ifna4  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    QuantiTect Primer Assay
    Description:
    QuantiTect Primer Assays are genomewide bioinformatically validated primer sets for use in SYBR Green based real time RT PCR on any cycler Assays are available for all genes from human rat mouse and many other species Each assay for a specific gene is supplied as a lyophilized mix of forward and reverse primers that can be easily reconstituted to obtain a 10x assay solution reaction components for real time RT PCR need to be ordered separately When used in combination with QuantiFast QuantiTect Rotor Gene or FastLane Kits for SYBR Green detection QuantiTect Primer Assays guarantee highly specific and sensitive results in real time RT PCR that are comparable to probe based detection
    Catalog Number:
    249900
    Price:
    96.8
    Category:
    Assay PCR qPCR
    Buy from Supplier


    Structured Review

    Qiagen ifna4
    QuantiTect Primer Assay
    QuantiTect Primer Assays are genomewide bioinformatically validated primer sets for use in SYBR Green based real time RT PCR on any cycler Assays are available for all genes from human rat mouse and many other species Each assay for a specific gene is supplied as a lyophilized mix of forward and reverse primers that can be easily reconstituted to obtain a 10x assay solution reaction components for real time RT PCR need to be ordered separately When used in combination with QuantiFast QuantiTect Rotor Gene or FastLane Kits for SYBR Green detection QuantiTect Primer Assays guarantee highly specific and sensitive results in real time RT PCR that are comparable to probe based detection
    https://www.bioz.com/result/ifna4/product/Qiagen
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    ifna4 - by Bioz Stars, 2021-06
    99/100 stars

    Images

    1) Product Images from "IFN-λ prevents influenza virus spread from the upper airways to the lungs and limits virus transmission"

    Article Title: IFN-λ prevents influenza virus spread from the upper airways to the lungs and limits virus transmission

    Journal: eLife

    doi: 10.7554/eLife.33354

    Basal expression of IFN-λ genes is reduced in Ifnar1 −/− mice. ( A ) Basal expression of type I ( Ifnb1 and Ifna4 ), type III IFNs ( Ifnl2/3 ) and Mx1 was measured by RT-qPCR in snout homogenates of WT (n = 6), Ifnar1 −/− (n = 6) and Ifnlr1 −/− (n = 6). Gene expression levels are shown relative to the housekeeping gene Hprt . Symbols represent individual mice, and bars represent means ± SEM. Statistical analysis: One-way ANOVA with Tukey’s multiple comparisons; asterisks indicate p-values: ***p
    Figure Legend Snippet: Basal expression of IFN-λ genes is reduced in Ifnar1 −/− mice. ( A ) Basal expression of type I ( Ifnb1 and Ifna4 ), type III IFNs ( Ifnl2/3 ) and Mx1 was measured by RT-qPCR in snout homogenates of WT (n = 6), Ifnar1 −/− (n = 6) and Ifnlr1 −/− (n = 6). Gene expression levels are shown relative to the housekeeping gene Hprt . Symbols represent individual mice, and bars represent means ± SEM. Statistical analysis: One-way ANOVA with Tukey’s multiple comparisons; asterisks indicate p-values: ***p

    Techniques Used: Expressing, Mouse Assay, Quantitative RT-PCR

    2) Product Images from "High Magnesium Corrosion Rate has an Effect on Osteoclast and Mesenchymal Stem Cell Role During Bone Remodelling"

    Article Title: High Magnesium Corrosion Rate has an Effect on Osteoclast and Mesenchymal Stem Cell Role During Bone Remodelling

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-28476-w

    The effect of Mg100 conditioned media on the expression of osteoblast related genes and ALP levels. Fold change in the gene expression of (A ) Runx-2 and ( B ) osteocalcin in cells cultured in filtered or non-filtered medium over a period of 12 days was investigated. On day 2, a significant fold change (*p
    Figure Legend Snippet: The effect of Mg100 conditioned media on the expression of osteoblast related genes and ALP levels. Fold change in the gene expression of (A ) Runx-2 and ( B ) osteocalcin in cells cultured in filtered or non-filtered medium over a period of 12 days was investigated. On day 2, a significant fold change (*p

    Techniques Used: Expressing, ALP Assay, Cell Culture

    3) Product Images from "Vaccination With a FAT1-Derived B Cell Epitope Combined With Tumor-Specific B and T Cell Epitopes Elicits Additive Protection in Cancer Mouse Models"

    Article Title: Vaccination With a FAT1-Derived B Cell Epitope Combined With Tumor-Specific B and T Cell Epitopes Elicits Additive Protection in Cancer Mouse Models

    Journal: Frontiers in Oncology

    doi: 10.3389/fonc.2018.00481

    Expression and localization of mD8-FAT1 fusion proteins. (A) Schematic representation of plasmids expressing mD8-FAT1 fusion proteins . A synthetic minigene encoding three copies of mD8-FAT1 domain was fused to the 3′ end of either E. coli Maltose binding protein (MBP) gene or S. aureus fhuD2 gene. The two fusions were inserted into pET plasmid under the control of the T7 inducible promoter. Highlighted is the DNA sequence of the mD8-FAT1 minigene. (B) Compartmentalization of mD8-FAT1 fusions in OMVs . OMVs were purified from the supernatants of BL21(DE3)Δ ompA (pET_MBP-mD8-FAT1) and BL21(DE3)Δ ompA (pET_FhuD2-mD8-FAT1) strains and 20 μg of each OMVs preparation were separated by SDS-PAGE and the gel was stained with Coomassie Blue. As control, OMVs from BL21(DE3)Δ ompA (pET) strain (“Empty” OMVs) were also loaded on the gel. Arrows indicate the bands corresponding to the protein fusions. (C) Analysis of compartmentalization of mD8-FAT1 fusions in OMVs by Triton X-114 extraction . OMVs (100 μg) from BL21(DE3)Δ ompA (pET_MBP-mD8-FAT1) and BL21(DE3)Δ ompA (pET_FhuD2-mD8-FAT1) strains were incubated in 1% Triton X-114 solution at 4°C and subsequently aqueous and hydrophobic phases were separated by bringing the temperature at 37°C. Proteins in the aqueous (A) and hydrophobic (D) phases were precipitated by standard chloroform/methanol procedure, separated by SDS-PAGE together with 20 μg of OMVs and stained with Coomassie blue (T). (D) Analysis of surface localization of mD8-FAT1 fusion proteins . Bacterial cells from BL21(DE3)Δ ompA (pET_MBP-mD8-FAT1) and BL21(DE3)Δ ompA (pET_FhuD2-mD8-FAT1) cultures were first incubated with anti-mD8-FAT1 polyclonal antibodies and subsequently with fluorescent-labeled anti-rabbit antibodies. Antibody binding was visualized by flow cytometry.
    Figure Legend Snippet: Expression and localization of mD8-FAT1 fusion proteins. (A) Schematic representation of plasmids expressing mD8-FAT1 fusion proteins . A synthetic minigene encoding three copies of mD8-FAT1 domain was fused to the 3′ end of either E. coli Maltose binding protein (MBP) gene or S. aureus fhuD2 gene. The two fusions were inserted into pET plasmid under the control of the T7 inducible promoter. Highlighted is the DNA sequence of the mD8-FAT1 minigene. (B) Compartmentalization of mD8-FAT1 fusions in OMVs . OMVs were purified from the supernatants of BL21(DE3)Δ ompA (pET_MBP-mD8-FAT1) and BL21(DE3)Δ ompA (pET_FhuD2-mD8-FAT1) strains and 20 μg of each OMVs preparation were separated by SDS-PAGE and the gel was stained with Coomassie Blue. As control, OMVs from BL21(DE3)Δ ompA (pET) strain (“Empty” OMVs) were also loaded on the gel. Arrows indicate the bands corresponding to the protein fusions. (C) Analysis of compartmentalization of mD8-FAT1 fusions in OMVs by Triton X-114 extraction . OMVs (100 μg) from BL21(DE3)Δ ompA (pET_MBP-mD8-FAT1) and BL21(DE3)Δ ompA (pET_FhuD2-mD8-FAT1) strains were incubated in 1% Triton X-114 solution at 4°C and subsequently aqueous and hydrophobic phases were separated by bringing the temperature at 37°C. Proteins in the aqueous (A) and hydrophobic (D) phases were precipitated by standard chloroform/methanol procedure, separated by SDS-PAGE together with 20 μg of OMVs and stained with Coomassie blue (T). (D) Analysis of surface localization of mD8-FAT1 fusion proteins . Bacterial cells from BL21(DE3)Δ ompA (pET_MBP-mD8-FAT1) and BL21(DE3)Δ ompA (pET_FhuD2-mD8-FAT1) cultures were first incubated with anti-mD8-FAT1 polyclonal antibodies and subsequently with fluorescent-labeled anti-rabbit antibodies. Antibody binding was visualized by flow cytometry.

    Techniques Used: Expressing, Binding Assay, Positron Emission Tomography, Plasmid Preparation, Sequencing, Purification, SDS Page, Staining, Incubation, Labeling, Flow Cytometry, Cytometry

    Protection conferred by mD8-FAT1 OMVs immunization against CT26 challenge. (A) Schematic representation of immunization and challenge schedule . BALB/c mice were immunized three times (2 weeks apart) with OMVs from either BL21(DE3)Δ ompA (pET_MBP-mD8-FAT1) or BL21(DE3)Δ ompA (pET_FhuD2-mD8-FAT1) strains and 1 week after the third immunization the animals were challenged with 2 × 10 5 CT26 cells. Tumor growth was followed over a period of 25 days. As control, a group of mice was also immunized with “Empty” OMVs. (B) anti-mD8-FAT1 titers from mice immunized with mD8-FAT1 OMVs . The day before challenge sera from immunized mice were pooled (triangles: mice immunized with MBP-mD8-FAT1-OMVs; squares: mice immunized with FhuD2-mD8-FAT1-OMVs; circles: mice immunized with “Empty” OMVs) and the anti-mD8-FAT1 titers were determined by ELISA using plates coated with synthetic mD8-FAT1 peptide. (C) Anti-tumor activity of mD8-FAT1 OMVs immunizations . After challenge tumor growth was followed by measuring tumor volume with a caliper. Animals were sacrificed 25 days after challenge. Means ± SEM are indicated. ***Indicates that the difference in tumor size between the immunized group and control group is statistically significant with P
    Figure Legend Snippet: Protection conferred by mD8-FAT1 OMVs immunization against CT26 challenge. (A) Schematic representation of immunization and challenge schedule . BALB/c mice were immunized three times (2 weeks apart) with OMVs from either BL21(DE3)Δ ompA (pET_MBP-mD8-FAT1) or BL21(DE3)Δ ompA (pET_FhuD2-mD8-FAT1) strains and 1 week after the third immunization the animals were challenged with 2 × 10 5 CT26 cells. Tumor growth was followed over a period of 25 days. As control, a group of mice was also immunized with “Empty” OMVs. (B) anti-mD8-FAT1 titers from mice immunized with mD8-FAT1 OMVs . The day before challenge sera from immunized mice were pooled (triangles: mice immunized with MBP-mD8-FAT1-OMVs; squares: mice immunized with FhuD2-mD8-FAT1-OMVs; circles: mice immunized with “Empty” OMVs) and the anti-mD8-FAT1 titers were determined by ELISA using plates coated with synthetic mD8-FAT1 peptide. (C) Anti-tumor activity of mD8-FAT1 OMVs immunizations . After challenge tumor growth was followed by measuring tumor volume with a caliper. Animals were sacrificed 25 days after challenge. Means ± SEM are indicated. ***Indicates that the difference in tumor size between the immunized group and control group is statistically significant with P

    Techniques Used: Mouse Assay, Positron Emission Tomography, Enzyme-linked Immunosorbent Assay, Activity Assay

    Protective activity of mD8-FAT1 OMVs and EGFRvIII OMVs combination. (A) Analysis of mD8-FAT1 surface expression in B16F10-EGFRvIII cell line - B16F10-EGFRvIII cells expressing the EGFRvIII human variant were incubated with anti-MD8-FAT1 antibodies and subsequently stained with a fluorescent labeled anti-rabbit antibodies. Antibody binding was followed using flow cytometry analysis. (B) Protection of C57bl6 mice challenged with EGFRvIII-B16F10 . C57bl6 mice were immunized with either mD8-FAT1-OMVs, or EGFRvIII OMVs (20 μg/dose, three doses) or with the combination of mD8-FAT1 OMVs and EGFRvIII OMVs (10 μg/dose each OMV, three doses). Animals were subsequently challenged with 5 × 10 5 B16F10-EGFRvIII cells and tumor growth was followed over a period of 25 days. The data indicate the average of tumor sizes from each group at the end of the challenge experiment. Means ± SEM are indicated. *** P
    Figure Legend Snippet: Protective activity of mD8-FAT1 OMVs and EGFRvIII OMVs combination. (A) Analysis of mD8-FAT1 surface expression in B16F10-EGFRvIII cell line - B16F10-EGFRvIII cells expressing the EGFRvIII human variant were incubated with anti-MD8-FAT1 antibodies and subsequently stained with a fluorescent labeled anti-rabbit antibodies. Antibody binding was followed using flow cytometry analysis. (B) Protection of C57bl6 mice challenged with EGFRvIII-B16F10 . C57bl6 mice were immunized with either mD8-FAT1-OMVs, or EGFRvIII OMVs (20 μg/dose, three doses) or with the combination of mD8-FAT1 OMVs and EGFRvIII OMVs (10 μg/dose each OMV, three doses). Animals were subsequently challenged with 5 × 10 5 B16F10-EGFRvIII cells and tumor growth was followed over a period of 25 days. The data indicate the average of tumor sizes from each group at the end of the challenge experiment. Means ± SEM are indicated. *** P

    Techniques Used: Activity Assay, Expressing, Variant Assay, Incubation, Staining, Labeling, Binding Assay, Flow Cytometry, Cytometry, Mouse Assay

    Analysis of FAT1 expression in murine cell lines. (A) Schematic representation of the structural organization of FAT1 ) and the corresponding sequence in murine FAT1 (mD8-FAT1). (B) Quantitative analysis of FAT1 mRNA in mouse cancer cell lines —mRNA was purified from different cancer cells lines and qRT-PCR was carried out to quantify FAT1-specific mRNA. Data are reported as fold differences with respect to FAT1 mRNA from B16F10 cell line. The bars represent the means ± SD of three independent experiments. (C) Surface exposition of mD8-FAT1 domain in B16F10 and CT26 cell lines . Cancer cells were incubated with either mAb198.3 monoclonal antibodies or with polyclonal antibodies raised against the KLM-conjugated synthetic peptide corresponding to the mD8-FAT1 (A) . Cells were subsequently incubated with fluorescent labeled secondary antibodies and analyzed by flow cytometry.
    Figure Legend Snippet: Analysis of FAT1 expression in murine cell lines. (A) Schematic representation of the structural organization of FAT1 ) and the corresponding sequence in murine FAT1 (mD8-FAT1). (B) Quantitative analysis of FAT1 mRNA in mouse cancer cell lines —mRNA was purified from different cancer cells lines and qRT-PCR was carried out to quantify FAT1-specific mRNA. Data are reported as fold differences with respect to FAT1 mRNA from B16F10 cell line. The bars represent the means ± SD of three independent experiments. (C) Surface exposition of mD8-FAT1 domain in B16F10 and CT26 cell lines . Cancer cells were incubated with either mAb198.3 monoclonal antibodies or with polyclonal antibodies raised against the KLM-conjugated synthetic peptide corresponding to the mD8-FAT1 (A) . Cells were subsequently incubated with fluorescent labeled secondary antibodies and analyzed by flow cytometry.

    Techniques Used: Expressing, Sequencing, Purification, Quantitative RT-PCR, Incubation, Labeling, Flow Cytometry, Cytometry

    4) Product Images from "Telomere dysfunction promotes transdifferentiation of human fibroblasts into myofibroblasts. Telomere dysfunction promotes transdifferentiation of human fibroblasts into myofibroblasts"

    Article Title: Telomere dysfunction promotes transdifferentiation of human fibroblasts into myofibroblasts. Telomere dysfunction promotes transdifferentiation of human fibroblasts into myofibroblasts

    Journal: Aging Cell

    doi: 10.1111/acel.12838

    Telomere dysfunction causes myofibroblast transdifferentiation in a p53‐dependent manner. (a) ChIP‐qPCR analysis of p53 binding to a control distal promoter element (distal), to the αSMA promoter element (αSMA), or the p21 promoter element (p21) of normal BJ fibroblasts that were either control treated (C), treated with TGF‐β1 (10 ng/ml) for 48 hr, or transduced with shRNA targeting TRF2. Error bars: ± SD . * p
    Figure Legend Snippet: Telomere dysfunction causes myofibroblast transdifferentiation in a p53‐dependent manner. (a) ChIP‐qPCR analysis of p53 binding to a control distal promoter element (distal), to the αSMA promoter element (αSMA), or the p21 promoter element (p21) of normal BJ fibroblasts that were either control treated (C), treated with TGF‐β1 (10 ng/ml) for 48 hr, or transduced with shRNA targeting TRF2. Error bars: ± SD . * p

    Techniques Used: Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Binding Assay, Transduction, shRNA

    5) Product Images from "FOXP3 expression is modulated by TGF-β1/NOTCH1 pathway in human melanoma"

    Article Title: FOXP3 expression is modulated by TGF-β1/NOTCH1 pathway in human melanoma

    Journal: International Journal of Molecular Medicine

    doi: 10.3892/ijmm.2018.3618

    GSI effect on NOTCH1 NICD , NOTCH-specific target gene HES1 expression and on TGF-β/Smad signaling in melanoma cell lines. (A) Inhibition of NOTCH1 NICD and NOTCH-specific target gene HES1 is illustrated after 72 h of 20 μ M GSI treatment in WM35, A375 and A2058 cells. Western blot analysis showed that GSI suppressed NOTCH1 NICD and HES1 protein levels and downregulated TGFβ-1- induced NOTCH1 NICD , HES1 protein levels in melanoma cell lines. (B) GSI treatment consistently decreased pSMAD3 levels in all melanoma cell lines. GAPDH served as loading control. GSI, γ-secretase inhibitor; HES1, hairy and enhancer of split 1; TGF-β, transforming growth factor-β; pSMAD3, phosphorylated Smad3; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.
    Figure Legend Snippet: GSI effect on NOTCH1 NICD , NOTCH-specific target gene HES1 expression and on TGF-β/Smad signaling in melanoma cell lines. (A) Inhibition of NOTCH1 NICD and NOTCH-specific target gene HES1 is illustrated after 72 h of 20 μ M GSI treatment in WM35, A375 and A2058 cells. Western blot analysis showed that GSI suppressed NOTCH1 NICD and HES1 protein levels and downregulated TGFβ-1- induced NOTCH1 NICD , HES1 protein levels in melanoma cell lines. (B) GSI treatment consistently decreased pSMAD3 levels in all melanoma cell lines. GAPDH served as loading control. GSI, γ-secretase inhibitor; HES1, hairy and enhancer of split 1; TGF-β, transforming growth factor-β; pSMAD3, phosphorylated Smad3; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

    Techniques Used: Expressing, Inhibition, Western Blot

    Expression of NOTCH1 NICD and NOTCH-specific target gene HES1 in melanoma cell lines. (A) mRNA of NOTCH1 NICD and HES1 was measured by RT-qPCR in NHEM, WM35 and A375 and A2058 melanoma cells. Melanocytes served as the control. WM35 showed a higher level of NOTCH1 NICD mRNA and HES1 mRNA than A375 and A2058 cells. (B) Protein level of NOTCH1 NICD and HES1 was measured by western blot analysis in WM35, A375 and A2058 melanoma cell lines. All of the melanoma cell lines positively expressed NOTCH1 NICD and HES1. (B-D) Effect of TGFβ-1 treatment on NOTCH1 NICD , HES1 mRNA and protein levels in melanoma cell lines. Treatment with rhTGF-β1 (5 ng/ml) for 48 h induced a higher increase of NOTCH1 NICD and HES1 mRNA and their own protein levels in WM35, A375 and A2058 melanoma cells. As an internal control, GAPDH was used for normalization. Data are shown as mean ± SD of three independent experiments. The comparison of mRNA NOTCH-1 and HES1 expression in multiple groups was performed by ANOVA and Tukey's test. HES1, hairy and enhancer of split 1; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; TGF-β, transforming growth factor-β; rh, recombinant human; GAPDH, glyceraldehyde 3-phosphate dehydrogenase. ** P
    Figure Legend Snippet: Expression of NOTCH1 NICD and NOTCH-specific target gene HES1 in melanoma cell lines. (A) mRNA of NOTCH1 NICD and HES1 was measured by RT-qPCR in NHEM, WM35 and A375 and A2058 melanoma cells. Melanocytes served as the control. WM35 showed a higher level of NOTCH1 NICD mRNA and HES1 mRNA than A375 and A2058 cells. (B) Protein level of NOTCH1 NICD and HES1 was measured by western blot analysis in WM35, A375 and A2058 melanoma cell lines. All of the melanoma cell lines positively expressed NOTCH1 NICD and HES1. (B-D) Effect of TGFβ-1 treatment on NOTCH1 NICD , HES1 mRNA and protein levels in melanoma cell lines. Treatment with rhTGF-β1 (5 ng/ml) for 48 h induced a higher increase of NOTCH1 NICD and HES1 mRNA and their own protein levels in WM35, A375 and A2058 melanoma cells. As an internal control, GAPDH was used for normalization. Data are shown as mean ± SD of three independent experiments. The comparison of mRNA NOTCH-1 and HES1 expression in multiple groups was performed by ANOVA and Tukey's test. HES1, hairy and enhancer of split 1; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; TGF-β, transforming growth factor-β; rh, recombinant human; GAPDH, glyceraldehyde 3-phosphate dehydrogenase. ** P

    Techniques Used: Expressing, Quantitative RT-PCR, Western Blot, Real-time Polymerase Chain Reaction, Recombinant

    6) Product Images from "Methylseleninic Acid Sensitizes Ovarian Cancer Cells to T-Cell Mediated Killing by Decreasing PDL1 and VEGF Levels"

    Article Title: Methylseleninic Acid Sensitizes Ovarian Cancer Cells to T-Cell Mediated Killing by Decreasing PDL1 and VEGF Levels

    Journal: Frontiers in Oncology

    doi: 10.3389/fonc.2018.00407

    MSA decreases the protein levels of PDL1. (A) Western blot analysis of PDL1 (approximately 50 kDa) after treatment (5 μM) with selenite (S) or MSA (M) for 24 h. Graph shows quantification of PDL1 proteins normalized by β-actin. (B) Relative mRNA expression of PDL1 on treatment with selenite and MSA compared to control. (C) Relative mRNA expression of MMPs after selenite and MSA treatment compared to control. Columns represent mean expression levels (%); bar indicates SD ( * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001).
    Figure Legend Snippet: MSA decreases the protein levels of PDL1. (A) Western blot analysis of PDL1 (approximately 50 kDa) after treatment (5 μM) with selenite (S) or MSA (M) for 24 h. Graph shows quantification of PDL1 proteins normalized by β-actin. (B) Relative mRNA expression of PDL1 on treatment with selenite and MSA compared to control. (C) Relative mRNA expression of MMPs after selenite and MSA treatment compared to control. Columns represent mean expression levels (%); bar indicates SD ( * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001).

    Techniques Used: Western Blot, Expressing

    Related Articles

    Produced:

    Article Title: High Magnesium Corrosion Rate has an Effect on Osteoclast and Mesenchymal Stem Cell Role During Bone Remodelling
    Article Snippet: The quantity and purity of RNA was measured using a Nanodrop spectrophotometer (Themo Fisher Scientific). .. The RNA produced was used for quantitative real time PCR (qRT-PCR) to amplify the primers of osteogenesis-related genes: Runx-2, collagen type 1-alpha 1 (COL1A1) and osteocalcin (Quantitect primer assays, QIAGEN, UK) using a one-step real time PCR machine (ViiA 7, Applied Biosystems) and QuantiFast SYBR Green RT-PCR Kit (QIAGEN, UK). ..

    Real-time Polymerase Chain Reaction:

    Article Title: High Magnesium Corrosion Rate has an Effect on Osteoclast and Mesenchymal Stem Cell Role During Bone Remodelling
    Article Snippet: The quantity and purity of RNA was measured using a Nanodrop spectrophotometer (Themo Fisher Scientific). .. The RNA produced was used for quantitative real time PCR (qRT-PCR) to amplify the primers of osteogenesis-related genes: Runx-2, collagen type 1-alpha 1 (COL1A1) and osteocalcin (Quantitect primer assays, QIAGEN, UK) using a one-step real time PCR machine (ViiA 7, Applied Biosystems) and QuantiFast SYBR Green RT-PCR Kit (QIAGEN, UK). ..

    Article Title: IFN-λ prevents influenza virus spread from the upper airways to the lungs and limits virus transmission
    Article Snippet: DNA was removed by using DNAse I, Amplification Grade (Invitrogen). cDNA was generated using the Thermoscript RT-PCR system, following the manufacturer’s instructions (Invitrogen). .. The cDNA served as a template for the amplification of genes of interest (IAV-M1: forward: 5’-AAGACCAATCCTGTCACCTCTGA-3’; reverse: 5’-CAAAGCGTCTACGCTGCAGTCC-3’, Ifnl2/3 (mm0420156_gH, Applied Biosystems), Ifnb1 : forward: 5’-CCTGGAGCAGCTGAATGGAA-3’; reverse: 5’-CACTGTCTGCTGGTGGAGTTCATC-3’; probe: 5’-[6FAM]CCTACAGGGCGGACTTCAAG[BHQ1]−3’, Ifna4 (QT01774353, QuantiTect Primer Assay, Qiagen), Isg15 : forward: 5’-GAGCTAGAGCCTGCAGCAAT-3’; reverse: 5’-TTCTGGGCAATCTGCTTCTT-3’, Stat1 : forward: 5’-TCACAGTGGTTCGAGCTTCAG-3’; reverse: 5’-CGAGACATCATAGGCAGCGTG-3’, Mx1 : forward: 5’-TCTGAGGAGAGCCAGACGAT-3’; reverse: 5’-ACTCTGGTCCCCAATGACAG-3’ and Hprt (mm00446968_m1, Applied Biosystems)) by real-time PCR, using TaqMan Gene Expression Assays (Applied Biosystems), Universal PCR Master Mix (Applied Biosystems) and the ABI-Prism 7900 sequence detection system (Applied Biosystems). .. The increase in mRNA expression was determined by the 2-ΔCt method relative to the expression of Hprt or by the 2-ΔΔCt method relative to mock.

    Quantitative RT-PCR:

    Article Title: High Magnesium Corrosion Rate has an Effect on Osteoclast and Mesenchymal Stem Cell Role During Bone Remodelling
    Article Snippet: The quantity and purity of RNA was measured using a Nanodrop spectrophotometer (Themo Fisher Scientific). .. The RNA produced was used for quantitative real time PCR (qRT-PCR) to amplify the primers of osteogenesis-related genes: Runx-2, collagen type 1-alpha 1 (COL1A1) and osteocalcin (Quantitect primer assays, QIAGEN, UK) using a one-step real time PCR machine (ViiA 7, Applied Biosystems) and QuantiFast SYBR Green RT-PCR Kit (QIAGEN, UK). ..

    Article Title: LncRNA NLIPMT Inhibits Tumorigenesis in Esophageal Squamous-Cell Carcinomas by Regulating miR-320/Survivin Axis
    Article Snippet: .. To measure the mRNA expression of NLIPMT and survivin, all reverse transcriptions were performed using Tetro Reverse Transcriptase (Bioline), and all qRT-PCR assays were performed using QuantiTect SYBR Green PCR Kit (Qiagen). .. With GAPDH as endogenous control, gene expression was normalized.

    Article Title: Vaccination With a FAT1-Derived B Cell Epitope Combined With Tumor-Specific B and T Cell Epitopes Elicits Additive Protection in Cancer Mouse Models
    Article Snippet: RNA extraction from cell lines was performed using the RNeasy mini kit (QIAGEN) and 500 ng of it were reverse transcribed using Superscript III Reverse Transcriptase (Life Technologies) with oligo dT. .. Triplicate cDNA samples from each cell line (equal to 50 ng RNA/sample) were subjected to qRT-PCR to assess the relative FAT1 (Quantitect® Primer Assay for mouse FAT1, QIAGEN) transcript levels using the Quantitect® SYBR Green PCR kit (QIAGEN). .. MAPK, actin (Quantitect® Primer Assay for Human actin or MAPK, QIAGEN), were used as an internal normalization controls, respectively.

    SYBR Green Assay:

    Article Title: High Magnesium Corrosion Rate has an Effect on Osteoclast and Mesenchymal Stem Cell Role During Bone Remodelling
    Article Snippet: The quantity and purity of RNA was measured using a Nanodrop spectrophotometer (Themo Fisher Scientific). .. The RNA produced was used for quantitative real time PCR (qRT-PCR) to amplify the primers of osteogenesis-related genes: Runx-2, collagen type 1-alpha 1 (COL1A1) and osteocalcin (Quantitect primer assays, QIAGEN, UK) using a one-step real time PCR machine (ViiA 7, Applied Biosystems) and QuantiFast SYBR Green RT-PCR Kit (QIAGEN, UK). ..

    Article Title: LncRNA NLIPMT Inhibits Tumorigenesis in Esophageal Squamous-Cell Carcinomas by Regulating miR-320/Survivin Axis
    Article Snippet: .. To measure the mRNA expression of NLIPMT and survivin, all reverse transcriptions were performed using Tetro Reverse Transcriptase (Bioline), and all qRT-PCR assays were performed using QuantiTect SYBR Green PCR Kit (Qiagen). .. With GAPDH as endogenous control, gene expression was normalized.

    Article Title: Vaccination With a FAT1-Derived B Cell Epitope Combined With Tumor-Specific B and T Cell Epitopes Elicits Additive Protection in Cancer Mouse Models
    Article Snippet: RNA extraction from cell lines was performed using the RNeasy mini kit (QIAGEN) and 500 ng of it were reverse transcribed using Superscript III Reverse Transcriptase (Life Technologies) with oligo dT. .. Triplicate cDNA samples from each cell line (equal to 50 ng RNA/sample) were subjected to qRT-PCR to assess the relative FAT1 (Quantitect® Primer Assay for mouse FAT1, QIAGEN) transcript levels using the Quantitect® SYBR Green PCR kit (QIAGEN). .. MAPK, actin (Quantitect® Primer Assay for Human actin or MAPK, QIAGEN), were used as an internal normalization controls, respectively.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: High Magnesium Corrosion Rate has an Effect on Osteoclast and Mesenchymal Stem Cell Role During Bone Remodelling
    Article Snippet: The quantity and purity of RNA was measured using a Nanodrop spectrophotometer (Themo Fisher Scientific). .. The RNA produced was used for quantitative real time PCR (qRT-PCR) to amplify the primers of osteogenesis-related genes: Runx-2, collagen type 1-alpha 1 (COL1A1) and osteocalcin (Quantitect primer assays, QIAGEN, UK) using a one-step real time PCR machine (ViiA 7, Applied Biosystems) and QuantiFast SYBR Green RT-PCR Kit (QIAGEN, UK). ..

    Amplification:

    Article Title: IFN-λ prevents influenza virus spread from the upper airways to the lungs and limits virus transmission
    Article Snippet: DNA was removed by using DNAse I, Amplification Grade (Invitrogen). cDNA was generated using the Thermoscript RT-PCR system, following the manufacturer’s instructions (Invitrogen). .. The cDNA served as a template for the amplification of genes of interest (IAV-M1: forward: 5’-AAGACCAATCCTGTCACCTCTGA-3’; reverse: 5’-CAAAGCGTCTACGCTGCAGTCC-3’, Ifnl2/3 (mm0420156_gH, Applied Biosystems), Ifnb1 : forward: 5’-CCTGGAGCAGCTGAATGGAA-3’; reverse: 5’-CACTGTCTGCTGGTGGAGTTCATC-3’; probe: 5’-[6FAM]CCTACAGGGCGGACTTCAAG[BHQ1]−3’, Ifna4 (QT01774353, QuantiTect Primer Assay, Qiagen), Isg15 : forward: 5’-GAGCTAGAGCCTGCAGCAAT-3’; reverse: 5’-TTCTGGGCAATCTGCTTCTT-3’, Stat1 : forward: 5’-TCACAGTGGTTCGAGCTTCAG-3’; reverse: 5’-CGAGACATCATAGGCAGCGTG-3’, Mx1 : forward: 5’-TCTGAGGAGAGCCAGACGAT-3’; reverse: 5’-ACTCTGGTCCCCAATGACAG-3’ and Hprt (mm00446968_m1, Applied Biosystems)) by real-time PCR, using TaqMan Gene Expression Assays (Applied Biosystems), Universal PCR Master Mix (Applied Biosystems) and the ABI-Prism 7900 sequence detection system (Applied Biosystems). .. The increase in mRNA expression was determined by the 2-ΔCt method relative to the expression of Hprt or by the 2-ΔΔCt method relative to mock.

    Article Title: FOXP3 expression is modulated by TGF-β1/NOTCH1 pathway in human melanoma
    Article Snippet: RNA was reverse transcribed into cDNA using the SuperScript III First-Strand Synthesis system (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. mRNA expression was measured using SYBR-Green RT-qPCR using the Rotor-Gene Q thermal cycler (Qiagen, Inc., Valencia, CA, USA). .. Amplification reactions were performed using primers specific for FOXP3 (forward, 5′-CACAACATGCGACCCC CTTTCACC-3′ and reverse, 5′-AGGTTGTGGCGGAT GGCGTTCTTC-3′), NOTCH1 and HES1 (QuantiTect® Primer Assay; Qiagen, Inc.). .. The PCR reaction was carried out in 25 μ l buffer, containing 50 ng cDNA, 1 μ M of each primer and 12.5 μ l 2X RotorGene SYBR-Green PCR Master Mix (Qiagen, Inc.).

    Expressing:

    Article Title: IFN-λ prevents influenza virus spread from the upper airways to the lungs and limits virus transmission
    Article Snippet: DNA was removed by using DNAse I, Amplification Grade (Invitrogen). cDNA was generated using the Thermoscript RT-PCR system, following the manufacturer’s instructions (Invitrogen). .. The cDNA served as a template for the amplification of genes of interest (IAV-M1: forward: 5’-AAGACCAATCCTGTCACCTCTGA-3’; reverse: 5’-CAAAGCGTCTACGCTGCAGTCC-3’, Ifnl2/3 (mm0420156_gH, Applied Biosystems), Ifnb1 : forward: 5’-CCTGGAGCAGCTGAATGGAA-3’; reverse: 5’-CACTGTCTGCTGGTGGAGTTCATC-3’; probe: 5’-[6FAM]CCTACAGGGCGGACTTCAAG[BHQ1]−3’, Ifna4 (QT01774353, QuantiTect Primer Assay, Qiagen), Isg15 : forward: 5’-GAGCTAGAGCCTGCAGCAAT-3’; reverse: 5’-TTCTGGGCAATCTGCTTCTT-3’, Stat1 : forward: 5’-TCACAGTGGTTCGAGCTTCAG-3’; reverse: 5’-CGAGACATCATAGGCAGCGTG-3’, Mx1 : forward: 5’-TCTGAGGAGAGCCAGACGAT-3’; reverse: 5’-ACTCTGGTCCCCAATGACAG-3’ and Hprt (mm00446968_m1, Applied Biosystems)) by real-time PCR, using TaqMan Gene Expression Assays (Applied Biosystems), Universal PCR Master Mix (Applied Biosystems) and the ABI-Prism 7900 sequence detection system (Applied Biosystems). .. The increase in mRNA expression was determined by the 2-ΔCt method relative to the expression of Hprt or by the 2-ΔΔCt method relative to mock.

    Article Title: LncRNA NLIPMT Inhibits Tumorigenesis in Esophageal Squamous-Cell Carcinomas by Regulating miR-320/Survivin Axis
    Article Snippet: .. To measure the mRNA expression of NLIPMT and survivin, all reverse transcriptions were performed using Tetro Reverse Transcriptase (Bioline), and all qRT-PCR assays were performed using QuantiTect SYBR Green PCR Kit (Qiagen). .. With GAPDH as endogenous control, gene expression was normalized.

    Article Title: Telomere dysfunction promotes transdifferentiation of human fibroblasts into myofibroblasts. Telomere dysfunction promotes transdifferentiation of human fibroblasts into myofibroblasts
    Article Snippet: Quantitative PCR was performed using Bio‐Rad Real Time PCR detection system with the SYBR Green PCR Master Mix (Bio‐Rad). .. The following primers were used: COL1A1 forward (5′‐CACACGTCTCGGTCATGGTA‐3′) and reverse (5′‐CGGCTCCTGCTCCTCTTAG‐3′); COL1A2 forward (5′‐AGCAGGTCCTTGGAAACCTT‐3′) and reverse (5′‐GAAAAGGAGTTGGACTTGGC‐3′); ACTA2 (α‐SMA) forward (5′‐GATGGCCACTGCCGCATCCT‐3′) and reverse (5′‐ACAGGGTCTCTGGGCAGCGG‐3′); MMP9 forward (5′ GGTGATTGACGACGCCTTTGC 3′) and reverse (5′ CGCGACACCAAACTGGATGAC 3′); TIMP forward (5′ CCAGGACGCCTTCTGCAAC 3′) and reverse (5′ CCTCCTTTACCAGCTTCTTCCC 3′); Fibronectin forward (5′‐CCA TCG CAA ACC GCT GCC AT‐3′) and reverse (5′‐AAC ACT TCT CAG CTA TGG GCT T‐3′); GAPDH forward (5′‐AAG AAG GTG GTG AAG CAG GC‐3′) and reverse (5′‐TCC ACC ACC CTG TTG CTG TA‐3′); CTGF forward (5′‐CAGGCTGGGGAGAAGCAGAGTCGT‐3′) and reverse (5′‐CTGGTGCAGCCAGAAAGCTCAA‐3′); macroH2A forward (5′‐ AACAAGAAGGCCCGGATAGC‐3′) and reverse (5′‐CCTTTTAGCAGCTGGTTGAGC); p53 forward (5′‐ TTCCGAGAGCTGAATGAGGC‐3′) and reverse (5′‐CTTCAGGTGGCTGGAGTGAG‐3′); CDKN1A (Qiagen Quantitect primer Assay, Cat # QT00062090); MMP2 forward (GGCAACATGACCAGCTG) and reverse (CAAGGTGCTGGCTGAGTAGATC); PAI‐1 (Plasminogen Activator Inhibitor) Forward (GGCAACATGACCAGCTG) and reverse (GGCCAAGTGATGGAACCC); HP1‐β forward (5′‐ CTTTGCAGGACTACGGAGGAG‐3′) and reverse (5′‐ GTGTAAAGGGTGACGCTGCTTG‐3′); Relative changes in mRNA expression were calculated using GAPDH as an internal reference. ..

    Polymerase Chain Reaction:

    Article Title: IFN-λ prevents influenza virus spread from the upper airways to the lungs and limits virus transmission
    Article Snippet: DNA was removed by using DNAse I, Amplification Grade (Invitrogen). cDNA was generated using the Thermoscript RT-PCR system, following the manufacturer’s instructions (Invitrogen). .. The cDNA served as a template for the amplification of genes of interest (IAV-M1: forward: 5’-AAGACCAATCCTGTCACCTCTGA-3’; reverse: 5’-CAAAGCGTCTACGCTGCAGTCC-3’, Ifnl2/3 (mm0420156_gH, Applied Biosystems), Ifnb1 : forward: 5’-CCTGGAGCAGCTGAATGGAA-3’; reverse: 5’-CACTGTCTGCTGGTGGAGTTCATC-3’; probe: 5’-[6FAM]CCTACAGGGCGGACTTCAAG[BHQ1]−3’, Ifna4 (QT01774353, QuantiTect Primer Assay, Qiagen), Isg15 : forward: 5’-GAGCTAGAGCCTGCAGCAAT-3’; reverse: 5’-TTCTGGGCAATCTGCTTCTT-3’, Stat1 : forward: 5’-TCACAGTGGTTCGAGCTTCAG-3’; reverse: 5’-CGAGACATCATAGGCAGCGTG-3’, Mx1 : forward: 5’-TCTGAGGAGAGCCAGACGAT-3’; reverse: 5’-ACTCTGGTCCCCAATGACAG-3’ and Hprt (mm00446968_m1, Applied Biosystems)) by real-time PCR, using TaqMan Gene Expression Assays (Applied Biosystems), Universal PCR Master Mix (Applied Biosystems) and the ABI-Prism 7900 sequence detection system (Applied Biosystems). .. The increase in mRNA expression was determined by the 2-ΔCt method relative to the expression of Hprt or by the 2-ΔΔCt method relative to mock.

    Article Title: LncRNA NLIPMT Inhibits Tumorigenesis in Esophageal Squamous-Cell Carcinomas by Regulating miR-320/Survivin Axis
    Article Snippet: .. To measure the mRNA expression of NLIPMT and survivin, all reverse transcriptions were performed using Tetro Reverse Transcriptase (Bioline), and all qRT-PCR assays were performed using QuantiTect SYBR Green PCR Kit (Qiagen). .. With GAPDH as endogenous control, gene expression was normalized.

    Article Title: Vaccination With a FAT1-Derived B Cell Epitope Combined With Tumor-Specific B and T Cell Epitopes Elicits Additive Protection in Cancer Mouse Models
    Article Snippet: RNA extraction from cell lines was performed using the RNeasy mini kit (QIAGEN) and 500 ng of it were reverse transcribed using Superscript III Reverse Transcriptase (Life Technologies) with oligo dT. .. Triplicate cDNA samples from each cell line (equal to 50 ng RNA/sample) were subjected to qRT-PCR to assess the relative FAT1 (Quantitect® Primer Assay for mouse FAT1, QIAGEN) transcript levels using the Quantitect® SYBR Green PCR kit (QIAGEN). .. MAPK, actin (Quantitect® Primer Assay for Human actin or MAPK, QIAGEN), were used as an internal normalization controls, respectively.

    Sequencing:

    Article Title: IFN-λ prevents influenza virus spread from the upper airways to the lungs and limits virus transmission
    Article Snippet: DNA was removed by using DNAse I, Amplification Grade (Invitrogen). cDNA was generated using the Thermoscript RT-PCR system, following the manufacturer’s instructions (Invitrogen). .. The cDNA served as a template for the amplification of genes of interest (IAV-M1: forward: 5’-AAGACCAATCCTGTCACCTCTGA-3’; reverse: 5’-CAAAGCGTCTACGCTGCAGTCC-3’, Ifnl2/3 (mm0420156_gH, Applied Biosystems), Ifnb1 : forward: 5’-CCTGGAGCAGCTGAATGGAA-3’; reverse: 5’-CACTGTCTGCTGGTGGAGTTCATC-3’; probe: 5’-[6FAM]CCTACAGGGCGGACTTCAAG[BHQ1]−3’, Ifna4 (QT01774353, QuantiTect Primer Assay, Qiagen), Isg15 : forward: 5’-GAGCTAGAGCCTGCAGCAAT-3’; reverse: 5’-TTCTGGGCAATCTGCTTCTT-3’, Stat1 : forward: 5’-TCACAGTGGTTCGAGCTTCAG-3’; reverse: 5’-CGAGACATCATAGGCAGCGTG-3’, Mx1 : forward: 5’-TCTGAGGAGAGCCAGACGAT-3’; reverse: 5’-ACTCTGGTCCCCAATGACAG-3’ and Hprt (mm00446968_m1, Applied Biosystems)) by real-time PCR, using TaqMan Gene Expression Assays (Applied Biosystems), Universal PCR Master Mix (Applied Biosystems) and the ABI-Prism 7900 sequence detection system (Applied Biosystems). .. The increase in mRNA expression was determined by the 2-ΔCt method relative to the expression of Hprt or by the 2-ΔΔCt method relative to mock.

    Cellular Antioxidant Activity Assay:

    Article Title: Telomere dysfunction promotes transdifferentiation of human fibroblasts into myofibroblasts. Telomere dysfunction promotes transdifferentiation of human fibroblasts into myofibroblasts
    Article Snippet: Quantitative PCR was performed using Bio‐Rad Real Time PCR detection system with the SYBR Green PCR Master Mix (Bio‐Rad). .. The following primers were used: COL1A1 forward (5′‐CACACGTCTCGGTCATGGTA‐3′) and reverse (5′‐CGGCTCCTGCTCCTCTTAG‐3′); COL1A2 forward (5′‐AGCAGGTCCTTGGAAACCTT‐3′) and reverse (5′‐GAAAAGGAGTTGGACTTGGC‐3′); ACTA2 (α‐SMA) forward (5′‐GATGGCCACTGCCGCATCCT‐3′) and reverse (5′‐ACAGGGTCTCTGGGCAGCGG‐3′); MMP9 forward (5′ GGTGATTGACGACGCCTTTGC 3′) and reverse (5′ CGCGACACCAAACTGGATGAC 3′); TIMP forward (5′ CCAGGACGCCTTCTGCAAC 3′) and reverse (5′ CCTCCTTTACCAGCTTCTTCCC 3′); Fibronectin forward (5′‐CCA TCG CAA ACC GCT GCC AT‐3′) and reverse (5′‐AAC ACT TCT CAG CTA TGG GCT T‐3′); GAPDH forward (5′‐AAG AAG GTG GTG AAG CAG GC‐3′) and reverse (5′‐TCC ACC ACC CTG TTG CTG TA‐3′); CTGF forward (5′‐CAGGCTGGGGAGAAGCAGAGTCGT‐3′) and reverse (5′‐CTGGTGCAGCCAGAAAGCTCAA‐3′); macroH2A forward (5′‐ AACAAGAAGGCCCGGATAGC‐3′) and reverse (5′‐CCTTTTAGCAGCTGGTTGAGC); p53 forward (5′‐ TTCCGAGAGCTGAATGAGGC‐3′) and reverse (5′‐CTTCAGGTGGCTGGAGTGAG‐3′); CDKN1A (Qiagen Quantitect primer Assay, Cat # QT00062090); MMP2 forward (GGCAACATGACCAGCTG) and reverse (CAAGGTGCTGGCTGAGTAGATC); PAI‐1 (Plasminogen Activator Inhibitor) Forward (GGCAACATGACCAGCTG) and reverse (GGCCAAGTGATGGAACCC); HP1‐β forward (5′‐ CTTTGCAGGACTACGGAGGAG‐3′) and reverse (5′‐ GTGTAAAGGGTGACGCTGCTTG‐3′); Relative changes in mRNA expression were calculated using GAPDH as an internal reference. ..

    Activated Clotting Time Assay:

    Article Title: Telomere dysfunction promotes transdifferentiation of human fibroblasts into myofibroblasts. Telomere dysfunction promotes transdifferentiation of human fibroblasts into myofibroblasts
    Article Snippet: Quantitative PCR was performed using Bio‐Rad Real Time PCR detection system with the SYBR Green PCR Master Mix (Bio‐Rad). .. The following primers were used: COL1A1 forward (5′‐CACACGTCTCGGTCATGGTA‐3′) and reverse (5′‐CGGCTCCTGCTCCTCTTAG‐3′); COL1A2 forward (5′‐AGCAGGTCCTTGGAAACCTT‐3′) and reverse (5′‐GAAAAGGAGTTGGACTTGGC‐3′); ACTA2 (α‐SMA) forward (5′‐GATGGCCACTGCCGCATCCT‐3′) and reverse (5′‐ACAGGGTCTCTGGGCAGCGG‐3′); MMP9 forward (5′ GGTGATTGACGACGCCTTTGC 3′) and reverse (5′ CGCGACACCAAACTGGATGAC 3′); TIMP forward (5′ CCAGGACGCCTTCTGCAAC 3′) and reverse (5′ CCTCCTTTACCAGCTTCTTCCC 3′); Fibronectin forward (5′‐CCA TCG CAA ACC GCT GCC AT‐3′) and reverse (5′‐AAC ACT TCT CAG CTA TGG GCT T‐3′); GAPDH forward (5′‐AAG AAG GTG GTG AAG CAG GC‐3′) and reverse (5′‐TCC ACC ACC CTG TTG CTG TA‐3′); CTGF forward (5′‐CAGGCTGGGGAGAAGCAGAGTCGT‐3′) and reverse (5′‐CTGGTGCAGCCAGAAAGCTCAA‐3′); macroH2A forward (5′‐ AACAAGAAGGCCCGGATAGC‐3′) and reverse (5′‐CCTTTTAGCAGCTGGTTGAGC); p53 forward (5′‐ TTCCGAGAGCTGAATGAGGC‐3′) and reverse (5′‐CTTCAGGTGGCTGGAGTGAG‐3′); CDKN1A (Qiagen Quantitect primer Assay, Cat # QT00062090); MMP2 forward (GGCAACATGACCAGCTG) and reverse (CAAGGTGCTGGCTGAGTAGATC); PAI‐1 (Plasminogen Activator Inhibitor) Forward (GGCAACATGACCAGCTG) and reverse (GGCCAAGTGATGGAACCC); HP1‐β forward (5′‐ CTTTGCAGGACTACGGAGGAG‐3′) and reverse (5′‐ GTGTAAAGGGTGACGCTGCTTG‐3′); Relative changes in mRNA expression were calculated using GAPDH as an internal reference. ..

    CTG Assay:

    Article Title: Telomere dysfunction promotes transdifferentiation of human fibroblasts into myofibroblasts. Telomere dysfunction promotes transdifferentiation of human fibroblasts into myofibroblasts
    Article Snippet: Quantitative PCR was performed using Bio‐Rad Real Time PCR detection system with the SYBR Green PCR Master Mix (Bio‐Rad). .. The following primers were used: COL1A1 forward (5′‐CACACGTCTCGGTCATGGTA‐3′) and reverse (5′‐CGGCTCCTGCTCCTCTTAG‐3′); COL1A2 forward (5′‐AGCAGGTCCTTGGAAACCTT‐3′) and reverse (5′‐GAAAAGGAGTTGGACTTGGC‐3′); ACTA2 (α‐SMA) forward (5′‐GATGGCCACTGCCGCATCCT‐3′) and reverse (5′‐ACAGGGTCTCTGGGCAGCGG‐3′); MMP9 forward (5′ GGTGATTGACGACGCCTTTGC 3′) and reverse (5′ CGCGACACCAAACTGGATGAC 3′); TIMP forward (5′ CCAGGACGCCTTCTGCAAC 3′) and reverse (5′ CCTCCTTTACCAGCTTCTTCCC 3′); Fibronectin forward (5′‐CCA TCG CAA ACC GCT GCC AT‐3′) and reverse (5′‐AAC ACT TCT CAG CTA TGG GCT T‐3′); GAPDH forward (5′‐AAG AAG GTG GTG AAG CAG GC‐3′) and reverse (5′‐TCC ACC ACC CTG TTG CTG TA‐3′); CTGF forward (5′‐CAGGCTGGGGAGAAGCAGAGTCGT‐3′) and reverse (5′‐CTGGTGCAGCCAGAAAGCTCAA‐3′); macroH2A forward (5′‐ AACAAGAAGGCCCGGATAGC‐3′) and reverse (5′‐CCTTTTAGCAGCTGGTTGAGC); p53 forward (5′‐ TTCCGAGAGCTGAATGAGGC‐3′) and reverse (5′‐CTTCAGGTGGCTGGAGTGAG‐3′); CDKN1A (Qiagen Quantitect primer Assay, Cat # QT00062090); MMP2 forward (GGCAACATGACCAGCTG) and reverse (CAAGGTGCTGGCTGAGTAGATC); PAI‐1 (Plasminogen Activator Inhibitor) Forward (GGCAACATGACCAGCTG) and reverse (GGCCAAGTGATGGAACCC); HP1‐β forward (5′‐ CTTTGCAGGACTACGGAGGAG‐3′) and reverse (5′‐ GTGTAAAGGGTGACGCTGCTTG‐3′); Relative changes in mRNA expression were calculated using GAPDH as an internal reference. ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Qiagen ifna4
    Basal expression of IFN-λ genes is reduced in Ifnar1 −/− mice. ( A ) Basal expression of type I ( Ifnb1 and <t>Ifna4</t> ), type III IFNs ( Ifnl2/3 ) and Mx1 was measured by RT-qPCR in snout homogenates of WT (n = 6), Ifnar1 −/− (n = 6) and Ifnlr1 −/− (n = 6). Gene expression levels are shown relative to the housekeeping gene Hprt . Symbols represent individual mice, and bars represent means ± SEM. Statistical analysis: One-way ANOVA with Tukey’s multiple comparisons; asterisks indicate p-values: ***p
    Ifna4, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ifna4/product/Qiagen
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    ifna4 - by Bioz Stars, 2021-06
    99/100 stars
      Buy from Supplier

    86
    Qiagen sybr green fluorescent based primer assay
    Verification of the knock out efficiency of <t>VPREB1</t> gene in myeloma cells by qPCR. Evaluation of VPREB1 mRNA expression in human myeloma cells was determined by qPCR using <t>SYBR-Green</t> fluorescent-based primer assay [Hs_VPREB1_1_SG QuantiTect Primer Assay, cat no: 249900, ID: QT00214466], (Qiagen; Germany). A highly significant decrease (p
    Sybr Green Fluorescent Based Primer Assay, supplied by Qiagen, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sybr green fluorescent based primer assay/product/Qiagen
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    sybr green fluorescent based primer assay - by Bioz Stars, 2021-06
    86/100 stars
      Buy from Supplier

    Image Search Results


    Basal expression of IFN-λ genes is reduced in Ifnar1 −/− mice. ( A ) Basal expression of type I ( Ifnb1 and Ifna4 ), type III IFNs ( Ifnl2/3 ) and Mx1 was measured by RT-qPCR in snout homogenates of WT (n = 6), Ifnar1 −/− (n = 6) and Ifnlr1 −/− (n = 6). Gene expression levels are shown relative to the housekeeping gene Hprt . Symbols represent individual mice, and bars represent means ± SEM. Statistical analysis: One-way ANOVA with Tukey’s multiple comparisons; asterisks indicate p-values: ***p

    Journal: eLife

    Article Title: IFN-λ prevents influenza virus spread from the upper airways to the lungs and limits virus transmission

    doi: 10.7554/eLife.33354

    Figure Lengend Snippet: Basal expression of IFN-λ genes is reduced in Ifnar1 −/− mice. ( A ) Basal expression of type I ( Ifnb1 and Ifna4 ), type III IFNs ( Ifnl2/3 ) and Mx1 was measured by RT-qPCR in snout homogenates of WT (n = 6), Ifnar1 −/− (n = 6) and Ifnlr1 −/− (n = 6). Gene expression levels are shown relative to the housekeeping gene Hprt . Symbols represent individual mice, and bars represent means ± SEM. Statistical analysis: One-way ANOVA with Tukey’s multiple comparisons; asterisks indicate p-values: ***p

    Article Snippet: The cDNA served as a template for the amplification of genes of interest (IAV-M1: forward: 5’-AAGACCAATCCTGTCACCTCTGA-3’; reverse: 5’-CAAAGCGTCTACGCTGCAGTCC-3’, Ifnl2/3 (mm0420156_gH, Applied Biosystems), Ifnb1 : forward: 5’-CCTGGAGCAGCTGAATGGAA-3’; reverse: 5’-CACTGTCTGCTGGTGGAGTTCATC-3’; probe: 5’-[6FAM]CCTACAGGGCGGACTTCAAG[BHQ1]−3’, Ifna4 (QT01774353, QuantiTect Primer Assay, Qiagen), Isg15 : forward: 5’-GAGCTAGAGCCTGCAGCAAT-3’; reverse: 5’-TTCTGGGCAATCTGCTTCTT-3’, Stat1 : forward: 5’-TCACAGTGGTTCGAGCTTCAG-3’; reverse: 5’-CGAGACATCATAGGCAGCGTG-3’, Mx1 : forward: 5’-TCTGAGGAGAGCCAGACGAT-3’; reverse: 5’-ACTCTGGTCCCCAATGACAG-3’ and Hprt (mm00446968_m1, Applied Biosystems)) by real-time PCR, using TaqMan Gene Expression Assays (Applied Biosystems), Universal PCR Master Mix (Applied Biosystems) and the ABI-Prism 7900 sequence detection system (Applied Biosystems).

    Techniques: Expressing, Mouse Assay, Quantitative RT-PCR

    The effect of Mg100 conditioned media on the expression of osteoblast related genes and ALP levels. Fold change in the gene expression of (A ) Runx-2 and ( B ) osteocalcin in cells cultured in filtered or non-filtered medium over a period of 12 days was investigated. On day 2, a significant fold change (*p

    Journal: Scientific Reports

    Article Title: High Magnesium Corrosion Rate has an Effect on Osteoclast and Mesenchymal Stem Cell Role During Bone Remodelling

    doi: 10.1038/s41598-018-28476-w

    Figure Lengend Snippet: The effect of Mg100 conditioned media on the expression of osteoblast related genes and ALP levels. Fold change in the gene expression of (A ) Runx-2 and ( B ) osteocalcin in cells cultured in filtered or non-filtered medium over a period of 12 days was investigated. On day 2, a significant fold change (*p

    Article Snippet: The RNA produced was used for quantitative real time PCR (qRT-PCR) to amplify the primers of osteogenesis-related genes: Runx-2, collagen type 1-alpha 1 (COL1A1) and osteocalcin (Quantitect primer assays, QIAGEN, UK) using a one-step real time PCR machine (ViiA 7, Applied Biosystems) and QuantiFast SYBR Green RT-PCR Kit (QIAGEN, UK).

    Techniques: Expressing, ALP Assay, Cell Culture

    Relative mRNA expression (real time PCR using rat-specific primers) compared with one control subject at the first week (early phase, Ep) and the 14th week (late phase, Lp) after irradiation for each group. (A) Interleukin-6 (IL-6). (B) Hypoxia-inducible factor (HIF)-1α. (C) Vascular endothelial growth factor (VEGF)-A. (D) Nuclear factor (NF)-κB. Data represent the mean and 95% confidence interval of the results of three independent experiments, each with six samples. A significant Ep–Lp decrease pairs ( P

    Journal: Journal of Radiation Research

    Article Title: Pancreatic radiation effect in apoptosis-related rectal radiation toxicity

    doi: 10.1093/jrr/rry043

    Figure Lengend Snippet: Relative mRNA expression (real time PCR using rat-specific primers) compared with one control subject at the first week (early phase, Ep) and the 14th week (late phase, Lp) after irradiation for each group. (A) Interleukin-6 (IL-6). (B) Hypoxia-inducible factor (HIF)-1α. (C) Vascular endothelial growth factor (VEGF)-A. (D) Nuclear factor (NF)-κB. Data represent the mean and 95% confidence interval of the results of three independent experiments, each with six samples. A significant Ep–Lp decrease pairs ( P

    Article Snippet: The following primers were used: interleukin-6 (IL-6) (Rn_Il6_1_SG QuantiTect Primer Assay, Qiagen), nuclear factor (NF)-κB (Rn_Nfkb1_1_SG QuantiTect Primer Assay), hypoxia-inducible factor (HIF)-1α (Rn_Hif1a_1_SG QuantiTect Primer Assay), vascular endothelial growth factor (VEGF)-A (Rn_RGD:619991_1_SG QuantiTect Primer Assay), and of the endogenous control gene 18s RNA (Rn_Rn18s_1_SG QuantiTect Primer Assay).

    Techniques: Expressing, Real-time Polymerase Chain Reaction, Irradiation

    Verification of the knock out efficiency of VPREB1 gene in myeloma cells by qPCR. Evaluation of VPREB1 mRNA expression in human myeloma cells was determined by qPCR using SYBR-Green fluorescent-based primer assay [Hs_VPREB1_1_SG QuantiTect Primer Assay, cat no: 249900, ID: QT00214466], (Qiagen; Germany). A highly significant decrease (p

    Journal: PLoS ONE

    Article Title: CRISPR/Cas9 mediated knock-out of VPREB1 gene induces a cytotoxic effect in myeloma cells

    doi: 10.1371/journal.pone.0245349

    Figure Lengend Snippet: Verification of the knock out efficiency of VPREB1 gene in myeloma cells by qPCR. Evaluation of VPREB1 mRNA expression in human myeloma cells was determined by qPCR using SYBR-Green fluorescent-based primer assay [Hs_VPREB1_1_SG QuantiTect Primer Assay, cat no: 249900, ID: QT00214466], (Qiagen; Germany). A highly significant decrease (p

    Article Snippet: The VPREB1 gene expression was measured by quantitative real time PCR (qPCR) using SYBR-Green fluorescent-based primer assay [Hs_VPREB1_1_SG QuantiTect Primer Assay, cat no: 249900, ID: QT00214466], (Qiagen; Germany).

    Techniques: Knock-Out, Real-time Polymerase Chain Reaction, Expressing, SYBR Green Assay