Review



gtttaagcacttcgcaaggta ip  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    ATCC gtttaagcacttcgcaaggta ip
    Gtttaagcacttcgcaaggta Ip, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gtttaagcacttcgcaaggta ip/product/ATCC
    Average 90 stars, based on 6 article reviews
    gtttaagcacttcgcaaggta ip - by Bioz Stars, 2026-02
    90/100 stars

    Images



    Similar Products

    gtttaagcacttcgcaaggta ip  (ATCC)
    90
    ATCC gtttaagcacttcgcaaggta ip
    Gtttaagcacttcgcaaggta Ip, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gtttaagcacttcgcaaggta ip/product/ATCC
    Average 90 stars, based on 1 article reviews
    gtttaagcacttcgcaaggta ip - by Bioz Stars, 2026-02
    90/100 stars
    		  Buy from Supplier
    addgene 236545 236551  (Addgene inc)
    91
    Addgene inc addgene 236545 236551
    Addgene 236545 236551, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/addgene 236545 236551/product/Addgene inc
    Average 91 stars, based on 1 article reviews
    addgene 236545 236551 - by Bioz Stars, 2026-02
    91/100 stars
    		  Buy from Supplier
    plasmid pdonr223 acvr2a  (Addgene inc)
    91
    Addgene inc plasmid pdonr223 acvr2a
    Plasmid Pdonr223 Acvr2a, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plasmid pdonr223 acvr2a/product/Addgene inc
    Average 91 stars, based on 1 article reviews
    plasmid pdonr223 acvr2a - by Bioz Stars, 2026-02
    91/100 stars
    		  Buy from Supplier
    atcc 23654  (ATCC)
    90
    ATCC atcc 23654
    Atcc 23654, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/atcc 23654/product/ATCC
    Average 90 stars, based on 1 article reviews
    atcc 23654 - by Bioz Stars, 2026-02
    90/100 stars
    		  Buy from Supplier
    type strain  (ATCC)
    90
    ATCC type strain
    Type Strain, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/type strain/product/ATCC
    Average 90 stars, based on 1 article reviews
    type strain - by Bioz Stars, 2026-02
    90/100 stars
    		  Buy from Supplier
    salmonella typhimurium atcc 23654  (ATCC)
    90
    ATCC salmonella typhimurium atcc 23654
    Salmonella Typhimurium Atcc 23654, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/salmonella typhimurium atcc 23654/product/ATCC
    Average 90 stars, based on 1 article reviews
    salmonella typhimurium atcc 23654 - by Bioz Stars, 2026-02
    90/100 stars
    		  Buy from Supplier
    atcc 23654 x53164 sv  (ATCC)
    90
    ATCC atcc 23654 x53164 sv
    Atcc 23654 X53164 Sv, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/atcc 23654 x53164 sv/product/ATCC
    Average 90 stars, based on 1 article reviews
    atcc 23654 x53164 sv - by Bioz Stars, 2026-02
    90/100 stars
    		  Buy from Supplier
    23654 x53164 sv  (ATCC)
    90
    ATCC 23654 x53164 sv
    23654 X53164 Sv, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/23654 x53164 sv/product/ATCC
    Average 90 stars, based on 1 article reviews
    23654 x53164 sv - by Bioz Stars, 2026-02
    90/100 stars
    		  Buy from Supplier

    Image Search Results