1x t4 rna ligase buffer  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    T4 RNA Ligase Reaction Buffer
    Description:
    T4 RNA Ligase Reaction Buffer 3 0 ml
    Catalog Number:
    b0216l
    Price:
    45
    Size:
    3 0 ml
    Category:
    Buffers
    Buy from Supplier


    Structured Review

    New England Biolabs 1x t4 rna ligase buffer
    T4 RNA Ligase Reaction Buffer
    T4 RNA Ligase Reaction Buffer 3 0 ml
    https://www.bioz.com/result/1x t4 rna ligase buffer/product/New England Biolabs
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    1x t4 rna ligase buffer - by Bioz Stars, 2020-01
    90/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Functional Analysis of Three Arabidopsis ARGONAUTES Using Slicer-Defective Mutants [W] ARGONAUTES Using Slicer-Defective Mutants [W] [OA]
    Article Snippet: Ten microliters (or 100%) of the immunoprecipitated RNA was mixed with 15 pmol of Cloning Linker 1 (IDT; see online) and incubated at 70°C for 2 min. .. The mixture was cooled on ice for 2 min before adding 1.5 μL of 10× T4 RNA ligase reaction buffer (NEB), 40 units of RNase OUT), and 10 units of T4 RNA Ligase 2 truncated K227Q (NEB).

    Article Title: The dynamic transcriptional and translational landscape of the model antibiotic producer Streptomyces coelicolor A3(2)
    Article Snippet: Dephosphorylated RNA was dissolved in 8.5 μl of 10 mM Tris-HCl (pH8.0) and 1.5 μl of Universal miRNA Cloning Linker (NEB) was added to the RNA. .. The mixture was ligated in 20 μl volume with 2 μl of 10 × T4 RNA Ligase Reaction Buffer (NEB), 6 μl of PEG 8000 (50%, w/v) and 1 μl of T4 RNA Ligase 2, truncated (200 U μl−1 , NEB).

    Amplification:

    Article Title: A Novel Type of Influenza A Virus-Derived Defective Interfering Particle with Nucleotide Substitutions in Its Genome
    Article Snippet: The subsequent amplification of the junction region (containing the vRNA ends) was performed by RT-PCR. .. Circularization was performed by mixing 11.5 μl of the RNA sample with 4 μl (40 U) of T4 RNA ligase 1, 2 μl of 10× T4 RNA ligase reaction buffer, 2 μl of a 10 mM ATP solution (all reagents from New England BioLabs), and 0.5 μl (20 U) of RiboLock RNase inhibitor (Thermo Scientific).

    Article Title: Alston Virus, a Novel Paramyxovirus Isolated from Bats Causes Upper Respiratory Tract Infection in Experimentally Challenged Ferrets
    Article Snippet: Genome ends were ligated overnight at 16 °C using 20 U T4 RNA Ligase, 20 U RNasin, 50 μM ATP, 10% PEG8000 and T4 RNA ligase reaction buffer (NEB, Ipswich, MA, USA). .. Ligation was followed by hemi-nested PCR amplification using a Superscript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (Invitrogen, Carlsbad, CA, USA), then an Expand High Fidelity PCR System (Roche, Basel, Switzerland).

    De-Phosphorylation Assay:

    Article Title: The dynamic transcriptional and translational landscape of the model antibiotic producer Streptomyces coelicolor A3(2)
    Article Snippet: The dephosphorylation reaction was carried out as follows: samples were denatured for 90 s at 80 °C; after this step, the samples were equilibrated to 37 °C and incubated for 1 h at 37 °C with 5 μl of 10 × T4 PNK buffer (NEB), 1 μl of SUPERase·In (20 U μl−1 ) and 1 μl of T4 PNK (10 U μl−1 , NEB). .. The mixture was ligated in 20 μl volume with 2 μl of 10 × T4 RNA Ligase Reaction Buffer (NEB), 6 μl of PEG 8000 (50%, w/v) and 1 μl of T4 RNA Ligase 2, truncated (200 U μl−1 , NEB).

    Autoradiography:

    Article Title: Mapping the miRNA interactome by cross linking ligation and sequencing of hybrids (CLASH)
    Article Snippet: .. Hybond-C Extra membrane (GE Healthcare, RPN303E) Kodak BioMax MS Autoradiography Film (#8222648) MetaPhor agarose (Lonza, #50180) SYBRSafe (Life Technologies, S33102) cOmplete Protease inhibitors, EDTA-free (Roche Applied Science, #11873580001) RNace-IT (Agilent, #400720) diluted 1:20 with water, store at 4°C for at least 2 years SeeBlue Plus2 Pre-Stained Standard (Life Technologies, LC5925) NuPAGE LDS Sample Buffer 4X (Life Technologies, N0007) NuPAGE 4-12% polyacrylamide Bis-Tris gels (Life Technologies, NP0335) NuPAGE SDS MOPS running buffer (Life Technologies, NP0001) NuPage Transfer Buffer (Life Technologies, NP00061) GlycoBlue (Life Technologies, AM9515) MinElute PCR purification kit (QIAGEN, #28004) MinElute Gel extraction kit (QIAGEN, #28604) GeneRuler 50 bp DNA ladder (Thermo Scientific, SM0371) Qubit dsDNA HS Assay Kit (Life Technologies, ) 6 x DNA Loading dye (Thermo Scientific, R0611) T4 PNK, T4 Polynucleotide Kinase (New England BioLabs, M0201L) T4 RNA ligase 1 (New England BioLabs, M0204L) T4 RNA ligase reaction buffer, 10× (supplied with T4 RNA ligase 1) T4 RNA ligase 2 truncated, K227Q (New England BioLabs, M0351L) TSAP, Thermosensitive Alkaline Phosphatase (Promega, M9910) Proteinase K (Roche Applied Science, #03115836001) SuperScript III Reverse Transcriptase (Life Technologies, #18080-044) 5 x First strand buffer (supplied with SuperScript III Reverse Transcriptase) 0.1M DTT (supplied with SuperScript III Reverse Transcriptase) RNase H (New England BioLabs, M0297L) TaKaRa LA Taq (Clontech, RR002M) 10X LA PCR Buffer ll (Mg2+ plus) supplied with TaKaRa LA Taq dNTPs 2.5mM (supplied with TaKaRa LA Taq). ..

    TA Cloning:

    Article Title: Mapping the miRNA interactome by cross linking ligation and sequencing of hybrids (CLASH)
    Article Snippet: Hybond-C Extra membrane (GE Healthcare, RPN303E) Kodak BioMax MS Autoradiography Film (#8222648) MetaPhor agarose (Lonza, #50180) SYBRSafe (Life Technologies, S33102) cOmplete Protease inhibitors, EDTA-free (Roche Applied Science, #11873580001) RNace-IT (Agilent, #400720) diluted 1:20 with water, store at 4°C for at least 2 years SeeBlue Plus2 Pre-Stained Standard (Life Technologies, LC5925) NuPAGE LDS Sample Buffer 4X (Life Technologies, N0007) NuPAGE 4-12% polyacrylamide Bis-Tris gels (Life Technologies, NP0335) NuPAGE SDS MOPS running buffer (Life Technologies, NP0001) NuPage Transfer Buffer (Life Technologies, NP00061) GlycoBlue (Life Technologies, AM9515) MinElute PCR purification kit (QIAGEN, #28004) MinElute Gel extraction kit (QIAGEN, #28604) GeneRuler 50 bp DNA ladder (Thermo Scientific, SM0371) Qubit dsDNA HS Assay Kit (Life Technologies, ) 6 x DNA Loading dye (Thermo Scientific, R0611) T4 PNK, T4 Polynucleotide Kinase (New England BioLabs, M0201L) T4 RNA ligase 1 (New England BioLabs, M0204L) T4 RNA ligase reaction buffer, 10× (supplied with T4 RNA ligase 1) T4 RNA ligase 2 truncated, K227Q (New England BioLabs, M0351L) TSAP, Thermosensitive Alkaline Phosphatase (Promega, M9910) Proteinase K (Roche Applied Science, #03115836001) SuperScript III Reverse Transcriptase (Life Technologies, #18080-044) 5 x First strand buffer (supplied with SuperScript III Reverse Transcriptase) 0.1M DTT (supplied with SuperScript III Reverse Transcriptase) RNase H (New England BioLabs, M0297L) TaKaRa LA Taq (Clontech, RR002M) 10X LA PCR Buffer ll (Mg2+ plus) supplied with TaKaRa LA Taq dNTPs 2.5mM (supplied with TaKaRa LA Taq). .. TOPO TA Cloning® Kit for Sequencing, with One Shot® TOP10 Chemically Competent E. coli (Life Technologies, K4575-40) Phenol (Sigma-Aldrich, P4557, used without Equilibration Buffer) CAUTION Phenol is toxic on inhalation, on contact with skin or if swallowed, causes severe skin burns and eye damage.

    Blocking Assay:

    Article Title: Protein Interaction Profile Sequencing (PIP-seq)
    Article Snippet: .. Protein interaction profile RNA (Basic Protocol 2) 10× Fragmentation Reagent (Life Technologies, cat. no. AM8740) Fragmentation Stop Solution (Life Technologies, cat. no. AM8740) DEPC-treated H2 O 5 mg/ml Glycogen, ultrapure (Life Technologies, cat. no. AM9510) 3 M NaOAc (pH = 5.5) (Life Technologies, cat. no. AM9740) 100% EtOH (Decon Labs, cat. no. 2716) 80% EtOH Ice T4 DNA ligase buffer (NEB, cat. no. B0202S) T4 polynucleotide kinase (NEB, cat. no. M0201S) 10 mM ATP (Life Technologies, cat. no. AM8110G) 10× TBE (Bio-Rad, 161-0733) Gel loading buffer II (Life Technologies, cat. no. AM8546G) 10-bp DNA ladder (Life Technologies, cat. no. 10821-015) 10 mg/ml Ethidium Bromide (Life Technologies, cat. no. 15585-011) 0.3 M NaCl 5 μM 3′ Adapter (RA3) (TGGAATTCTCGGGTGCCAAGG) RNA Ligase Buffer (NEB, cat. no. B0216L) RNaseOUT (Life Technologies, cat. no. 10777019) 200 U/μl Epicenter T4 RNA Ligase 2, truncated (NEB, cat. no. M0242S) 25 μM 5′ Adapter (RA5) (GUUCAGAGUUCUACAGUCCGACGAUC) T4 RNA Ligase 1 (NEB, cat. no. M0204S) RNA RT Primer (RTP) (GCCTTGGCACCCGAGAATTCCA) 5× First-Strand Buffer (Life Technologies, cat. no. 18064-014) 50 mM dNTPs 100 mM DTT (Life Technologies, cat. no. 18064-014) SuperScript II Reverse Transcriptase (Life Technologies, cat. no. 18064-014) 2× Phusion Mix (NEB, cat. no. M0531S) 5 mM Betaine (MP Biomedicals, cat. no. 215046180) 10 μM RNA PCR Primer (RTP) (GCCTTGGCACCCGAGAATTCCA) 10 μM RNA PCR Primer Index Nuclease-free water 25-bp DNA ladder (Life Technologies, cat. no. 10597-011) DSN Hybridization buffer (see recipe) 10× DSN Master Mix (Evrogen, cat. no. EA001) DSN Enzyme (Evrogen, cat. no. EA001) DSN STOP solution (Evrogen, cat. no. EA001) 1.7-ml tubes 70°C heat block Centrifuge 37°C heat block 1.0-mm, 10-well 15% TBE-Urea gels (Life Technologies, cat. no. EC6885BOX) Gel box for running prepoured gels (Life, Technologies, cat. no. EI0001) 18-G needles Razor blades Gel Breaker Tubes (IST Engineering, cat. no. 388-100) 2-ml tubes End-over-end rotator Spin-X columns (Costar, cat. no. 8160) 200-μl PCR tubes Thermal cycler 6% TBE gels 1.0 mm, 10 well (Invitrogen, cat. no. EC6265BOX) ..

    Electrophoresis:

    Article Title: Mitochondrial Ribosome (Mitoribosome) Profiling for Monitoring Mitochondrial Translation in vivo
    Article Snippet: .. Solutions and reagents: Mitoribosome-associated RNA (from Basic Protocol 1) and/or fragmented and size-selected mRNA (from Support Protocol) 2X urea RNA loading buffer (see recipe) 10-bp DNA ladder 15%, 10% TBE-urea, 8% TBE polyacrylamide gels SYBR gold (10,000X concentrate) RNase-free water 3 M sodium acetate, pH 5.5 (RNase-free) 25 mg/ml linear polyacrylamide (LPA) Isopropanol 70% (v/v) ethanol 10X T4 polynucleotide kinase (PNK) buffer 10 U/μl T4 PNK Oligonucleotide linker and primers (see Table) 50% (w/v) PEG 8000 (RNase-free) 10X T4 RNA ligase reaction buffer (NEB, B0216L) 200 U/μl T4 RNA ligase 2, truncated (NEB) 10 mM Tris, pH 8.0 (RNase-free) 5X First-strand (FS) RT reaction buffer (Invitrogen, 18080-993) 10 mM dNTPs 0.1 M DTT 20 U/μl SUPERase-In 200 U/μl Superscript III 1 N sodium hydroxide 3 M sodium chloride 10X CircLigase reaction buffer (Epicentre, CL4111K) 1 mM ATP 50 mM manganese chloride 100 U/μl CircLigase ssDNA ligase 5X Phusion HF reaction buffer (NEB, M0530S) 2 U/μl Phusion HF DNA polymerase 10X DNA loading buffer (see recipe) 100-bp DNA ladder DNA gel extraction buffer (see recipe) 10 mM Tris, pH 8.5 Qubit dsDNA HS Assay kit Special equipment: Heat blocks: 80°C, 70°C, 37°C, 25°C Typhoon fluorescent/phosphorescent image scanner, or UV transilluminator with camera Blue light transilluminator (or UV transilluminator) box End over end rotator Costar Spin-X centrifuge tube filter (0.45-um cellulose acetate in 2-ml tube; Corning) Qubit Fluorometer Bioanalyzer DNA high sensitivity chip and reagents Other equipment: Polyacrylamide electrophoresis apparatus and power source 0.5-ml and 1.5-ml RNase-free non-stick microcentrifuge tubes Plastic sheet protector Razor blades or scalpels Thermocycler Plastic sheet protector .. 1 Combine 10 μl RNA from large scale mitoribosome purification with 10 μl 2X urea RNA loading buffer.

    Incubation:

    Article Title: A Novel Type of Influenza A Virus-Derived Defective Interfering Particle with Nucleotide Substitutions in Its Genome
    Article Snippet: Circularization was performed by mixing 11.5 μl of the RNA sample with 4 μl (40 U) of T4 RNA ligase 1, 2 μl of 10× T4 RNA ligase reaction buffer, 2 μl of a 10 mM ATP solution (all reagents from New England BioLabs), and 0.5 μl (20 U) of RiboLock RNase inhibitor (Thermo Scientific). .. The mixture was incubated for 1 h at 37°C, followed by heat inactivation at 65°C for 15 min. We immediately reverse transcribed the circularized RNA.

    Article Title: The unfolded protein response and endoplasmic reticulum protein targeting machineries converge on the stress sensor IRE1
    Article Snippet: .. Preparation of small RNA cDNA libraries for deep sequencing 1 μL of RA3 RNA 3’ adapter (5’-TGGAATTCTCGGGTGCCAAGG-3’) from the TruSeq RNA small Sample Prep Kit (Illumina) was added to each of the purified RNA samples above, and the mixture was placed at 80°C for 2 min, then placed immediately on ice for another 2 min. 1.5 μL of 10× T4 RNA ligase reaction buffer (500 mM Tris pH 7.5, 100 mM MgCl2 , 10 mM DTT; New England Biolabs) and 4.5 μL 50% PEG 8,000 (New England Biolabs), 1 μL RNase inhibitor (Illumina), and 1 μL (200 units) T4 RNA ligase 2, truncated R55K, K227Q (KQ) mutant (New England Biolabs) were added to each sample and the reactions were incubated at 16°C overnight. .. 12–16 hr later, 0.5 μL of 10× T4 RNA ligase reaction buffer, 1.5 μL of 50% PEG 8,000, 2 μL of RNase-free water and 1 μL (200 units) T4 RNA ligase 2 truncated KQ were added to each sample and the reactions were incubated an additional 2 hr at 25°C.

    Article Title: Functional Analysis of Three Arabidopsis ARGONAUTES Using Slicer-Defective Mutants [W] ARGONAUTES Using Slicer-Defective Mutants [W] [OA]
    Article Snippet: Ten microliters (or 100%) of the immunoprecipitated RNA was mixed with 15 pmol of Cloning Linker 1 (IDT; see online) and incubated at 70°C for 2 min. .. The mixture was cooled on ice for 2 min before adding 1.5 μL of 10× T4 RNA ligase reaction buffer (NEB), 40 units of RNase OUT), and 10 units of T4 RNA Ligase 2 truncated K227Q (NEB).

    Article Title: Biochemical and structural bioinformatics studies of fungal CutA nucleotidyltransferases explain their unusual specificity toward CTP and increased tendency for cytidine incorporation at the 3′-terminal positions of synthesized tails
    Article Snippet: Of note, 10.7 µL of purified RNA was mixed with 2 µL of T4 RNA Ligase Reaction buffer (New England Biolabs), 1 µL of 30 µM RA3 adapter, 4.8 µL of 50% PEG 8000 (New England Biolabs) and 0.5 µL of RiboLock RNase Inhibitor (40 U/µL; Thermo Fisher Scientific). .. After 2 min of incubation at 70°C, the tube was placed on ice, and 1 µL of T4 RNA Ligase 2, Truncated (200 U/µL; New England Biolabs) was added.

    Article Title: The dynamic transcriptional and translational landscape of the model antibiotic producer Streptomyces coelicolor A3(2)
    Article Snippet: The dephosphorylation reaction was carried out as follows: samples were denatured for 90 s at 80 °C; after this step, the samples were equilibrated to 37 °C and incubated for 1 h at 37 °C with 5 μl of 10 × T4 PNK buffer (NEB), 1 μl of SUPERase·In (20 U μl−1 ) and 1 μl of T4 PNK (10 U μl−1 , NEB). .. The mixture was ligated in 20 μl volume with 2 μl of 10 × T4 RNA Ligase Reaction Buffer (NEB), 6 μl of PEG 8000 (50%, w/v) and 1 μl of T4 RNA Ligase 2, truncated (200 U μl−1 , NEB).

    Article Title: Multifunctional Roles for the Protein Translocation Machinery in RNA Anchoring to the Endoplasmic Reticulum *
    Article Snippet: .. For T4 RNA ligase reaction, the RM fractions were adjusted to a final concentration of 50 m m Tris-HCl, pH 7.5, 10 m m MgCl2 , 1 m m DTT, 15% DMSO, 1 m m ATP, 80 μCi of [5′-32 P]cytidine 3′,5′-bis(phosphate), 1 unit/μl T4 RNA ligase (New England Biolabs), and incubated at 4 °C. .. The lysate was collected, TCA-precipitated, and analyzed by SDS-PAGE and phosphorimaging.

    Article Title: The unfolded protein response and endoplasmic reticulum protein targeting machineries converge on the stress sensor IRE1
    Article Snippet: .. 1 μL of RA3 RNA 3’ adapter (5’-TGGAATTCTCGGGTGCCAAGG-3’) from the TruSeq RNA small Sample Prep Kit (Illumina) was added to each of the purified RNA samples above, and the mixture was placed at 80°C for 2 min, then placed immediately on ice for another 2 min. 1.5 μL of 10× T4 RNA ligase reaction buffer (500 mM Tris pH 7.5, 100 mM MgCl2 , 10 mM DTT; New England Biolabs) and 4.5 μL 50% PEG 8,000 (New England Biolabs), 1 μL RNase inhibitor (Illumina), and 1 μL (200 units) T4 RNA ligase 2, truncated R55K, K227Q (KQ) mutant (New England Biolabs) were added to each sample and the reactions were incubated at 16°C overnight. .. 12–16 hr later, 0.5 μL of 10× T4 RNA ligase reaction buffer, 1.5 μL of 50% PEG 8,000, 2 μL of RNase-free water and 1 μL (200 units) T4 RNA ligase 2 truncated KQ were added to each sample and the reactions were incubated an additional 2 hr at 25°C.

    Article Title: Genome-Wide Mapping of Yeast RNA Polymerase II Termination
    Article Snippet: .. The beads were resuspended in 50 ul of T4 RNA Ligase reaction solution (5 uM 5′ Adaptor [ GUUCAGAGUUCUACAGUCCGACGAUC , IDT], 1.2 U/µl RNase Inhibitor, 1 mM ATP, 0.5 U/µl T4 RNA Ligase [NEB], 1 mM DTT in RNA Ligase Buffer) and incubated at 16°C overnight. ..

    Mass Spectrometry:

    Article Title: Mapping the miRNA interactome by cross linking ligation and sequencing of hybrids (CLASH)
    Article Snippet: .. Hybond-C Extra membrane (GE Healthcare, RPN303E) Kodak BioMax MS Autoradiography Film (#8222648) MetaPhor agarose (Lonza, #50180) SYBRSafe (Life Technologies, S33102) cOmplete Protease inhibitors, EDTA-free (Roche Applied Science, #11873580001) RNace-IT (Agilent, #400720) diluted 1:20 with water, store at 4°C for at least 2 years SeeBlue Plus2 Pre-Stained Standard (Life Technologies, LC5925) NuPAGE LDS Sample Buffer 4X (Life Technologies, N0007) NuPAGE 4-12% polyacrylamide Bis-Tris gels (Life Technologies, NP0335) NuPAGE SDS MOPS running buffer (Life Technologies, NP0001) NuPage Transfer Buffer (Life Technologies, NP00061) GlycoBlue (Life Technologies, AM9515) MinElute PCR purification kit (QIAGEN, #28004) MinElute Gel extraction kit (QIAGEN, #28604) GeneRuler 50 bp DNA ladder (Thermo Scientific, SM0371) Qubit dsDNA HS Assay Kit (Life Technologies, ) 6 x DNA Loading dye (Thermo Scientific, R0611) T4 PNK, T4 Polynucleotide Kinase (New England BioLabs, M0201L) T4 RNA ligase 1 (New England BioLabs, M0204L) T4 RNA ligase reaction buffer, 10× (supplied with T4 RNA ligase 1) T4 RNA ligase 2 truncated, K227Q (New England BioLabs, M0351L) TSAP, Thermosensitive Alkaline Phosphatase (Promega, M9910) Proteinase K (Roche Applied Science, #03115836001) SuperScript III Reverse Transcriptase (Life Technologies, #18080-044) 5 x First strand buffer (supplied with SuperScript III Reverse Transcriptase) 0.1M DTT (supplied with SuperScript III Reverse Transcriptase) RNase H (New England BioLabs, M0297L) TaKaRa LA Taq (Clontech, RR002M) 10X LA PCR Buffer ll (Mg2+ plus) supplied with TaKaRa LA Taq dNTPs 2.5mM (supplied with TaKaRa LA Taq). ..

    Hybridization:

    Article Title: Protein Interaction Profile Sequencing (PIP-seq)
    Article Snippet: .. Protein interaction profile RNA (Basic Protocol 2) 10× Fragmentation Reagent (Life Technologies, cat. no. AM8740) Fragmentation Stop Solution (Life Technologies, cat. no. AM8740) DEPC-treated H2 O 5 mg/ml Glycogen, ultrapure (Life Technologies, cat. no. AM9510) 3 M NaOAc (pH = 5.5) (Life Technologies, cat. no. AM9740) 100% EtOH (Decon Labs, cat. no. 2716) 80% EtOH Ice T4 DNA ligase buffer (NEB, cat. no. B0202S) T4 polynucleotide kinase (NEB, cat. no. M0201S) 10 mM ATP (Life Technologies, cat. no. AM8110G) 10× TBE (Bio-Rad, 161-0733) Gel loading buffer II (Life Technologies, cat. no. AM8546G) 10-bp DNA ladder (Life Technologies, cat. no. 10821-015) 10 mg/ml Ethidium Bromide (Life Technologies, cat. no. 15585-011) 0.3 M NaCl 5 μM 3′ Adapter (RA3) (TGGAATTCTCGGGTGCCAAGG) RNA Ligase Buffer (NEB, cat. no. B0216L) RNaseOUT (Life Technologies, cat. no. 10777019) 200 U/μl Epicenter T4 RNA Ligase 2, truncated (NEB, cat. no. M0242S) 25 μM 5′ Adapter (RA5) (GUUCAGAGUUCUACAGUCCGACGAUC) T4 RNA Ligase 1 (NEB, cat. no. M0204S) RNA RT Primer (RTP) (GCCTTGGCACCCGAGAATTCCA) 5× First-Strand Buffer (Life Technologies, cat. no. 18064-014) 50 mM dNTPs 100 mM DTT (Life Technologies, cat. no. 18064-014) SuperScript II Reverse Transcriptase (Life Technologies, cat. no. 18064-014) 2× Phusion Mix (NEB, cat. no. M0531S) 5 mM Betaine (MP Biomedicals, cat. no. 215046180) 10 μM RNA PCR Primer (RTP) (GCCTTGGCACCCGAGAATTCCA) 10 μM RNA PCR Primer Index Nuclease-free water 25-bp DNA ladder (Life Technologies, cat. no. 10597-011) DSN Hybridization buffer (see recipe) 10× DSN Master Mix (Evrogen, cat. no. EA001) DSN Enzyme (Evrogen, cat. no. EA001) DSN STOP solution (Evrogen, cat. no. EA001) 1.7-ml tubes 70°C heat block Centrifuge 37°C heat block 1.0-mm, 10-well 15% TBE-Urea gels (Life Technologies, cat. no. EC6885BOX) Gel box for running prepoured gels (Life, Technologies, cat. no. EI0001) 18-G needles Razor blades Gel Breaker Tubes (IST Engineering, cat. no. 388-100) 2-ml tubes End-over-end rotator Spin-X columns (Costar, cat. no. 8160) 200-μl PCR tubes Thermal cycler 6% TBE gels 1.0 mm, 10 well (Invitrogen, cat. no. EC6265BOX) ..

    Sequencing:

    Article Title: The unfolded protein response and endoplasmic reticulum protein targeting machineries converge on the stress sensor IRE1
    Article Snippet: .. Preparation of small RNA cDNA libraries for deep sequencing 1 μL of RA3 RNA 3’ adapter (5’-TGGAATTCTCGGGTGCCAAGG-3’) from the TruSeq RNA small Sample Prep Kit (Illumina) was added to each of the purified RNA samples above, and the mixture was placed at 80°C for 2 min, then placed immediately on ice for another 2 min. 1.5 μL of 10× T4 RNA ligase reaction buffer (500 mM Tris pH 7.5, 100 mM MgCl2 , 10 mM DTT; New England Biolabs) and 4.5 μL 50% PEG 8,000 (New England Biolabs), 1 μL RNase inhibitor (Illumina), and 1 μL (200 units) T4 RNA ligase 2, truncated R55K, K227Q (KQ) mutant (New England Biolabs) were added to each sample and the reactions were incubated at 16°C overnight. .. 12–16 hr later, 0.5 μL of 10× T4 RNA ligase reaction buffer, 1.5 μL of 50% PEG 8,000, 2 μL of RNase-free water and 1 μL (200 units) T4 RNA ligase 2 truncated KQ were added to each sample and the reactions were incubated an additional 2 hr at 25°C.

    Article Title: Alston Virus, a Novel Paramyxovirus Isolated from Bats Causes Upper Respiratory Tract Infection in Experimentally Challenged Ferrets
    Article Snippet: Confirmation of Genome Termini Ligation of genome ends was used to enable sequencing of the 3′ terminus, adapted from a protocol previously developed for influenza virus sequencing [ ]. .. Genome ends were ligated overnight at 16 °C using 20 U T4 RNA Ligase, 20 U RNasin, 50 μM ATP, 10% PEG8000 and T4 RNA ligase reaction buffer (NEB, Ipswich, MA, USA).

    Article Title: The unfolded protein response and endoplasmic reticulum protein targeting machineries converge on the stress sensor IRE1
    Article Snippet: Paragraph title: Preparation of small RNA cDNA libraries for deep sequencing ... 1 μL of RA3 RNA 3’ adapter (5’-TGGAATTCTCGGGTGCCAAGG-3’) from the TruSeq RNA small Sample Prep Kit (Illumina) was added to each of the purified RNA samples above, and the mixture was placed at 80°C for 2 min, then placed immediately on ice for another 2 min. 1.5 μL of 10× T4 RNA ligase reaction buffer (500 mM Tris pH 7.5, 100 mM MgCl2 , 10 mM DTT; New England Biolabs) and 4.5 μL 50% PEG 8,000 (New England Biolabs), 1 μL RNase inhibitor (Illumina), and 1 μL (200 units) T4 RNA ligase 2, truncated R55K, K227Q (KQ) mutant (New England Biolabs) were added to each sample and the reactions were incubated at 16°C overnight.

    Article Title: Mapping the miRNA interactome by cross linking ligation and sequencing of hybrids (CLASH)
    Article Snippet: Hybond-C Extra membrane (GE Healthcare, RPN303E) Kodak BioMax MS Autoradiography Film (#8222648) MetaPhor agarose (Lonza, #50180) SYBRSafe (Life Technologies, S33102) cOmplete Protease inhibitors, EDTA-free (Roche Applied Science, #11873580001) RNace-IT (Agilent, #400720) diluted 1:20 with water, store at 4°C for at least 2 years SeeBlue Plus2 Pre-Stained Standard (Life Technologies, LC5925) NuPAGE LDS Sample Buffer 4X (Life Technologies, N0007) NuPAGE 4-12% polyacrylamide Bis-Tris gels (Life Technologies, NP0335) NuPAGE SDS MOPS running buffer (Life Technologies, NP0001) NuPage Transfer Buffer (Life Technologies, NP00061) GlycoBlue (Life Technologies, AM9515) MinElute PCR purification kit (QIAGEN, #28004) MinElute Gel extraction kit (QIAGEN, #28604) GeneRuler 50 bp DNA ladder (Thermo Scientific, SM0371) Qubit dsDNA HS Assay Kit (Life Technologies, ) 6 x DNA Loading dye (Thermo Scientific, R0611) T4 PNK, T4 Polynucleotide Kinase (New England BioLabs, M0201L) T4 RNA ligase 1 (New England BioLabs, M0204L) T4 RNA ligase reaction buffer, 10× (supplied with T4 RNA ligase 1) T4 RNA ligase 2 truncated, K227Q (New England BioLabs, M0351L) TSAP, Thermosensitive Alkaline Phosphatase (Promega, M9910) Proteinase K (Roche Applied Science, #03115836001) SuperScript III Reverse Transcriptase (Life Technologies, #18080-044) 5 x First strand buffer (supplied with SuperScript III Reverse Transcriptase) 0.1M DTT (supplied with SuperScript III Reverse Transcriptase) RNase H (New England BioLabs, M0297L) TaKaRa LA Taq (Clontech, RR002M) 10X LA PCR Buffer ll (Mg2+ plus) supplied with TaKaRa LA Taq dNTPs 2.5mM (supplied with TaKaRa LA Taq). .. TOPO TA Cloning® Kit for Sequencing, with One Shot® TOP10 Chemically Competent E. coli (Life Technologies, K4575-40) Phenol (Sigma-Aldrich, P4557, used without Equilibration Buffer) CAUTION Phenol is toxic on inhalation, on contact with skin or if swallowed, causes severe skin burns and eye damage.

    Ligation:

    Article Title: Functional Analysis of Three Arabidopsis ARGONAUTES Using Slicer-Defective Mutants [W] ARGONAUTES Using Slicer-Defective Mutants [W] [OA]
    Article Snippet: The mixture was cooled on ice for 2 min before adding 1.5 μL of 10× T4 RNA ligase reaction buffer (NEB), 40 units of RNase OUT), and 10 units of T4 RNA Ligase 2 truncated K227Q (NEB). .. Ligation reactions were incubated overnight at 16°C.

    Article Title: Biochemical and structural bioinformatics studies of fungal CutA nucleotidyltransferases explain their unusual specificity toward CTP and increased tendency for cytidine incorporation at the 3′-terminal positions of synthesized tails
    Article Snippet: Paragraph title: Adapter ligation ... Of note, 10.7 µL of purified RNA was mixed with 2 µL of T4 RNA Ligase Reaction buffer (New England Biolabs), 1 µL of 30 µM RA3 adapter, 4.8 µL of 50% PEG 8000 (New England Biolabs) and 0.5 µL of RiboLock RNase Inhibitor (40 U/µL; Thermo Fisher Scientific).

    Article Title: Alston Virus, a Novel Paramyxovirus Isolated from Bats Causes Upper Respiratory Tract Infection in Experimentally Challenged Ferrets
    Article Snippet: Confirmation of Genome Termini Ligation of genome ends was used to enable sequencing of the 3′ terminus, adapted from a protocol previously developed for influenza virus sequencing [ ]. .. Genome ends were ligated overnight at 16 °C using 20 U T4 RNA Ligase, 20 U RNasin, 50 μM ATP, 10% PEG8000 and T4 RNA ligase reaction buffer (NEB, Ipswich, MA, USA).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: A Novel Type of Influenza A Virus-Derived Defective Interfering Particle with Nucleotide Substitutions in Its Genome
    Article Snippet: The subsequent amplification of the junction region (containing the vRNA ends) was performed by RT-PCR. .. Circularization was performed by mixing 11.5 μl of the RNA sample with 4 μl (40 U) of T4 RNA ligase 1, 2 μl of 10× T4 RNA ligase reaction buffer, 2 μl of a 10 mM ATP solution (all reagents from New England BioLabs), and 0.5 μl (20 U) of RiboLock RNase inhibitor (Thermo Scientific).

    Article Title: Alston Virus, a Novel Paramyxovirus Isolated from Bats Causes Upper Respiratory Tract Infection in Experimentally Challenged Ferrets
    Article Snippet: Genome ends were ligated overnight at 16 °C using 20 U T4 RNA Ligase, 20 U RNasin, 50 μM ATP, 10% PEG8000 and T4 RNA ligase reaction buffer (NEB, Ipswich, MA, USA). .. Ligation was followed by hemi-nested PCR amplification using a Superscript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (Invitrogen, Carlsbad, CA, USA), then an Expand High Fidelity PCR System (Roche, Basel, Switzerland).

    Magnetic Beads:

    Article Title: Evolution of Sequence-Defined Highly Functionalized Nucleic Acid Polymers
    Article Snippet: .. Synthesis of HFNAP by templated translation via DNA ligase-mediated polymerization DNA template [up to 10 pmol, either in solution or immobilized on MyOne Streptavidin C1 magnetic beads (ThermoFisher Scientific)], polymerization initiation and termination primers (1.5 equivalents each relative to template), functionalized trinucleotide building blocks (10 equivalents relative to template for each occurrence of the corresponding codon) and 10x T4 RNA ligase reaction buffer (New England Biolabs; 1 μL) were mixed in a total volume of 8 μL in a PCR tube. .. The mixture was subjected to the following temperature program on a thermocycler: 95 °C for 10 sec; 65 °C for 4 min; a ramp from 65 °C to 4 °C at 0.1 °C per 10 s. To the PCR tube were added 1 μL of 10 mM ATP and 1 μL of T3 DNA ligase (New England Biolabs).

    Article Title: Evolution of Sequence-Defined Highly Functionalized Nucleic Acid Polymers
    Article Snippet: .. Biotinylated species was captured on streptavidin magnetic beads, which were then washed three times with 20 mM NaOH and then twice with 1x T4 RNA ligase reaction buffer. ..

    Mutagenesis:

    Article Title: The unfolded protein response and endoplasmic reticulum protein targeting machineries converge on the stress sensor IRE1
    Article Snippet: .. Preparation of small RNA cDNA libraries for deep sequencing 1 μL of RA3 RNA 3’ adapter (5’-TGGAATTCTCGGGTGCCAAGG-3’) from the TruSeq RNA small Sample Prep Kit (Illumina) was added to each of the purified RNA samples above, and the mixture was placed at 80°C for 2 min, then placed immediately on ice for another 2 min. 1.5 μL of 10× T4 RNA ligase reaction buffer (500 mM Tris pH 7.5, 100 mM MgCl2 , 10 mM DTT; New England Biolabs) and 4.5 μL 50% PEG 8,000 (New England Biolabs), 1 μL RNase inhibitor (Illumina), and 1 μL (200 units) T4 RNA ligase 2, truncated R55K, K227Q (KQ) mutant (New England Biolabs) were added to each sample and the reactions were incubated at 16°C overnight. .. 12–16 hr later, 0.5 μL of 10× T4 RNA ligase reaction buffer, 1.5 μL of 50% PEG 8,000, 2 μL of RNase-free water and 1 μL (200 units) T4 RNA ligase 2 truncated KQ were added to each sample and the reactions were incubated an additional 2 hr at 25°C.

    Article Title: The unfolded protein response and endoplasmic reticulum protein targeting machineries converge on the stress sensor IRE1
    Article Snippet: .. 1 μL of RA3 RNA 3’ adapter (5’-TGGAATTCTCGGGTGCCAAGG-3’) from the TruSeq RNA small Sample Prep Kit (Illumina) was added to each of the purified RNA samples above, and the mixture was placed at 80°C for 2 min, then placed immediately on ice for another 2 min. 1.5 μL of 10× T4 RNA ligase reaction buffer (500 mM Tris pH 7.5, 100 mM MgCl2 , 10 mM DTT; New England Biolabs) and 4.5 μL 50% PEG 8,000 (New England Biolabs), 1 μL RNase inhibitor (Illumina), and 1 μL (200 units) T4 RNA ligase 2, truncated R55K, K227Q (KQ) mutant (New England Biolabs) were added to each sample and the reactions were incubated at 16°C overnight. .. 12–16 hr later, 0.5 μL of 10× T4 RNA ligase reaction buffer, 1.5 μL of 50% PEG 8,000, 2 μL of RNase-free water and 1 μL (200 units) T4 RNA ligase 2 truncated KQ were added to each sample and the reactions were incubated an additional 2 hr at 25°C.

    Size-exclusion Chromatography:

    Article Title: Evolution of Sequence-Defined Highly Functionalized Nucleic Acid Polymers
    Article Snippet: Synthesis of HFNAP by templated translation via DNA ligase-mediated polymerization DNA template [up to 10 pmol, either in solution or immobilized on MyOne Streptavidin C1 magnetic beads (ThermoFisher Scientific)], polymerization initiation and termination primers (1.5 equivalents each relative to template), functionalized trinucleotide building blocks (10 equivalents relative to template for each occurrence of the corresponding codon) and 10x T4 RNA ligase reaction buffer (New England Biolabs; 1 μL) were mixed in a total volume of 8 μL in a PCR tube. .. The mixture was subjected to the following temperature program on a thermocycler: 95 °C for 10 sec; 65 °C for 4 min; a ramp from 65 °C to 4 °C at 0.1 °C per 10 s. To the PCR tube were added 1 μL of 10 mM ATP and 1 μL of T3 DNA ligase (New England Biolabs).

    Labeling:

    Article Title: Multifunctional Roles for the Protein Translocation Machinery in RNA Anchoring to the Endoplasmic Reticulum *
    Article Snippet: Paragraph title: RNA-dependent T4 RNA Ligase Labeling of UV-irradiated RM ... For T4 RNA ligase reaction, the RM fractions were adjusted to a final concentration of 50 m m Tris-HCl, pH 7.5, 10 m m MgCl2 , 1 m m DTT, 15% DMSO, 1 m m ATP, 80 μCi of [5′-32 P]cytidine 3′,5′-bis(phosphate), 1 unit/μl T4 RNA ligase (New England Biolabs), and incubated at 4 °C.

    Purification:

    Article Title: The unfolded protein response and endoplasmic reticulum protein targeting machineries converge on the stress sensor IRE1
    Article Snippet: .. Preparation of small RNA cDNA libraries for deep sequencing 1 μL of RA3 RNA 3’ adapter (5’-TGGAATTCTCGGGTGCCAAGG-3’) from the TruSeq RNA small Sample Prep Kit (Illumina) was added to each of the purified RNA samples above, and the mixture was placed at 80°C for 2 min, then placed immediately on ice for another 2 min. 1.5 μL of 10× T4 RNA ligase reaction buffer (500 mM Tris pH 7.5, 100 mM MgCl2 , 10 mM DTT; New England Biolabs) and 4.5 μL 50% PEG 8,000 (New England Biolabs), 1 μL RNase inhibitor (Illumina), and 1 μL (200 units) T4 RNA ligase 2, truncated R55K, K227Q (KQ) mutant (New England Biolabs) were added to each sample and the reactions were incubated at 16°C overnight. .. 12–16 hr later, 0.5 μL of 10× T4 RNA ligase reaction buffer, 1.5 μL of 50% PEG 8,000, 2 μL of RNase-free water and 1 μL (200 units) T4 RNA ligase 2 truncated KQ were added to each sample and the reactions were incubated an additional 2 hr at 25°C.

    Article Title: Biochemical and structural bioinformatics studies of fungal CutA nucleotidyltransferases explain their unusual specificity toward CTP and increased tendency for cytidine incorporation at the 3′-terminal positions of synthesized tails
    Article Snippet: .. Of note, 10.7 µL of purified RNA was mixed with 2 µL of T4 RNA Ligase Reaction buffer (New England Biolabs), 1 µL of 30 µM RA3 adapter, 4.8 µL of 50% PEG 8000 (New England Biolabs) and 0.5 µL of RiboLock RNase Inhibitor (40 U/µL; Thermo Fisher Scientific). .. After 2 min of incubation at 70°C, the tube was placed on ice, and 1 µL of T4 RNA Ligase 2, Truncated (200 U/µL; New England Biolabs) was added.

    Article Title: The dynamic transcriptional and translational landscape of the model antibiotic producer Streptomyces coelicolor A3(2)
    Article Snippet: Thereafter, the enzyme inactivation was performed for 10 min at 70 °C and RNA was purified by ethanol precipitation. .. The mixture was ligated in 20 μl volume with 2 μl of 10 × T4 RNA Ligase Reaction Buffer (NEB), 6 μl of PEG 8000 (50%, w/v) and 1 μl of T4 RNA Ligase 2, truncated (200 U μl−1 , NEB).

    Article Title: The unfolded protein response and endoplasmic reticulum protein targeting machineries converge on the stress sensor IRE1
    Article Snippet: .. 1 μL of RA3 RNA 3’ adapter (5’-TGGAATTCTCGGGTGCCAAGG-3’) from the TruSeq RNA small Sample Prep Kit (Illumina) was added to each of the purified RNA samples above, and the mixture was placed at 80°C for 2 min, then placed immediately on ice for another 2 min. 1.5 μL of 10× T4 RNA ligase reaction buffer (500 mM Tris pH 7.5, 100 mM MgCl2 , 10 mM DTT; New England Biolabs) and 4.5 μL 50% PEG 8,000 (New England Biolabs), 1 μL RNase inhibitor (Illumina), and 1 μL (200 units) T4 RNA ligase 2, truncated R55K, K227Q (KQ) mutant (New England Biolabs) were added to each sample and the reactions were incubated at 16°C overnight. .. 12–16 hr later, 0.5 μL of 10× T4 RNA ligase reaction buffer, 1.5 μL of 50% PEG 8,000, 2 μL of RNase-free water and 1 μL (200 units) T4 RNA ligase 2 truncated KQ were added to each sample and the reactions were incubated an additional 2 hr at 25°C.

    Article Title: Mapping the miRNA interactome by cross linking ligation and sequencing of hybrids (CLASH)
    Article Snippet: .. Hybond-C Extra membrane (GE Healthcare, RPN303E) Kodak BioMax MS Autoradiography Film (#8222648) MetaPhor agarose (Lonza, #50180) SYBRSafe (Life Technologies, S33102) cOmplete Protease inhibitors, EDTA-free (Roche Applied Science, #11873580001) RNace-IT (Agilent, #400720) diluted 1:20 with water, store at 4°C for at least 2 years SeeBlue Plus2 Pre-Stained Standard (Life Technologies, LC5925) NuPAGE LDS Sample Buffer 4X (Life Technologies, N0007) NuPAGE 4-12% polyacrylamide Bis-Tris gels (Life Technologies, NP0335) NuPAGE SDS MOPS running buffer (Life Technologies, NP0001) NuPage Transfer Buffer (Life Technologies, NP00061) GlycoBlue (Life Technologies, AM9515) MinElute PCR purification kit (QIAGEN, #28004) MinElute Gel extraction kit (QIAGEN, #28604) GeneRuler 50 bp DNA ladder (Thermo Scientific, SM0371) Qubit dsDNA HS Assay Kit (Life Technologies, ) 6 x DNA Loading dye (Thermo Scientific, R0611) T4 PNK, T4 Polynucleotide Kinase (New England BioLabs, M0201L) T4 RNA ligase 1 (New England BioLabs, M0204L) T4 RNA ligase reaction buffer, 10× (supplied with T4 RNA ligase 1) T4 RNA ligase 2 truncated, K227Q (New England BioLabs, M0351L) TSAP, Thermosensitive Alkaline Phosphatase (Promega, M9910) Proteinase K (Roche Applied Science, #03115836001) SuperScript III Reverse Transcriptase (Life Technologies, #18080-044) 5 x First strand buffer (supplied with SuperScript III Reverse Transcriptase) 0.1M DTT (supplied with SuperScript III Reverse Transcriptase) RNase H (New England BioLabs, M0297L) TaKaRa LA Taq (Clontech, RR002M) 10X LA PCR Buffer ll (Mg2+ plus) supplied with TaKaRa LA Taq dNTPs 2.5mM (supplied with TaKaRa LA Taq). ..

    Polymerase Chain Reaction:

    Article Title: A Novel Type of Influenza A Virus-Derived Defective Interfering Particle with Nucleotide Substitutions in Its Genome
    Article Snippet: In subsequent PCR (primers are listed in ), we used a segment-specific primer in combination with a second primer that was designed across the junction of the 3′ and 5′ vRNA ends. .. Circularization was performed by mixing 11.5 μl of the RNA sample with 4 μl (40 U) of T4 RNA ligase 1, 2 μl of 10× T4 RNA ligase reaction buffer, 2 μl of a 10 mM ATP solution (all reagents from New England BioLabs), and 0.5 μl (20 U) of RiboLock RNase inhibitor (Thermo Scientific).

    Article Title: Evolution of Sequence-Defined Highly Functionalized Nucleic Acid Polymers
    Article Snippet: .. Synthesis of HFNAP by templated translation via DNA ligase-mediated polymerization DNA template [up to 10 pmol, either in solution or immobilized on MyOne Streptavidin C1 magnetic beads (ThermoFisher Scientific)], polymerization initiation and termination primers (1.5 equivalents each relative to template), functionalized trinucleotide building blocks (10 equivalents relative to template for each occurrence of the corresponding codon) and 10x T4 RNA ligase reaction buffer (New England Biolabs; 1 μL) were mixed in a total volume of 8 μL in a PCR tube. .. The mixture was subjected to the following temperature program on a thermocycler: 95 °C for 10 sec; 65 °C for 4 min; a ramp from 65 °C to 4 °C at 0.1 °C per 10 s. To the PCR tube were added 1 μL of 10 mM ATP and 1 μL of T3 DNA ligase (New England Biolabs).

    Article Title: Alston Virus, a Novel Paramyxovirus Isolated from Bats Causes Upper Respiratory Tract Infection in Experimentally Challenged Ferrets
    Article Snippet: Genome ends were ligated overnight at 16 °C using 20 U T4 RNA Ligase, 20 U RNasin, 50 μM ATP, 10% PEG8000 and T4 RNA ligase reaction buffer (NEB, Ipswich, MA, USA). .. Ligation was followed by hemi-nested PCR amplification using a Superscript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (Invitrogen, Carlsbad, CA, USA), then an Expand High Fidelity PCR System (Roche, Basel, Switzerland).

    Article Title: Protein Interaction Profile Sequencing (PIP-seq)
    Article Snippet: .. Protein interaction profile RNA (Basic Protocol 2) 10× Fragmentation Reagent (Life Technologies, cat. no. AM8740) Fragmentation Stop Solution (Life Technologies, cat. no. AM8740) DEPC-treated H2 O 5 mg/ml Glycogen, ultrapure (Life Technologies, cat. no. AM9510) 3 M NaOAc (pH = 5.5) (Life Technologies, cat. no. AM9740) 100% EtOH (Decon Labs, cat. no. 2716) 80% EtOH Ice T4 DNA ligase buffer (NEB, cat. no. B0202S) T4 polynucleotide kinase (NEB, cat. no. M0201S) 10 mM ATP (Life Technologies, cat. no. AM8110G) 10× TBE (Bio-Rad, 161-0733) Gel loading buffer II (Life Technologies, cat. no. AM8546G) 10-bp DNA ladder (Life Technologies, cat. no. 10821-015) 10 mg/ml Ethidium Bromide (Life Technologies, cat. no. 15585-011) 0.3 M NaCl 5 μM 3′ Adapter (RA3) (TGGAATTCTCGGGTGCCAAGG) RNA Ligase Buffer (NEB, cat. no. B0216L) RNaseOUT (Life Technologies, cat. no. 10777019) 200 U/μl Epicenter T4 RNA Ligase 2, truncated (NEB, cat. no. M0242S) 25 μM 5′ Adapter (RA5) (GUUCAGAGUUCUACAGUCCGACGAUC) T4 RNA Ligase 1 (NEB, cat. no. M0204S) RNA RT Primer (RTP) (GCCTTGGCACCCGAGAATTCCA) 5× First-Strand Buffer (Life Technologies, cat. no. 18064-014) 50 mM dNTPs 100 mM DTT (Life Technologies, cat. no. 18064-014) SuperScript II Reverse Transcriptase (Life Technologies, cat. no. 18064-014) 2× Phusion Mix (NEB, cat. no. M0531S) 5 mM Betaine (MP Biomedicals, cat. no. 215046180) 10 μM RNA PCR Primer (RTP) (GCCTTGGCACCCGAGAATTCCA) 10 μM RNA PCR Primer Index Nuclease-free water 25-bp DNA ladder (Life Technologies, cat. no. 10597-011) DSN Hybridization buffer (see recipe) 10× DSN Master Mix (Evrogen, cat. no. EA001) DSN Enzyme (Evrogen, cat. no. EA001) DSN STOP solution (Evrogen, cat. no. EA001) 1.7-ml tubes 70°C heat block Centrifuge 37°C heat block 1.0-mm, 10-well 15% TBE-Urea gels (Life Technologies, cat. no. EC6885BOX) Gel box for running prepoured gels (Life, Technologies, cat. no. EI0001) 18-G needles Razor blades Gel Breaker Tubes (IST Engineering, cat. no. 388-100) 2-ml tubes End-over-end rotator Spin-X columns (Costar, cat. no. 8160) 200-μl PCR tubes Thermal cycler 6% TBE gels 1.0 mm, 10 well (Invitrogen, cat. no. EC6265BOX) ..

    Article Title: Mapping the miRNA interactome by cross linking ligation and sequencing of hybrids (CLASH)
    Article Snippet: .. Hybond-C Extra membrane (GE Healthcare, RPN303E) Kodak BioMax MS Autoradiography Film (#8222648) MetaPhor agarose (Lonza, #50180) SYBRSafe (Life Technologies, S33102) cOmplete Protease inhibitors, EDTA-free (Roche Applied Science, #11873580001) RNace-IT (Agilent, #400720) diluted 1:20 with water, store at 4°C for at least 2 years SeeBlue Plus2 Pre-Stained Standard (Life Technologies, LC5925) NuPAGE LDS Sample Buffer 4X (Life Technologies, N0007) NuPAGE 4-12% polyacrylamide Bis-Tris gels (Life Technologies, NP0335) NuPAGE SDS MOPS running buffer (Life Technologies, NP0001) NuPage Transfer Buffer (Life Technologies, NP00061) GlycoBlue (Life Technologies, AM9515) MinElute PCR purification kit (QIAGEN, #28004) MinElute Gel extraction kit (QIAGEN, #28604) GeneRuler 50 bp DNA ladder (Thermo Scientific, SM0371) Qubit dsDNA HS Assay Kit (Life Technologies, ) 6 x DNA Loading dye (Thermo Scientific, R0611) T4 PNK, T4 Polynucleotide Kinase (New England BioLabs, M0201L) T4 RNA ligase 1 (New England BioLabs, M0204L) T4 RNA ligase reaction buffer, 10× (supplied with T4 RNA ligase 1) T4 RNA ligase 2 truncated, K227Q (New England BioLabs, M0351L) TSAP, Thermosensitive Alkaline Phosphatase (Promega, M9910) Proteinase K (Roche Applied Science, #03115836001) SuperScript III Reverse Transcriptase (Life Technologies, #18080-044) 5 x First strand buffer (supplied with SuperScript III Reverse Transcriptase) 0.1M DTT (supplied with SuperScript III Reverse Transcriptase) RNase H (New England BioLabs, M0297L) TaKaRa LA Taq (Clontech, RR002M) 10X LA PCR Buffer ll (Mg2+ plus) supplied with TaKaRa LA Taq dNTPs 2.5mM (supplied with TaKaRa LA Taq). ..

    Immunoprecipitation:

    Article Title: Functional Analysis of Three Arabidopsis ARGONAUTES Using Slicer-Defective Mutants [W] ARGONAUTES Using Slicer-Defective Mutants [W] [OA]
    Article Snippet: Ten microliters (or 100%) of the immunoprecipitated RNA was mixed with 15 pmol of Cloning Linker 1 (IDT; see online) and incubated at 70°C for 2 min. .. The mixture was cooled on ice for 2 min before adding 1.5 μL of 10× T4 RNA ligase reaction buffer (NEB), 40 units of RNase OUT), and 10 units of T4 RNA Ligase 2 truncated K227Q (NEB).

    Polyacrylamide Gel Electrophoresis:

    Article Title: The unfolded protein response and endoplasmic reticulum protein targeting machineries converge on the stress sensor IRE1
    Article Snippet: Preparation of small RNA cDNA libraries for deep sequencing 1 μL of RA3 RNA 3’ adapter (5’-TGGAATTCTCGGGTGCCAAGG-3’) from the TruSeq RNA small Sample Prep Kit (Illumina) was added to each of the purified RNA samples above, and the mixture was placed at 80°C for 2 min, then placed immediately on ice for another 2 min. 1.5 μL of 10× T4 RNA ligase reaction buffer (500 mM Tris pH 7.5, 100 mM MgCl2 , 10 mM DTT; New England Biolabs) and 4.5 μL 50% PEG 8,000 (New England Biolabs), 1 μL RNase inhibitor (Illumina), and 1 μL (200 units) T4 RNA ligase 2, truncated R55K, K227Q (KQ) mutant (New England Biolabs) were added to each sample and the reactions were incubated at 16°C overnight. .. The 3’-adapter-ligated RNA tags were purified by PAGE using 10% TBE-urea gels.

    Article Title: The unfolded protein response and endoplasmic reticulum protein targeting machineries converge on the stress sensor IRE1
    Article Snippet: 1 μL of RA3 RNA 3’ adapter (5’-TGGAATTCTCGGGTGCCAAGG-3’) from the TruSeq RNA small Sample Prep Kit (Illumina) was added to each of the purified RNA samples above, and the mixture was placed at 80°C for 2 min, then placed immediately on ice for another 2 min. 1.5 μL of 10× T4 RNA ligase reaction buffer (500 mM Tris pH 7.5, 100 mM MgCl2 , 10 mM DTT; New England Biolabs) and 4.5 μL 50% PEG 8,000 (New England Biolabs), 1 μL RNase inhibitor (Illumina), and 1 μL (200 units) T4 RNA ligase 2, truncated R55K, K227Q (KQ) mutant (New England Biolabs) were added to each sample and the reactions were incubated at 16°C overnight. .. The 3’-adapter-ligated RNA tags were purified by PAGE using 10% TBE-urea gels.

    Gel Extraction:

    Article Title: Mitochondrial Ribosome (Mitoribosome) Profiling for Monitoring Mitochondrial Translation in vivo
    Article Snippet: .. Solutions and reagents: Mitoribosome-associated RNA (from Basic Protocol 1) and/or fragmented and size-selected mRNA (from Support Protocol) 2X urea RNA loading buffer (see recipe) 10-bp DNA ladder 15%, 10% TBE-urea, 8% TBE polyacrylamide gels SYBR gold (10,000X concentrate) RNase-free water 3 M sodium acetate, pH 5.5 (RNase-free) 25 mg/ml linear polyacrylamide (LPA) Isopropanol 70% (v/v) ethanol 10X T4 polynucleotide kinase (PNK) buffer 10 U/μl T4 PNK Oligonucleotide linker and primers (see Table) 50% (w/v) PEG 8000 (RNase-free) 10X T4 RNA ligase reaction buffer (NEB, B0216L) 200 U/μl T4 RNA ligase 2, truncated (NEB) 10 mM Tris, pH 8.0 (RNase-free) 5X First-strand (FS) RT reaction buffer (Invitrogen, 18080-993) 10 mM dNTPs 0.1 M DTT 20 U/μl SUPERase-In 200 U/μl Superscript III 1 N sodium hydroxide 3 M sodium chloride 10X CircLigase reaction buffer (Epicentre, CL4111K) 1 mM ATP 50 mM manganese chloride 100 U/μl CircLigase ssDNA ligase 5X Phusion HF reaction buffer (NEB, M0530S) 2 U/μl Phusion HF DNA polymerase 10X DNA loading buffer (see recipe) 100-bp DNA ladder DNA gel extraction buffer (see recipe) 10 mM Tris, pH 8.5 Qubit dsDNA HS Assay kit Special equipment: Heat blocks: 80°C, 70°C, 37°C, 25°C Typhoon fluorescent/phosphorescent image scanner, or UV transilluminator with camera Blue light transilluminator (or UV transilluminator) box End over end rotator Costar Spin-X centrifuge tube filter (0.45-um cellulose acetate in 2-ml tube; Corning) Qubit Fluorometer Bioanalyzer DNA high sensitivity chip and reagents Other equipment: Polyacrylamide electrophoresis apparatus and power source 0.5-ml and 1.5-ml RNase-free non-stick microcentrifuge tubes Plastic sheet protector Razor blades or scalpels Thermocycler Plastic sheet protector .. 1 Combine 10 μl RNA from large scale mitoribosome purification with 10 μl 2X urea RNA loading buffer.

    Article Title: Mapping the miRNA interactome by cross linking ligation and sequencing of hybrids (CLASH)
    Article Snippet: .. Hybond-C Extra membrane (GE Healthcare, RPN303E) Kodak BioMax MS Autoradiography Film (#8222648) MetaPhor agarose (Lonza, #50180) SYBRSafe (Life Technologies, S33102) cOmplete Protease inhibitors, EDTA-free (Roche Applied Science, #11873580001) RNace-IT (Agilent, #400720) diluted 1:20 with water, store at 4°C for at least 2 years SeeBlue Plus2 Pre-Stained Standard (Life Technologies, LC5925) NuPAGE LDS Sample Buffer 4X (Life Technologies, N0007) NuPAGE 4-12% polyacrylamide Bis-Tris gels (Life Technologies, NP0335) NuPAGE SDS MOPS running buffer (Life Technologies, NP0001) NuPage Transfer Buffer (Life Technologies, NP00061) GlycoBlue (Life Technologies, AM9515) MinElute PCR purification kit (QIAGEN, #28004) MinElute Gel extraction kit (QIAGEN, #28604) GeneRuler 50 bp DNA ladder (Thermo Scientific, SM0371) Qubit dsDNA HS Assay Kit (Life Technologies, ) 6 x DNA Loading dye (Thermo Scientific, R0611) T4 PNK, T4 Polynucleotide Kinase (New England BioLabs, M0201L) T4 RNA ligase 1 (New England BioLabs, M0204L) T4 RNA ligase reaction buffer, 10× (supplied with T4 RNA ligase 1) T4 RNA ligase 2 truncated, K227Q (New England BioLabs, M0351L) TSAP, Thermosensitive Alkaline Phosphatase (Promega, M9910) Proteinase K (Roche Applied Science, #03115836001) SuperScript III Reverse Transcriptase (Life Technologies, #18080-044) 5 x First strand buffer (supplied with SuperScript III Reverse Transcriptase) 0.1M DTT (supplied with SuperScript III Reverse Transcriptase) RNase H (New England BioLabs, M0297L) TaKaRa LA Taq (Clontech, RR002M) 10X LA PCR Buffer ll (Mg2+ plus) supplied with TaKaRa LA Taq dNTPs 2.5mM (supplied with TaKaRa LA Taq). ..

    cDNA Library Assay:

    Article Title: Genome-Wide Mapping of Yeast RNA Polymerase II Termination
    Article Snippet: Paragraph title: cDNA library preparation ... The beads were resuspended in 50 ul of T4 RNA Ligase reaction solution (5 uM 5′ Adaptor [ GUUCAGAGUUCUACAGUCCGACGAUC , IDT], 1.2 U/µl RNase Inhibitor, 1 mM ATP, 0.5 U/µl T4 RNA Ligase [NEB], 1 mM DTT in RNA Ligase Buffer) and incubated at 16°C overnight.

    Rapid Amplification of cDNA Ends:

    Article Title: Alston Virus, a Novel Paramyxovirus Isolated from Bats Causes Upper Respiratory Tract Infection in Experimentally Challenged Ferrets
    Article Snippet: Genome ends were ligated overnight at 16 °C using 20 U T4 RNA Ligase, 20 U RNasin, 50 μM ATP, 10% PEG8000 and T4 RNA ligase reaction buffer (NEB, Ipswich, MA, USA). .. The rapid amplification of cDNA ends (RACE) [ ] was required to determine the 5′ terminus, with some adaptations made to the original method.

    Chromatin Immunoprecipitation:

    Article Title: Mitochondrial Ribosome (Mitoribosome) Profiling for Monitoring Mitochondrial Translation in vivo
    Article Snippet: .. Solutions and reagents: Mitoribosome-associated RNA (from Basic Protocol 1) and/or fragmented and size-selected mRNA (from Support Protocol) 2X urea RNA loading buffer (see recipe) 10-bp DNA ladder 15%, 10% TBE-urea, 8% TBE polyacrylamide gels SYBR gold (10,000X concentrate) RNase-free water 3 M sodium acetate, pH 5.5 (RNase-free) 25 mg/ml linear polyacrylamide (LPA) Isopropanol 70% (v/v) ethanol 10X T4 polynucleotide kinase (PNK) buffer 10 U/μl T4 PNK Oligonucleotide linker and primers (see Table) 50% (w/v) PEG 8000 (RNase-free) 10X T4 RNA ligase reaction buffer (NEB, B0216L) 200 U/μl T4 RNA ligase 2, truncated (NEB) 10 mM Tris, pH 8.0 (RNase-free) 5X First-strand (FS) RT reaction buffer (Invitrogen, 18080-993) 10 mM dNTPs 0.1 M DTT 20 U/μl SUPERase-In 200 U/μl Superscript III 1 N sodium hydroxide 3 M sodium chloride 10X CircLigase reaction buffer (Epicentre, CL4111K) 1 mM ATP 50 mM manganese chloride 100 U/μl CircLigase ssDNA ligase 5X Phusion HF reaction buffer (NEB, M0530S) 2 U/μl Phusion HF DNA polymerase 10X DNA loading buffer (see recipe) 100-bp DNA ladder DNA gel extraction buffer (see recipe) 10 mM Tris, pH 8.5 Qubit dsDNA HS Assay kit Special equipment: Heat blocks: 80°C, 70°C, 37°C, 25°C Typhoon fluorescent/phosphorescent image scanner, or UV transilluminator with camera Blue light transilluminator (or UV transilluminator) box End over end rotator Costar Spin-X centrifuge tube filter (0.45-um cellulose acetate in 2-ml tube; Corning) Qubit Fluorometer Bioanalyzer DNA high sensitivity chip and reagents Other equipment: Polyacrylamide electrophoresis apparatus and power source 0.5-ml and 1.5-ml RNase-free non-stick microcentrifuge tubes Plastic sheet protector Razor blades or scalpels Thermocycler Plastic sheet protector .. 1 Combine 10 μl RNA from large scale mitoribosome purification with 10 μl 2X urea RNA loading buffer.

    SDS Page:

    Article Title: Multifunctional Roles for the Protein Translocation Machinery in RNA Anchoring to the Endoplasmic Reticulum *
    Article Snippet: For T4 RNA ligase reaction, the RM fractions were adjusted to a final concentration of 50 m m Tris-HCl, pH 7.5, 10 m m MgCl2 , 1 m m DTT, 15% DMSO, 1 m m ATP, 80 μCi of [5′-32 P]cytidine 3′,5′-bis(phosphate), 1 unit/μl T4 RNA ligase (New England Biolabs), and incubated at 4 °C. .. The lysate was collected, TCA-precipitated, and analyzed by SDS-PAGE and phosphorimaging.

    Sample Prep:

    Article Title: The unfolded protein response and endoplasmic reticulum protein targeting machineries converge on the stress sensor IRE1
    Article Snippet: .. Preparation of small RNA cDNA libraries for deep sequencing 1 μL of RA3 RNA 3’ adapter (5’-TGGAATTCTCGGGTGCCAAGG-3’) from the TruSeq RNA small Sample Prep Kit (Illumina) was added to each of the purified RNA samples above, and the mixture was placed at 80°C for 2 min, then placed immediately on ice for another 2 min. 1.5 μL of 10× T4 RNA ligase reaction buffer (500 mM Tris pH 7.5, 100 mM MgCl2 , 10 mM DTT; New England Biolabs) and 4.5 μL 50% PEG 8,000 (New England Biolabs), 1 μL RNase inhibitor (Illumina), and 1 μL (200 units) T4 RNA ligase 2, truncated R55K, K227Q (KQ) mutant (New England Biolabs) were added to each sample and the reactions were incubated at 16°C overnight. .. 12–16 hr later, 0.5 μL of 10× T4 RNA ligase reaction buffer, 1.5 μL of 50% PEG 8,000, 2 μL of RNase-free water and 1 μL (200 units) T4 RNA ligase 2 truncated KQ were added to each sample and the reactions were incubated an additional 2 hr at 25°C.

    Article Title: The unfolded protein response and endoplasmic reticulum protein targeting machineries converge on the stress sensor IRE1
    Article Snippet: .. 1 μL of RA3 RNA 3’ adapter (5’-TGGAATTCTCGGGTGCCAAGG-3’) from the TruSeq RNA small Sample Prep Kit (Illumina) was added to each of the purified RNA samples above, and the mixture was placed at 80°C for 2 min, then placed immediately on ice for another 2 min. 1.5 μL of 10× T4 RNA ligase reaction buffer (500 mM Tris pH 7.5, 100 mM MgCl2 , 10 mM DTT; New England Biolabs) and 4.5 μL 50% PEG 8,000 (New England Biolabs), 1 μL RNase inhibitor (Illumina), and 1 μL (200 units) T4 RNA ligase 2, truncated R55K, K227Q (KQ) mutant (New England Biolabs) were added to each sample and the reactions were incubated at 16°C overnight. .. 12–16 hr later, 0.5 μL of 10× T4 RNA ligase reaction buffer, 1.5 μL of 50% PEG 8,000, 2 μL of RNase-free water and 1 μL (200 units) T4 RNA ligase 2 truncated KQ were added to each sample and the reactions were incubated an additional 2 hr at 25°C.

    Ethanol Precipitation:

    Article Title: The dynamic transcriptional and translational landscape of the model antibiotic producer Streptomyces coelicolor A3(2)
    Article Snippet: Thereafter, the enzyme inactivation was performed for 10 min at 70 °C and RNA was purified by ethanol precipitation. .. The mixture was ligated in 20 μl volume with 2 μl of 10 × T4 RNA Ligase Reaction Buffer (NEB), 6 μl of PEG 8000 (50%, w/v) and 1 μl of T4 RNA Ligase 2, truncated (200 U μl−1 , NEB).

    Random Hexamer Labeling:

    Article Title: A Novel Type of Influenza A Virus-Derived Defective Interfering Particle with Nucleotide Substitutions in Its Genome
    Article Snippet: For RT, a random hexamer primer was used. .. Circularization was performed by mixing 11.5 μl of the RNA sample with 4 μl (40 U) of T4 RNA ligase 1, 2 μl of 10× T4 RNA ligase reaction buffer, 2 μl of a 10 mM ATP solution (all reagents from New England BioLabs), and 0.5 μl (20 U) of RiboLock RNase inhibitor (Thermo Scientific).

    Concentration Assay:

    Article Title: Multifunctional Roles for the Protein Translocation Machinery in RNA Anchoring to the Endoplasmic Reticulum *
    Article Snippet: .. For T4 RNA ligase reaction, the RM fractions were adjusted to a final concentration of 50 m m Tris-HCl, pH 7.5, 10 m m MgCl2 , 1 m m DTT, 15% DMSO, 1 m m ATP, 80 μCi of [5′-32 P]cytidine 3′,5′-bis(phosphate), 1 unit/μl T4 RNA ligase (New England Biolabs), and incubated at 4 °C. .. The lysate was collected, TCA-precipitated, and analyzed by SDS-PAGE and phosphorimaging.

    Lysis:

    Article Title: Multifunctional Roles for the Protein Translocation Machinery in RNA Anchoring to the Endoplasmic Reticulum *
    Article Snippet: RM-associated RNAs were digested with mung bean nuclease at a final concentration of 1 unit/μg RNA and incubated at 30 °C for 1 h. RM were collected by ultracentrifugation, and the RM pellet was resuspended in lysis buffer. .. For T4 RNA ligase reaction, the RM fractions were adjusted to a final concentration of 50 m m Tris-HCl, pH 7.5, 10 m m MgCl2 , 1 m m DTT, 15% DMSO, 1 m m ATP, 80 μCi of [5′-32 P]cytidine 3′,5′-bis(phosphate), 1 unit/μl T4 RNA ligase (New England Biolabs), and incubated at 4 °C.

    Hood:

    Article Title: Mapping the miRNA interactome by cross linking ligation and sequencing of hybrids (CLASH)
    Article Snippet: Hybond-C Extra membrane (GE Healthcare, RPN303E) Kodak BioMax MS Autoradiography Film (#8222648) MetaPhor agarose (Lonza, #50180) SYBRSafe (Life Technologies, S33102) cOmplete Protease inhibitors, EDTA-free (Roche Applied Science, #11873580001) RNace-IT (Agilent, #400720) diluted 1:20 with water, store at 4°C for at least 2 years SeeBlue Plus2 Pre-Stained Standard (Life Technologies, LC5925) NuPAGE LDS Sample Buffer 4X (Life Technologies, N0007) NuPAGE 4-12% polyacrylamide Bis-Tris gels (Life Technologies, NP0335) NuPAGE SDS MOPS running buffer (Life Technologies, NP0001) NuPage Transfer Buffer (Life Technologies, NP00061) GlycoBlue (Life Technologies, AM9515) MinElute PCR purification kit (QIAGEN, #28004) MinElute Gel extraction kit (QIAGEN, #28604) GeneRuler 50 bp DNA ladder (Thermo Scientific, SM0371) Qubit dsDNA HS Assay Kit (Life Technologies, ) 6 x DNA Loading dye (Thermo Scientific, R0611) T4 PNK, T4 Polynucleotide Kinase (New England BioLabs, M0201L) T4 RNA ligase 1 (New England BioLabs, M0204L) T4 RNA ligase reaction buffer, 10× (supplied with T4 RNA ligase 1) T4 RNA ligase 2 truncated, K227Q (New England BioLabs, M0351L) TSAP, Thermosensitive Alkaline Phosphatase (Promega, M9910) Proteinase K (Roche Applied Science, #03115836001) SuperScript III Reverse Transcriptase (Life Technologies, #18080-044) 5 x First strand buffer (supplied with SuperScript III Reverse Transcriptase) 0.1M DTT (supplied with SuperScript III Reverse Transcriptase) RNase H (New England BioLabs, M0297L) TaKaRa LA Taq (Clontech, RR002M) 10X LA PCR Buffer ll (Mg2+ plus) supplied with TaKaRa LA Taq dNTPs 2.5mM (supplied with TaKaRa LA Taq). .. Use a hood, protective clothing, eyes protection and gloves.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs ligation mix
    Ligation Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 62 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ligation mix/product/New England Biolabs
    Average 90 stars, based on 62 article reviews
    Price from $9.99 to $1999.99
    ligation mix - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    90
    New England Biolabs t4 rna ligase reaction buffer
    T4 Rna Ligase Reaction Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 rna ligase reaction buffer/product/New England Biolabs
    Average 90 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    t4 rna ligase reaction buffer - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    90
    New England Biolabs t4 rna ligase 2 truncated buffer
    Graphical Visualization of the 3′ RACE-Seq Approach, Related to Figure 2 (A) Graphical representation of 3′ RACE-seq library preparation and the oligonucleotides used. First, the 3′ adaptor RA3_15N was joined to the 3′ end of RNA by enzymatic ligation. The adaptor has: (i) 5′ rApp modification for efficient and specific ligation by the truncated <t>T4</t> RNA ligase 2, (ii) delimiter sequence to be used in bioinformatics analyses to exclude RT and PCR artifacts (CTGAC, highlighted in violet), (iii) unique 15N barcode for individual transcript barcoding (highlighted in green), (iv) anchor sequence to pair with the reverse transcription primer (underlined) and (v) dideoxyC on the 3′ end to prevent concatamer formation. The RNA ligated to the adaptor sequence was purified from excess adaptor and reverse transcription was performed with the RT primer, which is compatible with Illumina sequencing and has: (i) sequences to base-pair with the adaptor (underlined), (ii) 6-nucleotide barcode for sample barcoding (highlighted in red), (iii) sequences that base pair with the universal outer primer for nested PCR (blue). Libraries were generated by nested PCR with 2 outer forward primers (F1 and F2) and a single universal reverse primer (uni rev). PCR amplicons of first and second PCRs were purified from excess primers on AmPure beads (Agencourt) before beginning the next step. (B) Flowchart of the bioinformatics approach to 3′ RACE-seq data analysis. The procedure starts at the top. Datasets are shown in rectangles. Software used is depicted in hexagons.
    T4 Rna Ligase 2 Truncated Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 rna ligase 2 truncated buffer/product/New England Biolabs
    Average 90 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    t4 rna ligase 2 truncated buffer - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results


    Graphical Visualization of the 3′ RACE-Seq Approach, Related to Figure 2 (A) Graphical representation of 3′ RACE-seq library preparation and the oligonucleotides used. First, the 3′ adaptor RA3_15N was joined to the 3′ end of RNA by enzymatic ligation. The adaptor has: (i) 5′ rApp modification for efficient and specific ligation by the truncated T4 RNA ligase 2, (ii) delimiter sequence to be used in bioinformatics analyses to exclude RT and PCR artifacts (CTGAC, highlighted in violet), (iii) unique 15N barcode for individual transcript barcoding (highlighted in green), (iv) anchor sequence to pair with the reverse transcription primer (underlined) and (v) dideoxyC on the 3′ end to prevent concatamer formation. The RNA ligated to the adaptor sequence was purified from excess adaptor and reverse transcription was performed with the RT primer, which is compatible with Illumina sequencing and has: (i) sequences to base-pair with the adaptor (underlined), (ii) 6-nucleotide barcode for sample barcoding (highlighted in red), (iii) sequences that base pair with the universal outer primer for nested PCR (blue). Libraries were generated by nested PCR with 2 outer forward primers (F1 and F2) and a single universal reverse primer (uni rev). PCR amplicons of first and second PCRs were purified from excess primers on AmPure beads (Agencourt) before beginning the next step. (B) Flowchart of the bioinformatics approach to 3′ RACE-seq data analysis. The procedure starts at the top. Datasets are shown in rectangles. Software used is depicted in hexagons.

    Journal: Cell

    Article Title: Uridylation by TUT4/7 Restricts Retrotransposition of Human LINE-1s

    doi: 10.1016/j.cell.2018.07.022

    Figure Lengend Snippet: Graphical Visualization of the 3′ RACE-Seq Approach, Related to Figure 2 (A) Graphical representation of 3′ RACE-seq library preparation and the oligonucleotides used. First, the 3′ adaptor RA3_15N was joined to the 3′ end of RNA by enzymatic ligation. The adaptor has: (i) 5′ rApp modification for efficient and specific ligation by the truncated T4 RNA ligase 2, (ii) delimiter sequence to be used in bioinformatics analyses to exclude RT and PCR artifacts (CTGAC, highlighted in violet), (iii) unique 15N barcode for individual transcript barcoding (highlighted in green), (iv) anchor sequence to pair with the reverse transcription primer (underlined) and (v) dideoxyC on the 3′ end to prevent concatamer formation. The RNA ligated to the adaptor sequence was purified from excess adaptor and reverse transcription was performed with the RT primer, which is compatible with Illumina sequencing and has: (i) sequences to base-pair with the adaptor (underlined), (ii) 6-nucleotide barcode for sample barcoding (highlighted in red), (iii) sequences that base pair with the universal outer primer for nested PCR (blue). Libraries were generated by nested PCR with 2 outer forward primers (F1 and F2) and a single universal reverse primer (uni rev). PCR amplicons of first and second PCRs were purified from excess primers on AmPure beads (Agencourt) before beginning the next step. (B) Flowchart of the bioinformatics approach to 3′ RACE-seq data analysis. The procedure starts at the top. Datasets are shown in rectangles. Software used is depicted in hexagons.

    Article Snippet: The reactions were carried out in 20 μL with 1x T4 RNA ligase 2 truncated buffer (NEB) supplemented with PEG-8000 at 10% final concentration, 0.25 U/μl RiboLock inhibitor (Thermo Fisher Scientific), 3 pmol of the 5′ FAM-labeled 44-mer oligonucleotide RNA44 (Future Synthesis) and 300 U T4 RNA ligase 2 truncated (NEB) for 18h at 18°C.

    Techniques: Ligation, Modification, Sequencing, Polymerase Chain Reaction, Purification, Nested PCR, Generated, Software