quantitect primer assays  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    QuantiTect Primer Assay
    Description:
    QuantiTect Primer Assays are genomewide bioinformatically validated primer sets for use in SYBR Green based real time RT PCR on any cycler Assays are available for all genes from human rat mouse and many other species Each assay for a specific gene is supplied as a lyophilized mix of forward and reverse primers that can be easily reconstituted to obtain a 10x assay solution reaction components for real time RT PCR need to be ordered separately When used in combination with QuantiFast QuantiTect Rotor Gene or FastLane Kits for SYBR Green detection QuantiTect Primer Assays guarantee highly specific and sensitive results in real time RT PCR that are comparable to probe based detection
    Catalog Number:
    249900
    Price:
    96.8
    Category:
    Assay PCR qPCR
    Buy from Supplier


    Structured Review

    Qiagen quantitect primer assays
    QuantiTect Primer Assay
    QuantiTect Primer Assays are genomewide bioinformatically validated primer sets for use in SYBR Green based real time RT PCR on any cycler Assays are available for all genes from human rat mouse and many other species Each assay for a specific gene is supplied as a lyophilized mix of forward and reverse primers that can be easily reconstituted to obtain a 10x assay solution reaction components for real time RT PCR need to be ordered separately When used in combination with QuantiFast QuantiTect Rotor Gene or FastLane Kits for SYBR Green detection QuantiTect Primer Assays guarantee highly specific and sensitive results in real time RT PCR that are comparable to probe based detection
    https://www.bioz.com/result/quantitect primer assays/product/Qiagen
    Average 90 stars, based on 480 article reviews
    Price from $9.99 to $1999.99
    quantitect primer assays - by Bioz Stars, 2020-01
    90/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: Disruption of CLOCK-BMAL1 Transcriptional Activity Is Responsible for Aryl Hydrocarbon Receptor-Mediated Regulation of Period1 Gene
    Article Snippet: Following complementary DNA (cDNA) synthesis, 5 μl of diluted cDNA (1:5) was used in 20 μl of SYBR green PCR mix (Bio-Rad) containing 300nM Per1 -specific primer pairs as previously published , and 5 μl of diluted cDNA (1:5) was used in 20 μl of SYBR green PCR mix with 1× Quantitect Primer Assay for Cyp1a1 gene expression analysis (Qiagen). .. Amplification was performed using a Smart Cycler rapid thermal cycler (Cepheid) according to the following protocol: an initial 10-min denaturation step at 95°C, followed by 40 cycles of denaturation (95°C) for 30 s, annealing (primer-optimized temperature) for 30 s, and extension (72°C) for 30 s. Detection of the fluorescent product was carried out during each 72°C extension period, and emission data were quantified using threshold cycle values.

    Article Title: Type I interferon receptor controls B-cell expression of nucleic acid-sensing Toll-like receptors and autoantibody production in a murine model of lupus
    Article Snippet: RNA (10 ng) was amplified using one-step QuantiTect SYBR Green reverse transcription-polymerase chain reaction (Qiagen Inc.) and 0.5 μM forward and reverse primers using an Opticon2 continuous fluorescence detector (MJ Research, now part of Bio-Rad Laboratories, Inc., Hercules, CA, USA). .. QuantiTect Primer Assay sets for murine TLR7, TLR9, and GAPDH were purchased from Qiagen Inc.

    Article Title: Reduced mRNA and Protein Expression of the Genomic Caretaker RAD9A in Primary Fibroblasts of Individuals with Childhood and Independent Second Cancer
    Article Snippet: Linearity of amplification was verified by qPCR standard curve and sequence analysis. .. Each 25 µl reaction volume contained 25 ng cDNA template in 10 µl RNase-free PCR graded water, 2.5 µl 10x QuantiTect Primer Assay and 12.5 µl 2x QuantiTect SYBR Green PCR Master Mix (Qiagen).

    Article Title: Inflammasome Activation Contributes to Interleukin-23 Production in Response to Clostridium difficile
    Article Snippet: .. IL-23a gene expression was quantified via a QuantiTect primer assay (Qiagen) using Sensifast SYBR and fluorescein mix (Bioline) in the QuantiTect 2-step amplification protocol. .. Gene expression was normalized to that of β-actin (forward primer, ATTGCCGACAGGATGCAGAA; reverse primer, GCTGATCCACATCTGCTGGAA).

    Article Title: Salinomycin increases chemosensitivity to the effects of doxorubicin in soft tissue sarcomas
    Article Snippet: For quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR), first-strand cDNA was synthesized from 1 μg of total RNA using the Applied Biosystems High Capacity cDNA reverse transcription kit (Life Technologies, Darmstadt, Germany). cDNA was amplified on an Eppendorf Realplex4 thermal cycler (Hamburg, Germany) using Promega GoTaq qPCR Master Mix. .. The sequence for the PCR primers are: p21 : 5′-GGCGGCAGACCAGCATGACAGATT-3′ and 5′-GCAGGGGGCGGCCAGGGTAT-3′; p53: 5′-CTAAGCGAGCACTGCCCAAC-3′ and 5′-GGCCTCATTCAGCTCTCGGA-3′; actin: 5′-CATGCCATCCTGCGTCTGGACC-3′ and 5′-ACATGGTGGTGCCGCCAGACAG-3′, whereas PUMA expression was analyzed using the QuantiTect Primer Assay (Qiagen, Hilden, Germany).

    Synthesized:

    Article Title: Leukocyte-Derived Interleukin-10 Aggravates Postoperative Ileus
    Article Snippet: Complementary DNA was synthesized using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Darmstadt, Germany). .. Expression of mRNA was quantified in triplicates by a RT-PCR with exon-spanning primers, Quantitect primer assay (Qiagen), or TaqMan probes (Supplementary Table ) and SYBR Green PCR Master Mix or the TaqMan Gene Expression Master Mix (Applied Biosystems) were used for the PCR.

    Article Title: ATP induces PAD2-dependent citrullination in Mast Cells through the P2X7 Receptor
    Article Snippet: Total RNA was extracted from mouse tissues using TRIzol Reagent (Invitrogen), or from BMMC cultures using the RNeasy Plus kit (QUIAGEN, Hilden, Germany), following manufacturer instructions. cDNA was synthesized from three different cultures of each genotype using the iScript cDNA synthesis kit (Bio-Rad). qPCR was performed using a System 7500 (Applied Biosystems, Carlsbad, CA). .. QuantiTect Primer Assay was used for mouse TNFR2 (QIAGEN).

    Article Title: Human decidua basalis mesenchymal stem/stromal cells protect endothelial cell functions from oxidative stress induced by hydrogen peroxide and monocytes
    Article Snippet: The expression of 84 genes related to endothelial cell biology (catalogue number PAHS-015ZD-24, Qiagen, Hilden, Germany) by HUVEC was determined using QuantiTect Primer Assay (Qiagen, Hilden, Germany) in a real-time polymerase chain reaction (RT-PCR) as previously published [ ]. .. Briefly, total RNA from HUVEC pretreated with DBMSCs and 100 μM H2 O2 for 48 h was isolated, and cDNA was then synthesized using FastLane Cell cDNA kit and RT Primer Mix (Qiagen) as previously published [ ].

    Article Title: Salinomycin increases chemosensitivity to the effects of doxorubicin in soft tissue sarcomas
    Article Snippet: For quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR), first-strand cDNA was synthesized from 1 μg of total RNA using the Applied Biosystems High Capacity cDNA reverse transcription kit (Life Technologies, Darmstadt, Germany). cDNA was amplified on an Eppendorf Realplex4 thermal cycler (Hamburg, Germany) using Promega GoTaq qPCR Master Mix. .. The sequence for the PCR primers are: p21 : 5′-GGCGGCAGACCAGCATGACAGATT-3′ and 5′-GCAGGGGGCGGCCAGGGTAT-3′; p53: 5′-CTAAGCGAGCACTGCCCAAC-3′ and 5′-GGCCTCATTCAGCTCTCGGA-3′; actin: 5′-CATGCCATCCTGCGTCTGGACC-3′ and 5′-ACATGGTGGTGCCGCCAGACAG-3′, whereas PUMA expression was analyzed using the QuantiTect Primer Assay (Qiagen, Hilden, Germany).

    Quantitative RT-PCR:

    Article Title: Leukocyte-Derived Interleukin-10 Aggravates Postoperative Ileus
    Article Snippet: Paragraph title: Quantitative RT-PCR ... Expression of mRNA was quantified in triplicates by a RT-PCR with exon-spanning primers, Quantitect primer assay (Qiagen), or TaqMan probes (Supplementary Table ) and SYBR Green PCR Master Mix or the TaqMan Gene Expression Master Mix (Applied Biosystems) were used for the PCR.

    Article Title: Heparan Sulfate Modulates Neutrophil and Endothelial Function in Antibacterial Innate Immunity
    Article Snippet: For quantitative RT-PCR analysis, RNA was isolated from BMDMs using TRIzol (Life Technologies) 30 min after GBS stimulation (MOI = 10) and used as a template for cDNA preparation by iScript (Bio-Rad). .. Primers for IL-10 were obtained from the QuantiTect primer assay (Qiagen).

    Article Title: Novel insights into a treatment for aplastic anemia based on the advanced proliferation of bone marrow-derived mesenchymal stem cells induced by fibroblast growth factor 1
    Article Snippet: .. RT-qPCR was performed using the QuantiTect Primer assay (Qiagen GmbH, Hilden, Germany) and QuantiTect SYBR Green RT-PCR kit (Qiagen GmbH) on a LightCycler 480 Instrument (Roche Diagnostics, Mannheim, Germany). .. The target gene primers were designed by Invitrogen Life Technologies and primer sequences were as follows: Forward: 5′-CAGTACTTGGCCATGGACA-3′ and reverse: 5′-AGTGAGTCCGAGGACCGC-3′.

    Article Title: Elevated IGFBP3 levels in diabetic tears: a negative regulator of IGF-1 signaling in the corneal epithelium
    Article Snippet: For each sample, 100 ng of cDNA was subjected to 40 cycles of real-time RT-PCR in a total volume of 25 µl containing 1µM of each primer sets. .. The primers used in PCR were obtained from QuantiTect Primer Assay (Qiagen, Valencia, CA) as follows: β-actin probe (Cat. QT00095431); IGF-1R probe (Cat. QT00005831); IGFBP-3 probe (Cat. QT00072737).

    Article Title: Elongase Reactions as Control Points in Long-Chain Polyunsaturated Fatty Acid Synthesis
    Article Snippet: Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was performed using a Rotor-Gene 3000 (Corbett Research) with the QuantiFast™ SYBR® Green PCR kit (Qiagen). .. Each reaction contained 10 ng of cDNA, 5 µl QuantiFast™ SYBR® Green PCR master mix and 1 µl of QuantiTect® Primer Assay (Qiagen), in a total volume of 10 µl.

    Article Title: Reduced mRNA and Protein Expression of the Genomic Caretaker RAD9A in Primary Fibroblasts of Individuals with Childhood and Independent Second Cancer
    Article Snippet: Paragraph title: Quantitative real-time RT PCR ... Each 25 µl reaction volume contained 25 ng cDNA template in 10 µl RNase-free PCR graded water, 2.5 µl 10x QuantiTect Primer Assay and 12.5 µl 2x QuantiTect SYBR Green PCR Master Mix (Qiagen).

    Article Title: Salinomycin increases chemosensitivity to the effects of doxorubicin in soft tissue sarcomas
    Article Snippet: For quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR), first-strand cDNA was synthesized from 1 μg of total RNA using the Applied Biosystems High Capacity cDNA reverse transcription kit (Life Technologies, Darmstadt, Germany). cDNA was amplified on an Eppendorf Realplex4 thermal cycler (Hamburg, Germany) using Promega GoTaq qPCR Master Mix. .. The sequence for the PCR primers are: p21 : 5′-GGCGGCAGACCAGCATGACAGATT-3′ and 5′-GCAGGGGGCGGCCAGGGTAT-3′; p53: 5′-CTAAGCGAGCACTGCCCAAC-3′ and 5′-GGCCTCATTCAGCTCTCGGA-3′; actin: 5′-CATGCCATCCTGCGTCTGGACC-3′ and 5′-ACATGGTGGTGCCGCCAGACAG-3′, whereas PUMA expression was analyzed using the QuantiTect Primer Assay (Qiagen, Hilden, Germany).

    Real-time Polymerase Chain Reaction:

    Article Title: Influence of cryopreservation on the CATSPER2 and TEKT2 expression levels and protein levels in human spermatozoa
    Article Snippet: .. The cDNA served as the template for qPCR analysis, which was performed using the QuantiTect primer assay (Qiagen, Germany) according to the manufacturer’s recommendations. ..

    Article Title: The effect of differentiation and TGFβ on mitochondrial respiration and mitochondrial enzyme abundance in cultured primary human skeletal muscle cells
    Article Snippet: .. RNA was extracted employing the NucleoSpin miRNA kit (Macherey-Nagel, Düren, Germany) and reverse transcription was carried out with the Transcriptor First Strand Synthesis Kit (Roche, Basel, Switzerland) using 500–1,000 ng total RNA per 20 µl reaction. cDNA was diluted with 80 µl of nuclease free water and 2.5 µl of this dilution was used in a 20 µl qPCR reaction containing 10 µl QuantiFast SYBR Green PCR Mix and 2 µl QuantiTect Primer Assay (Qiagen, Hilden, Germany, Table ) on a LightCycler 480 machine (Roche). .. Standards for PCR were generated by purifying PCR-Product (MinElute PCR Purification Kit, Qiagen) for each primer and generating a 10-fold serial dilution series ranging from 5 pg/µl to 0.5 ag/µl.

    Article Title: Heparan Sulfate Modulates Neutrophil and Endothelial Function in Antibacterial Innate Immunity
    Article Snippet: Quantitative PCR was performed using iQ SYBR green supermix (Bio-Rad) per standard protocols. .. Primers for IL-10 were obtained from the QuantiTect primer assay (Qiagen).

    Article Title: ATP induces PAD2-dependent citrullination in Mast Cells through the P2X7 Receptor
    Article Snippet: Paragraph title: Quantitative PCR ... QuantiTect Primer Assay was used for mouse TNFR2 (QIAGEN).

    Article Title: Histochemical Examination on Periodontal Tissues of Klotho-Deficient Mice Fed With Phosphate-Insufficient Diet
    Article Snippet: .. Real-time PCR on mouse β-actin was performed using QuantiTect Primer Assay (Mm_Actb_2_SG; Catalog No. QT01136772; QIAGEN GmbH). .. Consistent with the appearance of whole body size at the 7 weeks of age , the average body weight of wild-type lowPi mice was lower than wild-type norPi mice, whereas that of kl/kl lowPi mice was markedly increased compared with kl/kl norPi mice ( ).

    Article Title: Human decidua basalis mesenchymal stem/stromal cells protect endothelial cell functions from oxidative stress induced by hydrogen peroxide and monocytes
    Article Snippet: .. The expression of 84 genes related to endothelial cell biology (catalogue number PAHS-015ZD-24, Qiagen, Hilden, Germany) by HUVEC was determined using QuantiTect Primer Assay (Qiagen, Hilden, Germany) in a real-time polymerase chain reaction (RT-PCR) as previously published [ ]. .. Briefly, total RNA from HUVEC pretreated with DBMSCs and 100 μM H2 O2 for 48 h was isolated, and cDNA was then synthesized using FastLane Cell cDNA kit and RT Primer Mix (Qiagen) as previously published [ ].

    Article Title: Type I interferon receptor controls B-cell expression of nucleic acid-sensing Toll-like receptors and autoantibody production in a murine model of lupus
    Article Snippet: Paragraph title: Real-time quantitative polymerase chain reaction ... QuantiTect Primer Assay sets for murine TLR7, TLR9, and GAPDH were purchased from Qiagen Inc.

    Article Title: Reduced mRNA and Protein Expression of the Genomic Caretaker RAD9A in Primary Fibroblasts of Individuals with Childhood and Independent Second Cancer
    Article Snippet: Linearity of amplification was verified by qPCR standard curve and sequence analysis. .. Each 25 µl reaction volume contained 25 ng cDNA template in 10 µl RNase-free PCR graded water, 2.5 µl 10x QuantiTect Primer Assay and 12.5 µl 2x QuantiTect SYBR Green PCR Master Mix (Qiagen).

    Article Title: Salinomycin increases chemosensitivity to the effects of doxorubicin in soft tissue sarcomas
    Article Snippet: For quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR), first-strand cDNA was synthesized from 1 μg of total RNA using the Applied Biosystems High Capacity cDNA reverse transcription kit (Life Technologies, Darmstadt, Germany). cDNA was amplified on an Eppendorf Realplex4 thermal cycler (Hamburg, Germany) using Promega GoTaq qPCR Master Mix. .. The sequence for the PCR primers are: p21 : 5′-GGCGGCAGACCAGCATGACAGATT-3′ and 5′-GCAGGGGGCGGCCAGGGTAT-3′; p53: 5′-CTAAGCGAGCACTGCCCAAC-3′ and 5′-GGCCTCATTCAGCTCTCGGA-3′; actin: 5′-CATGCCATCCTGCGTCTGGACC-3′ and 5′-ACATGGTGGTGCCGCCAGACAG-3′, whereas PUMA expression was analyzed using the QuantiTect Primer Assay (Qiagen, Hilden, Germany).

    Incubation:

    Article Title: Histochemical Examination on Periodontal Tissues of Klotho-Deficient Mice Fed With Phosphate-Insufficient Diet
    Article Snippet: Cycling conditions involved an initial activation step of 50C for 2 min and 94C for 15 min, followed by 50 cycles of 94C for 15 sec and annealing at 55C ( Gapdh ) or 53C ( Fgfr1c and αKlotho ) for 30 sec, extension at 72C for 35 sec, and a final incubation at 95C for 15 sec, 60C for 1 min, and 95C for 15 sec, using ABI 7500 (Applied Biosystems). .. Real-time PCR on mouse β-actin was performed using QuantiTect Primer Assay (Mm_Actb_2_SG; Catalog No. QT01136772; QIAGEN GmbH).

    Activity Assay:

    Article Title: Heparan Sulfate Modulates Neutrophil and Endothelial Function in Antibacterial Innate Immunity
    Article Snippet: Paragraph title: BMDM bactericidal activity and cytokine release. ... Primers for IL-10 were obtained from the QuantiTect primer assay (Qiagen).

    Cell Culture:

    Article Title: Type I interferon receptor controls B-cell expression of nucleic acid-sensing Toll-like receptors and autoantibody production in a murine model of lupus
    Article Snippet: B cells were cultured in RPMI supplemented with L -glutamine (2 mM), sodium pyruvate (1 mM), nonessential amino acids (0.1 mM), penicillin (100 U/mL), streptomycin (0.1 mg/mL), 2-ME (5 × 10-5 M), and FBS (10%) in the presence or absence of 1,000 IU/mL recombinant IFN-α (Calbiochem, now part of EMD Biosciences, Inc., San Diego, CA, USA) for 4 hours. .. QuantiTect Primer Assay sets for murine TLR7, TLR9, and GAPDH were purchased from Qiagen Inc.

    Expressing:

    Article Title: Influence of cryopreservation on the CATSPER2 and TEKT2 expression levels and protein levels in human spermatozoa
    Article Snippet: 2.5.2 Quantitative PCR (qPCR-Screening study) Quantitative PCR (qPCR) was performed for all fresh and cryopreservation samples to quantify the expression level of three genes, namely CATSPER2, TEKT2 , and the housekeeping gene GAPDH as a reference gene (Qiagen, Germany), using a StepOnePlus™ System (Applied Biosystems 7500Fast, USA). .. The cDNA served as the template for qPCR analysis, which was performed using the QuantiTect primer assay (Qiagen, Germany) according to the manufacturer’s recommendations.

    Article Title: Leukocyte-Derived Interleukin-10 Aggravates Postoperative Ileus
    Article Snippet: .. Expression of mRNA was quantified in triplicates by a RT-PCR with exon-spanning primers, Quantitect primer assay (Qiagen), or TaqMan probes (Supplementary Table ) and SYBR Green PCR Master Mix or the TaqMan Gene Expression Master Mix (Applied Biosystems) were used for the PCR. .. Midjejunal, ME whole mounts were fixed in ethanol for 10 min and underwent an staining of myeloperoxidase (MPO)+ cells for 10 min with 1 mg/ml Hanker Yates reagent (Polysciences Europe, Hamburg, Germany) in PBS containing 0.3% H2 O2 .

    Article Title: Novel insights into a treatment for aplastic anemia based on the advanced proliferation of bone marrow-derived mesenchymal stem cells induced by fibroblast growth factor 1
    Article Snippet: Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) To investigate the expression of target genes, total RNA was extracted and isolated from BMSCs using TRIzol reagent (Invitrogen Life Technologies). .. RT-qPCR was performed using the QuantiTect Primer assay (Qiagen GmbH, Hilden, Germany) and QuantiTect SYBR Green RT-PCR kit (Qiagen GmbH) on a LightCycler 480 Instrument (Roche Diagnostics, Mannheim, Germany).

    Article Title: Elevated IGFBP3 levels in diabetic tears: a negative regulator of IGF-1 signaling in the corneal epithelium
    Article Snippet: IGF-1R and IGFBP-3 expression in samples were normalized to β-actin mRNA expression using the ΔCt method. .. The primers used in PCR were obtained from QuantiTect Primer Assay (Qiagen, Valencia, CA) as follows: β-actin probe (Cat. QT00095431); IGF-1R probe (Cat. QT00005831); IGFBP-3 probe (Cat. QT00072737).

    Article Title: ATP induces PAD2-dependent citrullination in Mast Cells through the P2X7 Receptor
    Article Snippet: TaqMan Gene Expression Assays were used for mouse Adamts9 and Rab6b (Applied Biosystems). .. QuantiTect Primer Assay was used for mouse TNFR2 (QIAGEN).

    Article Title: Disruption of CLOCK-BMAL1 Transcriptional Activity Is Responsible for Aryl Hydrocarbon Receptor-Mediated Regulation of Period1 Gene
    Article Snippet: .. Following complementary DNA (cDNA) synthesis, 5 μl of diluted cDNA (1:5) was used in 20 μl of SYBR green PCR mix (Bio-Rad) containing 300nM Per1 -specific primer pairs as previously published , and 5 μl of diluted cDNA (1:5) was used in 20 μl of SYBR green PCR mix with 1× Quantitect Primer Assay for Cyp1a1 gene expression analysis (Qiagen). .. Amplification was performed using a Smart Cycler rapid thermal cycler (Cepheid) according to the following protocol: an initial 10-min denaturation step at 95°C, followed by 40 cycles of denaturation (95°C) for 30 s, annealing (primer-optimized temperature) for 30 s, and extension (72°C) for 30 s. Detection of the fluorescent product was carried out during each 72°C extension period, and emission data were quantified using threshold cycle values.

    Article Title: Human decidua basalis mesenchymal stem/stromal cells protect endothelial cell functions from oxidative stress induced by hydrogen peroxide and monocytes
    Article Snippet: .. The expression of 84 genes related to endothelial cell biology (catalogue number PAHS-015ZD-24, Qiagen, Hilden, Germany) by HUVEC was determined using QuantiTect Primer Assay (Qiagen, Hilden, Germany) in a real-time polymerase chain reaction (RT-PCR) as previously published [ ]. .. Briefly, total RNA from HUVEC pretreated with DBMSCs and 100 μM H2 O2 for 48 h was isolated, and cDNA was then synthesized using FastLane Cell cDNA kit and RT Primer Mix (Qiagen) as previously published [ ].

    Article Title: Elongase Reactions as Control Points in Long-Chain Polyunsaturated Fatty Acid Synthesis
    Article Snippet: Paragraph title: Elovl2 and Elovl5 expression levels ... Each reaction contained 10 ng of cDNA, 5 µl QuantiFast™ SYBR® Green PCR master mix and 1 µl of QuantiTect® Primer Assay (Qiagen), in a total volume of 10 µl.

    Article Title: Type I interferon receptor controls B-cell expression of nucleic acid-sensing Toll-like receptors and autoantibody production in a murine model of lupus
    Article Snippet: The fold change in expression of each transcript normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was determined using the 2-ΔΔCt method. .. QuantiTect Primer Assay sets for murine TLR7, TLR9, and GAPDH were purchased from Qiagen Inc.

    Article Title: Inflammasome Activation Contributes to Interleukin-23 Production in Response to Clostridium difficile
    Article Snippet: .. IL-23a gene expression was quantified via a QuantiTect primer assay (Qiagen) using Sensifast SYBR and fluorescein mix (Bioline) in the QuantiTect 2-step amplification protocol. .. Gene expression was normalized to that of β-actin (forward primer, ATTGCCGACAGGATGCAGAA; reverse primer, GCTGATCCACATCTGCTGGAA).

    Article Title: Salinomycin increases chemosensitivity to the effects of doxorubicin in soft tissue sarcomas
    Article Snippet: .. The sequence for the PCR primers are: p21 : 5′-GGCGGCAGACCAGCATGACAGATT-3′ and 5′-GCAGGGGGCGGCCAGGGTAT-3′; p53: 5′-CTAAGCGAGCACTGCCCAAC-3′ and 5′-GGCCTCATTCAGCTCTCGGA-3′; actin: 5′-CATGCCATCCTGCGTCTGGACC-3′ and 5′-ACATGGTGGTGCCGCCAGACAG-3′, whereas PUMA expression was analyzed using the QuantiTect Primer Assay (Qiagen, Hilden, Germany). .. After an initial activation at 94°C for 3 min, 40 cycles of 94°C for 15 s, 55°C for 30 seconds, and 72°C for 45 s. Experiments were done in triplicates and fold changes calculated based on the ∆∆Ct method.

    Sequencing:

    Article Title: Reduced mRNA and Protein Expression of the Genomic Caretaker RAD9A in Primary Fibroblasts of Individuals with Childhood and Independent Second Cancer
    Article Snippet: Linearity of amplification was verified by qPCR standard curve and sequence analysis. .. Each 25 µl reaction volume contained 25 ng cDNA template in 10 µl RNase-free PCR graded water, 2.5 µl 10x QuantiTect Primer Assay and 12.5 µl 2x QuantiTect SYBR Green PCR Master Mix (Qiagen).

    Article Title: Salinomycin increases chemosensitivity to the effects of doxorubicin in soft tissue sarcomas
    Article Snippet: .. The sequence for the PCR primers are: p21 : 5′-GGCGGCAGACCAGCATGACAGATT-3′ and 5′-GCAGGGGGCGGCCAGGGTAT-3′; p53: 5′-CTAAGCGAGCACTGCCCAAC-3′ and 5′-GGCCTCATTCAGCTCTCGGA-3′; actin: 5′-CATGCCATCCTGCGTCTGGACC-3′ and 5′-ACATGGTGGTGCCGCCAGACAG-3′, whereas PUMA expression was analyzed using the QuantiTect Primer Assay (Qiagen, Hilden, Germany). .. After an initial activation at 94°C for 3 min, 40 cycles of 94°C for 15 s, 55°C for 30 seconds, and 72°C for 45 s. Experiments were done in triplicates and fold changes calculated based on the ∆∆Ct method.

    Activation Assay:

    Article Title: Histochemical Examination on Periodontal Tissues of Klotho-Deficient Mice Fed With Phosphate-Insufficient Diet
    Article Snippet: Cycling conditions involved an initial activation step of 50C for 2 min and 94C for 15 min, followed by 50 cycles of 94C for 15 sec and annealing at 55C ( Gapdh ) or 53C ( Fgfr1c and αKlotho ) for 30 sec, extension at 72C for 35 sec, and a final incubation at 95C for 15 sec, 60C for 1 min, and 95C for 15 sec, using ABI 7500 (Applied Biosystems). .. Real-time PCR on mouse β-actin was performed using QuantiTect Primer Assay (Mm_Actb_2_SG; Catalog No. QT01136772; QIAGEN GmbH).

    Article Title: Salinomycin increases chemosensitivity to the effects of doxorubicin in soft tissue sarcomas
    Article Snippet: The sequence for the PCR primers are: p21 : 5′-GGCGGCAGACCAGCATGACAGATT-3′ and 5′-GCAGGGGGCGGCCAGGGTAT-3′; p53: 5′-CTAAGCGAGCACTGCCCAAC-3′ and 5′-GGCCTCATTCAGCTCTCGGA-3′; actin: 5′-CATGCCATCCTGCGTCTGGACC-3′ and 5′-ACATGGTGGTGCCGCCAGACAG-3′, whereas PUMA expression was analyzed using the QuantiTect Primer Assay (Qiagen, Hilden, Germany). .. After an initial activation at 94°C for 3 min, 40 cycles of 94°C for 15 s, 55°C for 30 seconds, and 72°C for 45 s. Experiments were done in triplicates and fold changes calculated based on the ∆∆Ct method.

    Serial Dilution:

    Article Title: The effect of differentiation and TGFβ on mitochondrial respiration and mitochondrial enzyme abundance in cultured primary human skeletal muscle cells
    Article Snippet: RNA was extracted employing the NucleoSpin miRNA kit (Macherey-Nagel, Düren, Germany) and reverse transcription was carried out with the Transcriptor First Strand Synthesis Kit (Roche, Basel, Switzerland) using 500–1,000 ng total RNA per 20 µl reaction. cDNA was diluted with 80 µl of nuclease free water and 2.5 µl of this dilution was used in a 20 µl qPCR reaction containing 10 µl QuantiFast SYBR Green PCR Mix and 2 µl QuantiTect Primer Assay (Qiagen, Hilden, Germany, Table ) on a LightCycler 480 machine (Roche). .. Standards for PCR were generated by purifying PCR-Product (MinElute PCR Purification Kit, Qiagen) for each primer and generating a 10-fold serial dilution series ranging from 5 pg/µl to 0.5 ag/µl.

    Infection:

    Article Title: Heparan Sulfate Modulates Neutrophil and Endothelial Function in Antibacterial Innate Immunity
    Article Snippet: Culture supernatants were collected 24 h after infection, and secretion of tumor necrosis factor alpha (TNF-α) and interleukin 6 (IL-6) was analyzed by enzyme-linked immunosorbent assay (ELISA) (BD Biosciences). .. Primers for IL-10 were obtained from the QuantiTect primer assay (Qiagen).

    Generated:

    Article Title: The effect of differentiation and TGFβ on mitochondrial respiration and mitochondrial enzyme abundance in cultured primary human skeletal muscle cells
    Article Snippet: RNA was extracted employing the NucleoSpin miRNA kit (Macherey-Nagel, Düren, Germany) and reverse transcription was carried out with the Transcriptor First Strand Synthesis Kit (Roche, Basel, Switzerland) using 500–1,000 ng total RNA per 20 µl reaction. cDNA was diluted with 80 µl of nuclease free water and 2.5 µl of this dilution was used in a 20 µl qPCR reaction containing 10 µl QuantiFast SYBR Green PCR Mix and 2 µl QuantiTect Primer Assay (Qiagen, Hilden, Germany, Table ) on a LightCycler 480 machine (Roche). .. Standards for PCR were generated by purifying PCR-Product (MinElute PCR Purification Kit, Qiagen) for each primer and generating a 10-fold serial dilution series ranging from 5 pg/µl to 0.5 ag/µl.

    Article Title: ATP induces PAD2-dependent citrullination in Mast Cells through the P2X7 Receptor
    Article Snippet: Error bars were generated by averaging the ΔΔCt values from culture cDNAs. .. QuantiTect Primer Assay was used for mouse TNFR2 (QIAGEN).

    Polymerase Chain Reaction:

    Article Title: The effect of differentiation and TGFβ on mitochondrial respiration and mitochondrial enzyme abundance in cultured primary human skeletal muscle cells
    Article Snippet: .. RNA was extracted employing the NucleoSpin miRNA kit (Macherey-Nagel, Düren, Germany) and reverse transcription was carried out with the Transcriptor First Strand Synthesis Kit (Roche, Basel, Switzerland) using 500–1,000 ng total RNA per 20 µl reaction. cDNA was diluted with 80 µl of nuclease free water and 2.5 µl of this dilution was used in a 20 µl qPCR reaction containing 10 µl QuantiFast SYBR Green PCR Mix and 2 µl QuantiTect Primer Assay (Qiagen, Hilden, Germany, Table ) on a LightCycler 480 machine (Roche). .. Standards for PCR were generated by purifying PCR-Product (MinElute PCR Purification Kit, Qiagen) for each primer and generating a 10-fold serial dilution series ranging from 5 pg/µl to 0.5 ag/µl.

    Article Title: Leukocyte-Derived Interleukin-10 Aggravates Postoperative Ileus
    Article Snippet: .. Expression of mRNA was quantified in triplicates by a RT-PCR with exon-spanning primers, Quantitect primer assay (Qiagen), or TaqMan probes (Supplementary Table ) and SYBR Green PCR Master Mix or the TaqMan Gene Expression Master Mix (Applied Biosystems) were used for the PCR. .. Midjejunal, ME whole mounts were fixed in ethanol for 10 min and underwent an staining of myeloperoxidase (MPO)+ cells for 10 min with 1 mg/ml Hanker Yates reagent (Polysciences Europe, Hamburg, Germany) in PBS containing 0.3% H2 O2 .

    Article Title: Novel insights into a treatment for aplastic anemia based on the advanced proliferation of bone marrow-derived mesenchymal stem cells induced by fibroblast growth factor 1
    Article Snippet: Paragraph title: Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) ... RT-qPCR was performed using the QuantiTect Primer assay (Qiagen GmbH, Hilden, Germany) and QuantiTect SYBR Green RT-PCR kit (Qiagen GmbH) on a LightCycler 480 Instrument (Roche Diagnostics, Mannheim, Germany).

    Article Title: Elevated IGFBP3 levels in diabetic tears: a negative regulator of IGF-1 signaling in the corneal epithelium
    Article Snippet: .. The primers used in PCR were obtained from QuantiTect Primer Assay (Qiagen, Valencia, CA) as follows: β-actin probe (Cat. QT00095431); IGF-1R probe (Cat. QT00005831); IGFBP-3 probe (Cat. QT00072737). .. Statistical analysis was performed using SigmaStat 3.1 (Systat Software, Inc., San Jose, CA).

    Article Title: Histochemical Examination on Periodontal Tissues of Klotho-Deficient Mice Fed With Phosphate-Insufficient Diet
    Article Snippet: Paragraph title: Polymerase Chain Reaction and Real-Time PCR for αKlotho and Fgfr1c ... Real-time PCR on mouse β-actin was performed using QuantiTect Primer Assay (Mm_Actb_2_SG; Catalog No. QT01136772; QIAGEN GmbH).

    Article Title: Disruption of CLOCK-BMAL1 Transcriptional Activity Is Responsible for Aryl Hydrocarbon Receptor-Mediated Regulation of Period1 Gene
    Article Snippet: .. Following complementary DNA (cDNA) synthesis, 5 μl of diluted cDNA (1:5) was used in 20 μl of SYBR green PCR mix (Bio-Rad) containing 300nM Per1 -specific primer pairs as previously published , and 5 μl of diluted cDNA (1:5) was used in 20 μl of SYBR green PCR mix with 1× Quantitect Primer Assay for Cyp1a1 gene expression analysis (Qiagen). .. Amplification was performed using a Smart Cycler rapid thermal cycler (Cepheid) according to the following protocol: an initial 10-min denaturation step at 95°C, followed by 40 cycles of denaturation (95°C) for 30 s, annealing (primer-optimized temperature) for 30 s, and extension (72°C) for 30 s. Detection of the fluorescent product was carried out during each 72°C extension period, and emission data were quantified using threshold cycle values.

    Article Title: Human decidua basalis mesenchymal stem/stromal cells protect endothelial cell functions from oxidative stress induced by hydrogen peroxide and monocytes
    Article Snippet: The expression of 84 genes related to endothelial cell biology (catalogue number PAHS-015ZD-24, Qiagen, Hilden, Germany) by HUVEC was determined using QuantiTect Primer Assay (Qiagen, Hilden, Germany) in a real-time polymerase chain reaction (RT-PCR) as previously published [ ]. .. After quantifying mRNA using QuantiTect SYBR Green PCR Kit (Qiagen), the real-time PCR reaction was performed in triplicate on the CFX96 real-time PCR detection system (BIO-RAD) as previously published [ ].

    Article Title: Elongase Reactions as Control Points in Long-Chain Polyunsaturated Fatty Acid Synthesis
    Article Snippet: .. Each reaction contained 10 ng of cDNA, 5 µl QuantiFast™ SYBR® Green PCR master mix and 1 µl of QuantiTect® Primer Assay (Qiagen), in a total volume of 10 µl. ..

    Article Title: Reduced mRNA and Protein Expression of the Genomic Caretaker RAD9A in Primary Fibroblasts of Individuals with Childhood and Independent Second Cancer
    Article Snippet: .. Each 25 µl reaction volume contained 25 ng cDNA template in 10 µl RNase-free PCR graded water, 2.5 µl 10x QuantiTect Primer Assay and 12.5 µl 2x QuantiTect SYBR Green PCR Master Mix (Qiagen). ..

    Article Title: Inflammasome Activation Contributes to Interleukin-23 Production in Response to Clostridium difficile
    Article Snippet: The resulting cDNA was purified using Qiagen’s PCR purification kit. .. IL-23a gene expression was quantified via a QuantiTect primer assay (Qiagen) using Sensifast SYBR and fluorescein mix (Bioline) in the QuantiTect 2-step amplification protocol.

    Article Title: Salinomycin increases chemosensitivity to the effects of doxorubicin in soft tissue sarcomas
    Article Snippet: .. The sequence for the PCR primers are: p21 : 5′-GGCGGCAGACCAGCATGACAGATT-3′ and 5′-GCAGGGGGCGGCCAGGGTAT-3′; p53: 5′-CTAAGCGAGCACTGCCCAAC-3′ and 5′-GGCCTCATTCAGCTCTCGGA-3′; actin: 5′-CATGCCATCCTGCGTCTGGACC-3′ and 5′-ACATGGTGGTGCCGCCAGACAG-3′, whereas PUMA expression was analyzed using the QuantiTect Primer Assay (Qiagen, Hilden, Germany). .. After an initial activation at 94°C for 3 min, 40 cycles of 94°C for 15 s, 55°C for 30 seconds, and 72°C for 45 s. Experiments were done in triplicates and fold changes calculated based on the ∆∆Ct method.

    Recombinant:

    Article Title: Type I interferon receptor controls B-cell expression of nucleic acid-sensing Toll-like receptors and autoantibody production in a murine model of lupus
    Article Snippet: B cells were cultured in RPMI supplemented with L -glutamine (2 mM), sodium pyruvate (1 mM), nonessential amino acids (0.1 mM), penicillin (100 U/mL), streptomycin (0.1 mg/mL), 2-ME (5 × 10-5 M), and FBS (10%) in the presence or absence of 1,000 IU/mL recombinant IFN-α (Calbiochem, now part of EMD Biosciences, Inc., San Diego, CA, USA) for 4 hours. .. QuantiTect Primer Assay sets for murine TLR7, TLR9, and GAPDH were purchased from Qiagen Inc.

    Nucleic Acid Electrophoresis:

    Article Title: Disruption of CLOCK-BMAL1 Transcriptional Activity Is Responsible for Aryl Hydrocarbon Receptor-Mediated Regulation of Period1 Gene
    Article Snippet: Concentration, purity, and quality of the RNA were determined using Nanodrop ND-1000 UV Spectrophotometer at 260 and 280 nm and by gel electrophoresis. .. Following complementary DNA (cDNA) synthesis, 5 μl of diluted cDNA (1:5) was used in 20 μl of SYBR green PCR mix (Bio-Rad) containing 300nM Per1 -specific primer pairs as previously published , and 5 μl of diluted cDNA (1:5) was used in 20 μl of SYBR green PCR mix with 1× Quantitect Primer Assay for Cyp1a1 gene expression analysis (Qiagen).

    Fluorescence:

    Article Title: Elevated IGFBP3 levels in diabetic tears: a negative regulator of IGF-1 signaling in the corneal epithelium
    Article Snippet: Acquisition of fluorescence signals was monitored on an iCycler and data analysis was performed with the iCycler iQ real-time detection system software (Bio-rad, Hercules, CA). .. The primers used in PCR were obtained from QuantiTect Primer Assay (Qiagen, Valencia, CA) as follows: β-actin probe (Cat. QT00095431); IGF-1R probe (Cat. QT00005831); IGFBP-3 probe (Cat. QT00072737).

    Article Title: Type I interferon receptor controls B-cell expression of nucleic acid-sensing Toll-like receptors and autoantibody production in a murine model of lupus
    Article Snippet: RNA (10 ng) was amplified using one-step QuantiTect SYBR Green reverse transcription-polymerase chain reaction (Qiagen Inc.) and 0.5 μM forward and reverse primers using an Opticon2 continuous fluorescence detector (MJ Research, now part of Bio-Rad Laboratories, Inc., Hercules, CA, USA). .. QuantiTect Primer Assay sets for murine TLR7, TLR9, and GAPDH were purchased from Qiagen Inc.

    Isolation:

    Article Title: Leukocyte-Derived Interleukin-10 Aggravates Postoperative Ileus
    Article Snippet: Sorted cells were extracted using PicoPure Isolation RNA kit (Thermo Fischer Scientific, Germany). .. Expression of mRNA was quantified in triplicates by a RT-PCR with exon-spanning primers, Quantitect primer assay (Qiagen), or TaqMan probes (Supplementary Table ) and SYBR Green PCR Master Mix or the TaqMan Gene Expression Master Mix (Applied Biosystems) were used for the PCR.

    Article Title: Heparan Sulfate Modulates Neutrophil and Endothelial Function in Antibacterial Innate Immunity
    Article Snippet: For quantitative RT-PCR analysis, RNA was isolated from BMDMs using TRIzol (Life Technologies) 30 min after GBS stimulation (MOI = 10) and used as a template for cDNA preparation by iScript (Bio-Rad). .. Primers for IL-10 were obtained from the QuantiTect primer assay (Qiagen).

    Article Title: Novel insights into a treatment for aplastic anemia based on the advanced proliferation of bone marrow-derived mesenchymal stem cells induced by fibroblast growth factor 1
    Article Snippet: Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) To investigate the expression of target genes, total RNA was extracted and isolated from BMSCs using TRIzol reagent (Invitrogen Life Technologies). .. RT-qPCR was performed using the QuantiTect Primer assay (Qiagen GmbH, Hilden, Germany) and QuantiTect SYBR Green RT-PCR kit (Qiagen GmbH) on a LightCycler 480 Instrument (Roche Diagnostics, Mannheim, Germany).

    Article Title: Disruption of CLOCK-BMAL1 Transcriptional Activity Is Responsible for Aryl Hydrocarbon Receptor-Mediated Regulation of Period1 Gene
    Article Snippet: Paragraph title: Total RNA isolation, reverse transcription, and quantitative reverse transcription–PCR. ... Following complementary DNA (cDNA) synthesis, 5 μl of diluted cDNA (1:5) was used in 20 μl of SYBR green PCR mix (Bio-Rad) containing 300nM Per1 -specific primer pairs as previously published , and 5 μl of diluted cDNA (1:5) was used in 20 μl of SYBR green PCR mix with 1× Quantitect Primer Assay for Cyp1a1 gene expression analysis (Qiagen).

    Article Title: Human decidua basalis mesenchymal stem/stromal cells protect endothelial cell functions from oxidative stress induced by hydrogen peroxide and monocytes
    Article Snippet: Paragraph title: RNA isolation, cDNA synthesis, and real-time polymerase chain reaction (RT-PCR) analysis ... The expression of 84 genes related to endothelial cell biology (catalogue number PAHS-015ZD-24, Qiagen, Hilden, Germany) by HUVEC was determined using QuantiTect Primer Assay (Qiagen, Hilden, Germany) in a real-time polymerase chain reaction (RT-PCR) as previously published [ ].

    Article Title: Inflammasome Activation Contributes to Interleukin-23 Production in Response to Clostridium difficile
    Article Snippet: RNA was isolated using the RNeasy isolation kit (Qiagen). .. IL-23a gene expression was quantified via a QuantiTect primer assay (Qiagen) using Sensifast SYBR and fluorescein mix (Bioline) in the QuantiTect 2-step amplification protocol.

    Article Title: Salinomycin increases chemosensitivity to the effects of doxorubicin in soft tissue sarcomas
    Article Snippet: Paragraph title: RNA isolation and RT-PCR ... The sequence for the PCR primers are: p21 : 5′-GGCGGCAGACCAGCATGACAGATT-3′ and 5′-GCAGGGGGCGGCCAGGGTAT-3′; p53: 5′-CTAAGCGAGCACTGCCCAAC-3′ and 5′-GGCCTCATTCAGCTCTCGGA-3′; actin: 5′-CATGCCATCCTGCGTCTGGACC-3′ and 5′-ACATGGTGGTGCCGCCAGACAG-3′, whereas PUMA expression was analyzed using the QuantiTect Primer Assay (Qiagen, Hilden, Germany).

    Size-exclusion Chromatography:

    Article Title: Histochemical Examination on Periodontal Tissues of Klotho-Deficient Mice Fed With Phosphate-Insufficient Diet
    Article Snippet: Cycling conditions involved an initial activation step of 50C for 2 min and 94C for 15 min, followed by 50 cycles of 94C for 15 sec and annealing at 55C ( Gapdh ) or 53C ( Fgfr1c and αKlotho ) for 30 sec, extension at 72C for 35 sec, and a final incubation at 95C for 15 sec, 60C for 1 min, and 95C for 15 sec, using ABI 7500 (Applied Biosystems). .. Real-time PCR on mouse β-actin was performed using QuantiTect Primer Assay (Mm_Actb_2_SG; Catalog No. QT01136772; QIAGEN GmbH).

    Purification:

    Article Title: The effect of differentiation and TGFβ on mitochondrial respiration and mitochondrial enzyme abundance in cultured primary human skeletal muscle cells
    Article Snippet: RNA was extracted employing the NucleoSpin miRNA kit (Macherey-Nagel, Düren, Germany) and reverse transcription was carried out with the Transcriptor First Strand Synthesis Kit (Roche, Basel, Switzerland) using 500–1,000 ng total RNA per 20 µl reaction. cDNA was diluted with 80 µl of nuclease free water and 2.5 µl of this dilution was used in a 20 µl qPCR reaction containing 10 µl QuantiFast SYBR Green PCR Mix and 2 µl QuantiTect Primer Assay (Qiagen, Hilden, Germany, Table ) on a LightCycler 480 machine (Roche). .. Standards for PCR were generated by purifying PCR-Product (MinElute PCR Purification Kit, Qiagen) for each primer and generating a 10-fold serial dilution series ranging from 5 pg/µl to 0.5 ag/µl.

    Article Title: Inflammasome Activation Contributes to Interleukin-23 Production in Response to Clostridium difficile
    Article Snippet: The resulting cDNA was purified using Qiagen’s PCR purification kit. .. IL-23a gene expression was quantified via a QuantiTect primer assay (Qiagen) using Sensifast SYBR and fluorescein mix (Bioline) in the QuantiTect 2-step amplification protocol.

    Article Title: Salinomycin increases chemosensitivity to the effects of doxorubicin in soft tissue sarcomas
    Article Snippet: To remove possible genomic contamination, DNA digestion was performed by using the Ambion TurboDNAse purification kit (Life Technologies, Darmstadt, Germany) as described in the kit’s manual. .. The sequence for the PCR primers are: p21 : 5′-GGCGGCAGACCAGCATGACAGATT-3′ and 5′-GCAGGGGGCGGCCAGGGTAT-3′; p53: 5′-CTAAGCGAGCACTGCCCAAC-3′ and 5′-GGCCTCATTCAGCTCTCGGA-3′; actin: 5′-CATGCCATCCTGCGTCTGGACC-3′ and 5′-ACATGGTGGTGCCGCCAGACAG-3′, whereas PUMA expression was analyzed using the QuantiTect Primer Assay (Qiagen, Hilden, Germany).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Leukocyte-Derived Interleukin-10 Aggravates Postoperative Ileus
    Article Snippet: .. Expression of mRNA was quantified in triplicates by a RT-PCR with exon-spanning primers, Quantitect primer assay (Qiagen), or TaqMan probes (Supplementary Table ) and SYBR Green PCR Master Mix or the TaqMan Gene Expression Master Mix (Applied Biosystems) were used for the PCR. .. Midjejunal, ME whole mounts were fixed in ethanol for 10 min and underwent an staining of myeloperoxidase (MPO)+ cells for 10 min with 1 mg/ml Hanker Yates reagent (Polysciences Europe, Hamburg, Germany) in PBS containing 0.3% H2 O2 .

    Article Title: Novel insights into a treatment for aplastic anemia based on the advanced proliferation of bone marrow-derived mesenchymal stem cells induced by fibroblast growth factor 1
    Article Snippet: .. RT-qPCR was performed using the QuantiTect Primer assay (Qiagen GmbH, Hilden, Germany) and QuantiTect SYBR Green RT-PCR kit (Qiagen GmbH) on a LightCycler 480 Instrument (Roche Diagnostics, Mannheim, Germany). .. The target gene primers were designed by Invitrogen Life Technologies and primer sequences were as follows: Forward: 5′-CAGTACTTGGCCATGGACA-3′ and reverse: 5′-AGTGAGTCCGAGGACCGC-3′.

    Article Title: Histochemical Examination on Periodontal Tissues of Klotho-Deficient Mice Fed With Phosphate-Insufficient Diet
    Article Snippet: The PCR was performed using a thermal cycler (GeneAmp PCR System 2700; Applied Biosystems, Foster City, CA) as follows: denaturation at 94C for 30 sec, annealing at 60C (for Gapdh ) and 55C (for Fgfr1c and αKlotho ) for 30 sec, extension at 72C for 30 sec, and a final incubation at 72C for 10 min. RT-PCR products were subjected to 2% agarose gel electrophoresis, stained with ethidium bromide, and detected using E-Gel Imager (Life Technologies). .. Real-time PCR on mouse β-actin was performed using QuantiTect Primer Assay (Mm_Actb_2_SG; Catalog No. QT01136772; QIAGEN GmbH).

    Article Title: Human decidua basalis mesenchymal stem/stromal cells protect endothelial cell functions from oxidative stress induced by hydrogen peroxide and monocytes
    Article Snippet: .. The expression of 84 genes related to endothelial cell biology (catalogue number PAHS-015ZD-24, Qiagen, Hilden, Germany) by HUVEC was determined using QuantiTect Primer Assay (Qiagen, Hilden, Germany) in a real-time polymerase chain reaction (RT-PCR) as previously published [ ]. .. Briefly, total RNA from HUVEC pretreated with DBMSCs and 100 μM H2 O2 for 48 h was isolated, and cDNA was then synthesized using FastLane Cell cDNA kit and RT Primer Mix (Qiagen) as previously published [ ].

    Article Title: Elongase Reactions as Control Points in Long-Chain Polyunsaturated Fatty Acid Synthesis
    Article Snippet: Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was performed using a Rotor-Gene 3000 (Corbett Research) with the QuantiFast™ SYBR® Green PCR kit (Qiagen). .. Each reaction contained 10 ng of cDNA, 5 µl QuantiFast™ SYBR® Green PCR master mix and 1 µl of QuantiTect® Primer Assay (Qiagen), in a total volume of 10 µl.

    Article Title: Type I interferon receptor controls B-cell expression of nucleic acid-sensing Toll-like receptors and autoantibody production in a murine model of lupus
    Article Snippet: RNA (10 ng) was amplified using one-step QuantiTect SYBR Green reverse transcription-polymerase chain reaction (Qiagen Inc.) and 0.5 μM forward and reverse primers using an Opticon2 continuous fluorescence detector (MJ Research, now part of Bio-Rad Laboratories, Inc., Hercules, CA, USA). .. QuantiTect Primer Assay sets for murine TLR7, TLR9, and GAPDH were purchased from Qiagen Inc.

    Article Title: Salinomycin increases chemosensitivity to the effects of doxorubicin in soft tissue sarcomas
    Article Snippet: Paragraph title: RNA isolation and RT-PCR ... The sequence for the PCR primers are: p21 : 5′-GGCGGCAGACCAGCATGACAGATT-3′ and 5′-GCAGGGGGCGGCCAGGGTAT-3′; p53: 5′-CTAAGCGAGCACTGCCCAAC-3′ and 5′-GGCCTCATTCAGCTCTCGGA-3′; actin: 5′-CATGCCATCCTGCGTCTGGACC-3′ and 5′-ACATGGTGGTGCCGCCAGACAG-3′, whereas PUMA expression was analyzed using the QuantiTect Primer Assay (Qiagen, Hilden, Germany).

    Software:

    Article Title: Elevated IGFBP3 levels in diabetic tears: a negative regulator of IGF-1 signaling in the corneal epithelium
    Article Snippet: Acquisition of fluorescence signals was monitored on an iCycler and data analysis was performed with the iCycler iQ real-time detection system software (Bio-rad, Hercules, CA). .. The primers used in PCR were obtained from QuantiTect Primer Assay (Qiagen, Valencia, CA) as follows: β-actin probe (Cat. QT00095431); IGF-1R probe (Cat. QT00005831); IGFBP-3 probe (Cat. QT00072737).

    Article Title: Human decidua basalis mesenchymal stem/stromal cells protect endothelial cell functions from oxidative stress induced by hydrogen peroxide and monocytes
    Article Snippet: The expression of 84 genes related to endothelial cell biology (catalogue number PAHS-015ZD-24, Qiagen, Hilden, Germany) by HUVEC was determined using QuantiTect Primer Assay (Qiagen, Hilden, Germany) in a real-time polymerase chain reaction (RT-PCR) as previously published [ ]. .. To analyze the data, the CFX manager software (Bio-Rad, CA, USA) was used.

    SYBR Green Assay:

    Article Title: The effect of differentiation and TGFβ on mitochondrial respiration and mitochondrial enzyme abundance in cultured primary human skeletal muscle cells
    Article Snippet: .. RNA was extracted employing the NucleoSpin miRNA kit (Macherey-Nagel, Düren, Germany) and reverse transcription was carried out with the Transcriptor First Strand Synthesis Kit (Roche, Basel, Switzerland) using 500–1,000 ng total RNA per 20 µl reaction. cDNA was diluted with 80 µl of nuclease free water and 2.5 µl of this dilution was used in a 20 µl qPCR reaction containing 10 µl QuantiFast SYBR Green PCR Mix and 2 µl QuantiTect Primer Assay (Qiagen, Hilden, Germany, Table ) on a LightCycler 480 machine (Roche). .. Standards for PCR were generated by purifying PCR-Product (MinElute PCR Purification Kit, Qiagen) for each primer and generating a 10-fold serial dilution series ranging from 5 pg/µl to 0.5 ag/µl.

    Article Title: Leukocyte-Derived Interleukin-10 Aggravates Postoperative Ileus
    Article Snippet: .. Expression of mRNA was quantified in triplicates by a RT-PCR with exon-spanning primers, Quantitect primer assay (Qiagen), or TaqMan probes (Supplementary Table ) and SYBR Green PCR Master Mix or the TaqMan Gene Expression Master Mix (Applied Biosystems) were used for the PCR. .. Midjejunal, ME whole mounts were fixed in ethanol for 10 min and underwent an staining of myeloperoxidase (MPO)+ cells for 10 min with 1 mg/ml Hanker Yates reagent (Polysciences Europe, Hamburg, Germany) in PBS containing 0.3% H2 O2 .

    Article Title: Heparan Sulfate Modulates Neutrophil and Endothelial Function in Antibacterial Innate Immunity
    Article Snippet: Quantitative PCR was performed using iQ SYBR green supermix (Bio-Rad) per standard protocols. .. Primers for IL-10 were obtained from the QuantiTect primer assay (Qiagen).

    Article Title: Novel insights into a treatment for aplastic anemia based on the advanced proliferation of bone marrow-derived mesenchymal stem cells induced by fibroblast growth factor 1
    Article Snippet: .. RT-qPCR was performed using the QuantiTect Primer assay (Qiagen GmbH, Hilden, Germany) and QuantiTect SYBR Green RT-PCR kit (Qiagen GmbH) on a LightCycler 480 Instrument (Roche Diagnostics, Mannheim, Germany). .. The target gene primers were designed by Invitrogen Life Technologies and primer sequences were as follows: Forward: 5′-CAGTACTTGGCCATGGACA-3′ and reverse: 5′-AGTGAGTCCGAGGACCGC-3′.

    Article Title: Elevated IGFBP3 levels in diabetic tears: a negative regulator of IGF-1 signaling in the corneal epithelium
    Article Snippet: The expression of β-actin, IGF-1R, and IGFBP-3 was quantified on an iCycler iQ real-time detection system (Bio-rad, Hercules, CA) using the QuantiFast SYBR Green PCR Kit (Qiagen, Valencia, CA) according to manufacturer’s instructions. .. The primers used in PCR were obtained from QuantiTect Primer Assay (Qiagen, Valencia, CA) as follows: β-actin probe (Cat. QT00095431); IGF-1R probe (Cat. QT00005831); IGFBP-3 probe (Cat. QT00072737).

    Article Title: Histochemical Examination on Periodontal Tissues of Klotho-Deficient Mice Fed With Phosphate-Insufficient Diet
    Article Snippet: Real-time PCR assays were performed in a final reaction volume of 50 µl that consisted of 25.0 µl of 2× QuantiFast SYBR Green PCR Master Mix (QIAGEN GmbH, Hilden, Germany), 2.5-µl of each primer, 1.0 ml of template DNA, and 19.0 µl of DEPC-treated water. .. Real-time PCR on mouse β-actin was performed using QuantiTect Primer Assay (Mm_Actb_2_SG; Catalog No. QT01136772; QIAGEN GmbH).

    Article Title: Disruption of CLOCK-BMAL1 Transcriptional Activity Is Responsible for Aryl Hydrocarbon Receptor-Mediated Regulation of Period1 Gene
    Article Snippet: .. Following complementary DNA (cDNA) synthesis, 5 μl of diluted cDNA (1:5) was used in 20 μl of SYBR green PCR mix (Bio-Rad) containing 300nM Per1 -specific primer pairs as previously published , and 5 μl of diluted cDNA (1:5) was used in 20 μl of SYBR green PCR mix with 1× Quantitect Primer Assay for Cyp1a1 gene expression analysis (Qiagen). .. Amplification was performed using a Smart Cycler rapid thermal cycler (Cepheid) according to the following protocol: an initial 10-min denaturation step at 95°C, followed by 40 cycles of denaturation (95°C) for 30 s, annealing (primer-optimized temperature) for 30 s, and extension (72°C) for 30 s. Detection of the fluorescent product was carried out during each 72°C extension period, and emission data were quantified using threshold cycle values.

    Article Title: Human decidua basalis mesenchymal stem/stromal cells protect endothelial cell functions from oxidative stress induced by hydrogen peroxide and monocytes
    Article Snippet: The expression of 84 genes related to endothelial cell biology (catalogue number PAHS-015ZD-24, Qiagen, Hilden, Germany) by HUVEC was determined using QuantiTect Primer Assay (Qiagen, Hilden, Germany) in a real-time polymerase chain reaction (RT-PCR) as previously published [ ]. .. After quantifying mRNA using QuantiTect SYBR Green PCR Kit (Qiagen), the real-time PCR reaction was performed in triplicate on the CFX96 real-time PCR detection system (BIO-RAD) as previously published [ ].

    Article Title: Elongase Reactions as Control Points in Long-Chain Polyunsaturated Fatty Acid Synthesis
    Article Snippet: .. Each reaction contained 10 ng of cDNA, 5 µl QuantiFast™ SYBR® Green PCR master mix and 1 µl of QuantiTect® Primer Assay (Qiagen), in a total volume of 10 µl. ..

    Article Title: Type I interferon receptor controls B-cell expression of nucleic acid-sensing Toll-like receptors and autoantibody production in a murine model of lupus
    Article Snippet: RNA (10 ng) was amplified using one-step QuantiTect SYBR Green reverse transcription-polymerase chain reaction (Qiagen Inc.) and 0.5 μM forward and reverse primers using an Opticon2 continuous fluorescence detector (MJ Research, now part of Bio-Rad Laboratories, Inc., Hercules, CA, USA). .. QuantiTect Primer Assay sets for murine TLR7, TLR9, and GAPDH were purchased from Qiagen Inc.

    Article Title: Reduced mRNA and Protein Expression of the Genomic Caretaker RAD9A in Primary Fibroblasts of Individuals with Childhood and Independent Second Cancer
    Article Snippet: .. Each 25 µl reaction volume contained 25 ng cDNA template in 10 µl RNase-free PCR graded water, 2.5 µl 10x QuantiTect Primer Assay and 12.5 µl 2x QuantiTect SYBR Green PCR Master Mix (Qiagen). ..

    Agarose Gel Electrophoresis:

    Article Title: Histochemical Examination on Periodontal Tissues of Klotho-Deficient Mice Fed With Phosphate-Insufficient Diet
    Article Snippet: The PCR was performed using a thermal cycler (GeneAmp PCR System 2700; Applied Biosystems, Foster City, CA) as follows: denaturation at 94C for 30 sec, annealing at 60C (for Gapdh ) and 55C (for Fgfr1c and αKlotho ) for 30 sec, extension at 72C for 30 sec, and a final incubation at 72C for 10 min. RT-PCR products were subjected to 2% agarose gel electrophoresis, stained with ethidium bromide, and detected using E-Gel Imager (Life Technologies). .. Real-time PCR on mouse β-actin was performed using QuantiTect Primer Assay (Mm_Actb_2_SG; Catalog No. QT01136772; QIAGEN GmbH).

    Article Title: Elongase Reactions as Control Points in Long-Chain Polyunsaturated Fatty Acid Synthesis
    Article Snippet: The quantity and quality of RNA was determined by measuring the absorbance at 260 and 280 nm (NanoDrop Technologies Inc., DE, USA) and agarose gel electrophoresis. .. Each reaction contained 10 ng of cDNA, 5 µl QuantiFast™ SYBR® Green PCR master mix and 1 µl of QuantiTect® Primer Assay (Qiagen), in a total volume of 10 µl.

    Enzyme-linked Immunosorbent Assay:

    Article Title: Heparan Sulfate Modulates Neutrophil and Endothelial Function in Antibacterial Innate Immunity
    Article Snippet: Culture supernatants were collected 24 h after infection, and secretion of tumor necrosis factor alpha (TNF-α) and interleukin 6 (IL-6) was analyzed by enzyme-linked immunosorbent assay (ELISA) (BD Biosciences). .. Primers for IL-10 were obtained from the QuantiTect primer assay (Qiagen).

    Spectrophotometry:

    Article Title: Disruption of CLOCK-BMAL1 Transcriptional Activity Is Responsible for Aryl Hydrocarbon Receptor-Mediated Regulation of Period1 Gene
    Article Snippet: Concentration, purity, and quality of the RNA were determined using Nanodrop ND-1000 UV Spectrophotometer at 260 and 280 nm and by gel electrophoresis. .. Following complementary DNA (cDNA) synthesis, 5 μl of diluted cDNA (1:5) was used in 20 μl of SYBR green PCR mix (Bio-Rad) containing 300nM Per1 -specific primer pairs as previously published , and 5 μl of diluted cDNA (1:5) was used in 20 μl of SYBR green PCR mix with 1× Quantitect Primer Assay for Cyp1a1 gene expression analysis (Qiagen).

    Concentration Assay:

    Article Title: Disruption of CLOCK-BMAL1 Transcriptional Activity Is Responsible for Aryl Hydrocarbon Receptor-Mediated Regulation of Period1 Gene
    Article Snippet: Concentration, purity, and quality of the RNA were determined using Nanodrop ND-1000 UV Spectrophotometer at 260 and 280 nm and by gel electrophoresis. .. Following complementary DNA (cDNA) synthesis, 5 μl of diluted cDNA (1:5) was used in 20 μl of SYBR green PCR mix (Bio-Rad) containing 300nM Per1 -specific primer pairs as previously published , and 5 μl of diluted cDNA (1:5) was used in 20 μl of SYBR green PCR mix with 1× Quantitect Primer Assay for Cyp1a1 gene expression analysis (Qiagen).

    Article Title: Salinomycin increases chemosensitivity to the effects of doxorubicin in soft tissue sarcomas
    Article Snippet: The RNA concentration was measured with a Tecan M200 (Tecan, Crailsheim, Germany). .. The sequence for the PCR primers are: p21 : 5′-GGCGGCAGACCAGCATGACAGATT-3′ and 5′-GCAGGGGGCGGCCAGGGTAT-3′; p53: 5′-CTAAGCGAGCACTGCCCAAC-3′ and 5′-GGCCTCATTCAGCTCTCGGA-3′; actin: 5′-CATGCCATCCTGCGTCTGGACC-3′ and 5′-ACATGGTGGTGCCGCCAGACAG-3′, whereas PUMA expression was analyzed using the QuantiTect Primer Assay (Qiagen, Hilden, Germany).

    CTG Assay:

    Article Title: Histochemical Examination on Periodontal Tissues of Klotho-Deficient Mice Fed With Phosphate-Insufficient Diet
    Article Snippet: The primer sequences used for PCR were as follows: mouse Gapdh forward: TGTCTTCACCACCATG GAGAAGG, reverse: GTGGATGCAGGGATGATGTT CTG; mouse Fgfr1c forward: CTTGACGTCGTGGAAC GATCT, reverse: AGAACGGTCAACCATGCAGAG; and mouse αKlotho forward: GGGTCACTGGGTCA ATCT, reverse: GCAAAGTAGCCACAAAGG. .. Real-time PCR on mouse β-actin was performed using QuantiTect Primer Assay (Mm_Actb_2_SG; Catalog No. QT01136772; QIAGEN GmbH).

    Staining:

    Article Title: Histochemical Examination on Periodontal Tissues of Klotho-Deficient Mice Fed With Phosphate-Insufficient Diet
    Article Snippet: The PCR was performed using a thermal cycler (GeneAmp PCR System 2700; Applied Biosystems, Foster City, CA) as follows: denaturation at 94C for 30 sec, annealing at 60C (for Gapdh ) and 55C (for Fgfr1c and αKlotho ) for 30 sec, extension at 72C for 30 sec, and a final incubation at 72C for 10 min. RT-PCR products were subjected to 2% agarose gel electrophoresis, stained with ethidium bromide, and detected using E-Gel Imager (Life Technologies). .. Real-time PCR on mouse β-actin was performed using QuantiTect Primer Assay (Mm_Actb_2_SG; Catalog No. QT01136772; QIAGEN GmbH).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Qiagen quantitect primer assay
    Quantitect Primer Assay, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 128 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitect primer assay/product/Qiagen
    Average 90 stars, based on 128 article reviews
    Price from $9.99 to $1999.99
    quantitect primer assay - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results