for 96 h compared to control siRNA. (D) survivin expression was blunted by XIAP overexpression in NF45 knocked-down HeLa cells. The HeLa cells were transfected with 50 nM NF45 or control siRNA and transfected 48 h later with GFP-XIAP for an additional 48 h. The protein extracts were analyzed by Western blotting and densitometry for survivin, XIAP, NF45, and GAPDH. (E) NF45 regulates cyclin E expression. HeLa cells were treated with 50 nM NF45 or control siRNA for 96 h, and expression of the indicated proteins was analyzed by Western blotting and densitometry. (F) NF45 controls cyclin E protein levels through its regulation of cIAP1 IRES-mediated translation. The HeLa cells were treated with 100 nM Smac mimetic (SM) or DMSO for 24 h and transfected with a pcDNA3-GFP or pcDNA3-GFP-NF45R plasmid for an additional 24 h. Protein extracts were analyzed by Western blotting for NF45, cIAP1, cyclin E, and GAPDH expression, and densitometry was performed.

    Techniques Used: Expressing, Immunofluorescence, Staining, Flow Cytometry, Cytometry, Western Blot, Over Expression, Transfection, Plasmid Preparation

    ) that NF45 expression does not affect Bcl-x L , DAP5, APAF1, or VCIP IRES activities, but it does impact the cIAP1 IRES. (B) List of IRES-containing human mRNAs that have a > 50% AU content within their 5′ UTRs. The percent AU content of the minimal IRES is indicated in brackets (if unknown, the content is equivalent to that of the 5′ UTR).
    Figure Legend Snippet: ) that NF45 expression does not affect Bcl-x L , DAP5, APAF1, or VCIP IRES activities, but it does impact the cIAP1 IRES. (B) List of IRES-containing human mRNAs that have a > 50% AU content within their 5′ UTRs. The percent AU content of the minimal IRES is indicated in brackets (if unknown, the content is equivalent to that of the 5′ UTR).

    Techniques Used: Expressing

    NF45 regulates XIAP translation through interaction with its IRES. (A) Western blots of endogenous XIAP and cIAP1 protein expression in d5 cells relative to that in c cells. The blots and densitometry analyses are representative of at least three experiments. (B) NF45 reexpression in NF45-deficient HeLa cells rescues XIAP protein expression. The HeLa cells were transfected with 50 nM control nontargeting siRNA or NF45 siRNA (d5 siRNA) for 48 h, followed by the overexpression of GFP or GFP-NF45R for an additional 48 h. The cell extracts were analyzed by Western blotting for NF45, XIAP, cIAP1, and GAPDH expression, and protein expression was quantified. (C) De novo protein expression of cIAP1 and XIAP in NF45-deficient cells. c cells were transfected with 50 nM control or NF45 siRNA and were pulse-labeled with [ 35 S]methionine. 35 S-labeled and Coomassie blue-stained total protein, as well as specific cIAP1, XIAP, and GAPDH immunoprecipitates, are shown. (D) NF45 interacts specifically with the XIAP IRES. NF45 and PABP Western blotting of an RNA affinity chromatography preparation was performed using the XIAP IRES or hemoglobin RNA.
    Figure Legend Snippet: NF45 regulates XIAP translation through interaction with its IRES. (A) Western blots of endogenous XIAP and cIAP1 protein expression in d5 cells relative to that in c cells. The blots and densitometry analyses are representative of at least three experiments. (B) NF45 reexpression in NF45-deficient HeLa cells rescues XIAP protein expression. The HeLa cells were transfected with 50 nM control nontargeting siRNA or NF45 siRNA (d5 siRNA) for 48 h, followed by the overexpression of GFP or GFP-NF45R for an additional 48 h. The cell extracts were analyzed by Western blotting for NF45, XIAP, cIAP1, and GAPDH expression, and protein expression was quantified. (C) De novo protein expression of cIAP1 and XIAP in NF45-deficient cells. c cells were transfected with 50 nM control or NF45 siRNA and were pulse-labeled with [ 35 S]methionine. 35 S-labeled and Coomassie blue-stained total protein, as well as specific cIAP1, XIAP, and GAPDH immunoprecipitates, are shown. (D) NF45 interacts specifically with the XIAP IRES. NF45 and PABP Western blotting of an RNA affinity chromatography preparation was performed using the XIAP IRES or hemoglobin RNA.

    Techniques Used: Western Blot, Expressing, Transfection, Over Expression, Labeling, Staining, Affinity Chromatography

    29) Product Images from "Telomere dysfunction promotes transdifferentiation of human fibroblasts into myofibroblasts. Telomere dysfunction promotes transdifferentiation of human fibroblasts into myofibroblasts"

    Article Title: Telomere dysfunction promotes transdifferentiation of human fibroblasts into myofibroblasts. Telomere dysfunction promotes transdifferentiation of human fibroblasts into myofibroblasts

    Journal: Aging Cell

    doi: 10.1111/acel.12838

    Telomere dysfunction causes myofibroblast transdifferentiation in a p53‐dependent manner. (a) ChIP‐qPCR analysis of p53 binding to a control distal promoter element (distal), to the αSMA promoter element (αSMA), or the p21 promoter element (p21) of normal BJ fibroblasts that were either control treated (C), treated with TGF‐β1 (10 ng/ml) for 48 hr, or transduced with shRNA targeting TRF2. Error bars: ± SD . * p
    Figure Legend Snippet: Telomere dysfunction causes myofibroblast transdifferentiation in a p53‐dependent manner. (a) ChIP‐qPCR analysis of p53 binding to a control distal promoter element (distal), to the αSMA promoter element (αSMA), or the p21 promoter element (p21) of normal BJ fibroblasts that were either control treated (C), treated with TGF‐β1 (10 ng/ml) for 48 hr, or transduced with shRNA targeting TRF2. Error bars: ± SD . * p

    Techniques Used: Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Binding Assay, Transduction, shRNA

    30) Product Images from "IFN-λ prevents influenza virus spread from the upper airways to the lungs and limits virus transmission"

    Article Title: IFN-λ prevents influenza virus spread from the upper airways to the lungs and limits virus transmission

    Journal: eLife

    doi: 10.7554/eLife.33354

    Basal expression of IFN-λ genes is reduced in Ifnar1 −/− mice. ( A ) Basal expression of type I ( Ifnb1 and Ifna4 ), type III IFNs ( Ifnl2/3 ) and Mx1 was measured by RT-qPCR in snout homogenates of WT (n = 6), Ifnar1 −/− (n = 6) and Ifnlr1 −/− (n = 6). Gene expression levels are shown relative to the housekeeping gene Hprt . Symbols represent individual mice, and bars represent means ± SEM. Statistical analysis: One-way ANOVA with Tukey’s multiple comparisons; asterisks indicate p-values: ***p
    Figure Legend Snippet: Basal expression of IFN-λ genes is reduced in Ifnar1 −/− mice. ( A ) Basal expression of type I ( Ifnb1 and Ifna4 ), type III IFNs ( Ifnl2/3 ) and Mx1 was measured by RT-qPCR in snout homogenates of WT (n = 6), Ifnar1 −/− (n = 6) and Ifnlr1 −/− (n = 6). Gene expression levels are shown relative to the housekeeping gene Hprt . Symbols represent individual mice, and bars represent means ± SEM. Statistical analysis: One-way ANOVA with Tukey’s multiple comparisons; asterisks indicate p-values: ***p

    Techniques Used: Expressing, Mouse Assay, Quantitative RT-PCR

    31) Product Images from "ERK8 is a novel HuR kinase that regulates tumour suppressor PDCD4 through a miR-21 dependent mechanism"

    Article Title: ERK8 is a novel HuR kinase that regulates tumour suppressor PDCD4 through a miR-21 dependent mechanism

    Journal: Oncotarget

    doi:

    HuR regulates PDCD4 stability via miR-21 A . HeLa cells were transiently transfected with a miR-21 mimic for 24 h and cells were harvested for western blot analysis. Tubulin was used as a loading control. B . HeLa cells were transiently transfected with a miR-21 mimic for 24 h and RNA was harvested. qRT-PCR analysis showing decrease of PDCD4 mRNA relative to GAPDH after miR-21 over-expression. C . Left panel: AntimiR-21 or antimiR-CTRL (control) was transiently transfected into HeLa cells for 24 h followed by siHuR transfection for an additional 48 h. Cells were harvested and protein levels were analyzed by western blot. Right panel: Quantification of PDCD4 protein levels relative to Tubulin.
    Figure Legend Snippet: HuR regulates PDCD4 stability via miR-21 A . HeLa cells were transiently transfected with a miR-21 mimic for 24 h and cells were harvested for western blot analysis. Tubulin was used as a loading control. B . HeLa cells were transiently transfected with a miR-21 mimic for 24 h and RNA was harvested. qRT-PCR analysis showing decrease of PDCD4 mRNA relative to GAPDH after miR-21 over-expression. C . Left panel: AntimiR-21 or antimiR-CTRL (control) was transiently transfected into HeLa cells for 24 h followed by siHuR transfection for an additional 48 h. Cells were harvested and protein levels were analyzed by western blot. Right panel: Quantification of PDCD4 protein levels relative to Tubulin.

    Techniques Used: Transfection, Western Blot, Quantitative RT-PCR, Over Expression

    ERK8 phosphorylates HuR to prevent its binding to PDCD4 mRNA A . ERK8 or control siRNA was transfected into HeLa cells for 48 h followed by treatment of cells with 0.5 mM H 2 O 2 or PBS for 1 h. Cells were fixed and immunofluorescence was performed to monitor HuR localization. Hoechst was used to stain the nuclei. Nuclear/Cytoplasmic ratio of HuR is shown on the right. Higher ratio denotes more nuclear staining. B . Top panel: HeLa cells were treated as in (A) and cells were harvested for western blot analysis for indicated proteins. Bottom panel: Quantification of PDCD4 protein levels relative to Tubulin. C . The kinase assay was performed with immunoprecipitated Flag-HuR or Flag empty vector as substrate and HA-ERK8 kinase in the presence of 32 P gamma-ATP and exposed to X-ray film. The levels of HuR and ERK8 proteins were detected by western blot analysis.
    Figure Legend Snippet: ERK8 phosphorylates HuR to prevent its binding to PDCD4 mRNA A . ERK8 or control siRNA was transfected into HeLa cells for 48 h followed by treatment of cells with 0.5 mM H 2 O 2 or PBS for 1 h. Cells were fixed and immunofluorescence was performed to monitor HuR localization. Hoechst was used to stain the nuclei. Nuclear/Cytoplasmic ratio of HuR is shown on the right. Higher ratio denotes more nuclear staining. B . Top panel: HeLa cells were treated as in (A) and cells were harvested for western blot analysis for indicated proteins. Bottom panel: Quantification of PDCD4 protein levels relative to Tubulin. C . The kinase assay was performed with immunoprecipitated Flag-HuR or Flag empty vector as substrate and HA-ERK8 kinase in the presence of 32 P gamma-ATP and exposed to X-ray film. The levels of HuR and ERK8 proteins were detected by western blot analysis.

    Techniques Used: Binding Assay, Transfection, Immunofluorescence, Staining, Western Blot, Kinase Assay, Immunoprecipitation, Plasmid Preparation

    HuR directly binds to PDCD4 3′UTR mRNA to regulate its protein expression A . Left panel: Western blot analysis of PDCD4 protein levels after HuR knockdown. HeLa cells were treated with siHuR or siCTRL (non-targeting control) for 72 h and harvested for western blot analysis. Tubulin was used as a loading control. Right panel: PDCD4 protein levels are quantified relative to Tubulin. B . HeLa cells were treated with siHuR or siCTRL for 72 h, harvested, and total RNA was isolated. PDCD4 mRNA levels were quantified by qRT-PCR and are shown relative to GAPDH mRNA levels. C . Seventy-two hours after siRNA transfection, HeLa cells were treated with 5 μg/mL actinomycin D. After the chase period, cells were processed for qRT-PCR to determine the mRNA half-life (11.6h for siCTRL; 9.5h for siHuR). D . Top panel: HeLa cells were crosslinked with formaldehyde and endogenous HuR was immunoprecipitated with mouse anti-HuR antibody; IgG was used as a control. Western blot analysis shows the level of immunoprecipitated HuR. Bottom panel: HuR-bound RNA was isolated and quantified by qRT-PCR, and is shown relative to IgG-immunoprecipitated material. The levels of GAPDH and RPL13 in HuR immunoprecipitation were determined as specificity controls E . PDCD4 3′UTR RNA was in vitro transcribed, 32 P labelled and UV crosslinking was performed with recombinant GST (control) or GST-HuR, separated by SDS-PAGE, and exposed to X-Ray film.
    Figure Legend Snippet: HuR directly binds to PDCD4 3′UTR mRNA to regulate its protein expression A . Left panel: Western blot analysis of PDCD4 protein levels after HuR knockdown. HeLa cells were treated with siHuR or siCTRL (non-targeting control) for 72 h and harvested for western blot analysis. Tubulin was used as a loading control. Right panel: PDCD4 protein levels are quantified relative to Tubulin. B . HeLa cells were treated with siHuR or siCTRL for 72 h, harvested, and total RNA was isolated. PDCD4 mRNA levels were quantified by qRT-PCR and are shown relative to GAPDH mRNA levels. C . Seventy-two hours after siRNA transfection, HeLa cells were treated with 5 μg/mL actinomycin D. After the chase period, cells were processed for qRT-PCR to determine the mRNA half-life (11.6h for siCTRL; 9.5h for siHuR). D . Top panel: HeLa cells were crosslinked with formaldehyde and endogenous HuR was immunoprecipitated with mouse anti-HuR antibody; IgG was used as a control. Western blot analysis shows the level of immunoprecipitated HuR. Bottom panel: HuR-bound RNA was isolated and quantified by qRT-PCR, and is shown relative to IgG-immunoprecipitated material. The levels of GAPDH and RPL13 in HuR immunoprecipitation were determined as specificity controls E . PDCD4 3′UTR RNA was in vitro transcribed, 32 P labelled and UV crosslinking was performed with recombinant GST (control) or GST-HuR, separated by SDS-PAGE, and exposed to X-Ray film.

    Techniques Used: Expressing, Western Blot, Isolation, Quantitative RT-PCR, Transfection, Immunoprecipitation, In Vitro, Recombinant, SDS Page

    HuR oligomerizes on the PDCD4 3′UTR A . Left panel: Coomassie stain of the recombinant GST and GST-HuR purified from E. coli cells. Right panel: Schematic representation of a fragment of the PDCD4 3′UTR (nucleotides 1-610). S1: nucleotides 1-199, S2: nucleotides 200-400, S3: nucleotides 401-610. The grey box indicates the miR-21 binding site at nucleotides 228-249 [ 25 ]. B . UV-crosslinking with GST or GST-HuR and the PDCD4 3′UTR fragments that were in vitro transcribed and 32 P-labelled. C . RNA EMSA with increasing concentrations of GST-HuR and in vitro transcribed and 32 P-labelled PDCD4 S1S2 probe (nucleotides 1-401). The complexes between HuR and PDCD4 S1S2 RNA are indicated as C1, C2, C3, and C4. D . RNA EMSA with 300 nM GST-HuR or GST incubated with 8 nM Cy5.5 3′-end labelled miR-21 RNA and increasing concentrations of 5 pM, 10 pM, 15 pM, or 20 pM 32 P-UTP labelled, in vitro transcribed S1S2 fragment of PDCD4 RNA. The complexes between HuR and PDCD4 S1S2 RNA are indicated by C1, C2, and C3. The binding between HuR and miR-21 is indicated by HuR:miR-21. Gel was exposed to X-ray film at −80°C to detect autoradiography and subsequently scanned with the Li-Cor Odyssey infrared scanner to detect the miR-21 Cy5.5 signal.
    Figure Legend Snippet: HuR oligomerizes on the PDCD4 3′UTR A . Left panel: Coomassie stain of the recombinant GST and GST-HuR purified from E. coli cells. Right panel: Schematic representation of a fragment of the PDCD4 3′UTR (nucleotides 1-610). S1: nucleotides 1-199, S2: nucleotides 200-400, S3: nucleotides 401-610. The grey box indicates the miR-21 binding site at nucleotides 228-249 [ 25 ]. B . UV-crosslinking with GST or GST-HuR and the PDCD4 3′UTR fragments that were in vitro transcribed and 32 P-labelled. C . RNA EMSA with increasing concentrations of GST-HuR and in vitro transcribed and 32 P-labelled PDCD4 S1S2 probe (nucleotides 1-401). The complexes between HuR and PDCD4 S1S2 RNA are indicated as C1, C2, C3, and C4. D . RNA EMSA with 300 nM GST-HuR or GST incubated with 8 nM Cy5.5 3′-end labelled miR-21 RNA and increasing concentrations of 5 pM, 10 pM, 15 pM, or 20 pM 32 P-UTP labelled, in vitro transcribed S1S2 fragment of PDCD4 RNA. The complexes between HuR and PDCD4 S1S2 RNA are indicated by C1, C2, and C3. The binding between HuR and miR-21 is indicated by HuR:miR-21. Gel was exposed to X-ray film at −80°C to detect autoradiography and subsequently scanned with the Li-Cor Odyssey infrared scanner to detect the miR-21 Cy5.5 signal.

    Techniques Used: Staining, Recombinant, Purification, Binding Assay, In Vitro, Incubation, Autoradiography

    H 2 O 2 causes cytoplasmic accumulation of HuR and a loss in PDCD4 expression that is mediated by miR-21 A . HuR localization by immunofluorescence of HeLa cells treated with PBS (0 mM H 2 O 2 ) or 0.5 mM H 2 O 2 for 1 h. Nuclei are visualized by Hoechst staining. Nuclear/Cytoplasmic ratio of HuR is shown on the right. Higher ratio denotes more nuclear staining. B . Left panel: HeLa cells were treated with 0.5 mM H 2 O 2 for the indicated times and cell lysates analysed by western blot analysis indicating a decrease in PDCD4 protein at 3 h as compared to Tubulin control. Right panel: PDCD4 protein levels were quantified relative to Tubulin. C . Cells were treated with 0.5 mM H 2 O 2 for the indicated time points, total RNA was isolated and analysed by qRT-PCR indicating a loss of PDCD4 mRNA as compared to GAPDH control. D . Left panel: HeLa cells were treated with antimiR-21 or a non-targeting antimiR-CTRL (control) for 24 h followed by treatment with 0.5 mM H 2 O 2 for 4 h. Cells were harvested and analysed by western blot analysis. Tubulin was used as a loading control. Right panel: Quantification of PDCD4 levels relative to Tubulin. E . HeLa cells were treated with 0.5 mM H 2 O 2 or PBS and HuR was immunoprecipitated. Bound RNA was isolated and qRT-PCR was performed to determine levels of PDCD4 mRNA. The levels of HuR-bound PDCD4 in PBS-treated cells were set as 1.
    Figure Legend Snippet: H 2 O 2 causes cytoplasmic accumulation of HuR and a loss in PDCD4 expression that is mediated by miR-21 A . HuR localization by immunofluorescence of HeLa cells treated with PBS (0 mM H 2 O 2 ) or 0.5 mM H 2 O 2 for 1 h. Nuclei are visualized by Hoechst staining. Nuclear/Cytoplasmic ratio of HuR is shown on the right. Higher ratio denotes more nuclear staining. B . Left panel: HeLa cells were treated with 0.5 mM H 2 O 2 for the indicated times and cell lysates analysed by western blot analysis indicating a decrease in PDCD4 protein at 3 h as compared to Tubulin control. Right panel: PDCD4 protein levels were quantified relative to Tubulin. C . Cells were treated with 0.5 mM H 2 O 2 for the indicated time points, total RNA was isolated and analysed by qRT-PCR indicating a loss of PDCD4 mRNA as compared to GAPDH control. D . Left panel: HeLa cells were treated with antimiR-21 or a non-targeting antimiR-CTRL (control) for 24 h followed by treatment with 0.5 mM H 2 O 2 for 4 h. Cells were harvested and analysed by western blot analysis. Tubulin was used as a loading control. Right panel: Quantification of PDCD4 levels relative to Tubulin. E . HeLa cells were treated with 0.5 mM H 2 O 2 or PBS and HuR was immunoprecipitated. Bound RNA was isolated and qRT-PCR was performed to determine levels of PDCD4 mRNA. The levels of HuR-bound PDCD4 in PBS-treated cells were set as 1.

    Techniques Used: Expressing, Immunofluorescence, Staining, Western Blot, Isolation, Quantitative RT-PCR, Immunoprecipitation

    32) Product Images from "Epigallocatechin-3-gallate protects against hepatic ischaemia–reperfusion injury by reducing oxidative stress and apoptotic cell death"

    Article Title: Epigallocatechin-3-gallate protects against hepatic ischaemia–reperfusion injury by reducing oxidative stress and apoptotic cell death

    Journal: The Journal of International Medical Research

    doi: 10.1177/0300060516662735

    Western blot and reverse transcription–polymerase chain reaction (RT–PCR) analyses to investigate the effects of pretreatment with 50 mg/kg epigallocatechin-3-gallate (EGCG) prior to hepatic ischaemia–reperfusion injury on antioxidant enzyme protein and mRNA levels in mice. The three treatment groups were as follows: sham-operated group (Sham,  n  = 10), hepatic ischaemia–reperfusion injury group (IR,  n  = 10), and EGCG with ischaemia–reperfusion injury group (EGCG-treated IR,  n  = 10). (a) Representative Western blots showing oxidative stress markers, lipid peroxidation markers, and carbonyl reductase 1 (CBR1) down-stream enzymes after hepatic ischaemia–reperfusion injury. β-actin was used as a loading control; (b) Results of RT–PCR analysis of the mRNA levels of oxidative stress markers. The control housekeeping gene was glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Data are presented as mean ± SD.  P
    Figure Legend Snippet: Western blot and reverse transcription–polymerase chain reaction (RT–PCR) analyses to investigate the effects of pretreatment with 50 mg/kg epigallocatechin-3-gallate (EGCG) prior to hepatic ischaemia–reperfusion injury on antioxidant enzyme protein and mRNA levels in mice. The three treatment groups were as follows: sham-operated group (Sham, n  = 10), hepatic ischaemia–reperfusion injury group (IR, n  = 10), and EGCG with ischaemia–reperfusion injury group (EGCG-treated IR, n  = 10). (a) Representative Western blots showing oxidative stress markers, lipid peroxidation markers, and carbonyl reductase 1 (CBR1) down-stream enzymes after hepatic ischaemia–reperfusion injury. β-actin was used as a loading control; (b) Results of RT–PCR analysis of the mRNA levels of oxidative stress markers. The control housekeeping gene was glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Data are presented as mean ± SD. P

    Techniques Used: Western Blot, Reverse Transcription Polymerase Chain Reaction, Mouse Assay

    33) Product Images from "ROCK signalling induced gene expression changes in mouse pancreatic ductal adenocarcinoma cells"

    Article Title: ROCK signalling induced gene expression changes in mouse pancreatic ductal adenocarcinoma cells

    Journal: Scientific Data

    doi: 10.1038/sdata.2016.101

    Quality control of RNA-Seq data. ( a ) Principal component plot of RNA-Seq (DESeq2) data indicating the clustering together of GFP:ER samples treated with vehicle control or 4HT, and ROCK1:ER plus ROCK2:ER samples treated with 4HT. ( b ) PDAC cells expressing GFP:ER, ROCK1:ER or ( c ) ROCK2:ER were treated with EtOH vehicle or 1 μM 4HT. Ptgs2 and Tff3 mRNA levels relative to Gapdh housekeeping gene were determined by qPCR. Means±s.e.m., unpaired t -test ( n =3). *** P
    Figure Legend Snippet: Quality control of RNA-Seq data. ( a ) Principal component plot of RNA-Seq (DESeq2) data indicating the clustering together of GFP:ER samples treated with vehicle control or 4HT, and ROCK1:ER plus ROCK2:ER samples treated with 4HT. ( b ) PDAC cells expressing GFP:ER, ROCK1:ER or ( c ) ROCK2:ER were treated with EtOH vehicle or 1 μM 4HT. Ptgs2 and Tff3 mRNA levels relative to Gapdh housekeeping gene were determined by qPCR. Means±s.e.m., unpaired t -test ( n =3). *** P

    Techniques Used: RNA Sequencing Assay, Expressing, Real-time Polymerase Chain Reaction

    34) Product Images from "Antileukemic Efficacy in Vitro of Talazoparib and APE1 Inhibitor III Combined with Decitabine in Myeloid Malignancies"

    Article Title: Antileukemic Efficacy in Vitro of Talazoparib and APE1 Inhibitor III Combined with Decitabine in Myeloid Malignancies

    Journal: Cancers

    doi: 10.3390/cancers11101493

    Cytotoxic efficacy of talazoparib and APE1 inhibitor III in CD34+ myelodysplastic syndrome (MDS)/chronic myelomonocytic leukemia (CMML) cells and in CD34+ or CD34− acute myeloid leukemia (AML) cells in relation to PARP1 / APE1 mRNA expression and γ H2AX foci levels. ( A , B ) PARP1 and APE1 mRNA expression levels in ‘responders’ and ‘non-responders’. ( C , D ) Levels of γH2AX foci in ‘responders’ and ‘non-responders’. Error bars represent mean ± standard error of mean.
    Figure Legend Snippet: Cytotoxic efficacy of talazoparib and APE1 inhibitor III in CD34+ myelodysplastic syndrome (MDS)/chronic myelomonocytic leukemia (CMML) cells and in CD34+ or CD34− acute myeloid leukemia (AML) cells in relation to PARP1 / APE1 mRNA expression and γ H2AX foci levels. ( A , B ) PARP1 and APE1 mRNA expression levels in ‘responders’ and ‘non-responders’. ( C , D ) Levels of γH2AX foci in ‘responders’ and ‘non-responders’. Error bars represent mean ± standard error of mean.

    Techniques Used: Expressing

    35) Product Images from "RUNX REGULATION OF SPHINGOLIPID METABOLISM AND SURVIVAL SIGNALLING"

    Article Title: RUNX REGULATION OF SPHINGOLIPID METABOLISM AND SURVIVAL SIGNALLING

    Journal: Cancer research

    doi: 10.1158/0008-5472.CAN-10-0726

    (A) Runx2 occupancy of promoter regions of Ugcg, St3gal5 and Sgpp1 in vivo as assessed by ChIP analysis. Specificity was demonstrated by lack of site recognition by a negative control polyclonal antiserum, α GST or when primary antibody was not
    Figure Legend Snippet: (A) Runx2 occupancy of promoter regions of Ugcg, St3gal5 and Sgpp1 in vivo as assessed by ChIP analysis. Specificity was demonstrated by lack of site recognition by a negative control polyclonal antiserum, α GST or when primary antibody was not

    Techniques Used: In Vivo, Chromatin Immunoprecipitation, Negative Control

    36) Product Images from "Triptolide activates unfolded protein response leading to chronic ER stress in pancreatic cancer cells"

    Article Title: Triptolide activates unfolded protein response leading to chronic ER stress in pancreatic cancer cells

    Journal: American Journal of Physiology - Gastrointestinal and Liver Physiology

    doi: 10.1152/ajpgi.00466.2013

    Effect of triptolide treatment on markers of the endoplasmic reticulum (ER) stress response in pancreatic cancer cells. A and B : MIA PaCa-2 and S2-VP10 cells were exposed to 100 nM triptolide for 0–24 h, and protein was extracted and assayed for expression of phosphorylated eukaryotic initiation factor 2α (p-eIF2α), total eIF2α (t-eIF2α), activating transcription factor 4 (ATF4), and inositol-requiring enzyme 1α (Ire1α). C and D : MIA PaCa-2 and S2-VP10 cells were exposed to 100 nM triptolide, and RNA was extracted and assayed for X-box-binding protein 1 ( XBP1 ) splicing and expression of C/EBP homology protein ( CHOP ). Actin and 18S were used as respective loading controls. u, Unspliced; s, spliced. E : MIA PaCa-2 and S2-VP10 cells were transfected with ER stress element (ERSE) luciferase construct and treated with 100 nM triptolide for 0–24 h, assayed for luciferase activity, and compared with untreated cells. Values are means ± SE; n = 3. * P
    Figure Legend Snippet: Effect of triptolide treatment on markers of the endoplasmic reticulum (ER) stress response in pancreatic cancer cells. A and B : MIA PaCa-2 and S2-VP10 cells were exposed to 100 nM triptolide for 0–24 h, and protein was extracted and assayed for expression of phosphorylated eukaryotic initiation factor 2α (p-eIF2α), total eIF2α (t-eIF2α), activating transcription factor 4 (ATF4), and inositol-requiring enzyme 1α (Ire1α). C and D : MIA PaCa-2 and S2-VP10 cells were exposed to 100 nM triptolide, and RNA was extracted and assayed for X-box-binding protein 1 ( XBP1 ) splicing and expression of C/EBP homology protein ( CHOP ). Actin and 18S were used as respective loading controls. u, Unspliced; s, spliced. E : MIA PaCa-2 and S2-VP10 cells were transfected with ER stress element (ERSE) luciferase construct and treated with 100 nM triptolide for 0–24 h, assayed for luciferase activity, and compared with untreated cells. Values are means ± SE; n = 3. * P

    Techniques Used: Expressing, Binding Assay, Transfection, Luciferase, Construct, Activity Assay

    37) Product Images from "Low expression of the putative tumour suppressor spinophilin is associated with higher proliferative activity and poor prognosis in patients with hepatocellular carcinoma"

    Article Title: Low expression of the putative tumour suppressor spinophilin is associated with higher proliferative activity and poor prognosis in patients with hepatocellular carcinoma

    Journal: British Journal of Cancer

    doi: 10.1038/bjc.2013.165

    Cyclin D2 expression increased about 1.5-fold after 48 h of treatment with Spn -targeting siRNA compared with the reference Allstars negative control.
    Figure Legend Snippet: Cyclin D2 expression increased about 1.5-fold after 48 h of treatment with Spn -targeting siRNA compared with the reference Allstars negative control.

    Techniques Used: Expressing, Negative Control

    38) Product Images from "Neutrophil expression of glucocorticoid-induced leucine zipper (GILZ) anti-inflammatory protein is associated with acute respiratory distress syndrome severity"

    Article Title: Neutrophil expression of glucocorticoid-induced leucine zipper (GILZ) anti-inflammatory protein is associated with acute respiratory distress syndrome severity

    Journal: Annals of Intensive Care

    doi: 10.1186/s13613-016-0210-0

    CRP, extracellular DNA and annexin A1 mRNA levels in relation to ARDS severity. CRP ( a ), extracellular DNA ( b ), and annexin A1 mRNA ( c ) levels predicted by a linear mixed model. controls ( full line ), mild/moderate ARDS patients ( small dotted line ), and severe ARDS patients ( large dotted line ) are represented. For each prediction, the confidence interval is represented by the gray region . All values are represented on the graph: circles for controls, triangles for mild/moderate ARDS patients, and squares for severe ARDS patients. Fixed effects of the model with the CRP are: 5.314 − 0.175 × mild/moderate ARDS − 0.291 × severe ARDS − 0.036 × time. Fixed effects of the model with DNA are: 5.969 − 1.311 × mild/moderate ARDS + 0.167 × severe ARDS − 0.011 × time. Fixed effects of the model with annexin A1 are: 0.400 − 0.125 × mild/moderate ARDS − 0.077 × severe ARDS + 0.003 × time
    Figure Legend Snippet: CRP, extracellular DNA and annexin A1 mRNA levels in relation to ARDS severity. CRP ( a ), extracellular DNA ( b ), and annexin A1 mRNA ( c ) levels predicted by a linear mixed model. controls ( full line ), mild/moderate ARDS patients ( small dotted line ), and severe ARDS patients ( large dotted line ) are represented. For each prediction, the confidence interval is represented by the gray region . All values are represented on the graph: circles for controls, triangles for mild/moderate ARDS patients, and squares for severe ARDS patients. Fixed effects of the model with the CRP are: 5.314 − 0.175 × mild/moderate ARDS − 0.291 × severe ARDS − 0.036 × time. Fixed effects of the model with DNA are: 5.969 − 1.311 × mild/moderate ARDS + 0.167 × severe ARDS − 0.011 × time. Fixed effects of the model with annexin A1 are: 0.400 − 0.125 × mild/moderate ARDS − 0.077 × severe ARDS + 0.003 × time

    Techniques Used:

    39) Product Images from "Loss of PDCD4 contributes to enhanced chemoresistance in Glioblastoma Multiforme through de-repression of Bcl-xL translation"

    Article Title: Loss of PDCD4 contributes to enhanced chemoresistance in Glioblastoma Multiforme through de-repression of Bcl-xL translation

    Journal: Oncotarget

    doi:

    GBM cell lines and tumor initiating cells have low levels of PDCD4 and high levels of Bcl-xL protein (A) Western blot analysis of a panel of GBM cell lines indicating the correlation between low PDCD4 levels and high Bcl-xL levels. (B) qPCR analysis of GBM cell lines showing no increase in Bcl-xL versus GAPDH mRNA as compared to HEK293 reference. (C) Western blot analysis of GBM tumor initiating cells (TICs) showing correlation between low PDCD4 and high Bcl-xL levels.
    Figure Legend Snippet: GBM cell lines and tumor initiating cells have low levels of PDCD4 and high levels of Bcl-xL protein (A) Western blot analysis of a panel of GBM cell lines indicating the correlation between low PDCD4 levels and high Bcl-xL levels. (B) qPCR analysis of GBM cell lines showing no increase in Bcl-xL versus GAPDH mRNA as compared to HEK293 reference. (C) Western blot analysis of GBM tumor initiating cells (TICs) showing correlation between low PDCD4 and high Bcl-xL levels.

    Techniques Used: Western Blot, Real-time Polymerase Chain Reaction

    40) Product Images from "Ca2+ signalling by P2Y receptors in cultured rat aortic smooth muscle cells"

    Article Title: Ca2+ signalling by P2Y receptors in cultured rat aortic smooth muscle cells

    Journal: British Journal of Pharmacology

    doi: 10.1111/j.1476-5381.2010.00763.x

    Different Ca 2+ signals evoked by selective activation of different P2Y receptors. Typical results from populations of cultured ASMC stimulated in HBS with agonists that allow selective activation of P2Y1 (1 µM MRS2365), P2Y2 (100 µM 2′-amino-UTP), P2Y4 (100 µM 2′-azido-UTP) or P2Y6 receptors (100 µM UDP). Results are means ± SEM from three wells on a single plate and are typical of results from three independent plates. 2′-amino-UTP, 2′-amino-2′-deoxyuridine-5′-triphosphate; 2′-azido-UTP, 2′-azido-2′-deoxyuridine-5′-triphosphate; ASMC, aortic smooth muscle cell; MRS2365, ( N )-methanocarba-2-MeSADP.
    Figure Legend Snippet: Different Ca 2+ signals evoked by selective activation of different P2Y receptors. Typical results from populations of cultured ASMC stimulated in HBS with agonists that allow selective activation of P2Y1 (1 µM MRS2365), P2Y2 (100 µM 2′-amino-UTP), P2Y4 (100 µM 2′-azido-UTP) or P2Y6 receptors (100 µM UDP). Results are means ± SEM from three wells on a single plate and are typical of results from three independent plates. 2′-amino-UTP, 2′-amino-2′-deoxyuridine-5′-triphosphate; 2′-azido-UTP, 2′-azido-2′-deoxyuridine-5′-triphosphate; ASMC, aortic smooth muscle cell; MRS2365, ( N )-methanocarba-2-MeSADP.

    Techniques Used: Activation Assay, Cell Culture

    Selectivity of ligands for the P2Y receptors expressed in rat cultured ASMC. ( Abbracchio et al ., 2006 ). The structures of the ligands are shown in Figure S1 . 2′-amino-UTP, 2′-amino-2′-deoxyuridine-5′-triphosphate; 2′-azido-UTP, 2′-azido-2′-deoxyuridine-5′-triphosphate; 2-MeSADP, 2-methylthio-adenosine-5′-diphosphate; 2-thio-UTP, 2-thio-uridine-5′-triphosphate; MRS2211, 2-[(2-chloro-5-nitrophenyl)azo]-5-hydroxy-6-methyl-3-[(phosphonooxy)methyl]-4-pyridinecarboxaldehyde; MRS2279, 2-chloro- N 6 -methyl-( N )-methanocarba-2′-deoxyadenosione-3′,5′-bisphosphate; MRS2365, ( N )-methanocarba-2-MeSADP; MRS2395, 2,2-dimethyl-propionic acid 3-(2-chloro-6-methylaminopurin-9-yl)-2-(2,2-dimethyl-propionyloxymethyl)-propyl ester; MRS2578, N,N″-1,4-butanediylbis [N′-(3-isothiocyanatophenyl)thio] urea; UDP-Glc, uridine-5′-diphospho-α- d -glucose.
    Figure Legend Snippet: Selectivity of ligands for the P2Y receptors expressed in rat cultured ASMC. ( Abbracchio et al ., 2006 ). The structures of the ligands are shown in Figure S1 . 2′-amino-UTP, 2′-amino-2′-deoxyuridine-5′-triphosphate; 2′-azido-UTP, 2′-azido-2′-deoxyuridine-5′-triphosphate; 2-MeSADP, 2-methylthio-adenosine-5′-diphosphate; 2-thio-UTP, 2-thio-uridine-5′-triphosphate; MRS2211, 2-[(2-chloro-5-nitrophenyl)azo]-5-hydroxy-6-methyl-3-[(phosphonooxy)methyl]-4-pyridinecarboxaldehyde; MRS2279, 2-chloro- N 6 -methyl-( N )-methanocarba-2′-deoxyadenosione-3′,5′-bisphosphate; MRS2365, ( N )-methanocarba-2-MeSADP; MRS2395, 2,2-dimethyl-propionic acid 3-(2-chloro-6-methylaminopurin-9-yl)-2-(2,2-dimethyl-propionyloxymethyl)-propyl ester; MRS2578, N,N″-1,4-butanediylbis [N′-(3-isothiocyanatophenyl)thio] urea; UDP-Glc, uridine-5′-diphospho-α- d -glucose.

    Techniques Used: Cell Culture, Gas Chromatography

    Expression of P2Y receptor subtypes in aortic smooth muscle cell (ASMC). Quantitative PCR was used to measure relative levels of mRNA encoding the subtypes of P2Y receptors in either cultures of ASMC (A, passage 3–7) or in freshly isolated ASMC (B). Results, expressed as percentages of total mRNA encoding P2Y receptors, are means ± SEM from three experiments, each performed in duplicate.
    Figure Legend Snippet: Expression of P2Y receptor subtypes in aortic smooth muscle cell (ASMC). Quantitative PCR was used to measure relative levels of mRNA encoding the subtypes of P2Y receptors in either cultures of ASMC (A, passage 3–7) or in freshly isolated ASMC (B). Results, expressed as percentages of total mRNA encoding P2Y receptors, are means ± SEM from three experiments, each performed in duplicate.

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Isolation

    Related Articles

    Real-time Polymerase Chain Reaction:

    Article Title: Gpr83 expression is not required for the maintenance of intestinal immune homeostasis and regulation of T-cell-dependent colitis
    Article Snippet: .. Quantitative PCR was performed using CD3 gamma chain (CD3γ), Gpr83 and Foxp3 specific primers (QuantiTect Primer Assays, Qiagen) and Platinum SYBR Green qPCR Supermix (Invitrogen). cDNA samples were assayed in triplicate using the Chromo4 detection system (GMI, Ramsey, MN), and gene expression levels for each individual sample were normalized to CD3γ. .. Mean relative gene expression was determined and expressed as 2−ΔCT .

    Article Title: Runx1 Orchestrates Sphingolipid Metabolism and Glucocorticoid Resistance in Lymphomagenesis
    Article Snippet: .. For quantitative real‐time PCR, 12.5 ng aliquots of cDNA were amplified in triplicate using primers for murine endogenous control Hprt or primers for murine Sgpp1 , Siat9 , Nr3c1 , Runx1 (Qiagen QuantiTect Primer Assays) or Ugcg (779F 5′ tttgctcagtacattgctgaagatta 3′ and 861R 5′ acttgagtagacattgaaaacctccaa 3′). ..

    Article Title: Tumor Lymphangiogenesis and Metastasis to Lymph Nodes Induced by Cancer Cell Expression of Podoplanin
    Article Snippet: .. Sybr Green-based real-time PCR was performed for human endothelin-1 (forward primer 5′-ACTTCTGCCACCTGGACATC-3′; reverse primer 5′-CTCTTGGACCTAGGGCTTCC-3), human villin-1 (Hs_VIL1_1_SG QuantiTect Primer Assay, Qiagen), mouse tenascin-C (Mm_Tnc_1_SG QuantiTect Primer Assay; Qiagen), human endothelin receptor B (Hs00240747_m1; Applied Biosystems), or human endothelin receptor A (Hs00609865_m1; Applied Biosystems). ..

    Article Title: IFN-λ prevents influenza virus spread from the upper airways to the lungs and limits virus transmission
    Article Snippet: .. The cDNA served as a template for the amplification of genes of interest (IAV-M1: forward: 5’-AAGACCAATCCTGTCACCTCTGA-3’; reverse: 5’-CAAAGCGTCTACGCTGCAGTCC-3’, Ifnl2/3 (mm0420156_gH, Applied Biosystems), Ifnb1 : forward: 5’-CCTGGAGCAGCTGAATGGAA-3’; reverse: 5’-CACTGTCTGCTGGTGGAGTTCATC-3’; probe: 5’-[6FAM]CCTACAGGGCGGACTTCAAG[BHQ1]−3’, Ifna4 (QT01774353, QuantiTect Primer Assay, Qiagen), Isg15 : forward: 5’-GAGCTAGAGCCTGCAGCAAT-3’; reverse: 5’-TTCTGGGCAATCTGCTTCTT-3’, Stat1 : forward: 5’-TCACAGTGGTTCGAGCTTCAG-3’; reverse: 5’-CGAGACATCATAGGCAGCGTG-3’, Mx1 : forward: 5’-TCTGAGGAGAGCCAGACGAT-3’; reverse: 5’-ACTCTGGTCCCCAATGACAG-3’ and Hprt (mm00446968_m1, Applied Biosystems)) by real-time PCR, using TaqMan Gene Expression Assays (Applied Biosystems), Universal PCR Master Mix (Applied Biosystems) and the ABI-Prism 7900 sequence detection system (Applied Biosystems). .. The increase in mRNA expression was determined by the 2-ΔCt method relative to the expression of Hprt or by the 2-ΔΔCt method relative to mock.

    Amplification:

    Article Title: Runx1 Orchestrates Sphingolipid Metabolism and Glucocorticoid Resistance in Lymphomagenesis
    Article Snippet: .. For quantitative real‐time PCR, 12.5 ng aliquots of cDNA were amplified in triplicate using primers for murine endogenous control Hprt or primers for murine Sgpp1 , Siat9 , Nr3c1 , Runx1 (Qiagen QuantiTect Primer Assays) or Ugcg (779F 5′ tttgctcagtacattgctgaagatta 3′ and 861R 5′ acttgagtagacattgaaaacctccaa 3′). ..

    Article Title: IFN-λ prevents influenza virus spread from the upper airways to the lungs and limits virus transmission
    Article Snippet: .. The cDNA served as a template for the amplification of genes of interest (IAV-M1: forward: 5’-AAGACCAATCCTGTCACCTCTGA-3’; reverse: 5’-CAAAGCGTCTACGCTGCAGTCC-3’, Ifnl2/3 (mm0420156_gH, Applied Biosystems), Ifnb1 : forward: 5’-CCTGGAGCAGCTGAATGGAA-3’; reverse: 5’-CACTGTCTGCTGGTGGAGTTCATC-3’; probe: 5’-[6FAM]CCTACAGGGCGGACTTCAAG[BHQ1]−3’, Ifna4 (QT01774353, QuantiTect Primer Assay, Qiagen), Isg15 : forward: 5’-GAGCTAGAGCCTGCAGCAAT-3’; reverse: 5’-TTCTGGGCAATCTGCTTCTT-3’, Stat1 : forward: 5’-TCACAGTGGTTCGAGCTTCAG-3’; reverse: 5’-CGAGACATCATAGGCAGCGTG-3’, Mx1 : forward: 5’-TCTGAGGAGAGCCAGACGAT-3’; reverse: 5’-ACTCTGGTCCCCAATGACAG-3’ and Hprt (mm00446968_m1, Applied Biosystems)) by real-time PCR, using TaqMan Gene Expression Assays (Applied Biosystems), Universal PCR Master Mix (Applied Biosystems) and the ABI-Prism 7900 sequence detection system (Applied Biosystems). .. The increase in mRNA expression was determined by the 2-ΔCt method relative to the expression of Hprt or by the 2-ΔΔCt method relative to mock.

    Synthesized:

    Article Title: Dopamine-Mediated Autocrine Inhibitory Circuit Regulating Human Insulin Secretion in Vitro
    Article Snippet: .. ) were synthesized by Eurofins MWG Operon (Huntsville, AL), except for those specific for human β-actin (QuantiTect Primer Assay; QIAGEN). .. Quantitative RT-PCR reagent controls (reagents without any template or with 30 ng non-retro-transcribed RNA) were included in all the assays.

    Quantitative RT-PCR:

    Article Title: Vaccination With a FAT1-Derived B Cell Epitope Combined With Tumor-Specific B and T Cell Epitopes Elicits Additive Protection in Cancer Mouse Models
    Article Snippet: .. Triplicate cDNA samples from each cell line (equal to 50 ng RNA/sample) were subjected to qRT-PCR to assess the relative FAT1 (Quantitect® Primer Assay for mouse FAT1, QIAGEN) transcript levels using the Quantitect® SYBR Green PCR kit (QIAGEN). .. MAPK, actin (Quantitect® Primer Assay for Human actin or MAPK, QIAGEN), were used as an internal normalization controls, respectively.

    Article Title: Overexpression of Protein Phosphatase 4 Correlates with Poor Prognosis in Patients with Stage II Pancreatic Ductal Adenocarcinoma
    Article Snippet: .. Briefly, total RNA was denatured for 5 min at 70°C and cooled for 5 min on ice, reverse transcriptase was added to a total volume of 20 μL, and reverse transcription was conducted at 42°C for 60 min. Quantitative reverse transcription-PCR (QRT-PCR) was performed using a set of primers specific for PP4C (QuantiTect Primer Assays, Qiagen, Inc. Valencia, CA) according to the manufacturer’s instructions. .. To correct for quantitative differences between samples and possible PCR artifacts, we used primers specific for Ribosomal protein S6 (RPS6) (forward, 5′-AAGGAGAGAAGGATATTCCTGGAC-3′; reverse, 5′-AGAGAGATTGAAAAGTTTGCGGAT-3′) as an internal control for each sample.

    SYBR Green Assay:

    Article Title: Gpr83 expression is not required for the maintenance of intestinal immune homeostasis and regulation of T-cell-dependent colitis
    Article Snippet: .. Quantitative PCR was performed using CD3 gamma chain (CD3γ), Gpr83 and Foxp3 specific primers (QuantiTect Primer Assays, Qiagen) and Platinum SYBR Green qPCR Supermix (Invitrogen). cDNA samples were assayed in triplicate using the Chromo4 detection system (GMI, Ramsey, MN), and gene expression levels for each individual sample were normalized to CD3γ. .. Mean relative gene expression was determined and expressed as 2−ΔCT .

    Article Title: Vaccination With a FAT1-Derived B Cell Epitope Combined With Tumor-Specific B and T Cell Epitopes Elicits Additive Protection in Cancer Mouse Models
    Article Snippet: .. Triplicate cDNA samples from each cell line (equal to 50 ng RNA/sample) were subjected to qRT-PCR to assess the relative FAT1 (Quantitect® Primer Assay for mouse FAT1, QIAGEN) transcript levels using the Quantitect® SYBR Green PCR kit (QIAGEN). .. MAPK, actin (Quantitect® Primer Assay for Human actin or MAPK, QIAGEN), were used as an internal normalization controls, respectively.

    Polymerase Chain Reaction:

    Article Title: Vaccination With a FAT1-Derived B Cell Epitope Combined With Tumor-Specific B and T Cell Epitopes Elicits Additive Protection in Cancer Mouse Models
    Article Snippet: .. Triplicate cDNA samples from each cell line (equal to 50 ng RNA/sample) were subjected to qRT-PCR to assess the relative FAT1 (Quantitect® Primer Assay for mouse FAT1, QIAGEN) transcript levels using the Quantitect® SYBR Green PCR kit (QIAGEN). .. MAPK, actin (Quantitect® Primer Assay for Human actin or MAPK, QIAGEN), were used as an internal normalization controls, respectively.

    Article Title: IFN-λ prevents influenza virus spread from the upper airways to the lungs and limits virus transmission
    Article Snippet: .. The cDNA served as a template for the amplification of genes of interest (IAV-M1: forward: 5’-AAGACCAATCCTGTCACCTCTGA-3’; reverse: 5’-CAAAGCGTCTACGCTGCAGTCC-3’, Ifnl2/3 (mm0420156_gH, Applied Biosystems), Ifnb1 : forward: 5’-CCTGGAGCAGCTGAATGGAA-3’; reverse: 5’-CACTGTCTGCTGGTGGAGTTCATC-3’; probe: 5’-[6FAM]CCTACAGGGCGGACTTCAAG[BHQ1]−3’, Ifna4 (QT01774353, QuantiTect Primer Assay, Qiagen), Isg15 : forward: 5’-GAGCTAGAGCCTGCAGCAAT-3’; reverse: 5’-TTCTGGGCAATCTGCTTCTT-3’, Stat1 : forward: 5’-TCACAGTGGTTCGAGCTTCAG-3’; reverse: 5’-CGAGACATCATAGGCAGCGTG-3’, Mx1 : forward: 5’-TCTGAGGAGAGCCAGACGAT-3’; reverse: 5’-ACTCTGGTCCCCAATGACAG-3’ and Hprt (mm00446968_m1, Applied Biosystems)) by real-time PCR, using TaqMan Gene Expression Assays (Applied Biosystems), Universal PCR Master Mix (Applied Biosystems) and the ABI-Prism 7900 sequence detection system (Applied Biosystems). .. The increase in mRNA expression was determined by the 2-ΔCt method relative to the expression of Hprt or by the 2-ΔΔCt method relative to mock.

    Expressing:

    Article Title: Gpr83 expression is not required for the maintenance of intestinal immune homeostasis and regulation of T-cell-dependent colitis
    Article Snippet: .. Quantitative PCR was performed using CD3 gamma chain (CD3γ), Gpr83 and Foxp3 specific primers (QuantiTect Primer Assays, Qiagen) and Platinum SYBR Green qPCR Supermix (Invitrogen). cDNA samples were assayed in triplicate using the Chromo4 detection system (GMI, Ramsey, MN), and gene expression levels for each individual sample were normalized to CD3γ. .. Mean relative gene expression was determined and expressed as 2−ΔCT .

    Article Title: IFN-λ prevents influenza virus spread from the upper airways to the lungs and limits virus transmission
    Article Snippet: .. The cDNA served as a template for the amplification of genes of interest (IAV-M1: forward: 5’-AAGACCAATCCTGTCACCTCTGA-3’; reverse: 5’-CAAAGCGTCTACGCTGCAGTCC-3’, Ifnl2/3 (mm0420156_gH, Applied Biosystems), Ifnb1 : forward: 5’-CCTGGAGCAGCTGAATGGAA-3’; reverse: 5’-CACTGTCTGCTGGTGGAGTTCATC-3’; probe: 5’-[6FAM]CCTACAGGGCGGACTTCAAG[BHQ1]−3’, Ifna4 (QT01774353, QuantiTect Primer Assay, Qiagen), Isg15 : forward: 5’-GAGCTAGAGCCTGCAGCAAT-3’; reverse: 5’-TTCTGGGCAATCTGCTTCTT-3’, Stat1 : forward: 5’-TCACAGTGGTTCGAGCTTCAG-3’; reverse: 5’-CGAGACATCATAGGCAGCGTG-3’, Mx1 : forward: 5’-TCTGAGGAGAGCCAGACGAT-3’; reverse: 5’-ACTCTGGTCCCCAATGACAG-3’ and Hprt (mm00446968_m1, Applied Biosystems)) by real-time PCR, using TaqMan Gene Expression Assays (Applied Biosystems), Universal PCR Master Mix (Applied Biosystems) and the ABI-Prism 7900 sequence detection system (Applied Biosystems). .. The increase in mRNA expression was determined by the 2-ΔCt method relative to the expression of Hprt or by the 2-ΔΔCt method relative to mock.

    Sequencing:

    Article Title: IFN-λ prevents influenza virus spread from the upper airways to the lungs and limits virus transmission
    Article Snippet: .. The cDNA served as a template for the amplification of genes of interest (IAV-M1: forward: 5’-AAGACCAATCCTGTCACCTCTGA-3’; reverse: 5’-CAAAGCGTCTACGCTGCAGTCC-3’, Ifnl2/3 (mm0420156_gH, Applied Biosystems), Ifnb1 : forward: 5’-CCTGGAGCAGCTGAATGGAA-3’; reverse: 5’-CACTGTCTGCTGGTGGAGTTCATC-3’; probe: 5’-[6FAM]CCTACAGGGCGGACTTCAAG[BHQ1]−3’, Ifna4 (QT01774353, QuantiTect Primer Assay, Qiagen), Isg15 : forward: 5’-GAGCTAGAGCCTGCAGCAAT-3’; reverse: 5’-TTCTGGGCAATCTGCTTCTT-3’, Stat1 : forward: 5’-TCACAGTGGTTCGAGCTTCAG-3’; reverse: 5’-CGAGACATCATAGGCAGCGTG-3’, Mx1 : forward: 5’-TCTGAGGAGAGCCAGACGAT-3’; reverse: 5’-ACTCTGGTCCCCAATGACAG-3’ and Hprt (mm00446968_m1, Applied Biosystems)) by real-time PCR, using TaqMan Gene Expression Assays (Applied Biosystems), Universal PCR Master Mix (Applied Biosystems) and the ABI-Prism 7900 sequence detection system (Applied Biosystems). .. The increase in mRNA expression was determined by the 2-ΔCt method relative to the expression of Hprt or by the 2-ΔΔCt method relative to mock.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • pp4c  (Qiagen)
    99
    Qiagen pp4c
    <t>PP4C</t> is overexpressed in pancreatic ductal adenocarcinoma (PDAC). A, Immunohistochemical staining results for PP4C expression in PDAC (N=133) and their paired benign pancreatic tissue samples (N=113). The expression of PP4C is significantly higher in PDAC samples than their paired benign pancreatic tissue (P
    Pp4c, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pp4c/product/Qiagen
    Average 99 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    pp4c - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    Image Search Results


    PP4C is overexpressed in pancreatic ductal adenocarcinoma (PDAC). A, Immunohistochemical staining results for PP4C expression in PDAC (N=133) and their paired benign pancreatic tissue samples (N=113). The expression of PP4C is significantly higher in PDAC samples than their paired benign pancreatic tissue (P

    Journal: Cancer epidemiology, biomarkers & prevention : a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive Oncology

    Article Title: Overexpression of Protein Phosphatase 4 Correlates with Poor Prognosis in Patients with Stage II Pancreatic Ductal Adenocarcinoma

    doi: 10.1158/1055-9965.EPI-12-0223

    Figure Lengend Snippet: PP4C is overexpressed in pancreatic ductal adenocarcinoma (PDAC). A, Immunohistochemical staining results for PP4C expression in PDAC (N=133) and their paired benign pancreatic tissue samples (N=113). The expression of PP4C is significantly higher in PDAC samples than their paired benign pancreatic tissue (P

    Article Snippet: Briefly, total RNA was denatured for 5 min at 70°C and cooled for 5 min on ice, reverse transcriptase was added to a total volume of 20 μL, and reverse transcription was conducted at 42°C for 60 min. Quantitative reverse transcription-PCR (QRT-PCR) was performed using a set of primers specific for PP4C (QuantiTect Primer Assays, Qiagen, Inc. Valencia, CA) according to the manufacturer’s instructions.

    Techniques: Immunohistochemistry, Staining, Expressing

    Representative micrographs show PP4C expression in pancreatic ductal adenocarcinoma (PDAC) samples and benign pancreatic tissue. A and B, strong cytoplasmic and nuclear staining for PP4C in a moderately to poorly differentiated PDAC; C and D, a moderately differentiated PDAC with weak staining for PP4C; E and F, Representative benign pancreatic tissue that is negative for PP4C (Original magnification, 40× for A, C, and E; 200× for B, D, and F).

    Journal: Cancer epidemiology, biomarkers & prevention : a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive Oncology

    Article Title: Overexpression of Protein Phosphatase 4 Correlates with Poor Prognosis in Patients with Stage II Pancreatic Ductal Adenocarcinoma

    doi: 10.1158/1055-9965.EPI-12-0223

    Figure Lengend Snippet: Representative micrographs show PP4C expression in pancreatic ductal adenocarcinoma (PDAC) samples and benign pancreatic tissue. A and B, strong cytoplasmic and nuclear staining for PP4C in a moderately to poorly differentiated PDAC; C and D, a moderately differentiated PDAC with weak staining for PP4C; E and F, Representative benign pancreatic tissue that is negative for PP4C (Original magnification, 40× for A, C, and E; 200× for B, D, and F).

    Article Snippet: Briefly, total RNA was denatured for 5 min at 70°C and cooled for 5 min on ice, reverse transcriptase was added to a total volume of 20 μL, and reverse transcription was conducted at 42°C for 60 min. Quantitative reverse transcription-PCR (QRT-PCR) was performed using a set of primers specific for PP4C (QuantiTect Primer Assays, Qiagen, Inc. Valencia, CA) according to the manufacturer’s instructions.

    Techniques: Expressing, Staining

    Expression of D2R transcripts in human striatum, pancreas, and purified cadaveric islets. A and B, RT-PCR semiquantitative assay using the primer pairs 4hD2_F/3hD2_R (A) and 4hD2_F/4hD2_R (B), amplifying cDNA derived from both the long and short mRNA isoform of D2R . The 234-bp and 532-bp products expected from the amplification of D2RS cDNA are not visible in A and B at 40 cycles. When the reaction in A was extended to 55 cycles, the D2RS cDNA 234-bp produce became visible. C, RT-PCR semiquantitative assay using the primer pair Long_hD2_F/Long_hD2_R, specific for the long isoform of D2R . D, RT-PCR semiquantitative assay using the primer pair Short_hD2_F/3hD2R, specific for the short isoform of D2R . The 215-bp product expected from the amplification of D2RS cDNA is not visible. When the reaction in D was extended to 55 cycles, the D2RS cDNA 215-bp product became visible. E, RT-PCR semiquantitative assay using the primer pair 2hD2_F/2hD2R, amplifying cDNA derived from all the known mRNA isoforms of D2R . F, RT-PCR semiquantitative assay using the primer pair Hs_ACTB_2_SG, amplifying β-actin-specific cDNA. This figure shows the results of one of five similar experiments. All primer pairs and primer sequences are listed in Supplemental Table 1.

    Journal: Molecular Endocrinology

    Article Title: Dopamine-Mediated Autocrine Inhibitory Circuit Regulating Human Insulin Secretion in Vitro

    doi: 10.1210/me.2012-1101

    Figure Lengend Snippet: Expression of D2R transcripts in human striatum, pancreas, and purified cadaveric islets. A and B, RT-PCR semiquantitative assay using the primer pairs 4hD2_F/3hD2_R (A) and 4hD2_F/4hD2_R (B), amplifying cDNA derived from both the long and short mRNA isoform of D2R . The 234-bp and 532-bp products expected from the amplification of D2RS cDNA are not visible in A and B at 40 cycles. When the reaction in A was extended to 55 cycles, the D2RS cDNA 234-bp produce became visible. C, RT-PCR semiquantitative assay using the primer pair Long_hD2_F/Long_hD2_R, specific for the long isoform of D2R . D, RT-PCR semiquantitative assay using the primer pair Short_hD2_F/3hD2R, specific for the short isoform of D2R . The 215-bp product expected from the amplification of D2RS cDNA is not visible. When the reaction in D was extended to 55 cycles, the D2RS cDNA 215-bp product became visible. E, RT-PCR semiquantitative assay using the primer pair 2hD2_F/2hD2R, amplifying cDNA derived from all the known mRNA isoforms of D2R . F, RT-PCR semiquantitative assay using the primer pair Hs_ACTB_2_SG, amplifying β-actin-specific cDNA. This figure shows the results of one of five similar experiments. All primer pairs and primer sequences are listed in Supplemental Table 1.

    Article Snippet: ) were synthesized by Eurofins MWG Operon (Huntsville, AL), except for those specific for human β-actin (QuantiTect Primer Assay; QIAGEN).

    Techniques: Expressing, Purification, Reverse Transcription Polymerase Chain Reaction, Derivative Assay, Amplification

    Ectopic Runx1 promotes S1P release from T‐lymphoma cells. (A) Total protein was extracted from p/m97 or p53/184 thymic lymphoma cells transduced with the pBabeRunx1 retroviral vector or the pBabePuro vector control and probed against antibodies to Runx1 (Cell Signalling #8229) or actin (Santa Cruz sc‐1616) as a loading control. Lymphoma cells over‐expressing Runx1 (9) were included as a positive control. (B) The blot was quantified using image J software and the Runx1 fold change indicated below the histogram. (C) Long chain ceramides were extracted from cell pellets from pBabePuro vector control and pBabeRunx1‐expressing T lymphoma cells (p/m97 shown), and separated, identified, and semi‐quantitated by HPLC mass spectrometry. The data are means ± SD where n = 4 from one experiment typical of two. Solid bars represent combined levels of 16.0, 24.1, and 24.0‐Cer ( P =

    Journal: Journal of Cellular Biochemistry

    Article Title: Runx1 Orchestrates Sphingolipid Metabolism and Glucocorticoid Resistance in Lymphomagenesis

    doi: 10.1002/jcb.25802

    Figure Lengend Snippet: Ectopic Runx1 promotes S1P release from T‐lymphoma cells. (A) Total protein was extracted from p/m97 or p53/184 thymic lymphoma cells transduced with the pBabeRunx1 retroviral vector or the pBabePuro vector control and probed against antibodies to Runx1 (Cell Signalling #8229) or actin (Santa Cruz sc‐1616) as a loading control. Lymphoma cells over‐expressing Runx1 (9) were included as a positive control. (B) The blot was quantified using image J software and the Runx1 fold change indicated below the histogram. (C) Long chain ceramides were extracted from cell pellets from pBabePuro vector control and pBabeRunx1‐expressing T lymphoma cells (p/m97 shown), and separated, identified, and semi‐quantitated by HPLC mass spectrometry. The data are means ± SD where n = 4 from one experiment typical of two. Solid bars represent combined levels of 16.0, 24.1, and 24.0‐Cer ( P =

    Article Snippet: For quantitative real‐time PCR, 12.5 ng aliquots of cDNA were amplified in triplicate using primers for murine endogenous control Hprt or primers for murine Sgpp1 , Siat9 , Nr3c1 , Runx1 (Qiagen QuantiTect Primer Assays) or Ugcg (779F 5′ tttgctcagtacattgctgaagatta 3′ and 861R 5′ acttgagtagacattgaaaacctccaa 3′).

    Techniques: Transduction, Plasmid Preparation, Expressing, Positive Control, Software, High Performance Liquid Chromatography, Mass Spectrometry

    Runx1 protects lymphoma cells against dexamethasone‐mediated apoptosis. (A) p53 null lymphoma cells transduced with the pBabeRunx1 retroviral vector or the pBabePuro vector control (p/m97 shown) were plated in triplicate in the presence and absence of 1.0 μM dexamethasone and monitored for live/dead counts by trypan blue exclusion over 4 days. (B) The same cells were plated at 4 × 10 5 per well in triplicate wells of a 12‐well plate and monitored for growth over 48 h. Ectopic Runx1 significantly reduced cell proliferation at 24 h ( P

    Journal: Journal of Cellular Biochemistry

    Article Title: Runx1 Orchestrates Sphingolipid Metabolism and Glucocorticoid Resistance in Lymphomagenesis

    doi: 10.1002/jcb.25802

    Figure Lengend Snippet: Runx1 protects lymphoma cells against dexamethasone‐mediated apoptosis. (A) p53 null lymphoma cells transduced with the pBabeRunx1 retroviral vector or the pBabePuro vector control (p/m97 shown) were plated in triplicate in the presence and absence of 1.0 μM dexamethasone and monitored for live/dead counts by trypan blue exclusion over 4 days. (B) The same cells were plated at 4 × 10 5 per well in triplicate wells of a 12‐well plate and monitored for growth over 48 h. Ectopic Runx1 significantly reduced cell proliferation at 24 h ( P

    Article Snippet: For quantitative real‐time PCR, 12.5 ng aliquots of cDNA were amplified in triplicate using primers for murine endogenous control Hprt or primers for murine Sgpp1 , Siat9 , Nr3c1 , Runx1 (Qiagen QuantiTect Primer Assays) or Ugcg (779F 5′ tttgctcagtacattgctgaagatta 3′ and 861R 5′ acttgagtagacattgaaaacctccaa 3′).

    Techniques: Transduction, Plasmid Preparation

    Enforced deletion of Runx1 impairs S1P release in vivo. (A) PCR genotyping of 60‐day‐old splenic tissue DNA from Runx1 fl/fl Mx1Cre + mice treated with vehicle control (PBS) for background excision or pIpC to excise Runx1 . Samples: A–C, 60‐day spleen tissue samples from two groups of three Runx1 fl/fl Mx1Cre + mice treated with either PBS or pIpC; D–F DNA controls, non‐excised Runx1 fl/fl Mx1Cre − (D), a mixture of partially excised Runx1 fl/fl Mx1Cre + and Balb/c normal kidney to show all three possible PCR products (E) and Balb/c normal kidney (F). Positions of Floxed (Runx1Fl), deleted (ΔRunx1Fl), and wildtype (WT) Runx1 alleles are as shown. Quantitation to estimate relative excision was performed using image J software. Estimated background and pIpC excision rates are labeled under the blots. (B) qt‐RT‐PCR analysis of Runx1 expression in 60‐day splenic tissue RNA samples from Runx1 fl/fl Mx1Cre + mice treated with vehicle control or pIpC (dark and light green bars, respectively). Parallel samples were analyzed from Runx1 fl/fl mice lacking the Mx1Cre gene to control for PBS and pIpC treatment (black and gray bars, respectively). The data are means ± SD where n = 9 representing three technical replicates of each biological replicate (3). A significant reduction in Runx1 expression was observed between Mx1Cre + and Mx1Cre − mice indicating background excision (gray vs. light green bar; P =

    Journal: Journal of Cellular Biochemistry

    Article Title: Runx1 Orchestrates Sphingolipid Metabolism and Glucocorticoid Resistance in Lymphomagenesis

    doi: 10.1002/jcb.25802

    Figure Lengend Snippet: Enforced deletion of Runx1 impairs S1P release in vivo. (A) PCR genotyping of 60‐day‐old splenic tissue DNA from Runx1 fl/fl Mx1Cre + mice treated with vehicle control (PBS) for background excision or pIpC to excise Runx1 . Samples: A–C, 60‐day spleen tissue samples from two groups of three Runx1 fl/fl Mx1Cre + mice treated with either PBS or pIpC; D–F DNA controls, non‐excised Runx1 fl/fl Mx1Cre − (D), a mixture of partially excised Runx1 fl/fl Mx1Cre + and Balb/c normal kidney to show all three possible PCR products (E) and Balb/c normal kidney (F). Positions of Floxed (Runx1Fl), deleted (ΔRunx1Fl), and wildtype (WT) Runx1 alleles are as shown. Quantitation to estimate relative excision was performed using image J software. Estimated background and pIpC excision rates are labeled under the blots. (B) qt‐RT‐PCR analysis of Runx1 expression in 60‐day splenic tissue RNA samples from Runx1 fl/fl Mx1Cre + mice treated with vehicle control or pIpC (dark and light green bars, respectively). Parallel samples were analyzed from Runx1 fl/fl mice lacking the Mx1Cre gene to control for PBS and pIpC treatment (black and gray bars, respectively). The data are means ± SD where n = 9 representing three technical replicates of each biological replicate (3). A significant reduction in Runx1 expression was observed between Mx1Cre + and Mx1Cre − mice indicating background excision (gray vs. light green bar; P =

    Article Snippet: For quantitative real‐time PCR, 12.5 ng aliquots of cDNA were amplified in triplicate using primers for murine endogenous control Hprt or primers for murine Sgpp1 , Siat9 , Nr3c1 , Runx1 (Qiagen QuantiTect Primer Assays) or Ugcg (779F 5′ tttgctcagtacattgctgaagatta 3′ and 861R 5′ acttgagtagacattgaaaacctccaa 3′).

    Techniques: In Vivo, Polymerase Chain Reaction, Mouse Assay, Quantitation Assay, Software, Labeling, Reverse Transcription Polymerase Chain Reaction, Expressing

    Enforced deletion of Runx1 promotes dexamethasone‐mediated apoptosis and Sgpp1 transcription. (A) Western blotting analysis as described in Figure 1 A to detect the deleted (ΔRunx1Fl) and full length (Runx1Fl) Runx1 proteins from in vitro excised in Runx1 fl/fl Mx1Cre + 3s B lymphoma cells. (B) Paired cell lines expressing the deleted (ΔRunx1Fl) and full length (Runx1Fl) proteins after in vitro excision of Runx1 fl/fl Mx1Cre + 3s B lymphoma cells were plated in triplicate in the presence of 1.0 μM dexamethasone and monitored for live/dead counts by trypan blue exclusion. (C) qt‐RT‐PCR analysis of steady state levels of Sgpp1 in ΔRunx1Fl and Runx1Fl 3s cells grown in the presence and absence of 1.0 μM dexamethasone for 6 h. The data are means ± SD where n = 9 representing three technical replicates of each biological replicate (3) from one experiment typical of two. (D) Runx1 schematic showing the mutated residues in the heterodimerization (T161A) and DNA‐binding (K83N) domains. qt‐RT‐PCR analysis of Sgpp1 expression in ΔRunx1Fl 3s cells transfected with full length Runx1, T161A Runx1, or K83N Runx1. Absolute levels of Sgpp1 were compared to control cultures expressing the pBabe Puro vector alone. The data were compiled as described in (C).

    Journal: Journal of Cellular Biochemistry

    Article Title: Runx1 Orchestrates Sphingolipid Metabolism and Glucocorticoid Resistance in Lymphomagenesis

    doi: 10.1002/jcb.25802

    Figure Lengend Snippet: Enforced deletion of Runx1 promotes dexamethasone‐mediated apoptosis and Sgpp1 transcription. (A) Western blotting analysis as described in Figure 1 A to detect the deleted (ΔRunx1Fl) and full length (Runx1Fl) Runx1 proteins from in vitro excised in Runx1 fl/fl Mx1Cre + 3s B lymphoma cells. (B) Paired cell lines expressing the deleted (ΔRunx1Fl) and full length (Runx1Fl) proteins after in vitro excision of Runx1 fl/fl Mx1Cre + 3s B lymphoma cells were plated in triplicate in the presence of 1.0 μM dexamethasone and monitored for live/dead counts by trypan blue exclusion. (C) qt‐RT‐PCR analysis of steady state levels of Sgpp1 in ΔRunx1Fl and Runx1Fl 3s cells grown in the presence and absence of 1.0 μM dexamethasone for 6 h. The data are means ± SD where n = 9 representing three technical replicates of each biological replicate (3) from one experiment typical of two. (D) Runx1 schematic showing the mutated residues in the heterodimerization (T161A) and DNA‐binding (K83N) domains. qt‐RT‐PCR analysis of Sgpp1 expression in ΔRunx1Fl 3s cells transfected with full length Runx1, T161A Runx1, or K83N Runx1. Absolute levels of Sgpp1 were compared to control cultures expressing the pBabe Puro vector alone. The data were compiled as described in (C).

    Article Snippet: For quantitative real‐time PCR, 12.5 ng aliquots of cDNA were amplified in triplicate using primers for murine endogenous control Hprt or primers for murine Sgpp1 , Siat9 , Nr3c1 , Runx1 (Qiagen QuantiTect Primer Assays) or Ugcg (779F 5′ tttgctcagtacattgctgaagatta 3′ and 861R 5′ acttgagtagacattgaaaacctccaa 3′).

    Techniques: Western Blot, In Vitro, Expressing, Reverse Transcription Polymerase Chain Reaction, Binding Assay, Transfection, Plasmid Preparation

    shRNA knockdown of Sgpp1 reduces dexamethasone‐mediated apoptosis. (A) qt‐RT‐PCR analysis of Sgpp1 expression in p/m97 cells stably infected with viral supernatants expressing an Sgpp1 or a non‐coding (NC) control shRNA sequence. Cells were grown for 6 h in the presence of 1.0 μM dexamethasone prior to RNA extraction and qt‐RT‐PCR analysis. The data were calculated as described in Fig. 4 C. (B) The same cells were plated in triplicate and grown for 36 h in the presence (Dex) and absence (MtOH) of 1.0 μM dexamethasone and monitored for live/dead counts by trypan blue exclusion. Knockdown of Sgpp1 had no effect on cell viability under control conditions but gave a significant reduction in cell death in the presence of 1.0 μM dexamethasone. (C) Interplay between Runx1 and dexamethasone on the expression of sphingolipid metabolism enzymes involved in the synthesis and breakdown of sphingosine and ceramide and their potential contributions to cell death and survival [Bianchini et al., 2006 ; Kilbey et al., 2010 ].

    Journal: Journal of Cellular Biochemistry

    Article Title: Runx1 Orchestrates Sphingolipid Metabolism and Glucocorticoid Resistance in Lymphomagenesis

    doi: 10.1002/jcb.25802

    Figure Lengend Snippet: shRNA knockdown of Sgpp1 reduces dexamethasone‐mediated apoptosis. (A) qt‐RT‐PCR analysis of Sgpp1 expression in p/m97 cells stably infected with viral supernatants expressing an Sgpp1 or a non‐coding (NC) control shRNA sequence. Cells were grown for 6 h in the presence of 1.0 μM dexamethasone prior to RNA extraction and qt‐RT‐PCR analysis. The data were calculated as described in Fig. 4 C. (B) The same cells were plated in triplicate and grown for 36 h in the presence (Dex) and absence (MtOH) of 1.0 μM dexamethasone and monitored for live/dead counts by trypan blue exclusion. Knockdown of Sgpp1 had no effect on cell viability under control conditions but gave a significant reduction in cell death in the presence of 1.0 μM dexamethasone. (C) Interplay between Runx1 and dexamethasone on the expression of sphingolipid metabolism enzymes involved in the synthesis and breakdown of sphingosine and ceramide and their potential contributions to cell death and survival [Bianchini et al., 2006 ; Kilbey et al., 2010 ].

    Article Snippet: For quantitative real‐time PCR, 12.5 ng aliquots of cDNA were amplified in triplicate using primers for murine endogenous control Hprt or primers for murine Sgpp1 , Siat9 , Nr3c1 , Runx1 (Qiagen QuantiTect Primer Assays) or Ugcg (779F 5′ tttgctcagtacattgctgaagatta 3′ and 861R 5′ acttgagtagacattgaaaacctccaa 3′).

    Techniques: shRNA, Reverse Transcription Polymerase Chain Reaction, Expressing, Stable Transfection, Infection, Sequencing, RNA Extraction

    Expression and localization of mD8-FAT1 fusion proteins. (A) Schematic representation of plasmids expressing mD8-FAT1 fusion proteins . A synthetic minigene encoding three copies of mD8-FAT1 domain was fused to the 3′ end of either E. coli Maltose binding protein (MBP) gene or S. aureus fhuD2 gene. The two fusions were inserted into pET plasmid under the control of the T7 inducible promoter. Highlighted is the DNA sequence of the mD8-FAT1 minigene. (B) Compartmentalization of mD8-FAT1 fusions in OMVs . OMVs were purified from the supernatants of BL21(DE3)Δ ompA (pET_MBP-mD8-FAT1) and BL21(DE3)Δ ompA (pET_FhuD2-mD8-FAT1) strains and 20 μg of each OMVs preparation were separated by SDS-PAGE and the gel was stained with Coomassie Blue. As control, OMVs from BL21(DE3)Δ ompA (pET) strain (“Empty” OMVs) were also loaded on the gel. Arrows indicate the bands corresponding to the protein fusions. (C) Analysis of compartmentalization of mD8-FAT1 fusions in OMVs by Triton X-114 extraction . OMVs (100 μg) from BL21(DE3)Δ ompA (pET_MBP-mD8-FAT1) and BL21(DE3)Δ ompA (pET_FhuD2-mD8-FAT1) strains were incubated in 1% Triton X-114 solution at 4°C and subsequently aqueous and hydrophobic phases were separated by bringing the temperature at 37°C. Proteins in the aqueous (A) and hydrophobic (D) phases were precipitated by standard chloroform/methanol procedure, separated by SDS-PAGE together with 20 μg of OMVs and stained with Coomassie blue (T). (D) Analysis of surface localization of mD8-FAT1 fusion proteins . Bacterial cells from BL21(DE3)Δ ompA (pET_MBP-mD8-FAT1) and BL21(DE3)Δ ompA (pET_FhuD2-mD8-FAT1) cultures were first incubated with anti-mD8-FAT1 polyclonal antibodies and subsequently with fluorescent-labeled anti-rabbit antibodies. Antibody binding was visualized by flow cytometry.

    Journal: Frontiers in Oncology

    Article Title: Vaccination With a FAT1-Derived B Cell Epitope Combined With Tumor-Specific B and T Cell Epitopes Elicits Additive Protection in Cancer Mouse Models

    doi: 10.3389/fonc.2018.00481

    Figure Lengend Snippet: Expression and localization of mD8-FAT1 fusion proteins. (A) Schematic representation of plasmids expressing mD8-FAT1 fusion proteins . A synthetic minigene encoding three copies of mD8-FAT1 domain was fused to the 3′ end of either E. coli Maltose binding protein (MBP) gene or S. aureus fhuD2 gene. The two fusions were inserted into pET plasmid under the control of the T7 inducible promoter. Highlighted is the DNA sequence of the mD8-FAT1 minigene. (B) Compartmentalization of mD8-FAT1 fusions in OMVs . OMVs were purified from the supernatants of BL21(DE3)Δ ompA (pET_MBP-mD8-FAT1) and BL21(DE3)Δ ompA (pET_FhuD2-mD8-FAT1) strains and 20 μg of each OMVs preparation were separated by SDS-PAGE and the gel was stained with Coomassie Blue. As control, OMVs from BL21(DE3)Δ ompA (pET) strain (“Empty” OMVs) were also loaded on the gel. Arrows indicate the bands corresponding to the protein fusions. (C) Analysis of compartmentalization of mD8-FAT1 fusions in OMVs by Triton X-114 extraction . OMVs (100 μg) from BL21(DE3)Δ ompA (pET_MBP-mD8-FAT1) and BL21(DE3)Δ ompA (pET_FhuD2-mD8-FAT1) strains were incubated in 1% Triton X-114 solution at 4°C and subsequently aqueous and hydrophobic phases were separated by bringing the temperature at 37°C. Proteins in the aqueous (A) and hydrophobic (D) phases were precipitated by standard chloroform/methanol procedure, separated by SDS-PAGE together with 20 μg of OMVs and stained with Coomassie blue (T). (D) Analysis of surface localization of mD8-FAT1 fusion proteins . Bacterial cells from BL21(DE3)Δ ompA (pET_MBP-mD8-FAT1) and BL21(DE3)Δ ompA (pET_FhuD2-mD8-FAT1) cultures were first incubated with anti-mD8-FAT1 polyclonal antibodies and subsequently with fluorescent-labeled anti-rabbit antibodies. Antibody binding was visualized by flow cytometry.

    Article Snippet: Triplicate cDNA samples from each cell line (equal to 50 ng RNA/sample) were subjected to qRT-PCR to assess the relative FAT1 (Quantitect® Primer Assay for mouse FAT1, QIAGEN) transcript levels using the Quantitect® SYBR Green PCR kit (QIAGEN).

    Techniques: Expressing, Binding Assay, Positron Emission Tomography, Plasmid Preparation, Sequencing, Purification, SDS Page, Staining, Incubation, Labeling, Flow Cytometry, Cytometry

    Protection conferred by mD8-FAT1 OMVs immunization against CT26 challenge. (A) Schematic representation of immunization and challenge schedule . BALB/c mice were immunized three times (2 weeks apart) with OMVs from either BL21(DE3)Δ ompA (pET_MBP-mD8-FAT1) or BL21(DE3)Δ ompA (pET_FhuD2-mD8-FAT1) strains and 1 week after the third immunization the animals were challenged with 2 × 10 5 CT26 cells. Tumor growth was followed over a period of 25 days. As control, a group of mice was also immunized with “Empty” OMVs. (B) anti-mD8-FAT1 titers from mice immunized with mD8-FAT1 OMVs . The day before challenge sera from immunized mice were pooled (triangles: mice immunized with MBP-mD8-FAT1-OMVs; squares: mice immunized with FhuD2-mD8-FAT1-OMVs; circles: mice immunized with “Empty” OMVs) and the anti-mD8-FAT1 titers were determined by ELISA using plates coated with synthetic mD8-FAT1 peptide. (C) Anti-tumor activity of mD8-FAT1 OMVs immunizations . After challenge tumor growth was followed by measuring tumor volume with a caliper. Animals were sacrificed 25 days after challenge. Means ± SEM are indicated. ***Indicates that the difference in tumor size between the immunized group and control group is statistically significant with P

    Journal: Frontiers in Oncology

    Article Title: Vaccination With a FAT1-Derived B Cell Epitope Combined With Tumor-Specific B and T Cell Epitopes Elicits Additive Protection in Cancer Mouse Models

    doi: 10.3389/fonc.2018.00481

    Figure Lengend Snippet: Protection conferred by mD8-FAT1 OMVs immunization against CT26 challenge. (A) Schematic representation of immunization and challenge schedule . BALB/c mice were immunized three times (2 weeks apart) with OMVs from either BL21(DE3)Δ ompA (pET_MBP-mD8-FAT1) or BL21(DE3)Δ ompA (pET_FhuD2-mD8-FAT1) strains and 1 week after the third immunization the animals were challenged with 2 × 10 5 CT26 cells. Tumor growth was followed over a period of 25 days. As control, a group of mice was also immunized with “Empty” OMVs. (B) anti-mD8-FAT1 titers from mice immunized with mD8-FAT1 OMVs . The day before challenge sera from immunized mice were pooled (triangles: mice immunized with MBP-mD8-FAT1-OMVs; squares: mice immunized with FhuD2-mD8-FAT1-OMVs; circles: mice immunized with “Empty” OMVs) and the anti-mD8-FAT1 titers were determined by ELISA using plates coated with synthetic mD8-FAT1 peptide. (C) Anti-tumor activity of mD8-FAT1 OMVs immunizations . After challenge tumor growth was followed by measuring tumor volume with a caliper. Animals were sacrificed 25 days after challenge. Means ± SEM are indicated. ***Indicates that the difference in tumor size between the immunized group and control group is statistically significant with P

    Article Snippet: Triplicate cDNA samples from each cell line (equal to 50 ng RNA/sample) were subjected to qRT-PCR to assess the relative FAT1 (Quantitect® Primer Assay for mouse FAT1, QIAGEN) transcript levels using the Quantitect® SYBR Green PCR kit (QIAGEN).

    Techniques: Mouse Assay, Positron Emission Tomography, Enzyme-linked Immunosorbent Assay, Activity Assay

    Protective activity of mD8-FAT1 OMVs and EGFRvIII OMVs combination. (A) Analysis of mD8-FAT1 surface expression in B16F10-EGFRvIII cell line - B16F10-EGFRvIII cells expressing the EGFRvIII human variant were incubated with anti-MD8-FAT1 antibodies and subsequently stained with a fluorescent labeled anti-rabbit antibodies. Antibody binding was followed using flow cytometry analysis. (B) Protection of C57bl6 mice challenged with EGFRvIII-B16F10 . C57bl6 mice were immunized with either mD8-FAT1-OMVs, or EGFRvIII OMVs (20 μg/dose, three doses) or with the combination of mD8-FAT1 OMVs and EGFRvIII OMVs (10 μg/dose each OMV, three doses). Animals were subsequently challenged with 5 × 10 5 B16F10-EGFRvIII cells and tumor growth was followed over a period of 25 days. The data indicate the average of tumor sizes from each group at the end of the challenge experiment. Means ± SEM are indicated. *** P

    Journal: Frontiers in Oncology

    Article Title: Vaccination With a FAT1-Derived B Cell Epitope Combined With Tumor-Specific B and T Cell Epitopes Elicits Additive Protection in Cancer Mouse Models

    doi: 10.3389/fonc.2018.00481

    Figure Lengend Snippet: Protective activity of mD8-FAT1 OMVs and EGFRvIII OMVs combination. (A) Analysis of mD8-FAT1 surface expression in B16F10-EGFRvIII cell line - B16F10-EGFRvIII cells expressing the EGFRvIII human variant were incubated with anti-MD8-FAT1 antibodies and subsequently stained with a fluorescent labeled anti-rabbit antibodies. Antibody binding was followed using flow cytometry analysis. (B) Protection of C57bl6 mice challenged with EGFRvIII-B16F10 . C57bl6 mice were immunized with either mD8-FAT1-OMVs, or EGFRvIII OMVs (20 μg/dose, three doses) or with the combination of mD8-FAT1 OMVs and EGFRvIII OMVs (10 μg/dose each OMV, three doses). Animals were subsequently challenged with 5 × 10 5 B16F10-EGFRvIII cells and tumor growth was followed over a period of 25 days. The data indicate the average of tumor sizes from each group at the end of the challenge experiment. Means ± SEM are indicated. *** P

    Article Snippet: Triplicate cDNA samples from each cell line (equal to 50 ng RNA/sample) were subjected to qRT-PCR to assess the relative FAT1 (Quantitect® Primer Assay for mouse FAT1, QIAGEN) transcript levels using the Quantitect® SYBR Green PCR kit (QIAGEN).

    Techniques: Activity Assay, Expressing, Variant Assay, Incubation, Staining, Labeling, Binding Assay, Flow Cytometry, Cytometry, Mouse Assay

    Analysis of FAT1 expression in murine cell lines. (A) Schematic representation of the structural organization of FAT1 ) and the corresponding sequence in murine FAT1 (mD8-FAT1). (B) Quantitative analysis of FAT1 mRNA in mouse cancer cell lines —mRNA was purified from different cancer cells lines and qRT-PCR was carried out to quantify FAT1-specific mRNA. Data are reported as fold differences with respect to FAT1 mRNA from B16F10 cell line. The bars represent the means ± SD of three independent experiments. (C) Surface exposition of mD8-FAT1 domain in B16F10 and CT26 cell lines . Cancer cells were incubated with either mAb198.3 monoclonal antibodies or with polyclonal antibodies raised against the KLM-conjugated synthetic peptide corresponding to the mD8-FAT1 (A) . Cells were subsequently incubated with fluorescent labeled secondary antibodies and analyzed by flow cytometry.

    Journal: Frontiers in Oncology

    Article Title: Vaccination With a FAT1-Derived B Cell Epitope Combined With Tumor-Specific B and T Cell Epitopes Elicits Additive Protection in Cancer Mouse Models

    doi: 10.3389/fonc.2018.00481

    Figure Lengend Snippet: Analysis of FAT1 expression in murine cell lines. (A) Schematic representation of the structural organization of FAT1 ) and the corresponding sequence in murine FAT1 (mD8-FAT1). (B) Quantitative analysis of FAT1 mRNA in mouse cancer cell lines —mRNA was purified from different cancer cells lines and qRT-PCR was carried out to quantify FAT1-specific mRNA. Data are reported as fold differences with respect to FAT1 mRNA from B16F10 cell line. The bars represent the means ± SD of three independent experiments. (C) Surface exposition of mD8-FAT1 domain in B16F10 and CT26 cell lines . Cancer cells were incubated with either mAb198.3 monoclonal antibodies or with polyclonal antibodies raised against the KLM-conjugated synthetic peptide corresponding to the mD8-FAT1 (A) . Cells were subsequently incubated with fluorescent labeled secondary antibodies and analyzed by flow cytometry.

    Article Snippet: Triplicate cDNA samples from each cell line (equal to 50 ng RNA/sample) were subjected to qRT-PCR to assess the relative FAT1 (Quantitect® Primer Assay for mouse FAT1, QIAGEN) transcript levels using the Quantitect® SYBR Green PCR kit (QIAGEN).

    Techniques: Expressing, Sequencing, Purification, Quantitative RT-PCR, Incubation, Labeling, Flow Cytometry, Cytometry