glyceraldehyde 3 phosphate dehydrogenase  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Name:
    QuantiTect Primer Assay
    Description:
    QuantiTect Primer Assays are genomewide bioinformatically validated primer sets for use in SYBR Green based real time RT PCR on any cycler Assays are available for all genes from human rat mouse and many other species Each assay for a specific gene is supplied as a lyophilized mix of forward and reverse primers that can be easily reconstituted to obtain a 10x assay solution reaction components for real time RT PCR need to be ordered separately When used in combination with QuantiFast QuantiTect Rotor Gene or FastLane Kits for SYBR Green detection QuantiTect Primer Assays guarantee highly specific and sensitive results in real time RT PCR that are comparable to probe based detection
    Catalog Number:
    249900
    Price:
    96.8
    Category:
    Assay PCR qPCR
    Buy from Supplier


    Structured Review

    Qiagen glyceraldehyde 3 phosphate dehydrogenase
    QuantiTect Primer Assay
    QuantiTect Primer Assays are genomewide bioinformatically validated primer sets for use in SYBR Green based real time RT PCR on any cycler Assays are available for all genes from human rat mouse and many other species Each assay for a specific gene is supplied as a lyophilized mix of forward and reverse primers that can be easily reconstituted to obtain a 10x assay solution reaction components for real time RT PCR need to be ordered separately When used in combination with QuantiFast QuantiTect Rotor Gene or FastLane Kits for SYBR Green detection QuantiTect Primer Assays guarantee highly specific and sensitive results in real time RT PCR that are comparable to probe based detection
    https://www.bioz.com/result/glyceraldehyde 3 phosphate dehydrogenase/product/Qiagen
    Average 93 stars, based on 178 article reviews
    Price from $9.99 to $1999.99
    glyceraldehyde 3 phosphate dehydrogenase - by Bioz Stars, 2020-04
    93/100 stars

    Images

    1) Product Images from "Epigallocatechin-3-gallate protects against hepatic ischaemia–reperfusion injury by reducing oxidative stress and apoptotic cell death"

    Article Title: Epigallocatechin-3-gallate protects against hepatic ischaemia–reperfusion injury by reducing oxidative stress and apoptotic cell death

    Journal: The Journal of International Medical Research

    doi: 10.1177/0300060516662735

    Western blot and reverse transcription–polymerase chain reaction (RT–PCR) analyses to investigate the effects of pretreatment with 50 mg/kg epigallocatechin-3-gallate (EGCG) prior to hepatic ischaemia–reperfusion injury on antioxidant enzyme protein and mRNA levels in mice. The three treatment groups were as follows: sham-operated group (Sham,  n  = 10), hepatic ischaemia–reperfusion injury group (IR,  n  = 10), and EGCG with ischaemia–reperfusion injury group (EGCG-treated IR,  n  = 10). (a) Representative Western blots showing oxidative stress markers, lipid peroxidation markers, and carbonyl reductase 1 (CBR1) down-stream enzymes after hepatic ischaemia–reperfusion injury. β-actin was used as a loading control; (b) Results of RT–PCR analysis of the mRNA levels of oxidative stress markers. The control housekeeping gene was glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Data are presented as mean ± SD.  P
    Figure Legend Snippet: Western blot and reverse transcription–polymerase chain reaction (RT–PCR) analyses to investigate the effects of pretreatment with 50 mg/kg epigallocatechin-3-gallate (EGCG) prior to hepatic ischaemia–reperfusion injury on antioxidant enzyme protein and mRNA levels in mice. The three treatment groups were as follows: sham-operated group (Sham, n  = 10), hepatic ischaemia–reperfusion injury group (IR, n  = 10), and EGCG with ischaemia–reperfusion injury group (EGCG-treated IR, n  = 10). (a) Representative Western blots showing oxidative stress markers, lipid peroxidation markers, and carbonyl reductase 1 (CBR1) down-stream enzymes after hepatic ischaemia–reperfusion injury. β-actin was used as a loading control; (b) Results of RT–PCR analysis of the mRNA levels of oxidative stress markers. The control housekeeping gene was glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Data are presented as mean ± SD. P

    Techniques Used: Western Blot, Reverse Transcription Polymerase Chain Reaction, Mouse Assay

    2) Product Images from "Epigallocatechin-3-gallate protects against hepatic ischaemia–reperfusion injury by reducing oxidative stress and apoptotic cell death"

    Article Title: Epigallocatechin-3-gallate protects against hepatic ischaemia–reperfusion injury by reducing oxidative stress and apoptotic cell death

    Journal: The Journal of International Medical Research

    doi: 10.1177/0300060516662735

    Investigations into the effects of pretreatment with 50 mg/kg epigallocatechin-3-gallate (EGCG) prior to hepatic ischaemia–reperfusion injury on biochemical and histological makers of liver injury in mice. The three treatment groups were as follows: sham-operated group (Sham, n = 10), hepatic ischaemia–reperfusion injury group (IR, n = 10), and EGCG with ischaemia–reperfusion injury group (EGCG-treated IR, n = 10). (a) Serum aspartate aminotransferase (AST) levels. Data presented as mean ± SD of five to eight animals per group; (b) Serum alanine aminotransferase (ALT) levels. Data presented as mean ± SD of five to eight animals per group; (c–f) Results of real-time reverse transcription–polymerase chain reaction analysis of the mRNA levels in samples of mouse liver after hepatic ischaemia–reperfusion injury for the following markers of liver injury: (c) interleukin(IL)-6, (d) tumour necrosis factor (TNF)-α, (e) IL-1β, and (f) IL-10. Data presented as mean ± SD of five to eight animals per group; (g) Representative photomicrographs showing liver sections stained with haematoxylin and eosin. The hepatic ischaemia–reperfusion injury group (IR) showed inflammatory cell infiltration in the liver. Scale bar: 50 µm; (h) Quantification of the liver injury measured using the Suzuki histological scoring index (0–4). Data are presented as median (50 th percentile), box (25 th to 75 th percentile) and whisker (minimum to maximum). P
    Figure Legend Snippet: Investigations into the effects of pretreatment with 50 mg/kg epigallocatechin-3-gallate (EGCG) prior to hepatic ischaemia–reperfusion injury on biochemical and histological makers of liver injury in mice. The three treatment groups were as follows: sham-operated group (Sham, n = 10), hepatic ischaemia–reperfusion injury group (IR, n = 10), and EGCG with ischaemia–reperfusion injury group (EGCG-treated IR, n = 10). (a) Serum aspartate aminotransferase (AST) levels. Data presented as mean ± SD of five to eight animals per group; (b) Serum alanine aminotransferase (ALT) levels. Data presented as mean ± SD of five to eight animals per group; (c–f) Results of real-time reverse transcription–polymerase chain reaction analysis of the mRNA levels in samples of mouse liver after hepatic ischaemia–reperfusion injury for the following markers of liver injury: (c) interleukin(IL)-6, (d) tumour necrosis factor (TNF)-α, (e) IL-1β, and (f) IL-10. Data presented as mean ± SD of five to eight animals per group; (g) Representative photomicrographs showing liver sections stained with haematoxylin and eosin. The hepatic ischaemia–reperfusion injury group (IR) showed inflammatory cell infiltration in the liver. Scale bar: 50 µm; (h) Quantification of the liver injury measured using the Suzuki histological scoring index (0–4). Data are presented as median (50 th percentile), box (25 th to 75 th percentile) and whisker (minimum to maximum). P

    Techniques Used: Mouse Assay, AST Assay, Reverse Transcription Polymerase Chain Reaction, Staining, Whisker Assay

    3) Product Images from "Antiproliferation effect of imatinib mesylate on MCF7, T-47D tumorigenic and MCF 10A nontumorigenic breast cell lines via PDGFR-β, PDGF-BB, c-Kit and SCF genes"

    Article Title: Antiproliferation effect of imatinib mesylate on MCF7, T-47D tumorigenic and MCF 10A nontumorigenic breast cell lines via PDGFR-β, PDGF-BB, c-Kit and SCF genes

    Journal: Drug Design, Development and Therapy

    doi: 10.2147/DDDT.S124102

    QuantiTect Primer Assay specification. Abbreviations: PDGFR, platelet-derived growth factor receptor; PDGF-BB, platelet-derived growth factor BB; SCF, stem cell factor.
    Figure Legend Snippet: QuantiTect Primer Assay specification. Abbreviations: PDGFR, platelet-derived growth factor receptor; PDGF-BB, platelet-derived growth factor BB; SCF, stem cell factor.

    Techniques Used: Derivative Assay

    Related Articles

    Centrifugation:

    Article Title: Molecular profiling of the tumor microenvironment in glioblastoma patients: correlation of microglia/macrophage polarization state with metalloprotease expression profiles and survival
    Article Snippet: Following a centrifugation of 15 min at 4°C the upper aqueous phase was transferred, 500 μl isopropanol were added and samples were incubated for 10 min at room temperature to precipitate RNA. .. Primers for macrophage makers as well as proteases were validated QuantiTect Primer Assays (Qiagen GmbH, Hilden, Germany).

    Amplification:

    Article Title: Molecular profiling of the tumor microenvironment in glioblastoma patients: correlation of microglia/macrophage polarization state with metalloprotease expression profiles and survival
    Article Snippet: Primers for macrophage makers as well as proteases were validated QuantiTect Primer Assays (Qiagen GmbH, Hilden, Germany). .. PCR amplification reactions were carried out in 20 μl reaction volumes with 20 ng of cDNA.

    Article Title: Inflammasome Activation Contributes to Interleukin-23 Production in Response to Clostridium difficile
    Article Snippet: .. IL-23a gene expression was quantified via a QuantiTect primer assay (Qiagen) using Sensifast SYBR and fluorescein mix (Bioline) in the QuantiTect 2-step amplification protocol. .. Gene expression was normalized to that of β-actin (forward primer, ATTGCCGACAGGATGCAGAA; reverse primer, GCTGATCCACATCTGCTGGAA).

    Article Title: Analysis of the chromosome X exome in patients with autism spectrum disorders identified novel candidate genes, including TMLHE
    Article Snippet: The reverse-transcribed TMLHE cDNA was amplified and sequenced using specific primers located in exons 2 (forward) and 4 (reverse). .. TMLHE mRNA was quantified using the Qiagen QuantiTect primer assays for TMLHE (forward and reverse primers located in exons 7 and 8 of TMLHE ).

    Synthesized:

    Article Title: Monocytes, neutrophils, and platelets cooperate to initiate and propagate venous thrombosis in mice in vivo
    Article Snippet: Template cDNA was synthesized from 2 µg total RNA using the High Capacity cDNA Archive kit (Applied Biosystems) and applied in SYBR Green assays performed on a GeneAmp 7700 Sequence Detection System (Applied Biosystems). .. The murine sequences of CXCL1, CXCL5, CCL2, IL6, and P-selectin were detected by QuantiTect Primer Assays (QIAGEN).

    Article Title: Analysis of the chromosome X exome in patients with autism spectrum disorders identified novel candidate genes, including TMLHE
    Article Snippet: Total RNA from lymphoblasts and fibroblasts was isolated using the Qiagen RNeasy Mini kit (Invitrogen). cDNAs were synthesized from 1 μg of total RNA using the SuperScript III First-Strand Kit (Invitrogen). .. TMLHE mRNA was quantified using the Qiagen QuantiTect primer assays for TMLHE (forward and reverse primers located in exons 7 and 8 of TMLHE ).

    Pyrolysis Gas Chromatography:

    Article Title: Nutraceutical effects of Emblicaofficinalis in age-related macular degeneration
    Article Snippet: QuantiTect Primer Assays were used to study the expression of Caspase-3 gene (Cat. # QT00023947, Qiagen, Germantown, MD), and SOD2 gene (Cat. # QT01008693, Qiagen). .. KiCqStart® SYBR® green primers were used to examine the expression of PGC-1α and VEGF genes (Cat. # kspq12012, Sigma, St. Louis, MO).

    Quantitative RT-PCR:

    Article Title: Nutraceutical effects of Emblicaofficinalis in age-related macular degeneration
    Article Snippet: Quantitative Real-Time PCR RNA extraction, cDNA synthesis, and qRT-PCR analysis from EO-treated AMD cybrids were performed as described previously [ ]. .. QuantiTect Primer Assays were used to study the expression of Caspase-3 gene (Cat. # QT00023947, Qiagen, Germantown, MD), and SOD2 gene (Cat. # QT01008693, Qiagen).

    Article Title: Deletion of Dicer in Smooth Muscle Affects Voiding Pattern and Reduces Detrusor Contractility and Neuroeffector Transmission
    Article Snippet: Paragraph title: MiRNA Arrays and Quantitative RT-PCR ... Individual miRNAs and mRNAs were analyzed using miScript primer assays (Qiagen) and QuantiTect Primer assays (Qiagen), respectively.

    Article Title: Molecular Mechanisms Underlying Protective Effects of Quercetin Against Mitochondrial Dysfunction and Progressive Dopaminergic Neurodegeneration in Cell Culture and MitoPark Transgenic Mouse Models of Parkinson’s Disease
    Article Snippet: Paragraph title: Quantitative Real-Time RT-PCR ... Real-time PCR was performed on an Mx300P QPCR system (Stratagene) using the RT2 SYBR Green qPCR Mastermix kit (Qiagen) and QuantiTect Primer Assay kit (Qiagen).

    Article Title: Increased constitutive αSMA and Smad2/3 expression in idiopathic pulmonary fibrosis myofibroblasts is KCa3.1-dependent
    Article Snippet: Paragraph title: qRT-PCR ... Primers were designed for Smad2 , forward CGTCCATCTTGCCATTCACG and reverse CTCAAGCTCATCTAATCGTCCTG, product size 182 bp from NCB1 Reference sequence NM_005901.5; and Smad3, forward GCGTGCGGCTCTACTACATC and reverse GCACATTCGGGTCAACTGGTA product size 233 bp from reference sequence NM_005902.3 β-actin primers were analysed using gene-specific Quantitect Primer Assay primers (Qiagen, Germany), HS_ACTB_1_SG.

    Article Title: HNF-4-independent synthesis of coagulation factor VII in breast cancer cells and its inhibition by targeting selective histone acetyltransferases
    Article Snippet: Paragraph title: Quantitative RT-PCR analysis ... We determined fVII and TF mRNA levels by RT-PCR as previously described. ( ) As an internal standard, the expression level of 18S ribosomal RNA was determined using One Step SYBR RT-PCR Kit (Takara, Tokyo, Japan) and QuantiTect Primer Assay (Qiagen, Valencia, CA, USA).

    SYBR Green Assay:

    Article Title: Antiproliferation effect of imatinib mesylate on MCF7, T-47D tumorigenic and MCF 10A nontumorigenic breast cell lines via PDGFR-β, PDGF-BB, c-Kit and SCF genes
    Article Snippet: .. Relative quantification of RNA transcriptional levels, which is encoding PDGFR-β, c-Kit, PDGF-BB and SCF genes, was investigated by the QuantiTect Primer Assay kit (Qiagen) applying reverse transcription polymerase chain reaction (RT-PCR) SYBR Green detection following One-Step RT-PCR Standard Protocol using the total extracted RNA with β-actin is used as the reference gene for gene expression analysis. .. Extracted RNA (0.1 µg) from the untreated and treated breast cancer cell lines with their relevant IC50 concentration of imatinib mesylate were applied to one-step RT-PCR amplifications in 50 µL reactions, including the QuantiTect Primer Assay (which includes primer pairs as shown in ), QuantiTect SYBR Green RT-PCR Master Mix and QuantiTect RT Mix.

    Article Title: Nutraceutical effects of Emblicaofficinalis in age-related macular degeneration
    Article Snippet: QuantiTect Primer Assays were used to study the expression of Caspase-3 gene (Cat. # QT00023947, Qiagen, Germantown, MD), and SOD2 gene (Cat. # QT01008693, Qiagen). .. KiCqStart® SYBR® green primers were used to examine the expression of PGC-1α and VEGF genes (Cat. # kspq12012, Sigma, St. Louis, MO).

    Article Title: Monocytes, neutrophils, and platelets cooperate to initiate and propagate venous thrombosis in mice in vivo
    Article Snippet: Template cDNA was synthesized from 2 µg total RNA using the High Capacity cDNA Archive kit (Applied Biosystems) and applied in SYBR Green assays performed on a GeneAmp 7700 Sequence Detection System (Applied Biosystems). .. The murine sequences of CXCL1, CXCL5, CCL2, IL6, and P-selectin were detected by QuantiTect Primer Assays (QIAGEN).

    Article Title: Molecular Mechanisms Underlying Protective Effects of Quercetin Against Mitochondrial Dysfunction and Progressive Dopaminergic Neurodegeneration in Cell Culture and MitoPark Transgenic Mouse Models of Parkinson’s Disease
    Article Snippet: .. Real-time PCR was performed on an Mx300P QPCR system (Stratagene) using the RT2 SYBR Green qPCR Mastermix kit (Qiagen) and QuantiTect Primer Assay kit (Qiagen). .. All RT-qPCR reactions were performed in triplicate and normalized to β-actin housekeeping gene; PCR conditions are available upon request.

    Article Title: Retinoic acid-loaded polymeric nanoparticles induce neuroprotection in a mouse model for Parkinson's disease
    Article Snippet: Quantitative real-time PCR (qPCR) The qPCR assays for gene expression analysis of Nurr1 in the striatum and SN and Pitx3 in the SN were performed by adding 2 μl of cDNA sample, 10 μl SYBR Green Supermix (BioRad Laboratories, CA, USA), 1/10 dilution of each primer (according to primers datasheet) and RNase free water to a 20 μl total volume. .. Validated primer sets (GAPDH, Nurr1 and Pitx3) were obtained from selected QuantiTect Primer Assays (Qiagen, Austin, Texas).

    Article Title: Increased constitutive αSMA and Smad2/3 expression in idiopathic pulmonary fibrosis myofibroblasts is KCa3.1-dependent
    Article Snippet: Primers were designed for Smad2 , forward CGTCCATCTTGCCATTCACG and reverse CTCAAGCTCATCTAATCGTCCTG, product size 182 bp from NCB1 Reference sequence NM_005901.5; and Smad3, forward GCGTGCGGCTCTACTACATC and reverse GCACATTCGGGTCAACTGGTA product size 233 bp from reference sequence NM_005902.3 β-actin primers were analysed using gene-specific Quantitect Primer Assay primers (Qiagen, Germany), HS_ACTB_1_SG. .. Gene expression was quantified by real-time PCR using the Brilliant SYBR Green QRT-PCR 1-Step Master Mix (Strategene, The Netherlands).

    Article Title: Molecular profiling of the tumor microenvironment in glioblastoma patients: correlation of microglia/macrophage polarization state with metalloprotease expression profiles and survival
    Article Snippet: 2 μg of RNA were transcribed into cDNA with the RNA to cDNA EcoDry Premix (Clontech, Saint-Germain-en-Laye, France) according to manufacturer’s instructions. qPCR was performed using a StepOne-Plus Real-Time PCR instrument (Applied Biosystems, Thermo Fisher Scientific, Dreieich) and Sybr Green in form of the Precision FAST MasterMix with ROX (Primer Design, Southhampton, U.K.). .. Primers for macrophage makers as well as proteases were validated QuantiTect Primer Assays (Qiagen GmbH, Hilden, Germany).

    Incubation:

    Article Title: Molecular profiling of the tumor microenvironment in glioblastoma patients: correlation of microglia/macrophage polarization state with metalloprotease expression profiles and survival
    Article Snippet: Following a centrifugation of 15 min at 4°C the upper aqueous phase was transferred, 500 μl isopropanol were added and samples were incubated for 10 min at room temperature to precipitate RNA. .. Primers for macrophage makers as well as proteases were validated QuantiTect Primer Assays (Qiagen GmbH, Hilden, Germany).

    Expressing:

    Article Title: Antiproliferation effect of imatinib mesylate on MCF7, T-47D tumorigenic and MCF 10A nontumorigenic breast cell lines via PDGFR-β, PDGF-BB, c-Kit and SCF genes
    Article Snippet: .. Relative quantification of RNA transcriptional levels, which is encoding PDGFR-β, c-Kit, PDGF-BB and SCF genes, was investigated by the QuantiTect Primer Assay kit (Qiagen) applying reverse transcription polymerase chain reaction (RT-PCR) SYBR Green detection following One-Step RT-PCR Standard Protocol using the total extracted RNA with β-actin is used as the reference gene for gene expression analysis. .. Extracted RNA (0.1 µg) from the untreated and treated breast cancer cell lines with their relevant IC50 concentration of imatinib mesylate were applied to one-step RT-PCR amplifications in 50 µL reactions, including the QuantiTect Primer Assay (which includes primer pairs as shown in ), QuantiTect SYBR Green RT-PCR Master Mix and QuantiTect RT Mix.

    Article Title: Nutraceutical effects of Emblicaofficinalis in age-related macular degeneration
    Article Snippet: .. QuantiTect Primer Assays were used to study the expression of Caspase-3 gene (Cat. # QT00023947, Qiagen, Germantown, MD), and SOD2 gene (Cat. # QT01008693, Qiagen). .. KiCqStart® SYBR® green primers were used to examine the expression of PGC-1α and VEGF genes (Cat. # kspq12012, Sigma, St. Louis, MO).

    Article Title: Influence of cryopreservation on the CATSPER2 and TEKT2 expression levels and protein levels in human spermatozoa
    Article Snippet: 2.5.2 Quantitative PCR (qPCR-Screening study) Quantitative PCR (qPCR) was performed for all fresh and cryopreservation samples to quantify the expression level of three genes, namely CATSPER2, TEKT2 , and the housekeeping gene GAPDH as a reference gene (Qiagen, Germany), using a StepOnePlus™ System (Applied Biosystems 7500Fast, USA). .. The cDNA served as the template for qPCR analysis, which was performed using the QuantiTect primer assay (Qiagen, Germany) according to the manufacturer’s recommendations.

    Article Title: Monocytes, neutrophils, and platelets cooperate to initiate and propagate venous thrombosis in mice in vivo
    Article Snippet: The murine sequences of CXCL1, CXCL5, CCL2, IL6, and P-selectin were detected by QuantiTect Primer Assays (QIAGEN). .. Cycling conditions were 50°C for 2 min and 95°C for 15 min, followed by 40 cycles of denaturation at 95°C for 15 s, and annealing and elongation at 60°C for 60 s. Gene expression ratios for each sample (regulation factors and standard deviation) were calculated using the ddCt method ( ) and normalized against β-actin.

    Article Title: Retinoic acid-loaded polymeric nanoparticles induce neuroprotection in a mouse model for Parkinson's disease
    Article Snippet: Quantitative real-time PCR (qPCR) The qPCR assays for gene expression analysis of Nurr1 in the striatum and SN and Pitx3 in the SN were performed by adding 2 μl of cDNA sample, 10 μl SYBR Green Supermix (BioRad Laboratories, CA, USA), 1/10 dilution of each primer (according to primers datasheet) and RNase free water to a 20 μl total volume. .. Validated primer sets (GAPDH, Nurr1 and Pitx3) were obtained from selected QuantiTect Primer Assays (Qiagen, Austin, Texas).

    Article Title: Increased constitutive αSMA and Smad2/3 expression in idiopathic pulmonary fibrosis myofibroblasts is KCa3.1-dependent
    Article Snippet: Primers were designed for Smad2 , forward CGTCCATCTTGCCATTCACG and reverse CTCAAGCTCATCTAATCGTCCTG, product size 182 bp from NCB1 Reference sequence NM_005901.5; and Smad3, forward GCGTGCGGCTCTACTACATC and reverse GCACATTCGGGTCAACTGGTA product size 233 bp from reference sequence NM_005902.3 β-actin primers were analysed using gene-specific Quantitect Primer Assay primers (Qiagen, Germany), HS_ACTB_1_SG. .. All expression data were normalized to β-actin and corrected using the reference dye ROX.

    Article Title: Inflammasome Activation Contributes to Interleukin-23 Production in Response to Clostridium difficile
    Article Snippet: .. IL-23a gene expression was quantified via a QuantiTect primer assay (Qiagen) using Sensifast SYBR and fluorescein mix (Bioline) in the QuantiTect 2-step amplification protocol. .. Gene expression was normalized to that of β-actin (forward primer, ATTGCCGACAGGATGCAGAA; reverse primer, GCTGATCCACATCTGCTGGAA).

    Article Title: HNF-4-independent synthesis of coagulation factor VII in breast cancer cells and its inhibition by targeting selective histone acetyltransferases
    Article Snippet: .. We determined fVII and TF mRNA levels by RT-PCR as previously described. ( ) As an internal standard, the expression level of 18S ribosomal RNA was determined using One Step SYBR RT-PCR Kit (Takara, Tokyo, Japan) and QuantiTect Primer Assay (Qiagen, Valencia, CA, USA). .. TF expression was determined with the oligomers described in “ .”

    Concentration Assay:

    Article Title: Antiproliferation effect of imatinib mesylate on MCF7, T-47D tumorigenic and MCF 10A nontumorigenic breast cell lines via PDGFR-β, PDGF-BB, c-Kit and SCF genes
    Article Snippet: Relative quantification of RNA transcriptional levels, which is encoding PDGFR-β, c-Kit, PDGF-BB and SCF genes, was investigated by the QuantiTect Primer Assay kit (Qiagen) applying reverse transcription polymerase chain reaction (RT-PCR) SYBR Green detection following One-Step RT-PCR Standard Protocol using the total extracted RNA with β-actin is used as the reference gene for gene expression analysis. .. Extracted RNA (0.1 µg) from the untreated and treated breast cancer cell lines with their relevant IC50 concentration of imatinib mesylate were applied to one-step RT-PCR amplifications in 50 µL reactions, including the QuantiTect Primer Assay (which includes primer pairs as shown in ), QuantiTect SYBR Green RT-PCR Master Mix and QuantiTect RT Mix.

    Dissection:

    Article Title: Deletion of Dicer in Smooth Muscle Affects Voiding Pattern and Reduces Detrusor Contractility and Neuroeffector Transmission
    Article Snippet: Bladders were cut open from the urethra and pinned to the bottom of Sylgard-covered dissection dishes containing physiological buffer. .. Individual miRNAs and mRNAs were analyzed using miScript primer assays (Qiagen) and QuantiTect Primer assays (Qiagen), respectively.

    Cell Culture:

    Article Title: Analysis of the chromosome X exome in patients with autism spectrum disorders identified novel candidate genes, including TMLHE
    Article Snippet: Paragraph title: Cell culture and mRNA experiments ... TMLHE mRNA was quantified using the Qiagen QuantiTect primer assays for TMLHE (forward and reverse primers located in exons 7 and 8 of TMLHE ).

    Polymerase Chain Reaction:

    Article Title: Deletion of Dicer in Smooth Muscle Affects Voiding Pattern and Reduces Detrusor Contractility and Neuroeffector Transmission
    Article Snippet: Individual miRNAs and mRNAs were analyzed using miScript primer assays (Qiagen) and QuantiTect Primer assays (Qiagen), respectively. .. Individual miRNAs and mRNAs were analyzed using miScript primer assays (Qiagen) and QuantiTect Primer assays (Qiagen), respectively.

    Article Title: Molecular Mechanisms Underlying Protective Effects of Quercetin Against Mitochondrial Dysfunction and Progressive Dopaminergic Neurodegeneration in Cell Culture and MitoPark Transgenic Mouse Models of Parkinson’s Disease
    Article Snippet: Real-time PCR was performed on an Mx300P QPCR system (Stratagene) using the RT2 SYBR Green qPCR Mastermix kit (Qiagen) and QuantiTect Primer Assay kit (Qiagen). .. All RT-qPCR reactions were performed in triplicate and normalized to β-actin housekeeping gene; PCR conditions are available upon request.

    Article Title: Molecular profiling of the tumor microenvironment in glioblastoma patients: correlation of microglia/macrophage polarization state with metalloprotease expression profiles and survival
    Article Snippet: Primers for macrophage makers as well as proteases were validated QuantiTect Primer Assays (Qiagen GmbH, Hilden, Germany). .. PCR amplification reactions were carried out in 20 μl reaction volumes with 20 ng of cDNA.

    Article Title: Inflammasome Activation Contributes to Interleukin-23 Production in Response to Clostridium difficile
    Article Snippet: The resulting cDNA was purified using Qiagen’s PCR purification kit. .. IL-23a gene expression was quantified via a QuantiTect primer assay (Qiagen) using Sensifast SYBR and fluorescein mix (Bioline) in the QuantiTect 2-step amplification protocol.

    Article Title: Analysis of the chromosome X exome in patients with autism spectrum disorders identified novel candidate genes, including TMLHE
    Article Snippet: The PCR products were run on 2% agarose gels. .. TMLHE mRNA was quantified using the Qiagen QuantiTect primer assays for TMLHE (forward and reverse primers located in exons 7 and 8 of TMLHE ).

    Gene Assay:

    Article Title: Nutraceutical effects of Emblicaofficinalis in age-related macular degeneration
    Article Snippet: QuantiTect Primer Assays were used to study the expression of Caspase-3 gene (Cat. # QT00023947, Qiagen, Germantown, MD), and SOD2 gene (Cat. # QT01008693, Qiagen). .. TaqMan gene expression master mix (Cat. # 4369016, Life Technologies) and TaqMan gene expression assays were used to examine the expression of the MT-RNR2 gene (Assay ID: Hs02596860_s1, Life Technologies), for which GAPDH (Assay ID: Hs02786624_g1, Life Technologies) was used as a housekeeper gene.

    Sequencing:

    Article Title: Monocytes, neutrophils, and platelets cooperate to initiate and propagate venous thrombosis in mice in vivo
    Article Snippet: Template cDNA was synthesized from 2 µg total RNA using the High Capacity cDNA Archive kit (Applied Biosystems) and applied in SYBR Green assays performed on a GeneAmp 7700 Sequence Detection System (Applied Biosystems). .. The murine sequences of CXCL1, CXCL5, CCL2, IL6, and P-selectin were detected by QuantiTect Primer Assays (QIAGEN).

    Article Title: Increased constitutive αSMA and Smad2/3 expression in idiopathic pulmonary fibrosis myofibroblasts is KCa3.1-dependent
    Article Snippet: .. Primers were designed for Smad2 , forward CGTCCATCTTGCCATTCACG and reverse CTCAAGCTCATCTAATCGTCCTG, product size 182 bp from NCB1 Reference sequence NM_005901.5; and Smad3, forward GCGTGCGGCTCTACTACATC and reverse GCACATTCGGGTCAACTGGTA product size 233 bp from reference sequence NM_005902.3 β-actin primers were analysed using gene-specific Quantitect Primer Assay primers (Qiagen, Germany), HS_ACTB_1_SG. .. All expression data were normalized to β-actin and corrected using the reference dye ROX.

    Fluorescence:

    Article Title: Retinoic acid-loaded polymeric nanoparticles induce neuroprotection in a mouse model for Parkinson's disease
    Article Snippet: Validated primer sets (GAPDH, Nurr1 and Pitx3) were obtained from selected QuantiTect Primer Assays (Qiagen, Austin, Texas). .. The fluorescence was measured after the extension step by the iQ5 Multicolor Real-time PCR detection system (BioRad).

    Isolation:

    Article Title: Deletion of Dicer in Smooth Muscle Affects Voiding Pattern and Reduces Detrusor Contractility and Neuroeffector Transmission
    Article Snippet: Following freezing in liquid N2 , isolation of mRNA and miRNA from six pooled control and Dicer KO bladders without mucosa was performed using miRNeasy kit and RNeasy MinElute Cleanup Kit (Qiagen) according to the manufacturer’s recommendations. .. Individual miRNAs and mRNAs were analyzed using miScript primer assays (Qiagen) and QuantiTect Primer assays (Qiagen), respectively.

    Article Title: Monocytes, neutrophils, and platelets cooperate to initiate and propagate venous thrombosis in mice in vivo
    Article Snippet: RNA was isolated from the whole IVC using the NucleoSpin RNA XS kit (Macherey-Nagel) according to the manufacturer’s instructions. .. The murine sequences of CXCL1, CXCL5, CCL2, IL6, and P-selectin were detected by QuantiTect Primer Assays (QIAGEN).

    Article Title: Molecular Mechanisms Underlying Protective Effects of Quercetin Against Mitochondrial Dysfunction and Progressive Dopaminergic Neurodegeneration in Cell Culture and MitoPark Transgenic Mouse Models of Parkinson’s Disease
    Article Snippet: Total RNA was isolated from cells using the Absolutely RNA Miniprep kit (Stratagene, La Jolla, CA), and 1–2 µg RNA was used to generate cDNA using the High Capacity cDNA Reverse Transcription kit (Applied Biosystems). .. Real-time PCR was performed on an Mx300P QPCR system (Stratagene) using the RT2 SYBR Green qPCR Mastermix kit (Qiagen) and QuantiTect Primer Assay kit (Qiagen).

    Article Title: Increased constitutive αSMA and Smad2/3 expression in idiopathic pulmonary fibrosis myofibroblasts is KCa3.1-dependent
    Article Snippet: qRT-PCR Myofibroblast RNA was isolated using the RNeasy Plus Kit (Qiagen, West Sussex, UK) according to the manufacturer’s instructions. .. Primers were designed for Smad2 , forward CGTCCATCTTGCCATTCACG and reverse CTCAAGCTCATCTAATCGTCCTG, product size 182 bp from NCB1 Reference sequence NM_005901.5; and Smad3, forward GCGTGCGGCTCTACTACATC and reverse GCACATTCGGGTCAACTGGTA product size 233 bp from reference sequence NM_005902.3 β-actin primers were analysed using gene-specific Quantitect Primer Assay primers (Qiagen, Germany), HS_ACTB_1_SG.

    Article Title: Molecular profiling of the tumor microenvironment in glioblastoma patients: correlation of microglia/macrophage polarization state with metalloprotease expression profiles and survival
    Article Snippet: Paragraph title: RNA isolation and qPCR ... Primers for macrophage makers as well as proteases were validated QuantiTect Primer Assays (Qiagen GmbH, Hilden, Germany).

    Article Title: Inflammasome Activation Contributes to Interleukin-23 Production in Response to Clostridium difficile
    Article Snippet: RNA was isolated using the RNeasy isolation kit (Qiagen). .. IL-23a gene expression was quantified via a QuantiTect primer assay (Qiagen) using Sensifast SYBR and fluorescein mix (Bioline) in the QuantiTect 2-step amplification protocol.

    Article Title: Analysis of the chromosome X exome in patients with autism spectrum disorders identified novel candidate genes, including TMLHE
    Article Snippet: Total RNA from lymphoblasts and fibroblasts was isolated using the Qiagen RNeasy Mini kit (Invitrogen). cDNAs were synthesized from 1 μg of total RNA using the SuperScript III First-Strand Kit (Invitrogen). .. TMLHE mRNA was quantified using the Qiagen QuantiTect primer assays for TMLHE (forward and reverse primers located in exons 7 and 8 of TMLHE ).

    Purification:

    Article Title: Inflammasome Activation Contributes to Interleukin-23 Production in Response to Clostridium difficile
    Article Snippet: The resulting cDNA was purified using Qiagen’s PCR purification kit. .. IL-23a gene expression was quantified via a QuantiTect primer assay (Qiagen) using Sensifast SYBR and fluorescein mix (Bioline) in the QuantiTect 2-step amplification protocol.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Antiproliferation effect of imatinib mesylate on MCF7, T-47D tumorigenic and MCF 10A nontumorigenic breast cell lines via PDGFR-β, PDGF-BB, c-Kit and SCF genes
    Article Snippet: .. Relative quantification of RNA transcriptional levels, which is encoding PDGFR-β, c-Kit, PDGF-BB and SCF genes, was investigated by the QuantiTect Primer Assay kit (Qiagen) applying reverse transcription polymerase chain reaction (RT-PCR) SYBR Green detection following One-Step RT-PCR Standard Protocol using the total extracted RNA with β-actin is used as the reference gene for gene expression analysis. .. Extracted RNA (0.1 µg) from the untreated and treated breast cancer cell lines with their relevant IC50 concentration of imatinib mesylate were applied to one-step RT-PCR amplifications in 50 µL reactions, including the QuantiTect Primer Assay (which includes primer pairs as shown in ), QuantiTect SYBR Green RT-PCR Master Mix and QuantiTect RT Mix.

    Article Title: Monocytes, neutrophils, and platelets cooperate to initiate and propagate venous thrombosis in mice in vivo
    Article Snippet: Paragraph title: RT-PCR. ... The murine sequences of CXCL1, CXCL5, CCL2, IL6, and P-selectin were detected by QuantiTect Primer Assays (QIAGEN).

    Article Title: HNF-4-independent synthesis of coagulation factor VII in breast cancer cells and its inhibition by targeting selective histone acetyltransferases
    Article Snippet: .. We determined fVII and TF mRNA levels by RT-PCR as previously described. ( ) As an internal standard, the expression level of 18S ribosomal RNA was determined using One Step SYBR RT-PCR Kit (Takara, Tokyo, Japan) and QuantiTect Primer Assay (Qiagen, Valencia, CA, USA). .. TF expression was determined with the oligomers described in “ .”

    Mouse Assay:

    Article Title: Deletion of Dicer in Smooth Muscle Affects Voiding Pattern and Reduces Detrusor Contractility and Neuroeffector Transmission
    Article Snippet: MiRNA Arrays and Quantitative RT-PCR Mice were sacrificed by increasing CO2 and whole bladders were excised and cleaned in HEPES buffered Krebs solution (nominally Ca2+ -free). .. Individual miRNAs and mRNAs were analyzed using miScript primer assays (Qiagen) and QuantiTect Primer assays (Qiagen), respectively.

    Software:

    Article Title: Analysis of the chromosome X exome in patients with autism spectrum disorders identified novel candidate genes, including TMLHE
    Article Snippet: TMLHE mRNA was quantified using the Qiagen QuantiTect primer assays for TMLHE (forward and reverse primers located in exons 7 and 8 of TMLHE ). .. Forty-five two-step cycles (15 s at 95 °C and 30 s at 60 °C) were performed and analyzed using Lightcycler 480 software release 1.5.0.

    Real-time Polymerase Chain Reaction:

    Article Title: Nutraceutical effects of Emblicaofficinalis in age-related macular degeneration
    Article Snippet: Paragraph title: Quantitative Real-Time PCR ... QuantiTect Primer Assays were used to study the expression of Caspase-3 gene (Cat. # QT00023947, Qiagen, Germantown, MD), and SOD2 gene (Cat. # QT01008693, Qiagen).

    Article Title: Deletion of Dicer in Smooth Muscle Affects Voiding Pattern and Reduces Detrusor Contractility and Neuroeffector Transmission
    Article Snippet: Individual miRNAs and mRNAs were analyzed using miScript primer assays (Qiagen) and QuantiTect Primer assays (Qiagen), respectively. .. Individual miRNAs and mRNAs were analyzed using miScript primer assays (Qiagen) and QuantiTect Primer assays (Qiagen), respectively.

    Article Title: Influence of cryopreservation on the CATSPER2 and TEKT2 expression levels and protein levels in human spermatozoa
    Article Snippet: .. The cDNA served as the template for qPCR analysis, which was performed using the QuantiTect primer assay (Qiagen, Germany) according to the manufacturer’s recommendations. ..

    Article Title: Molecular Mechanisms Underlying Protective Effects of Quercetin Against Mitochondrial Dysfunction and Progressive Dopaminergic Neurodegeneration in Cell Culture and MitoPark Transgenic Mouse Models of Parkinson’s Disease
    Article Snippet: .. Real-time PCR was performed on an Mx300P QPCR system (Stratagene) using the RT2 SYBR Green qPCR Mastermix kit (Qiagen) and QuantiTect Primer Assay kit (Qiagen). .. All RT-qPCR reactions were performed in triplicate and normalized to β-actin housekeeping gene; PCR conditions are available upon request.

    Article Title: Retinoic acid-loaded polymeric nanoparticles induce neuroprotection in a mouse model for Parkinson's disease
    Article Snippet: Paragraph title: Quantitative real-time PCR (qPCR) ... Validated primer sets (GAPDH, Nurr1 and Pitx3) were obtained from selected QuantiTect Primer Assays (Qiagen, Austin, Texas).

    Article Title: Increased constitutive αSMA and Smad2/3 expression in idiopathic pulmonary fibrosis myofibroblasts is KCa3.1-dependent
    Article Snippet: Primers were designed for Smad2 , forward CGTCCATCTTGCCATTCACG and reverse CTCAAGCTCATCTAATCGTCCTG, product size 182 bp from NCB1 Reference sequence NM_005901.5; and Smad3, forward GCGTGCGGCTCTACTACATC and reverse GCACATTCGGGTCAACTGGTA product size 233 bp from reference sequence NM_005902.3 β-actin primers were analysed using gene-specific Quantitect Primer Assay primers (Qiagen, Germany), HS_ACTB_1_SG. .. Gene expression was quantified by real-time PCR using the Brilliant SYBR Green QRT-PCR 1-Step Master Mix (Strategene, The Netherlands).

    Article Title: Molecular profiling of the tumor microenvironment in glioblastoma patients: correlation of microglia/macrophage polarization state with metalloprotease expression profiles and survival
    Article Snippet: Paragraph title: RNA isolation and qPCR ... Primers for macrophage makers as well as proteases were validated QuantiTect Primer Assays (Qiagen GmbH, Hilden, Germany).

    RNA Extraction:

    Article Title: Nutraceutical effects of Emblicaofficinalis in age-related macular degeneration
    Article Snippet: Quantitative Real-Time PCR RNA extraction, cDNA synthesis, and qRT-PCR analysis from EO-treated AMD cybrids were performed as described previously [ ]. .. QuantiTect Primer Assays were used to study the expression of Caspase-3 gene (Cat. # QT00023947, Qiagen, Germantown, MD), and SOD2 gene (Cat. # QT01008693, Qiagen).

    Activation Assay:

    Article Title: Retinoic acid-loaded polymeric nanoparticles induce neuroprotection in a mouse model for Parkinson's disease
    Article Snippet: The reaction was initiated with activation of Taq polymerase by heating at 94°C during 3 min followed by 40 cycles of a 15 s denaturation step at 94°C and a 30 s annealing and elongation step at 60°C. .. Validated primer sets (GAPDH, Nurr1 and Pitx3) were obtained from selected QuantiTect Primer Assays (Qiagen, Austin, Texas).

    Standard Deviation:

    Article Title: Monocytes, neutrophils, and platelets cooperate to initiate and propagate venous thrombosis in mice in vivo
    Article Snippet: The murine sequences of CXCL1, CXCL5, CCL2, IL6, and P-selectin were detected by QuantiTect Primer Assays (QIAGEN). .. Cycling conditions were 50°C for 2 min and 95°C for 15 min, followed by 40 cycles of denaturation at 95°C for 15 s, and annealing and elongation at 60°C for 60 s. Gene expression ratios for each sample (regulation factors and standard deviation) were calculated using the ddCt method ( ) and normalized against β-actin.

    Lysis:

    Article Title: Molecular profiling of the tumor microenvironment in glioblastoma patients: correlation of microglia/macrophage polarization state with metalloprotease expression profiles and survival
    Article Snippet: RNA isolation and qPCR Frozen tumor tissue samples were thawed on ice, 50 mg tissue was homogenized in 1 ml QIAzol Lysis reagent (Qiagen GmbH, Hilden, Germany) using a disperser. .. Primers for macrophage makers as well as proteases were validated QuantiTect Primer Assays (Qiagen GmbH, Hilden, Germany).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Qiagen quantitect primer assay kit
    <t>QuantiTect</t> Primer Assay specification. Abbreviations: PDGFR, platelet-derived growth factor receptor; PDGF-BB, platelet-derived growth factor BB; SCF, stem cell factor.
    Quantitect Primer Assay Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 31 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitect primer assay kit/product/Qiagen
    Average 99 stars, based on 31 article reviews
    Price from $9.99 to $1999.99
    quantitect primer assay kit - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    QuantiTect Primer Assay specification. Abbreviations: PDGFR, platelet-derived growth factor receptor; PDGF-BB, platelet-derived growth factor BB; SCF, stem cell factor.

    Journal: Drug Design, Development and Therapy

    Article Title: Antiproliferation effect of imatinib mesylate on MCF7, T-47D tumorigenic and MCF 10A nontumorigenic breast cell lines via PDGFR-β, PDGF-BB, c-Kit and SCF genes

    doi: 10.2147/DDDT.S124102

    Figure Lengend Snippet: QuantiTect Primer Assay specification. Abbreviations: PDGFR, platelet-derived growth factor receptor; PDGF-BB, platelet-derived growth factor BB; SCF, stem cell factor.

    Article Snippet: Relative quantification of RNA transcriptional levels, which is encoding PDGFR-β, c-Kit, PDGF-BB and SCF genes, was investigated by the QuantiTect Primer Assay kit (Qiagen) applying reverse transcription polymerase chain reaction (RT-PCR) SYBR Green detection following One-Step RT-PCR Standard Protocol using the total extracted RNA with β-actin is used as the reference gene for gene expression analysis.

    Techniques: Derivative Assay