2000 uv vis spectrophotometer  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    Thermo Fisher 2000 uv vis spectrophotometer
    2000 Uv Vis Spectrophotometer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 625 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/2000 uv vis spectrophotometer/product/Thermo Fisher
    Average 92 stars, based on 625 article reviews
    Price from $9.99 to $1999.99
    2000 uv vis spectrophotometer - by Bioz Stars, 2020-05
    92/100 stars

    Images

    Related Articles

    Agarose Gel Electrophoresis:

    Article Title: Dietary Supplementation with Compound Probiotics and Berberine Alters Piglet Production Performance and Fecal Microbiota
    Article Snippet: .. The final DNA concentration and purity were investigated by NanoDrop 2000 UV–vis spectrophotometer (Thermo Scientific, Wilmington, NC, USA), and DNA quality was checked by 1% agarose gel electrophoresis. .. The V3-V4 region of the 16S rRNA gene was amplified with 338F up-stream primer (5′-ACTCCTACGGGAGGCAGCAG-3′) and 806R down-stream primer (5′-GGACTACHVGGGTWTCTAAT-3′) by PCR (GeneAmp 9700, ABI, USA).

    Article Title: Gut Microbial Signatures Can Discriminate Unipolar from Bipolar Depression, Gut Microbial Signatures Can Discriminate Unipolar from Bipolar Depression
    Article Snippet: .. The NanoDrop 2000 UV–vis spectrophotometer was used to determine the DNA concentration and purification, and DNA quality was checked by 1% agarose gel electrophoresis. .. The V3–V4 hypervariable regions of the bacteria 16S rRNA gene were amplified by PCR with the use of primers 338F (5′‐ACTCCTACGGGAGGCAGCAG‐3′) and 806R (5′‐GGACTACHVGGGTWTCTAAT‐3).

    Synthesized:

    Article Title: Vascular function and arginine and dimethylarginines in gentamicin-induced renal failure: a possible effect of heme oxygenase 1 inducer hemin.
    Article Snippet: .. Total RNA was isolated using Ambion Pure Link RNA Mini kit (Life Technologies, Carlsbad, Calif.) and the quality and quantity of RNA were checked by NanoDrop 2000 UV–Vis spectrophotometer (Thermo Scientific, Wilmington, Denver, USA). cDNA was synthesized with RT2 Page 6 of 24 https://mc06.manuscriptcentral.com/cjpp-pubs Canadian Journal of Physiology and Pharmacology Draft HT First Strand cDNA kit (QIAGEN, Venlo, Netherlands). .. The primers for HO-1 (Forward: TTCTCCGATGGGTCCTTACA and Reverse: TTGAGACAGCTGCCACATTAG), and the housekeeping gene, β- actin (Forward: CCGCGAGTACAACCTTCTTG and Reverse: CAGTTGGTGACAATGCCGTG), were purchased from QIAGEN.

    Isolation:

    Article Title: Vascular function and arginine and dimethylarginines in gentamicin-induced renal failure: a possible effect of heme oxygenase 1 inducer hemin.
    Article Snippet: .. Total RNA was isolated using Ambion Pure Link RNA Mini kit (Life Technologies, Carlsbad, Calif.) and the quality and quantity of RNA were checked by NanoDrop 2000 UV–Vis spectrophotometer (Thermo Scientific, Wilmington, Denver, USA). cDNA was synthesized with RT2 Page 6 of 24 https://mc06.manuscriptcentral.com/cjpp-pubs Canadian Journal of Physiology and Pharmacology Draft HT First Strand cDNA kit (QIAGEN, Venlo, Netherlands). .. The primers for HO-1 (Forward: TTCTCCGATGGGTCCTTACA and Reverse: TTGAGACAGCTGCCACATTAG), and the housekeeping gene, β- actin (Forward: CCGCGAGTACAACCTTCTTG and Reverse: CAGTTGGTGACAATGCCGTG), were purchased from QIAGEN.

    Spectrophotometry:

    Article Title: Diversity of rhizosphere and endophytic fungi in Atractylodes macrocephala during continuous cropping
    Article Snippet: .. The quantity and purity of the DNA samples were assayed by a NanoDrop 2000 UV-vis spectrophotometer (Thermo Scientific, USA). ..

    Article Title: Development of Silica-Immobilized Vaccines for Improving Thermo-Tolerance and Shelf-Life
    Article Snippet: .. The concentration of the supernatant was measured at 280 nm with an IpaD extinction coefficient of 9.48 M−1 cm−1 using the Nanodrop 2000 UV-Vis spectrophotometer. .. The supernatant concentration was used along with the original concentration of IpaD to quantify the adsorption process in Equation 1: Percent adsorption = ( 1 - ( Supernatant IpaD concentration ) / ( Inital IpaD concentration ) ) * 100

    Article Title: Dietary Supplementation with Compound Probiotics and Berberine Alters Piglet Production Performance and Fecal Microbiota
    Article Snippet: .. The final DNA concentration and purity were investigated by NanoDrop 2000 UV–vis spectrophotometer (Thermo Scientific, Wilmington, NC, USA), and DNA quality was checked by 1% agarose gel electrophoresis. .. The V3-V4 region of the 16S rRNA gene was amplified with 338F up-stream primer (5′-ACTCCTACGGGAGGCAGCAG-3′) and 806R down-stream primer (5′-GGACTACHVGGGTWTCTAAT-3′) by PCR (GeneAmp 9700, ABI, USA).

    Article Title: Gut Microbial Signatures Can Discriminate Unipolar from Bipolar Depression, Gut Microbial Signatures Can Discriminate Unipolar from Bipolar Depression
    Article Snippet: .. The NanoDrop 2000 UV–vis spectrophotometer was used to determine the DNA concentration and purification, and DNA quality was checked by 1% agarose gel electrophoresis. .. The V3–V4 hypervariable regions of the bacteria 16S rRNA gene were amplified by PCR with the use of primers 338F (5′‐ACTCCTACGGGAGGCAGCAG‐3′) and 806R (5′‐GGACTACHVGGGTWTCTAAT‐3).

    Article Title: Genome Sequence Analysis of Auricularia heimuer Combined with Genetic Linkage Map
    Article Snippet: .. The quality of the extracted genomic DNA was determined using a NanoDrop 2000 UV-Vis spectrophotometer (Thermo Scientific, Waltham, MA USA) and Qubit 2.0 fluorometer (Life Technologies, Waltham, MA USA). .. DNA Library Construction and Illumina Deep Sequencing Two genome sequencing libraries with 500 bp and 2 kb of A14-8 were constructed for de novo sequencing using the NEBNext Ultra DNA Library Prep Kit for Illumina (E7370L, NEB, Ipswich, MA, USA) following the manufacturer’s instructions.

    Article Title: Vascular function and arginine and dimethylarginines in gentamicin-induced renal failure: a possible effect of heme oxygenase 1 inducer hemin.
    Article Snippet: .. Total RNA was isolated using Ambion Pure Link RNA Mini kit (Life Technologies, Carlsbad, Calif.) and the quality and quantity of RNA were checked by NanoDrop 2000 UV–Vis spectrophotometer (Thermo Scientific, Wilmington, Denver, USA). cDNA was synthesized with RT2 Page 6 of 24 https://mc06.manuscriptcentral.com/cjpp-pubs Canadian Journal of Physiology and Pharmacology Draft HT First Strand cDNA kit (QIAGEN, Venlo, Netherlands). .. The primers for HO-1 (Forward: TTCTCCGATGGGTCCTTACA and Reverse: TTGAGACAGCTGCCACATTAG), and the housekeeping gene, β- actin (Forward: CCGCGAGTACAACCTTCTTG and Reverse: CAGTTGGTGACAATGCCGTG), were purchased from QIAGEN.

    Article Title: Comparison of bacterial communities in soil samples with and without tomato bacterial wilt caused by Ralstonia solanacearum species complex
    Article Snippet: .. The extracted DNA samples were analyzed using a NanoDrop 2000 UV-Vis spectrophotometer (Thermo Scientific, Wilmington, DE, USA). ..

    Article Title: The Situation of Chemokine Ligands and Receptors Gene Expression, Following the Oral Administration of Drug Mannuronic Acid in Rheumatoid Arthritis Patients.
    Article Snippet: .. Regarding the leukocytes infiltration into the synovium of Rheumatoid Arthritis (RA) patients is mostly mediated by chemokine ligands and receptors, and following the efficient and motivating results of international Phase III clinical trial of β-D-Mannuronic acid (M2000) patented EP067919 (2017), as a novel anti-inflammatory drug, in patients with RA, the present research was designed. .. Regarding the leukocytes infiltration into the synovium of Rheumatoid Arthritis (RA) patients is mostly mediated by chemokine ligands and receptors, and following the efficient and motivating results of international Phase III clinical trial of β-D-Mannuronic acid (M2000) patented EP067919 (2017), as a novel anti-inflammatory drug, in patients with RA, the present research was designed.

    Purification:

    Article Title: Gut Microbial Signatures Can Discriminate Unipolar from Bipolar Depression, Gut Microbial Signatures Can Discriminate Unipolar from Bipolar Depression
    Article Snippet: .. The NanoDrop 2000 UV–vis spectrophotometer was used to determine the DNA concentration and purification, and DNA quality was checked by 1% agarose gel electrophoresis. .. The V3–V4 hypervariable regions of the bacteria 16S rRNA gene were amplified by PCR with the use of primers 338F (5′‐ACTCCTACGGGAGGCAGCAG‐3′) and 806R (5′‐GGACTACHVGGGTWTCTAAT‐3).

    Concentration Assay:

    Article Title: Development of Silica-Immobilized Vaccines for Improving Thermo-Tolerance and Shelf-Life
    Article Snippet: .. The concentration of the supernatant was measured at 280 nm with an IpaD extinction coefficient of 9.48 M−1 cm−1 using the Nanodrop 2000 UV-Vis spectrophotometer. .. The supernatant concentration was used along with the original concentration of IpaD to quantify the adsorption process in Equation 1: Percent adsorption = ( 1 - ( Supernatant IpaD concentration ) / ( Inital IpaD concentration ) ) * 100

    Article Title: Dietary Supplementation with Compound Probiotics and Berberine Alters Piglet Production Performance and Fecal Microbiota
    Article Snippet: .. The final DNA concentration and purity were investigated by NanoDrop 2000 UV–vis spectrophotometer (Thermo Scientific, Wilmington, NC, USA), and DNA quality was checked by 1% agarose gel electrophoresis. .. The V3-V4 region of the 16S rRNA gene was amplified with 338F up-stream primer (5′-ACTCCTACGGGAGGCAGCAG-3′) and 806R down-stream primer (5′-GGACTACHVGGGTWTCTAAT-3′) by PCR (GeneAmp 9700, ABI, USA).

    Article Title: Gut Microbial Signatures Can Discriminate Unipolar from Bipolar Depression, Gut Microbial Signatures Can Discriminate Unipolar from Bipolar Depression
    Article Snippet: .. The NanoDrop 2000 UV–vis spectrophotometer was used to determine the DNA concentration and purification, and DNA quality was checked by 1% agarose gel electrophoresis. .. The V3–V4 hypervariable regions of the bacteria 16S rRNA gene were amplified by PCR with the use of primers 338F (5′‐ACTCCTACGGGAGGCAGCAG‐3′) and 806R (5′‐GGACTACHVGGGTWTCTAAT‐3).

    Article Title: The Situation of Chemokine Ligands and Receptors Gene Expression, Following the Oral Administration of Drug Mannuronic Acid in Rheumatoid Arthritis Patients.
    Article Snippet: .. Regarding the leukocytes infiltration into the synovium of Rheumatoid Arthritis (RA) patients is mostly mediated by chemokine ligands and receptors, and following the efficient and motivating results of international Phase III clinical trial of β-D-Mannuronic acid (M2000) patented EP067919 (2017), as a novel anti-inflammatory drug, in patients with RA, the present research was designed. .. Regarding the leukocytes infiltration into the synovium of Rheumatoid Arthritis (RA) patients is mostly mediated by chemokine ligands and receptors, and following the efficient and motivating results of international Phase III clinical trial of β-D-Mannuronic acid (M2000) patented EP067919 (2017), as a novel anti-inflammatory drug, in patients with RA, the present research was designed.

    Polyacrylamide Gel Electrophoresis:

    Article Title: Vascular function and arginine and dimethylarginines in gentamicin-induced renal failure: a possible effect of heme oxygenase 1 inducer hemin.
    Article Snippet: .. Total RNA was isolated using Ambion Pure Link RNA Mini kit (Life Technologies, Carlsbad, Calif.) and the quality and quantity of RNA were checked by NanoDrop 2000 UV–Vis spectrophotometer (Thermo Scientific, Wilmington, Denver, USA). cDNA was synthesized with RT2 Page 6 of 24 https://mc06.manuscriptcentral.com/cjpp-pubs Canadian Journal of Physiology and Pharmacology Draft HT First Strand cDNA kit (QIAGEN, Venlo, Netherlands). .. The primers for HO-1 (Forward: TTCTCCGATGGGTCCTTACA and Reverse: TTGAGACAGCTGCCACATTAG), and the housekeeping gene, β- actin (Forward: CCGCGAGTACAACCTTCTTG and Reverse: CAGTTGGTGACAATGCCGTG), were purchased from QIAGEN.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher 2000 uv vis spectrophotometer
    GRK3 is a direct transcriptional target of CREB activation A. Western blot shows that GRK3 expression is up-regulated in prostate cancer cells overexpressing CREB-WT and CREB-Y134F cDNAs. B. PC3 and LNCaP cells were treated with 10 μM isoproterenol (ISO, beta-adrenergic receptor agonist), or 10 μM forskolin (FSK, adenylyl cyclase activator) + 0.5 mM IBMX (phosphodiesterase inhibitor) for 4 hours. Western blot analysis shows that CREB was hyper-phosphorylated at S133 and GRK3 was significantly up-regulated in both LNCaP and PC3 cells upon treatment with ISO or FSK+IBMX. C. Two consensus cAMP response element (CRE) sites, TGANNTCA, are located <t>~2000</t> bp upstream of the transcription initiation site in GRK3 promoter. D. PC3 and RWPE1 cells were treated with 10 μM ISO or 10 μM ISO+propranolol (PRO, beta-adrenergic receptor antagonist). Chromatin immunoprecipitation (ChIP) was done with anti-CREB and anti-IgG antibodies, followed by PCR using primers designed to recognize the GRK3 promoter sequence around the CRE sites. The ChIP-PCR results were confirmed by DNA gel electrophoresis, using inputs as loading controls. The quantitative measurements of CREB binding to GRK3 promoter are shown in Supplemental Figure S4 .
    2000 Uv Vis Spectrophotometer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 625 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/2000 uv vis spectrophotometer/product/Thermo Fisher
    Average 99 stars, based on 625 article reviews
    Price from $9.99 to $1999.99
    2000 uv vis spectrophotometer - by Bioz Stars, 2020-05
    99/100 stars
      Buy from Supplier

    Image Search Results


    GRK3 is a direct transcriptional target of CREB activation A. Western blot shows that GRK3 expression is up-regulated in prostate cancer cells overexpressing CREB-WT and CREB-Y134F cDNAs. B. PC3 and LNCaP cells were treated with 10 μM isoproterenol (ISO, beta-adrenergic receptor agonist), or 10 μM forskolin (FSK, adenylyl cyclase activator) + 0.5 mM IBMX (phosphodiesterase inhibitor) for 4 hours. Western blot analysis shows that CREB was hyper-phosphorylated at S133 and GRK3 was significantly up-regulated in both LNCaP and PC3 cells upon treatment with ISO or FSK+IBMX. C. Two consensus cAMP response element (CRE) sites, TGANNTCA, are located ~2000 bp upstream of the transcription initiation site in GRK3 promoter. D. PC3 and RWPE1 cells were treated with 10 μM ISO or 10 μM ISO+propranolol (PRO, beta-adrenergic receptor antagonist). Chromatin immunoprecipitation (ChIP) was done with anti-CREB and anti-IgG antibodies, followed by PCR using primers designed to recognize the GRK3 promoter sequence around the CRE sites. The ChIP-PCR results were confirmed by DNA gel electrophoresis, using inputs as loading controls. The quantitative measurements of CREB binding to GRK3 promoter are shown in Supplemental Figure S4 .

    Journal: Oncotarget

    Article Title: GRK3 is a direct target of CREB activation and regulates neuroendocrine differentiation of prostate cancer cells

    doi: 10.18632/oncotarget.9359

    Figure Lengend Snippet: GRK3 is a direct transcriptional target of CREB activation A. Western blot shows that GRK3 expression is up-regulated in prostate cancer cells overexpressing CREB-WT and CREB-Y134F cDNAs. B. PC3 and LNCaP cells were treated with 10 μM isoproterenol (ISO, beta-adrenergic receptor agonist), or 10 μM forskolin (FSK, adenylyl cyclase activator) + 0.5 mM IBMX (phosphodiesterase inhibitor) for 4 hours. Western blot analysis shows that CREB was hyper-phosphorylated at S133 and GRK3 was significantly up-regulated in both LNCaP and PC3 cells upon treatment with ISO or FSK+IBMX. C. Two consensus cAMP response element (CRE) sites, TGANNTCA, are located ~2000 bp upstream of the transcription initiation site in GRK3 promoter. D. PC3 and RWPE1 cells were treated with 10 μM ISO or 10 μM ISO+propranolol (PRO, beta-adrenergic receptor antagonist). Chromatin immunoprecipitation (ChIP) was done with anti-CREB and anti-IgG antibodies, followed by PCR using primers designed to recognize the GRK3 promoter sequence around the CRE sites. The ChIP-PCR results were confirmed by DNA gel electrophoresis, using inputs as loading controls. The quantitative measurements of CREB binding to GRK3 promoter are shown in Supplemental Figure S4 .

    Article Snippet: The RNA concentration and purity were measured by NanoDrop 2000 UV-vis Spectrophotometer (Thermo Scientific, USA).

    Techniques: Activation Assay, Western Blot, Expressing, Chromatin Immunoprecipitation, Polymerase Chain Reaction, Sequencing, DNA Gel Electrophoresis, Binding Assay

    The identification of CCHA-2142 -overexpressing Arabidopsis thaliana . (a) PCR analysis of transgenic plants with CCHA-2142 : M means DM 2000 marker; WT means wild type; 1, 2, 3, 4, and 5 mean transgenic lines; and plasmid means positive control (plasmid pBI121G- CCHA-2142 ). (b) Confirmation of CCHA-2142 was expressed in transgenic lines by RT-PCR; WT means wild type; and 1, 2, and 3 mean transgenic lines.

    Journal: The Scientific World Journal

    Article Title: Isolation of Salt Stress-Related Genes from Aspergillus glaucus CCHA by Random Overexpression in Escherichia coli

    doi: 10.1155/2014/620959

    Figure Lengend Snippet: The identification of CCHA-2142 -overexpressing Arabidopsis thaliana . (a) PCR analysis of transgenic plants with CCHA-2142 : M means DM 2000 marker; WT means wild type; 1, 2, 3, 4, and 5 mean transgenic lines; and plasmid means positive control (plasmid pBI121G- CCHA-2142 ). (b) Confirmation of CCHA-2142 was expressed in transgenic lines by RT-PCR; WT means wild type; and 1, 2, and 3 mean transgenic lines.

    Article Snippet: The quality and quantity of total RNA were analyzed using a NanoDrop 2000 UV-Vis spectrophotometer (Thermo, Wilmington, USA) and gel electrophoresis.

    Techniques: Polymerase Chain Reaction, Transgenic Assay, Marker, Plasmid Preparation, Positive Control, Reverse Transcription Polymerase Chain Reaction

    Quantity and quality of DNA extractions of 38 MAC and MABSC clinical isolates using optimized DNA extraction method. a Total DNA by Qubit® and b 260/280 and c 260/230 by NanoDrop 2000 UV-Vis Spectrophotometer. Significance by unpaired t-test with p -values as 0.033 (*), 0.002 (**),

    Journal: BMC Genomics

    Article Title: Complete nontuberculous mycobacteria whole genomes using an optimized DNA extraction protocol for long-read sequencing

    doi: 10.1186/s12864-019-6134-y

    Figure Lengend Snippet: Quantity and quality of DNA extractions of 38 MAC and MABSC clinical isolates using optimized DNA extraction method. a Total DNA by Qubit® and b 260/280 and c 260/230 by NanoDrop 2000 UV-Vis Spectrophotometer. Significance by unpaired t-test with p -values as 0.033 (*), 0.002 (**),

    Article Snippet: DNA purity was assessed with NanoDrop 2000 UV-Vis Spectrophotometer (ThermoFisher Scientific, United States) by measurements of 260/280 to detect protein contamination and 260/230 to detect contamination by solvents and salts.

    Techniques: DNA Extraction, Spectrophotometry

    Quantity and quality of DNA by variable methods. a Total DNA by Qubit® and b 260/280 and c 260/230 by NanoDrop 2000 UV-Vis Spectrophotometer. All methods performed in triplicate with error bars (standard deviation). All methods produced sufficient total DNA except Method 6 ( a ). For ( b ) and ( c ), horizontal bars representing significance values for one-way ANOVA with Tukey’s post-hoc multiple comparisons test against Method 5. Significance in p -values as follows: 0.033 (*), 0.002 (**),

    Journal: BMC Genomics

    Article Title: Complete nontuberculous mycobacteria whole genomes using an optimized DNA extraction protocol for long-read sequencing

    doi: 10.1186/s12864-019-6134-y

    Figure Lengend Snippet: Quantity and quality of DNA by variable methods. a Total DNA by Qubit® and b 260/280 and c 260/230 by NanoDrop 2000 UV-Vis Spectrophotometer. All methods performed in triplicate with error bars (standard deviation). All methods produced sufficient total DNA except Method 6 ( a ). For ( b ) and ( c ), horizontal bars representing significance values for one-way ANOVA with Tukey’s post-hoc multiple comparisons test against Method 5. Significance in p -values as follows: 0.033 (*), 0.002 (**),

    Article Snippet: DNA purity was assessed with NanoDrop 2000 UV-Vis Spectrophotometer (ThermoFisher Scientific, United States) by measurements of 260/280 to detect protein contamination and 260/230 to detect contamination by solvents and salts.

    Techniques: Spectrophotometry, Standard Deviation, Produced

    FACS and in vitro analyses of PCs and BMSCs. a Experimental design of periosteal cells (PCs) and bone marrow stromal cells/skeletal stem cells (BMSCs) cultures from Prx1-Cre;YFP fl/+ or Prx1-Cre;mTmG mouse hindlimbs. Bone marrow cells were flushed from hindlimbs and plated to obtain adherent bone marrow cells (aBM). After expansion, lineage depletion was performed to isolate BMSCs with no further passage. The flushed bones were placed in culture to isolate in one step the PCs migrating out of the explants. b Flow cytometry analyses of PCs and BMSCs isolated from Prx1-Cre;YFP fl/+ mice. PCs and BMSCs negative for endothelial/hematopoietic markers (CD31, CD11b, CD34, and CD45) and double-positive for Sca1/CD29 are largely YFP+ (derived from Prx1-mesenchymal lineage). c Quantitative RT-PCR analyses of FACS sorted GFP-positive and GFP-negative PCs and BMSCs isolated from Prx1-Cre;mTmG mice. Results show overexpression of the markers PDGFRα , Gremlin1 , Cxcl12 , and Nestin and to a lesser extent NG2 in GFP-positive compared to GFP-negative PCs, but not LeptinR . d CFE assays showing PCs forming colonies at cell density as low as 400 cells/cm 2 14 days after plating and BMSCs at 2000 cells/cm 2 14 days after plating. Colonies were stained with Giemsa blue and counted under microscope. e Cell-growth assay shows that PCs grow faster than adherent bone marrow cells (aBM) and BMSCs. The cells were plated at the same density (10 5 cells/dish) and counted every day during the first two days then every two days for 12 days (* represents the comparison between PCs and aBM, $ represents the comparison between PCs and BMSCs). f In vitro differentiation of PCs and BMSCs into osteogenic (3 weeks), adipogenic (3 weeks), and chondrogenic (2 weeks) lineages as shown by alizarin red S, Oil red O, and alcian blue staining, respectively. Due to the poor chondrogenic capacity of BMSCs, aBM were assessed for chondrogenesis. Statistical differences between the groups ( n = 3 or 4 per group) were determined using Mann–Whitney test (*,$ p ≤ 0.05, **,$$ p

    Journal: Nature Communications

    Article Title: Periosteum contains skeletal stem cells with high bone regenerative potential controlled by Periostin

    doi: 10.1038/s41467-018-03124-z

    Figure Lengend Snippet: FACS and in vitro analyses of PCs and BMSCs. a Experimental design of periosteal cells (PCs) and bone marrow stromal cells/skeletal stem cells (BMSCs) cultures from Prx1-Cre;YFP fl/+ or Prx1-Cre;mTmG mouse hindlimbs. Bone marrow cells were flushed from hindlimbs and plated to obtain adherent bone marrow cells (aBM). After expansion, lineage depletion was performed to isolate BMSCs with no further passage. The flushed bones were placed in culture to isolate in one step the PCs migrating out of the explants. b Flow cytometry analyses of PCs and BMSCs isolated from Prx1-Cre;YFP fl/+ mice. PCs and BMSCs negative for endothelial/hematopoietic markers (CD31, CD11b, CD34, and CD45) and double-positive for Sca1/CD29 are largely YFP+ (derived from Prx1-mesenchymal lineage). c Quantitative RT-PCR analyses of FACS sorted GFP-positive and GFP-negative PCs and BMSCs isolated from Prx1-Cre;mTmG mice. Results show overexpression of the markers PDGFRα , Gremlin1 , Cxcl12 , and Nestin and to a lesser extent NG2 in GFP-positive compared to GFP-negative PCs, but not LeptinR . d CFE assays showing PCs forming colonies at cell density as low as 400 cells/cm 2 14 days after plating and BMSCs at 2000 cells/cm 2 14 days after plating. Colonies were stained with Giemsa blue and counted under microscope. e Cell-growth assay shows that PCs grow faster than adherent bone marrow cells (aBM) and BMSCs. The cells were plated at the same density (10 5 cells/dish) and counted every day during the first two days then every two days for 12 days (* represents the comparison between PCs and aBM, $ represents the comparison between PCs and BMSCs). f In vitro differentiation of PCs and BMSCs into osteogenic (3 weeks), adipogenic (3 weeks), and chondrogenic (2 weeks) lineages as shown by alizarin red S, Oil red O, and alcian blue staining, respectively. Due to the poor chondrogenic capacity of BMSCs, aBM were assessed for chondrogenesis. Statistical differences between the groups ( n = 3 or 4 per group) were determined using Mann–Whitney test (*,$ p ≤ 0.05, **,$$ p

    Article Snippet: The concentration of extracted RNA was confirmed using a NanoDrop 2000 UV-Vis Spectrophotometer (Thermo Scientific, Wilmington, DE).

    Techniques: FACS, In Vitro, Flow Cytometry, Cytometry, Isolation, Mouse Assay, Derivative Assay, Quantitative RT-PCR, Over Expression, Staining, Microscopy, Growth Assay, MANN-WHITNEY