1x pcr buffer  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher 1x pcr buffer
    1x Pcr Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 430 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/1x pcr buffer/product/Thermo Fisher
    Average 99 stars, based on 430 article reviews
    Price from $9.99 to $1999.99
    1x pcr buffer - by Bioz Stars, 2020-02
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: POPULATION GENETICS OF THE MOSQUITO CULEX PIPIENS PALLENS REVEALS SEX-LINKED ASYMMETRIC INTROGRESSION BY CULEX QUINQUEFASCIATUS
    Article Snippet: Clones were amplified with the sequencing primers M13F(-20) and M13R. .. Reactions were carried out in 50-μL volumes containing 0.75 μM of each primer, 1X PCR buffer (10 mM Tris-HCl pH 8.3, 50 mM KCl), 500 μM of each dNTP, and 1.5 units Taq polymerase (Applied Biosystems, Foster City, CA).

    Amplification:

    Article Title: POPULATION GENETICS OF THE MOSQUITO CULEX PIPIENS PALLENS REVEALS SEX-LINKED ASYMMETRIC INTROGRESSION BY CULEX QUINQUEFASCIATUS
    Article Snippet: .. The loci were multiplexed and amplified in 20-μL reactions containing 0.2 μM of each primer, 1X PCR buffer (10 mM Tris-HCl pH 8.3, 50 mM KCl), 200 μM of each dNTP, 250 μM MgCl2 , 150 μg/mL of bovine serum albumin, 0.5 units of Taq polymerase (Applied Biosystems, Foster City, CA), and approximately 6 ng of the DNA template. .. The amplification program consisted of one cycle of 94°C for 5 min, 30 cycles of 94°C for 30 sec, 52°C or 54°C (depending on primer, ( ) for 30 sec, 72°C for 30 sec, and one cycle of 72°C for 5 min. A positive control with the clone used to design the microsatellite primers and a water negative control were included in each batch of samples.

    Article Title: CCR2 Genetic Polymorphism And Its Potential Effect On HIV Acquisition In A Population Of Children Living In The Northern Region Of Cameroon
    Article Snippet: .. A 380 base pair (bp) fragment was amplified in a 25 μL volume reaction containing 0.2 μM of each primer, 1X PCR buffer containing MgCl2 , 200 μM of each dNTP (Thermo Scientific), 0.625 Units of Taq polymerase (Roche Diagnostic, One Lambda, USA) and 5 μL (2–5 ng) of genomic DNA. .. The reaction mix was subjected to amplification using the following conditions: initial denaturation at 95°C for 3min, followed by 40 cycles of denaturation at 94°C for 30S, annealing at 63°C for 30S, extension at 72°C for 30S and a final extension at 72°C for 10 min. A 10 μL volume of the PCR product was digested overnight using 5 Units of FokI restriction enzyme (New England Biolabs).

    Article Title: Association of CD28 and CTLA4 haplotypes with susceptibility to primary Sjögren′s syndrome in Mexican population, et al. Association of CD28 and CTLA4 haplotypes with susceptibility to primary Sjögren′s syndrome in Mexican population
    Article Snippet: The CTLA4 −319 C > T amplification conditions were: a total volume of 25 μL containing 100 ng of gDNA, 1X PCR Buffer, 1.0 mmol/L MgCl2 , 0.12 mmol/L of each primer and 0.625 U of Taq DNA polymerase (Invitrogen® , Thermo Scientific, California, USA). .. CTLA4 + 6230 G > A: a total volume of 25 μL containing 100 ng of gDNA, 1X PCR Buffer, 1.0 mmol/L MgCl2 , 0.24 mmol/L of each primer and 0.625 U of Taq DNA polymerase (Invitrogen® , Thermo Scientific, California, USA).

    Article Title: POPULATION GENETICS OF THE MOSQUITO CULEX PIPIENS PALLENS REVEALS SEX-LINKED ASYMMETRIC INTROGRESSION BY CULEX QUINQUEFASCIATUS
    Article Snippet: Clones were amplified with the sequencing primers M13F(-20) and M13R. .. Reactions were carried out in 50-μL volumes containing 0.75 μM of each primer, 1X PCR buffer (10 mM Tris-HCl pH 8.3, 50 mM KCl), 500 μM of each dNTP, and 1.5 units Taq polymerase (Applied Biosystems, Foster City, CA).

    Article Title: Association of CD28 and CTLA4 haplotypes with susceptibility to primary Sjögren′s syndrome in Mexican population, et al. Association of CD28 and CTLA4 haplotypes with susceptibility to primary Sjögren′s syndrome in Mexican population
    Article Snippet: The regions, which include CD28 polymorphisms, were amplified with the following primers: −372 G > A (rs35593994) forward 5′ TCCTTCTTT TCTTTTCTTTTCTTTTC, reverse 5′ CTGCAG CATTTCACACAGGA; IVS3 + 17 T > C (rs3116496) forward 5′ TTTTCTGGGTAAGAGAAGCAGCGC, reverse 5′ GAACCTACTCAAGCATGGGG. .. PCR conditions for CD28 ‐372 G > A polymorphism was: a total volume of 25 μL containing 100 ng of gDNA, 1X PCR Buffer, 1.5 mmol/L MgCl2 , 0.18 mmol/L of each primer and 0.625 U of Taq DNA polymerase (Invitrogen® , Thermo Scientific, California, USA).

    Article Title: Accelerated Telomere Shortening and Replicative Senescence in Human Fibroblasts Overexpressing Mutant and Wild Type Lamin A
    Article Snippet: Each reaction included 1X PCR buffer (Invitrogen, Carlsbad, CA), 0.2mM dNTPs, 0.4X SybrGreen (Molecular Probes, Eugene, OR), 2.5mM DTT, 1% DMSO, and 5ng of DNA. .. The telomere PCR used 0.8 units of Platinum Taq (Invitrogen, Carlsbad, CA), 1.5mM MgCl2 , 300nM of each primer (tel1b: CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT; tel2b: GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT) and 30 cycles of amplification at 95°C for 15 seconds and at 56°C for 60 seconds.

    Article Title: Molecular analysis of genetic diversity in population of Silybum marianum (L.) Gaertn in Egypt
    Article Snippet: The disc was added directly into 25 μl PCR reaction mix containing 25 mM MgCl2, 1X PCR buffer, 200 μM dNTPs (Applied Biosystems), 1 U of Taq DNA polymerase (Applied Biosystems, Ampli-Taq Gold), 2 pmole of each primer, and the leaf disc. .. Polymerase chain reaction was made for amplification of ISSR fingerprinting.

    Article Title: Novel approach reveals genomic landscapes of single-strand DNA breaks with nucleotide resolution in human cells
    Article Snippet: .. The eluted DNA was subjected to PCR amplification in 20 μl reaction volume containing: 1X PCR buffer, 0.4 µl of 10 mM dNTP mix (Invitrogen), 1 μl of each of the following two oligonucleotides P5G10 (AATGATACGGCGACCACCGAGAtctACACTCTTTCCCTACACGACGCTCTTCCGATCTGGGGGGGGGGHN) and P7T12 (CAAGCAGAAGACGGCATACGAGATcgtgatGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTTTTTTTTTTTTVN) each at 10 μM and 1U of Taq DNA polymerase (Tiangen). .. The PCR conditions were as follows: (1) initial denaturation at 94 °C for 3 min; (2) followed by 1 cycle of denaturation at 94 °C for 30 s, annealing at 55 °C for 1 min and extension at 72 °C for 1 min; (3) 1 cycle of denaturation at 94 °C for 30 s, annealing at 37 °C for 1 min and slow ramp at 2 °C per minute to 72 °C followed by 2 min incubation, followed by (4) 30 cycles at 94 °C for 30 s and extension at 72 °C for 1 min.

    Article Title: Transcriptional profile of primary astrocytes expressing ALS-linked mutant SOD1
    Article Snippet: PCRs were carried out in a 50 μl reaction volume containing 1 μl of cDNA, 20 pmoles of each specific primer, 18S primers (1:9 ratio), 200 μM dNTPs, 1.5 mM MgCl2 , 1.5 U of Platinium Taq and 1X PCR buffer (Invitrogen, CA, USA). .. The cycling parameters were as follows: 95°C, 30 sec; 55°C, 30 sec; 72°C, 30 sec, for 19 to 22 cycles depending on the specific linear range of each amplicon.

    Positive Control:

    Article Title: POPULATION GENETICS OF THE MOSQUITO CULEX PIPIENS PALLENS REVEALS SEX-LINKED ASYMMETRIC INTROGRESSION BY CULEX QUINQUEFASCIATUS
    Article Snippet: The loci were multiplexed and amplified in 20-μL reactions containing 0.2 μM of each primer, 1X PCR buffer (10 mM Tris-HCl pH 8.3, 50 mM KCl), 200 μM of each dNTP, 250 μM MgCl2 , 150 μg/mL of bovine serum albumin, 0.5 units of Taq polymerase (Applied Biosystems, Foster City, CA), and approximately 6 ng of the DNA template. .. The amplification program consisted of one cycle of 94°C for 5 min, 30 cycles of 94°C for 30 sec, 52°C or 54°C (depending on primer, ( ) for 30 sec, 72°C for 30 sec, and one cycle of 72°C for 5 min. A positive control with the clone used to design the microsatellite primers and a water negative control were included in each batch of samples.

    Polymerase Chain Reaction:

    Article Title: POPULATION GENETICS OF THE MOSQUITO CULEX PIPIENS PALLENS REVEALS SEX-LINKED ASYMMETRIC INTROGRESSION BY CULEX QUINQUEFASCIATUS
    Article Snippet: .. The loci were multiplexed and amplified in 20-μL reactions containing 0.2 μM of each primer, 1X PCR buffer (10 mM Tris-HCl pH 8.3, 50 mM KCl), 200 μM of each dNTP, 250 μM MgCl2 , 150 μg/mL of bovine serum albumin, 0.5 units of Taq polymerase (Applied Biosystems, Foster City, CA), and approximately 6 ng of the DNA template. .. The amplification program consisted of one cycle of 94°C for 5 min, 30 cycles of 94°C for 30 sec, 52°C or 54°C (depending on primer, ( ) for 30 sec, 72°C for 30 sec, and one cycle of 72°C for 5 min. A positive control with the clone used to design the microsatellite primers and a water negative control were included in each batch of samples.

    Article Title: SQSTM-1/p62 potentiates HTLV-1 Tax-mediated NF-κB activation through its ubiquitin binding function
    Article Snippet: .. A volume of 2 μl of cDNA was then used in a PCR reaction (25 µl reaction volume) containing 1X PCR buffer (Invitrogen), 0.4 μM of forward and reverse primers, 0.2 mM dNTP mix, 1.5 mM MgCl2 , and 0.5 U of Taq DNA polymerase (Invitrogen). .. The gapdh primers from the RevertAid First Strand cDNA Synthesis Kit were used to amplify gapdh cDNAs (496 bp).

    Article Title: Association of Protein Expression and Methylation of DAPK1 with Clinicopathological Features in Invasive Ductal Carcinoma Patients from Kashmir
    Article Snippet: .. The total 25 ml of PCR mix contained 2 ml of bisulfite-modified DNA, 1X PCR buffer, 2 mM MgCl2 , 200ng of each primer, 0.3 mM dNTPs (Fermentas life sciences, Inc. USA), and 1U of Taq polymerase (Fermentas life sciences, Inc. USA). .. PCR was carried out in Thermal cycler (Mastercycle, Ependroff) under the following conditions: 95°C for 10 min, followed by 35 cycles of 95°C for 1 min, 64°C for 30 sec, 72°C for 1 min a final extension at 72°C for 10.

    Article Title: CCR2 Genetic Polymorphism And Its Potential Effect On HIV Acquisition In A Population Of Children Living In The Northern Region Of Cameroon
    Article Snippet: .. A 380 base pair (bp) fragment was amplified in a 25 μL volume reaction containing 0.2 μM of each primer, 1X PCR buffer containing MgCl2 , 200 μM of each dNTP (Thermo Scientific), 0.625 Units of Taq polymerase (Roche Diagnostic, One Lambda, USA) and 5 μL (2–5 ng) of genomic DNA. .. The reaction mix was subjected to amplification using the following conditions: initial denaturation at 95°C for 3min, followed by 40 cycles of denaturation at 94°C for 30S, annealing at 63°C for 30S, extension at 72°C for 30S and a final extension at 72°C for 10 min. A 10 μL volume of the PCR product was digested overnight using 5 Units of FokI restriction enzyme (New England Biolabs).

    Article Title: Association of CD28 and CTLA4 haplotypes with susceptibility to primary Sjögren′s syndrome in Mexican population, et al. Association of CD28 and CTLA4 haplotypes with susceptibility to primary Sjögren′s syndrome in Mexican population
    Article Snippet: .. CTLA4 + 6230 G > A: a total volume of 25 μL containing 100 ng of gDNA, 1X PCR Buffer, 1.0 mmol/L MgCl2 , 0.24 mmol/L of each primer and 0.625 U of Taq DNA polymerase (Invitrogen® , Thermo Scientific, California, USA). .. 3U of NcoI enzyme (New England, BioLab® , Inc, Massachusetts, USA) was used for 1 hour to 37°C; fragments of 196 bp and 26 bp represent the polymorphic homozygous genotype (AA); 216 bp, 196 bp and 20 bp the heterozygous genotype (GA) and 216 bp fragment represent the wild homozygous genotype (GG).

    Article Title: POPULATION GENETICS OF THE MOSQUITO CULEX PIPIENS PALLENS REVEALS SEX-LINKED ASYMMETRIC INTROGRESSION BY CULEX QUINQUEFASCIATUS
    Article Snippet: .. Reactions were carried out in 50-μL volumes containing 0.75 μM of each primer, 1X PCR buffer (10 mM Tris-HCl pH 8.3, 50 mM KCl), 500 μM of each dNTP, and 1.5 units Taq polymerase (Applied Biosystems, Foster City, CA). .. The M13 product was cleaned using a QIAquick PCR Purification Kit (Qiagen, Valencia, CA) and digested with the restriction enzyme Mlu I (New England Biolabs, Beverly, MA) according to manufacturer’s instructions.

    Article Title: Epigenetic Effects of the Continuous Exposure to Peroxisome Proliferator WY-14,643 in Mouse Liver are Dependent upon Peroxisome Proliferator Activated Receptor ?
    Article Snippet: .. The single nucleotide extension reaction was performed in a 25 μl reaction mixture containing 1.0 μg DNA, 1X PCR buffer, 1.0 mM MgCl2 , 0.25 U AmpliTaq DNA polymerase (Applied Biosystems, Foster City, CA), 0.1 μl of [3 H]dCTP (57.4 Ci/mmol; Perkin Elmer, Boston, MA) and incubated at 56°C for 1 h. Samples were applied to DE-81 ion-exchange filters and washed three times with 0.5 M sodium phosphate buffer (pH 7.0) at room temperature. ..

    Article Title: Association of CD28 and CTLA4 haplotypes with susceptibility to primary Sjögren′s syndrome in Mexican population, et al. Association of CD28 and CTLA4 haplotypes with susceptibility to primary Sjögren′s syndrome in Mexican population
    Article Snippet: .. PCR conditions for CD28 ‐372 G > A polymorphism was: a total volume of 25 μL containing 100 ng of gDNA, 1X PCR Buffer, 1.5 mmol/L MgCl2 , 0.18 mmol/L of each primer and 0.625 U of Taq DNA polymerase (Invitrogen® , Thermo Scientific, California, USA). .. 3U of HinfI enzyme restriction (New England, BioLab® , Inc, Massachusetts, USA) was used for 1 hour to 37°C; fragments of 415 bp and 135 bp represent the wild homozygous genotype (GG); 550 bp, 415 bp and 135 bp the heterozygous genotype (GA) and 550 bp fragment represent the polymorphic homozygous genotype (AA).

    Article Title: Association of CD28 and CTLA4 haplotypes with susceptibility to primary Sjögren′s syndrome in Mexican population, et al. Association of CD28 and CTLA4 haplotypes with susceptibility to primary Sjögren′s syndrome in Mexican population
    Article Snippet: .. For CD28 IVS3 + 17 T > C polymorphism: 20 μL of total volume containing 100 ng of gDNA, 1X PCR Buffer, 1.5 mmol/L MgCl2 , 0.15 mmol/L of each primer and 0.625 U of Taq DNA polymerase (Invitrogen® , Thermo Scientific, California, USA). .. Genotypes were identified with 5U of AfeI enzyme (New England, BioLab® , Inc, Massachusetts, USA) for 1:30 hour to 37°C, 125 bp and 22 bp fragments represent the wild homozygous genotype (TT), 147 pb, 125 bp and 22 bp the heterozygous genotype (TC) and 147 bp fragment represent the polymorphic homozygous genotype (CC).

    Article Title: Molecular analysis of genetic diversity in population of Silybum marianum (L.) Gaertn in Egypt
    Article Snippet: .. The disc was added directly into 25 μl PCR reaction mix containing 25 mM MgCl2, 1X PCR buffer, 200 μM dNTPs (Applied Biosystems), 1 U of Taq DNA polymerase (Applied Biosystems, Ampli-Taq Gold), 2 pmole of each primer, and the leaf disc. .. Polymerase chain reaction was made for amplification of ISSR fingerprinting.

    Article Title: Evaluation of in vitro fertilization parameters and estrogen receptor alpha gene polymorphisms for women with unexplained infertility
    Article Snippet: .. The total volume of the polymerase chain reaction (PCR) reaction mixture was 50 μL and contained 0.2 mM dNTPs (MBI Fermentas, Vilnius, Lithuania), 2 mM MgCl2 , 1X PCR buffer (MBI Fermentas, Vilnius, Lithuania), 10 pmol of primers (MWG Biotech, Martinsried, Germany) and 1.5 U Taq DNA polymerase (MBI Fermentas, Vilnius, Lithuania). .. PCR was performed using Eppendorf thermal cycler (Eppendorf, Hamburg, Germany).

    Article Title: Novel approach reveals genomic landscapes of single-strand DNA breaks with nucleotide resolution in human cells
    Article Snippet: .. The eluted DNA was subjected to PCR amplification in 20 μl reaction volume containing: 1X PCR buffer, 0.4 µl of 10 mM dNTP mix (Invitrogen), 1 μl of each of the following two oligonucleotides P5G10 (AATGATACGGCGACCACCGAGAtctACACTCTTTCCCTACACGACGCTCTTCCGATCTGGGGGGGGGGHN) and P7T12 (CAAGCAGAAGACGGCATACGAGATcgtgatGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTTTTTTTTTTTTVN) each at 10 μM and 1U of Taq DNA polymerase (Tiangen). .. The PCR conditions were as follows: (1) initial denaturation at 94 °C for 3 min; (2) followed by 1 cycle of denaturation at 94 °C for 30 s, annealing at 55 °C for 1 min and extension at 72 °C for 1 min; (3) 1 cycle of denaturation at 94 °C for 30 s, annealing at 37 °C for 1 min and slow ramp at 2 °C per minute to 72 °C followed by 2 min incubation, followed by (4) 30 cycles at 94 °C for 30 s and extension at 72 °C for 1 min.

    Article Title: Transcriptional profile of primary astrocytes expressing ALS-linked mutant SOD1
    Article Snippet: .. PCRs were carried out in a 50 μl reaction volume containing 1 μl of cDNA, 20 pmoles of each specific primer, 18S primers (1:9 ratio), 200 μM dNTPs, 1.5 mM MgCl2 , 1.5 U of Platinium Taq and 1X PCR buffer (Invitrogen, CA, USA). .. The cycling parameters were as follows: 95°C, 30 sec; 55°C, 30 sec; 72°C, 30 sec, for 19 to 22 cycles depending on the specific linear range of each amplicon.

    TA Cloning:

    Article Title: POPULATION GENETICS OF THE MOSQUITO CULEX PIPIENS PALLENS REVEALS SEX-LINKED ASYMMETRIC INTROGRESSION BY CULEX QUINQUEFASCIATUS
    Article Snippet: The ACE locus of Cx. p. pallens was amplified using the PCR+1 protocol and cloned with a TOPO TA cloning kit (Invitrogen, Carlsbad, CA). .. Reactions were carried out in 50-μL volumes containing 0.75 μM of each primer, 1X PCR buffer (10 mM Tris-HCl pH 8.3, 50 mM KCl), 500 μM of each dNTP, and 1.5 units Taq polymerase (Applied Biosystems, Foster City, CA).

    Blocking Assay:

    Article Title: Novel approach reveals genomic landscapes of single-strand DNA breaks with nucleotide resolution in human cells
    Article Snippet: Five units of TdT (NEB) and 2 µl of 10 mM dCTP (Roche) were then added to denatured DNA to the total volume of 22 µl and incubated at 37 °C for 30 min. To block free 3′-OH ends, 2 µl of 10 mM ddCTP (Roche) was added to the tailing mix and incubated at 37 °C for additional 30 min, followed by incubation at 70 °C for 10 min to inactivate TdT. .. The eluted DNA was subjected to PCR amplification in 20 μl reaction volume containing: 1X PCR buffer, 0.4 µl of 10 mM dNTP mix (Invitrogen), 1 μl of each of the following two oligonucleotides P5G10 (AATGATACGGCGACCACCGAGAtctACACTCTTTCCCTACACGACGCTCTTCCGATCTGGGGGGGGGGHN) and P7T12 (CAAGCAGAAGACGGCATACGAGATcgtgatGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTTTTTTTTTTTTVN) each at 10 μM and 1U of Taq DNA polymerase (Tiangen).

    Real-time Polymerase Chain Reaction:

    Article Title: Accelerated Telomere Shortening and Replicative Senescence in Human Fibroblasts Overexpressing Mutant and Wild Type Lamin A
    Article Snippet: Quantitative PCR was performed with a Rotor-Gene 3000 (Corbett Research, Sydney, Australia) in a final volume of 20μl. .. Each reaction included 1X PCR buffer (Invitrogen, Carlsbad, CA), 0.2mM dNTPs, 0.4X SybrGreen (Molecular Probes, Eugene, OR), 2.5mM DTT, 1% DMSO, and 5ng of DNA.

    Incubation:

    Article Title: Epigenetic Effects of the Continuous Exposure to Peroxisome Proliferator WY-14,643 in Mouse Liver are Dependent upon Peroxisome Proliferator Activated Receptor ?
    Article Snippet: .. The single nucleotide extension reaction was performed in a 25 μl reaction mixture containing 1.0 μg DNA, 1X PCR buffer, 1.0 mM MgCl2 , 0.25 U AmpliTaq DNA polymerase (Applied Biosystems, Foster City, CA), 0.1 μl of [3 H]dCTP (57.4 Ci/mmol; Perkin Elmer, Boston, MA) and incubated at 56°C for 1 h. Samples were applied to DE-81 ion-exchange filters and washed three times with 0.5 M sodium phosphate buffer (pH 7.0) at room temperature. ..

    Article Title: Novel approach reveals genomic landscapes of single-strand DNA breaks with nucleotide resolution in human cells
    Article Snippet: Five units of TdT (NEB) and 2 µl of 10 mM dCTP (Roche) were then added to denatured DNA to the total volume of 22 µl and incubated at 37 °C for 30 min. To block free 3′-OH ends, 2 µl of 10 mM ddCTP (Roche) was added to the tailing mix and incubated at 37 °C for additional 30 min, followed by incubation at 70 °C for 10 min to inactivate TdT. .. The eluted DNA was subjected to PCR amplification in 20 μl reaction volume containing: 1X PCR buffer, 0.4 µl of 10 mM dNTP mix (Invitrogen), 1 μl of each of the following two oligonucleotides P5G10 (AATGATACGGCGACCACCGAGAtctACACTCTTTCCCTACACGACGCTCTTCCGATCTGGGGGGGGGGHN) and P7T12 (CAAGCAGAAGACGGCATACGAGATcgtgatGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTTTTTTTTTTTTVN) each at 10 μM and 1U of Taq DNA polymerase (Tiangen).

    Modification:

    Article Title: Association of Protein Expression and Methylation of DAPK1 with Clinicopathological Features in Invasive Ductal Carcinoma Patients from Kashmir
    Article Snippet: Modified DNA was subjected to MSP using specific primers for methylated sequences (sense 5’-GGATAGTCGGATCGAGTTAACGTC-3’ and antisense 5’-CCCTCCCAAACGCCGA- 3’) and for unmethylated sequences (sense 5’- GGATAGTTGGATTGAGTTAATGTC -3’ and antisense 5’- CAAATCCCTCCCAAACACCAA-3’), which generates polymerase chain reaction (PCR) products of 98 and 106 bp, respectively. .. The total 25 ml of PCR mix contained 2 ml of bisulfite-modified DNA, 1X PCR buffer, 2 mM MgCl2 , 200ng of each primer, 0.3 mM dNTPs (Fermentas life sciences, Inc. USA), and 1U of Taq polymerase (Fermentas life sciences, Inc. USA).

    Article Title: Association of CD28 and CTLA4 haplotypes with susceptibility to primary Sjögren′s syndrome in Mexican population, et al. Association of CD28 and CTLA4 haplotypes with susceptibility to primary Sjögren′s syndrome in Mexican population
    Article Snippet: Genomic DNA was extracted from total leukocytes of peripheral blood through Miller's modified technique. .. PCR conditions for CD28 ‐372 G > A polymorphism was: a total volume of 25 μL containing 100 ng of gDNA, 1X PCR Buffer, 1.5 mmol/L MgCl2 , 0.18 mmol/L of each primer and 0.625 U of Taq DNA polymerase (Invitrogen® , Thermo Scientific, California, USA).

    Transformation Assay:

    Article Title: Accelerated Telomere Shortening and Replicative Senescence in Human Fibroblasts Overexpressing Mutant and Wild Type Lamin A
    Article Snippet: Each reaction included 1X PCR buffer (Invitrogen, Carlsbad, CA), 0.2mM dNTPs, 0.4X SybrGreen (Molecular Probes, Eugene, OR), 2.5mM DTT, 1% DMSO, and 5ng of DNA. .. A four-point standard curve (2-fold serial dilutions from 10 to 1.25 ng DNA) was used to allow transformation of cycle threshold into nanograms of DNA.

    Countercurrent Chromatography:

    Article Title: Evaluation of in vitro fertilization parameters and estrogen receptor alpha gene polymorphisms for women with unexplained infertility
    Article Snippet: For the ESR 1 Pvu II and Xba I SNPs, the forward and reverse primers were: 5′-CTG CCA CCC TAT CTG TAT CTT TTC CTA TTC TCC-3′ and 5′-TCT TTC TCT GCC ACC CTG GCG TCG ATT ATC TGA-3′, respectively. .. The total volume of the polymerase chain reaction (PCR) reaction mixture was 50 μL and contained 0.2 mM dNTPs (MBI Fermentas, Vilnius, Lithuania), 2 mM MgCl2 , 1X PCR buffer (MBI Fermentas, Vilnius, Lithuania), 10 pmol of primers (MWG Biotech, Martinsried, Germany) and 1.5 U Taq DNA polymerase (MBI Fermentas, Vilnius, Lithuania).

    CpG Methylation Assay:

    Article Title: Epigenetic Effects of the Continuous Exposure to Peroxisome Proliferator WY-14,643 in Mouse Liver are Dependent upon Peroxisome Proliferator Activated Receptor ?
    Article Snippet: A second DNA aliquot (1 μg) was digested with methylation-insensitive iso-schizomer MspI, which cleaves CCGG sites in DNA regardless of CpG methylation status, to serve as a control for the digestion efficiency. .. The single nucleotide extension reaction was performed in a 25 μl reaction mixture containing 1.0 μg DNA, 1X PCR buffer, 1.0 mM MgCl2 , 0.25 U AmpliTaq DNA polymerase (Applied Biosystems, Foster City, CA), 0.1 μl of [3 H]dCTP (57.4 Ci/mmol; Perkin Elmer, Boston, MA) and incubated at 56°C for 1 h. Samples were applied to DE-81 ion-exchange filters and washed three times with 0.5 M sodium phosphate buffer (pH 7.0) at room temperature.

    DNA Sequencing:

    Article Title: Evaluation of in vitro fertilization parameters and estrogen receptor alpha gene polymorphisms for women with unexplained infertility
    Article Snippet: To confirm the genotypes obtained by PCR-RFLP method, DNA sequencing was carried out 5% of the samples using ABI Prism 310 Genetic Analyzer. (Applied Biosystems, Foster City, CA, USA). .. The (TA)n (rs3138774) repeat polymorphism in the ESR 1 promoter region was investigated by PCR using a FAM labelled forward primer 5′ GACGCATGATATACTTCACC 3′ and reverse primer 5′ GCAGAATCAAATATCCAGATG 3′ in a 25 ml PCR reaction containing: 1X PCR buffer, 20 μM of dNTP, 2 mM MgCl2 (MBI Fermentas, Vilnius, Lithuania), 20 pmol of primers (MWG Biotech, Martinsried, Germany) and 1 U Taq DNA polymerase (MBI Fermentas, Vilnius, Lithuania).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: SQSTM-1/p62 potentiates HTLV-1 Tax-mediated NF-κB activation through its ubiquitin binding function
    Article Snippet: Paragraph title: RT-PCR assay ... A volume of 2 μl of cDNA was then used in a PCR reaction (25 µl reaction volume) containing 1X PCR buffer (Invitrogen), 0.4 μM of forward and reverse primers, 0.2 mM dNTP mix, 1.5 mM MgCl2 , and 0.5 U of Taq DNA polymerase (Invitrogen).

    Imaging:

    Article Title: Evaluation of in vitro fertilization parameters and estrogen receptor alpha gene polymorphisms for women with unexplained infertility
    Article Snippet: The PCR products and the restriction fragments were separated in 2% agarose gel stained with ethidium bromide, and were visualized by Gel Logic 100 Imaging System (GL 100) (Kodak, NY, USA). .. The (TA)n (rs3138774) repeat polymorphism in the ESR 1 promoter region was investigated by PCR using a FAM labelled forward primer 5′ GACGCATGATATACTTCACC 3′ and reverse primer 5′ GCAGAATCAAATATCCAGATG 3′ in a 25 ml PCR reaction containing: 1X PCR buffer, 20 μM of dNTP, 2 mM MgCl2 (MBI Fermentas, Vilnius, Lithuania), 20 pmol of primers (MWG Biotech, Martinsried, Germany) and 1 U Taq DNA polymerase (MBI Fermentas, Vilnius, Lithuania).

    DNA Extraction:

    Article Title: Molecular analysis of genetic diversity in population of Silybum marianum (L.) Gaertn in Egypt
    Article Snippet: ISSR The ISSR fingerprinting was performed using a protocol, developed by Sigma (Biometera Uno thermal cycler, Germany), and does not involve DNA extraction. .. The disc was added directly into 25 μl PCR reaction mix containing 25 mM MgCl2, 1X PCR buffer, 200 μM dNTPs (Applied Biosystems), 1 U of Taq DNA polymerase (Applied Biosystems, Ampli-Taq Gold), 2 pmole of each primer, and the leaf disc.

    Article Title: Evaluation of in vitro fertilization parameters and estrogen receptor alpha gene polymorphisms for women with unexplained infertility
    Article Snippet: Genomic DNA was extracted from peripheral blood leukocytes using Invisorb DNA extraction kit (Invitek, Berlin, Germany). .. The total volume of the polymerase chain reaction (PCR) reaction mixture was 50 μL and contained 0.2 mM dNTPs (MBI Fermentas, Vilnius, Lithuania), 2 mM MgCl2 , 1X PCR buffer (MBI Fermentas, Vilnius, Lithuania), 10 pmol of primers (MWG Biotech, Martinsried, Germany) and 1.5 U Taq DNA polymerase (MBI Fermentas, Vilnius, Lithuania).

    Methylation:

    Article Title: Association of Protein Expression and Methylation of DAPK1 with Clinicopathological Features in Invasive Ductal Carcinoma Patients from Kashmir
    Article Snippet: Paragraph title: Methylation-specific PCR (MSP) ... The total 25 ml of PCR mix contained 2 ml of bisulfite-modified DNA, 1X PCR buffer, 2 mM MgCl2 , 200ng of each primer, 0.3 mM dNTPs (Fermentas life sciences, Inc. USA), and 1U of Taq polymerase (Fermentas life sciences, Inc. USA).

    Article Title: Epigenetic Effects of the Continuous Exposure to Peroxisome Proliferator WY-14,643 in Mouse Liver are Dependent upon Peroxisome Proliferator Activated Receptor ?
    Article Snippet: A second DNA aliquot (1 μg) was digested with methylation-insensitive iso-schizomer MspI, which cleaves CCGG sites in DNA regardless of CpG methylation status, to serve as a control for the digestion efficiency. .. The single nucleotide extension reaction was performed in a 25 μl reaction mixture containing 1.0 μg DNA, 1X PCR buffer, 1.0 mM MgCl2 , 0.25 U AmpliTaq DNA polymerase (Applied Biosystems, Foster City, CA), 0.1 μl of [3 H]dCTP (57.4 Ci/mmol; Perkin Elmer, Boston, MA) and incubated at 56°C for 1 h. Samples were applied to DE-81 ion-exchange filters and washed three times with 0.5 M sodium phosphate buffer (pH 7.0) at room temperature.

    Isolation:

    Article Title: Accelerated Telomere Shortening and Replicative Senescence in Human Fibroblasts Overexpressing Mutant and Wild Type Lamin A
    Article Snippet: Genomic DNA was isolated via the salting out method [ ]. .. Each reaction included 1X PCR buffer (Invitrogen, Carlsbad, CA), 0.2mM dNTPs, 0.4X SybrGreen (Molecular Probes, Eugene, OR), 2.5mM DTT, 1% DMSO, and 5ng of DNA.

    Size-exclusion Chromatography:

    Article Title: POPULATION GENETICS OF THE MOSQUITO CULEX PIPIENS PALLENS REVEALS SEX-LINKED ASYMMETRIC INTROGRESSION BY CULEX QUINQUEFASCIATUS
    Article Snippet: The loci were multiplexed and amplified in 20-μL reactions containing 0.2 μM of each primer, 1X PCR buffer (10 mM Tris-HCl pH 8.3, 50 mM KCl), 200 μM of each dNTP, 250 μM MgCl2 , 150 μg/mL of bovine serum albumin, 0.5 units of Taq polymerase (Applied Biosystems, Foster City, CA), and approximately 6 ng of the DNA template. .. The amplification program consisted of one cycle of 94°C for 5 min, 30 cycles of 94°C for 30 sec, 52°C or 54°C (depending on primer, ( ) for 30 sec, 72°C for 30 sec, and one cycle of 72°C for 5 min. A positive control with the clone used to design the microsatellite primers and a water negative control were included in each batch of samples.

    Article Title: Association of Protein Expression and Methylation of DAPK1 with Clinicopathological Features in Invasive Ductal Carcinoma Patients from Kashmir
    Article Snippet: The total 25 ml of PCR mix contained 2 ml of bisulfite-modified DNA, 1X PCR buffer, 2 mM MgCl2 , 200ng of each primer, 0.3 mM dNTPs (Fermentas life sciences, Inc. USA), and 1U of Taq polymerase (Fermentas life sciences, Inc. USA). .. PCR was carried out in Thermal cycler (Mastercycle, Ependroff) under the following conditions: 95°C for 10 min, followed by 35 cycles of 95°C for 1 min, 64°C for 30 sec, 72°C for 1 min a final extension at 72°C for 10.

    Article Title: POPULATION GENETICS OF THE MOSQUITO CULEX PIPIENS PALLENS REVEALS SEX-LINKED ASYMMETRIC INTROGRESSION BY CULEX QUINQUEFASCIATUS
    Article Snippet: The amplification program consisted of 95°C for 2 min, 30 cycles of 95°C for 40 sec, 54°C for 30 sec, 72°C for 1 min, followed by 72°C for 7 min. Twenty microliters of the PCR product were used in a new 50-μl reaction for one additional cycle (the PCR+1 step, times and temperatures identical to those above) with 2.5 μM of a third primer F1457MluI (5′-ACGCGTGAGGAGATGTGGAATCCCAA-3′) with an extra 5μl of 1 X Easy-A buffer, additional dNTPs (to 500μM), and 2.5 units of Easy-A. .. Reactions were carried out in 50-μL volumes containing 0.75 μM of each primer, 1X PCR buffer (10 mM Tris-HCl pH 8.3, 50 mM KCl), 500 μM of each dNTP, and 1.5 units Taq polymerase (Applied Biosystems, Foster City, CA).

    Article Title: Evaluation of in vitro fertilization parameters and estrogen receptor alpha gene polymorphisms for women with unexplained infertility
    Article Snippet: The (TA)n (rs3138774) repeat polymorphism in the ESR 1 promoter region was investigated by PCR using a FAM labelled forward primer 5′ GACGCATGATATACTTCACC 3′ and reverse primer 5′ GCAGAATCAAATATCCAGATG 3′ in a 25 ml PCR reaction containing: 1X PCR buffer, 20 μM of dNTP, 2 mM MgCl2 (MBI Fermentas, Vilnius, Lithuania), 20 pmol of primers (MWG Biotech, Martinsried, Germany) and 1 U Taq DNA polymerase (MBI Fermentas, Vilnius, Lithuania). .. Following an initial denaturation step (5 min at 94°C), samples were subjected to 30 cycles of PCR at 94°C for 30 sec, 62°C for 1 min, and 72°C for 1 min with a final extension of 5 min at 72°C.

    Article Title: Evaluation of in vitro fertilization parameters and estrogen receptor alpha gene polymorphisms for women with unexplained infertility
    Article Snippet: The total volume of the polymerase chain reaction (PCR) reaction mixture was 50 μL and contained 0.2 mM dNTPs (MBI Fermentas, Vilnius, Lithuania), 2 mM MgCl2 , 1X PCR buffer (MBI Fermentas, Vilnius, Lithuania), 10 pmol of primers (MWG Biotech, Martinsried, Germany) and 1.5 U Taq DNA polymerase (MBI Fermentas, Vilnius, Lithuania). .. Following an initial denaturation step (5 min at 94°C), samples were subjected to 30 cycles of PCR at 94°C for 30 sec, 62°C for 1 min, and 72°C for 1.5 min with a final extension of 5 min at 72°C.

    Article Title: Transcriptional profile of primary astrocytes expressing ALS-linked mutant SOD1
    Article Snippet: PCRs were carried out in a 50 μl reaction volume containing 1 μl of cDNA, 20 pmoles of each specific primer, 18S primers (1:9 ratio), 200 μM dNTPs, 1.5 mM MgCl2 , 1.5 U of Platinium Taq and 1X PCR buffer (Invitrogen, CA, USA). .. The cycling parameters were as follows: 95°C, 30 sec; 55°C, 30 sec; 72°C, 30 sec, for 19 to 22 cycles depending on the specific linear range of each amplicon.

    Purification:

    Article Title: POPULATION GENETICS OF THE MOSQUITO CULEX PIPIENS PALLENS REVEALS SEX-LINKED ASYMMETRIC INTROGRESSION BY CULEX QUINQUEFASCIATUS
    Article Snippet: Reactions were carried out in 50-μL volumes containing 0.75 μM of each primer, 1X PCR buffer (10 mM Tris-HCl pH 8.3, 50 mM KCl), 500 μM of each dNTP, and 1.5 units Taq polymerase (Applied Biosystems, Foster City, CA). .. The M13 product was cleaned using a QIAquick PCR Purification Kit (Qiagen, Valencia, CA) and digested with the restriction enzyme Mlu I (New England Biolabs, Beverly, MA) according to manufacturer’s instructions.

    Article Title: Novel approach reveals genomic landscapes of single-strand DNA breaks with nucleotide resolution in human cells
    Article Snippet: Library construction: the polyC-tailed DNA was purified with 2X volume of VAHTS beads, eluted in 15.2 μl water and used in its entirety for the library construction as follows. .. The eluted DNA was subjected to PCR amplification in 20 μl reaction volume containing: 1X PCR buffer, 0.4 µl of 10 mM dNTP mix (Invitrogen), 1 μl of each of the following two oligonucleotides P5G10 (AATGATACGGCGACCACCGAGAtctACACTCTTTCCCTACACGACGCTCTTCCGATCTGGGGGGGGGGHN) and P7T12 (CAAGCAGAAGACGGCATACGAGATcgtgatGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTTTTTTTTTTTTVN) each at 10 μM and 1U of Taq DNA polymerase (Tiangen).

    Sequencing:

    Article Title: POPULATION GENETICS OF THE MOSQUITO CULEX PIPIENS PALLENS REVEALS SEX-LINKED ASYMMETRIC INTROGRESSION BY CULEX QUINQUEFASCIATUS
    Article Snippet: Clones were amplified with the sequencing primers M13F(-20) and M13R. .. Reactions were carried out in 50-μL volumes containing 0.75 μM of each primer, 1X PCR buffer (10 mM Tris-HCl pH 8.3, 50 mM KCl), 500 μM of each dNTP, and 1.5 units Taq polymerase (Applied Biosystems, Foster City, CA).

    Quantitative RT-PCR:

    Article Title: Transcriptional profile of primary astrocytes expressing ALS-linked mutant SOD1
    Article Snippet: Paragraph title: Relative quantitative RT-PCR ... PCRs were carried out in a 50 μl reaction volume containing 1 μl of cDNA, 20 pmoles of each specific primer, 18S primers (1:9 ratio), 200 μM dNTPs, 1.5 mM MgCl2 , 1.5 U of Platinium Taq and 1X PCR buffer (Invitrogen, CA, USA).

    Salting Out:

    Article Title: Accelerated Telomere Shortening and Replicative Senescence in Human Fibroblasts Overexpressing Mutant and Wild Type Lamin A
    Article Snippet: Genomic DNA was isolated via the salting out method [ ]. .. Each reaction included 1X PCR buffer (Invitrogen, Carlsbad, CA), 0.2mM dNTPs, 0.4X SybrGreen (Molecular Probes, Eugene, OR), 2.5mM DTT, 1% DMSO, and 5ng of DNA.

    Software:

    Article Title: Association of Protein Expression and Methylation of DAPK1 with Clinicopathological Features in Invasive Ductal Carcinoma Patients from Kashmir
    Article Snippet: The total 25 ml of PCR mix contained 2 ml of bisulfite-modified DNA, 1X PCR buffer, 2 mM MgCl2 , 200ng of each primer, 0.3 mM dNTPs (Fermentas life sciences, Inc. USA), and 1U of Taq polymerase (Fermentas life sciences, Inc. USA). .. From each PCR reaction, 8 μl was loaded onto a 3% agarose gel, stained with ethidium bromide and visualized under UV illumination and photographed with Alpha Imager 1,220 v5.5 Camera software.

    Electron Paramagnetic Resonance:

    Article Title: Evaluation of in vitro fertilization parameters and estrogen receptor alpha gene polymorphisms for women with unexplained infertility
    Article Snippet: .. The (TA)n (rs3138774) repeat polymorphism in the ESR 1 promoter region was investigated by PCR using a FAM labelled forward primer 5′ GACGCATGATATACTTCACC 3′ and reverse primer 5′ GCAGAATCAAATATCCAGATG 3′ in a 25 ml PCR reaction containing: 1X PCR buffer, 20 μM of dNTP, 2 mM MgCl2 (MBI Fermentas, Vilnius, Lithuania), 20 pmol of primers (MWG Biotech, Martinsried, Germany) and 1 U Taq DNA polymerase (MBI Fermentas, Vilnius, Lithuania). ..

    Article Title: Evaluation of in vitro fertilization parameters and estrogen receptor alpha gene polymorphisms for women with unexplained infertility
    Article Snippet: For the ESR 1 Pvu II and Xba I SNPs, the forward and reverse primers were: 5′-CTG CCA CCC TAT CTG TAT CTT TTC CTA TTC TCC-3′ and 5′-TCT TTC TCT GCC ACC CTG GCG TCG ATT ATC TGA-3′, respectively. .. The total volume of the polymerase chain reaction (PCR) reaction mixture was 50 μL and contained 0.2 mM dNTPs (MBI Fermentas, Vilnius, Lithuania), 2 mM MgCl2 , 1X PCR buffer (MBI Fermentas, Vilnius, Lithuania), 10 pmol of primers (MWG Biotech, Martinsried, Germany) and 1.5 U Taq DNA polymerase (MBI Fermentas, Vilnius, Lithuania).

    Negative Control:

    Article Title: POPULATION GENETICS OF THE MOSQUITO CULEX PIPIENS PALLENS REVEALS SEX-LINKED ASYMMETRIC INTROGRESSION BY CULEX QUINQUEFASCIATUS
    Article Snippet: The loci were multiplexed and amplified in 20-μL reactions containing 0.2 μM of each primer, 1X PCR buffer (10 mM Tris-HCl pH 8.3, 50 mM KCl), 200 μM of each dNTP, 250 μM MgCl2 , 150 μg/mL of bovine serum albumin, 0.5 units of Taq polymerase (Applied Biosystems, Foster City, CA), and approximately 6 ng of the DNA template. .. The amplification program consisted of one cycle of 94°C for 5 min, 30 cycles of 94°C for 30 sec, 52°C or 54°C (depending on primer, ( ) for 30 sec, 72°C for 30 sec, and one cycle of 72°C for 5 min. A positive control with the clone used to design the microsatellite primers and a water negative control were included in each batch of samples.

    Agarose Gel Electrophoresis:

    Article Title: Association of Protein Expression and Methylation of DAPK1 with Clinicopathological Features in Invasive Ductal Carcinoma Patients from Kashmir
    Article Snippet: The total 25 ml of PCR mix contained 2 ml of bisulfite-modified DNA, 1X PCR buffer, 2 mM MgCl2 , 200ng of each primer, 0.3 mM dNTPs (Fermentas life sciences, Inc. USA), and 1U of Taq polymerase (Fermentas life sciences, Inc. USA). .. From each PCR reaction, 8 μl was loaded onto a 3% agarose gel, stained with ethidium bromide and visualized under UV illumination and photographed with Alpha Imager 1,220 v5.5 Camera software.

    Article Title: CCR2 Genetic Polymorphism And Its Potential Effect On HIV Acquisition In A Population Of Children Living In The Northern Region Of Cameroon
    Article Snippet: A 380 base pair (bp) fragment was amplified in a 25 μL volume reaction containing 0.2 μM of each primer, 1X PCR buffer containing MgCl2 , 200 μM of each dNTP (Thermo Scientific), 0.625 Units of Taq polymerase (Roche Diagnostic, One Lambda, USA) and 5 μL (2–5 ng) of genomic DNA. .. The digested product was separated on 2% agarose gel, stained with ethidium bromide and visualized under UV light, then photographed.

    Article Title: POPULATION GENETICS OF THE MOSQUITO CULEX PIPIENS PALLENS REVEALS SEX-LINKED ASYMMETRIC INTROGRESSION BY CULEX QUINQUEFASCIATUS
    Article Snippet: Reactions were carried out in 50-μL volumes containing 0.75 μM of each primer, 1X PCR buffer (10 mM Tris-HCl pH 8.3, 50 mM KCl), 500 μM of each dNTP, and 1.5 units Taq polymerase (Applied Biosystems, Foster City, CA). .. The digestion product was electrophoresed on 1% agarose gel to detect clones that contained the cut site from the PCR+1 amplification step.

    Article Title: Evaluation of in vitro fertilization parameters and estrogen receptor alpha gene polymorphisms for women with unexplained infertility
    Article Snippet: The PCR products and the restriction fragments were separated in 2% agarose gel stained with ethidium bromide, and were visualized by Gel Logic 100 Imaging System (GL 100) (Kodak, NY, USA). .. The (TA)n (rs3138774) repeat polymorphism in the ESR 1 promoter region was investigated by PCR using a FAM labelled forward primer 5′ GACGCATGATATACTTCACC 3′ and reverse primer 5′ GCAGAATCAAATATCCAGATG 3′ in a 25 ml PCR reaction containing: 1X PCR buffer, 20 μM of dNTP, 2 mM MgCl2 (MBI Fermentas, Vilnius, Lithuania), 20 pmol of primers (MWG Biotech, Martinsried, Germany) and 1 U Taq DNA polymerase (MBI Fermentas, Vilnius, Lithuania).

    Article Title: Molecular analysis of genetic diversity in population of Silybum marianum (L.) Gaertn in Egypt
    Article Snippet: The disc was added directly into 25 μl PCR reaction mix containing 25 mM MgCl2, 1X PCR buffer, 200 μM dNTPs (Applied Biosystems), 1 U of Taq DNA polymerase (Applied Biosystems, Ampli-Taq Gold), 2 pmole of each primer, and the leaf disc. .. A total of 16 ISSR primers were used and only 10 primers produced a clear readable profile (Table ) The PCR products of RAPD were separated in 1.5% agarose gel containing 0.5 μg/ml ethidium bromide using a submarine EC370 Minicell and an EC105 power supply (EC Apparatus Corporation, USA).

    DNA Methylation Assay:

    Article Title: Association of Protein Expression and Methylation of DAPK1 with Clinicopathological Features in Invasive Ductal Carcinoma Patients from Kashmir
    Article Snippet: Briefly, extracted DNA was subjected to sodium bisulfite modification using EZ DNA Methylation™ Kit (Zymo Research, USA) according to manufactures protocol. .. The total 25 ml of PCR mix contained 2 ml of bisulfite-modified DNA, 1X PCR buffer, 2 mM MgCl2 , 200ng of each primer, 0.3 mM dNTPs (Fermentas life sciences, Inc. USA), and 1U of Taq polymerase (Fermentas life sciences, Inc. USA).

    Article Title: Epigenetic Effects of the Continuous Exposure to Peroxisome Proliferator WY-14,643 in Mouse Liver are Dependent upon Peroxisome Proliferator Activated Receptor ?
    Article Snippet: Paragraph title: Global DNA methylation analysis ... The single nucleotide extension reaction was performed in a 25 μl reaction mixture containing 1.0 μg DNA, 1X PCR buffer, 1.0 mM MgCl2 , 0.25 U AmpliTaq DNA polymerase (Applied Biosystems, Foster City, CA), 0.1 μl of [3 H]dCTP (57.4 Ci/mmol; Perkin Elmer, Boston, MA) and incubated at 56°C for 1 h. Samples were applied to DE-81 ion-exchange filters and washed three times with 0.5 M sodium phosphate buffer (pH 7.0) at room temperature.

    Produced:

    Article Title: POPULATION GENETICS OF THE MOSQUITO CULEX PIPIENS PALLENS REVEALS SEX-LINKED ASYMMETRIC INTROGRESSION BY CULEX QUINQUEFASCIATUS
    Article Snippet: Reactions were carried out in 50-μL volumes containing 0.75 μM of each primer, 1X PCR buffer (10 mM Tris-HCl pH 8.3, 50 mM KCl), 500 μM of each dNTP, and 1.5 units Taq polymerase (Applied Biosystems, Foster City, CA). .. Only clones with the cut site (less than 30% of the digested clones) were sequenced since it ensured they were produced during the last PCR step using the third primer and therefore did not result from priming by partially extended DNA fragments, which can lead to PCR cloning artifacts.

    Article Title: Molecular analysis of genetic diversity in population of Silybum marianum (L.) Gaertn in Egypt
    Article Snippet: The disc was added directly into 25 μl PCR reaction mix containing 25 mM MgCl2, 1X PCR buffer, 200 μM dNTPs (Applied Biosystems), 1 U of Taq DNA polymerase (Applied Biosystems, Ampli-Taq Gold), 2 pmole of each primer, and the leaf disc. .. A total of 16 ISSR primers were used and only 10 primers produced a clear readable profile (Table ) The PCR products of RAPD were separated in 1.5% agarose gel containing 0.5 μg/ml ethidium bromide using a submarine EC370 Minicell and an EC105 power supply (EC Apparatus Corporation, USA).

    Concentration Assay:

    Article Title: Novel approach reveals genomic landscapes of single-strand DNA breaks with nucleotide resolution in human cells
    Article Snippet: The eluted DNA was subjected to PCR amplification in 20 μl reaction volume containing: 1X PCR buffer, 0.4 µl of 10 mM dNTP mix (Invitrogen), 1 μl of each of the following two oligonucleotides P5G10 (AATGATACGGCGACCACCGAGAtctACACTCTTTCCCTACACGACGCTCTTCCGATCTGGGGGGGGGGHN) and P7T12 (CAAGCAGAAGACGGCATACGAGATcgtgatGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTTTTTTTTTTTTVN) each at 10 μM and 1U of Taq DNA polymerase (Tiangen). .. The concentration of DNA was measured using Qubit 3.0 fluorometer and “dsDNA HS Assay” kit (Thermo Fisher Scientific).

    CTG Assay:

    Article Title: Evaluation of in vitro fertilization parameters and estrogen receptor alpha gene polymorphisms for women with unexplained infertility
    Article Snippet: For the ESR 1 Pvu II and Xba I SNPs, the forward and reverse primers were: 5′-CTG CCA CCC TAT CTG TAT CTT TTC CTA TTC TCC-3′ and 5′-TCT TTC TCT GCC ACC CTG GCG TCG ATT ATC TGA-3′, respectively. .. The total volume of the polymerase chain reaction (PCR) reaction mixture was 50 μL and contained 0.2 mM dNTPs (MBI Fermentas, Vilnius, Lithuania), 2 mM MgCl2 , 1X PCR buffer (MBI Fermentas, Vilnius, Lithuania), 10 pmol of primers (MWG Biotech, Martinsried, Germany) and 1.5 U Taq DNA polymerase (MBI Fermentas, Vilnius, Lithuania).

    Staining:

    Article Title: Association of Protein Expression and Methylation of DAPK1 with Clinicopathological Features in Invasive Ductal Carcinoma Patients from Kashmir
    Article Snippet: The total 25 ml of PCR mix contained 2 ml of bisulfite-modified DNA, 1X PCR buffer, 2 mM MgCl2 , 200ng of each primer, 0.3 mM dNTPs (Fermentas life sciences, Inc. USA), and 1U of Taq polymerase (Fermentas life sciences, Inc. USA). .. From each PCR reaction, 8 μl was loaded onto a 3% agarose gel, stained with ethidium bromide and visualized under UV illumination and photographed with Alpha Imager 1,220 v5.5 Camera software.

    Article Title: CCR2 Genetic Polymorphism And Its Potential Effect On HIV Acquisition In A Population Of Children Living In The Northern Region Of Cameroon
    Article Snippet: A 380 base pair (bp) fragment was amplified in a 25 μL volume reaction containing 0.2 μM of each primer, 1X PCR buffer containing MgCl2 , 200 μM of each dNTP (Thermo Scientific), 0.625 Units of Taq polymerase (Roche Diagnostic, One Lambda, USA) and 5 μL (2–5 ng) of genomic DNA. .. The digested product was separated on 2% agarose gel, stained with ethidium bromide and visualized under UV light, then photographed.

    Article Title: Evaluation of in vitro fertilization parameters and estrogen receptor alpha gene polymorphisms for women with unexplained infertility
    Article Snippet: The PCR products and the restriction fragments were separated in 2% agarose gel stained with ethidium bromide, and were visualized by Gel Logic 100 Imaging System (GL 100) (Kodak, NY, USA). .. The (TA)n (rs3138774) repeat polymorphism in the ESR 1 promoter region was investigated by PCR using a FAM labelled forward primer 5′ GACGCATGATATACTTCACC 3′ and reverse primer 5′ GCAGAATCAAATATCCAGATG 3′ in a 25 ml PCR reaction containing: 1X PCR buffer, 20 μM of dNTP, 2 mM MgCl2 (MBI Fermentas, Vilnius, Lithuania), 20 pmol of primers (MWG Biotech, Martinsried, Germany) and 1 U Taq DNA polymerase (MBI Fermentas, Vilnius, Lithuania).

    Article Title: Transcriptional profile of primary astrocytes expressing ALS-linked mutant SOD1
    Article Snippet: PCRs were carried out in a 50 μl reaction volume containing 1 μl of cDNA, 20 pmoles of each specific primer, 18S primers (1:9 ratio), 200 μM dNTPs, 1.5 mM MgCl2 , 1.5 U of Platinium Taq and 1X PCR buffer (Invitrogen, CA, USA). .. The amplification products were run in non-denaturing 6% polyacrylamide gels and stained with SYBR Gold Nucleic Acid Gel Stain (Molecular Probes, OR, USA).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 78
    Thermo Fisher anti gpc1
    Tumor stage-specific analysis a, Table associated with receiver Operating Characteristic (ROC) curve analysis depicted in . b–f , ROC curve analysis for percent <t>GPC1</t> + crExos (red line), CA 19-9 serum levels (blue scattered line), exosomes concentration (black line) and exosomes size (scattered black line) in patients with carcinoma in situ (CIS) or stage I pancreatic cancer (n=5) (a), stage IIa pancreatic cancer (n=18) (b), stage IIb pancreatic cancer (n=117) (c), stage III pancreatic cancer (n=11) (d), and stage IV pancreas cancer (n=41) (e), compared to control (healthy donors (n=100) and patients with a benign pancreatic disease (n=26), total n=126). g . AUC: Area under the curve, CI: confidence interval. Figure 1f
    Anti Gpc1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 78/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti gpc1/product/Thermo Fisher
    Average 78 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    anti gpc1 - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    99
    Thermo Fisher pcr buffer
    <t>PCR</t> and RT-PCR of IL-17 cytokine family members in knee joint tissues at day 2 of AIA. ( a ) Representative PCR-ScreenTape (Agilent 2200 TapeStation) of IL-17 cytokine family members in tissues of WT and IL-17AKO mice. PCR analysis does not give information about expression quantity. Upper (magenta) and lower (green) markers are used as internal references to determine the molecular weight size of the sample. <t>DNA</t> ladder (25–1500 bp) on the left. GAPDH (Glyceraldehyde 3-phosphate dehydrogenase) serves as a housekeeping control gene. ( b ) Quantitative reverse transcriptase (RT)-PCR in tissues of sympathectomised IL-17AKO mice and IL-17AKO AIA control mice (n = 5 per group). mRNA level after sympathectomy are given in relation to non-sympathectomised control mice. Sympathectomy significantly (p = 0.012) decreases IL-17D-mRNA. Values are mean ± SEM. *p
    Pcr Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 198 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr buffer/product/Thermo Fisher
    Average 99 stars, based on 198 article reviews
    Price from $9.99 to $1999.99
    pcr buffer - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    91
    Thermo Fisher 1x hot start pcr buffer
    <t>PCR</t> and RT-PCR of IL-17 cytokine family members in knee joint tissues at day 2 of AIA. ( a ) Representative PCR-ScreenTape (Agilent 2200 TapeStation) of IL-17 cytokine family members in tissues of WT and IL-17AKO mice. PCR analysis does not give information about expression quantity. Upper (magenta) and lower (green) markers are used as internal references to determine the molecular weight size of the sample. <t>DNA</t> ladder (25–1500 bp) on the left. GAPDH (Glyceraldehyde 3-phosphate dehydrogenase) serves as a housekeeping control gene. ( b ) Quantitative reverse transcriptase (RT)-PCR in tissues of sympathectomised IL-17AKO mice and IL-17AKO AIA control mice (n = 5 per group). mRNA level after sympathectomy are given in relation to non-sympathectomised control mice. Sympathectomy significantly (p = 0.012) decreases IL-17D-mRNA. Values are mean ± SEM. *p
    1x Hot Start Pcr Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/1x hot start pcr buffer/product/Thermo Fisher
    Average 91 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    1x hot start pcr buffer - by Bioz Stars, 2020-02
    91/100 stars
      Buy from Supplier

    Image Search Results


    Tumor stage-specific analysis a, Table associated with receiver Operating Characteristic (ROC) curve analysis depicted in . b–f , ROC curve analysis for percent GPC1 + crExos (red line), CA 19-9 serum levels (blue scattered line), exosomes concentration (black line) and exosomes size (scattered black line) in patients with carcinoma in situ (CIS) or stage I pancreatic cancer (n=5) (a), stage IIa pancreatic cancer (n=18) (b), stage IIb pancreatic cancer (n=117) (c), stage III pancreatic cancer (n=11) (d), and stage IV pancreas cancer (n=41) (e), compared to control (healthy donors (n=100) and patients with a benign pancreatic disease (n=26), total n=126). g . AUC: Area under the curve, CI: confidence interval. Figure 1f

    Journal: Nature

    Article Title: Glypican1 identifies cancer exosomes and facilitates early detection of cancer

    doi: 10.1038/nature14581

    Figure Lengend Snippet: Tumor stage-specific analysis a, Table associated with receiver Operating Characteristic (ROC) curve analysis depicted in . b–f , ROC curve analysis for percent GPC1 + crExos (red line), CA 19-9 serum levels (blue scattered line), exosomes concentration (black line) and exosomes size (scattered black line) in patients with carcinoma in situ (CIS) or stage I pancreatic cancer (n=5) (a), stage IIa pancreatic cancer (n=18) (b), stage IIb pancreatic cancer (n=117) (c), stage III pancreatic cancer (n=11) (d), and stage IV pancreas cancer (n=41) (e), compared to control (healthy donors (n=100) and patients with a benign pancreatic disease (n=26), total n=126). g . AUC: Area under the curve, CI: confidence interval. Figure 1f

    Article Snippet: Exosomes-bound beads were washed 1 time in 1X PBS/2% BSA and centrifuge for 1 min at 10,000 rpm, blocked with 10% BSA with rotation at room temperature for 30 min, washed a second time in 1X PBS/2% BSA and centrifuged for 1 min at 10,000 rpm, and incubated with anti-GPC1 (PIPA528055, Thermo-Scientific, 3 μl of antibody in 20 μl of 2%BSA/1X PBS) during 30 min rotating at 4°C.

    Techniques: Concentration Assay, In Situ

    GPC1 + crExos is a non-invasive biomarker for pancreas cancer a , Percent beads with GPC1 + crExos in healthy donors (n=100), breast cancer patients (n=32) and patients with PDAC (n=190; ANOVA, post-hoc Tamhane T 2 , **** P

    Journal: Nature

    Article Title: Glypican1 identifies cancer exosomes and facilitates early detection of cancer

    doi: 10.1038/nature14581

    Figure Lengend Snippet: GPC1 + crExos is a non-invasive biomarker for pancreas cancer a , Percent beads with GPC1 + crExos in healthy donors (n=100), breast cancer patients (n=32) and patients with PDAC (n=190; ANOVA, post-hoc Tamhane T 2 , **** P

    Article Snippet: Exosomes-bound beads were washed 1 time in 1X PBS/2% BSA and centrifuge for 1 min at 10,000 rpm, blocked with 10% BSA with rotation at room temperature for 30 min, washed a second time in 1X PBS/2% BSA and centrifuged for 1 min at 10,000 rpm, and incubated with anti-GPC1 (PIPA528055, Thermo-Scientific, 3 μl of antibody in 20 μl of 2%BSA/1X PBS) during 30 min rotating at 4°C.

    Techniques: Biomarker Assay

    Exosomes isolation a , Exosomes concentration and size distribution by NanoSight® analysis of culture supernatant from NIH/3T3, MCF10A, HDF, MDA-MB-231 and E10 cells. Size mode: 105 nanometers (nm; 3 technical replicates). b , Transmission electron microscopy (TEM) micrograph of MDA-MB-231-derived exosomes. Upper right image shows a digitally zoomed inset. c , TEM micrograph of MDA-MB-231-derived exosomes following immunogold labeling for CD9. Gold particles are depicted as black dots. Upper right image shows a digitally zoomed inset. d , Immunoblot of flotillin1 and CD81 in exosomal proteins extracted from culture supernatant of E10, NIH/3T3, MDA-MB-231, MCF10A and HDF cells. e , RT–qPCR measurement of GPC1 mRNA levels in HMEL, HDF, HMLE, MCF7, MDA-MB-231, T3M4, Panc-1, MIA Paca2. Results are shown as mean ± standard deviation; n=3, 3 biological replicates, with 3 technical replicates each. f , Immunoblot of GPC1 in HMEL, HDF, HMLE, MCF7, MDA-MB-231, T3M4, Panc-1 and MIA Paca2 cell lysates (upper panel). β-actin was used as a loading control (lower panel). g , Immunoblot of GPC1 in exosomal protein lysates derived from the culture supernatant of 3 non-tumorigenic cell lines (HDF, HMEL, HMLE) and 5 tumorigenic cell lines (MCF7, MDA-MB-231, T3M4, Panc-1, MIA Paca2) (upper panel). Immunoblot of flotillin1 was used as loading control (lower panel). h , Immunoblot of flotillin1 in exosomal protein lysates from the culture supernatant of MDA-MB-231 and T3M4 following sucrose gradient purification. The protein content is assayed in each of the density layers listed.

    Journal: Nature

    Article Title: Glypican1 identifies cancer exosomes and facilitates early detection of cancer

    doi: 10.1038/nature14581

    Figure Lengend Snippet: Exosomes isolation a , Exosomes concentration and size distribution by NanoSight® analysis of culture supernatant from NIH/3T3, MCF10A, HDF, MDA-MB-231 and E10 cells. Size mode: 105 nanometers (nm; 3 technical replicates). b , Transmission electron microscopy (TEM) micrograph of MDA-MB-231-derived exosomes. Upper right image shows a digitally zoomed inset. c , TEM micrograph of MDA-MB-231-derived exosomes following immunogold labeling for CD9. Gold particles are depicted as black dots. Upper right image shows a digitally zoomed inset. d , Immunoblot of flotillin1 and CD81 in exosomal proteins extracted from culture supernatant of E10, NIH/3T3, MDA-MB-231, MCF10A and HDF cells. e , RT–qPCR measurement of GPC1 mRNA levels in HMEL, HDF, HMLE, MCF7, MDA-MB-231, T3M4, Panc-1, MIA Paca2. Results are shown as mean ± standard deviation; n=3, 3 biological replicates, with 3 technical replicates each. f , Immunoblot of GPC1 in HMEL, HDF, HMLE, MCF7, MDA-MB-231, T3M4, Panc-1 and MIA Paca2 cell lysates (upper panel). β-actin was used as a loading control (lower panel). g , Immunoblot of GPC1 in exosomal protein lysates derived from the culture supernatant of 3 non-tumorigenic cell lines (HDF, HMEL, HMLE) and 5 tumorigenic cell lines (MCF7, MDA-MB-231, T3M4, Panc-1, MIA Paca2) (upper panel). Immunoblot of flotillin1 was used as loading control (lower panel). h , Immunoblot of flotillin1 in exosomal protein lysates from the culture supernatant of MDA-MB-231 and T3M4 following sucrose gradient purification. The protein content is assayed in each of the density layers listed.

    Article Snippet: Exosomes-bound beads were washed 1 time in 1X PBS/2% BSA and centrifuge for 1 min at 10,000 rpm, blocked with 10% BSA with rotation at room temperature for 30 min, washed a second time in 1X PBS/2% BSA and centrifuged for 1 min at 10,000 rpm, and incubated with anti-GPC1 (PIPA528055, Thermo-Scientific, 3 μl of antibody in 20 μl of 2%BSA/1X PBS) during 30 min rotating at 4°C.

    Techniques: Isolation, Concentration Assay, Multiple Displacement Amplification, Transmission Assay, Electron Microscopy, Transmission Electron Microscopy, Derivative Assay, Labeling, Quantitative RT-PCR, Standard Deviation, Purification

    GPC1 + crExosomes are derived from cancer cells in tumor-bearing mice a , Longitudinal blood collection: nude mice with orthotopic MDA-MB-231 tumors (n=4 mice). b , Percentage of beads with GPC1 + exosomes harvested from systemic circulation (crExos) plotted against average tumor volume (n=4 mice, each sample analyzed in technical triplicates for GPC1). ANOVA, post-hoc Tamhane T 2 , ** P

    Journal: Nature

    Article Title: Glypican1 identifies cancer exosomes and facilitates early detection of cancer

    doi: 10.1038/nature14581

    Figure Lengend Snippet: GPC1 + crExosomes are derived from cancer cells in tumor-bearing mice a , Longitudinal blood collection: nude mice with orthotopic MDA-MB-231 tumors (n=4 mice). b , Percentage of beads with GPC1 + exosomes harvested from systemic circulation (crExos) plotted against average tumor volume (n=4 mice, each sample analyzed in technical triplicates for GPC1). ANOVA, post-hoc Tamhane T 2 , ** P

    Article Snippet: Exosomes-bound beads were washed 1 time in 1X PBS/2% BSA and centrifuge for 1 min at 10,000 rpm, blocked with 10% BSA with rotation at room temperature for 30 min, washed a second time in 1X PBS/2% BSA and centrifuged for 1 min at 10,000 rpm, and incubated with anti-GPC1 (PIPA528055, Thermo-Scientific, 3 μl of antibody in 20 μl of 2%BSA/1X PBS) during 30 min rotating at 4°C.

    Techniques: Derivative Assay, Mouse Assay, Multiple Displacement Amplification

    PDAC GEMM cross sectional studies a , Representative micrographs of H E stained pancreas from 16 days old control mice (left panel) and PKT mice presenting with (right panel, encircled) and without (middle panel) PanIN lesions. Scale bars: 100 μm. b , Ct values following qPCR analyses for oncogenic KRAS G12D , wild-type KRAS and 18S internal control RNA from exosomes of 44–48 days old PKT mice serum segregated using FACS for GPC1 + bead bound exos (red) and GPC1 − bead bound exos (blue). Data is presented as the mean ± standard deviation.

    Journal: Nature

    Article Title: Glypican1 identifies cancer exosomes and facilitates early detection of cancer

    doi: 10.1038/nature14581

    Figure Lengend Snippet: PDAC GEMM cross sectional studies a , Representative micrographs of H E stained pancreas from 16 days old control mice (left panel) and PKT mice presenting with (right panel, encircled) and without (middle panel) PanIN lesions. Scale bars: 100 μm. b , Ct values following qPCR analyses for oncogenic KRAS G12D , wild-type KRAS and 18S internal control RNA from exosomes of 44–48 days old PKT mice serum segregated using FACS for GPC1 + bead bound exos (red) and GPC1 − bead bound exos (blue). Data is presented as the mean ± standard deviation.

    Article Snippet: Exosomes-bound beads were washed 1 time in 1X PBS/2% BSA and centrifuge for 1 min at 10,000 rpm, blocked with 10% BSA with rotation at room temperature for 30 min, washed a second time in 1X PBS/2% BSA and centrifuged for 1 min at 10,000 rpm, and incubated with anti-GPC1 (PIPA528055, Thermo-Scientific, 3 μl of antibody in 20 μl of 2%BSA/1X PBS) during 30 min rotating at 4°C.

    Techniques: Staining, Mouse Assay, Real-time Polymerase Chain Reaction, FACS, Standard Deviation

    Raw scatter dot plot depicting flow cytometry analyses of beads with GPC1 + bound exosomes a , Scatter plots and histogram of flow cytometry analyses of serum exosomes on beads of a representative healthy control (left panels are secondary antibody only; right panels are GPC1 antibody and secondary antibody). b , Scatter plots and histogram of flow cytometry analysis of serum exosomes on beads of a representative pancreas cancer sample (left panels are secondary antibody only; right panels are with GPC1 antibody and secondary antibody).

    Journal: Nature

    Article Title: Glypican1 identifies cancer exosomes and facilitates early detection of cancer

    doi: 10.1038/nature14581

    Figure Lengend Snippet: Raw scatter dot plot depicting flow cytometry analyses of beads with GPC1 + bound exosomes a , Scatter plots and histogram of flow cytometry analyses of serum exosomes on beads of a representative healthy control (left panels are secondary antibody only; right panels are GPC1 antibody and secondary antibody). b , Scatter plots and histogram of flow cytometry analysis of serum exosomes on beads of a representative pancreas cancer sample (left panels are secondary antibody only; right panels are with GPC1 antibody and secondary antibody).

    Article Snippet: Exosomes-bound beads were washed 1 time in 1X PBS/2% BSA and centrifuge for 1 min at 10,000 rpm, blocked with 10% BSA with rotation at room temperature for 30 min, washed a second time in 1X PBS/2% BSA and centrifuged for 1 min at 10,000 rpm, and incubated with anti-GPC1 (PIPA528055, Thermo-Scientific, 3 μl of antibody in 20 μl of 2%BSA/1X PBS) during 30 min rotating at 4°C.

    Techniques: Flow Cytometry, Cytometry

    GPC1 + circulating exosomes predict pancreas cancer in GEMM a , Longitudinal blood collection from control and PKT mice: 4 (n=6 and n=7, respectively), 5 (n=6 and n=7), 6 (n=6 and n=6), 7 (n=6 and n=6) and 8 (n=2 and n=3) weeks of age. b , Percent beads with GPC1 + crExos from PKT (red) and control (blue) mice; ANOVA, post-hoc Tukey-Kramer test, **** P

    Journal: Nature

    Article Title: Glypican1 identifies cancer exosomes and facilitates early detection of cancer

    doi: 10.1038/nature14581

    Figure Lengend Snippet: GPC1 + circulating exosomes predict pancreas cancer in GEMM a , Longitudinal blood collection from control and PKT mice: 4 (n=6 and n=7, respectively), 5 (n=6 and n=7), 6 (n=6 and n=6), 7 (n=6 and n=6) and 8 (n=2 and n=3) weeks of age. b , Percent beads with GPC1 + crExos from PKT (red) and control (blue) mice; ANOVA, post-hoc Tukey-Kramer test, **** P

    Article Snippet: Exosomes-bound beads were washed 1 time in 1X PBS/2% BSA and centrifuge for 1 min at 10,000 rpm, blocked with 10% BSA with rotation at room temperature for 30 min, washed a second time in 1X PBS/2% BSA and centrifuged for 1 min at 10,000 rpm, and incubated with anti-GPC1 (PIPA528055, Thermo-Scientific, 3 μl of antibody in 20 μl of 2%BSA/1X PBS) during 30 min rotating at 4°C.

    Techniques: Mouse Assay

    Levels of circulating GPC1 + exosomes inform pancreas cancer resection outcome a , Longitudinal blood collection pre- (pre-op) and post-operatively (day 7). b , Percent beads with GPC1 + crExos from patients with BPD (n=4), PCPL (n=4) or PDAC (n=29) (paired two-tailed Student’s t -test, ** P

    Journal: Nature

    Article Title: Glypican1 identifies cancer exosomes and facilitates early detection of cancer

    doi: 10.1038/nature14581

    Figure Lengend Snippet: Levels of circulating GPC1 + exosomes inform pancreas cancer resection outcome a , Longitudinal blood collection pre- (pre-op) and post-operatively (day 7). b , Percent beads with GPC1 + crExos from patients with BPD (n=4), PCPL (n=4) or PDAC (n=29) (paired two-tailed Student’s t -test, ** P

    Article Snippet: Exosomes-bound beads were washed 1 time in 1X PBS/2% BSA and centrifuge for 1 min at 10,000 rpm, blocked with 10% BSA with rotation at room temperature for 30 min, washed a second time in 1X PBS/2% BSA and centrifuged for 1 min at 10,000 rpm, and incubated with anti-GPC1 (PIPA528055, Thermo-Scientific, 3 μl of antibody in 20 μl of 2%BSA/1X PBS) during 30 min rotating at 4°C.

    Techniques: Two Tailed Test

    Longitudinal human study a , Scatter plots of percent beads with GPC1 + crExos by flow cytometry in patients with pancreas cancer. Patients are divided based on metastatic disease (non-metastatic lesions, lymph node metastases and distant metastases). ANOVA, post-hoc Tukey-Kramer test, * P

    Journal: Nature

    Article Title: Glypican1 identifies cancer exosomes and facilitates early detection of cancer

    doi: 10.1038/nature14581

    Figure Lengend Snippet: Longitudinal human study a , Scatter plots of percent beads with GPC1 + crExos by flow cytometry in patients with pancreas cancer. Patients are divided based on metastatic disease (non-metastatic lesions, lymph node metastases and distant metastases). ANOVA, post-hoc Tukey-Kramer test, * P

    Article Snippet: Exosomes-bound beads were washed 1 time in 1X PBS/2% BSA and centrifuge for 1 min at 10,000 rpm, blocked with 10% BSA with rotation at room temperature for 30 min, washed a second time in 1X PBS/2% BSA and centrifuged for 1 min at 10,000 rpm, and incubated with anti-GPC1 (PIPA528055, Thermo-Scientific, 3 μl of antibody in 20 μl of 2%BSA/1X PBS) during 30 min rotating at 4°C.

    Techniques: Flow Cytometry, Cytometry

    GPC1 is present specifically on cancer exosomes a , Venn diagram of exosomal proteins from NIH/3T3 (blue), MCF 10A (red), HDF (green), E10 (yellow) and MDA-MB-231 (purple) cells. 48 proteins were exclusively detected in exosomes from MDA-MB-231 cells (n=3 protein samples, technical replicates). b , Transmission electron micrographs (TEM; left image) and immunogold TEM (right image) of GPC1. Upper right: digitally zoomed inset (n=2 experiments). c , Diagram of flow cytometry experiment to detect GPC1 on the surface of exosomes bound to beads. d , TEM of bead-bound exosomes and immunogold labeling of GPC1 (n=2 biological replicates). e , Percent beads with GPC1 + exosomes from cancer cells (red) and non-tumorigenic cells (black). f , Flow cytometry analyses of percent beads with GPC1 + exosomes from indicated cell lines (n=2 biological replicates). Negative control: secondary antibody only.

    Journal: Nature

    Article Title: Glypican1 identifies cancer exosomes and facilitates early detection of cancer

    doi: 10.1038/nature14581

    Figure Lengend Snippet: GPC1 is present specifically on cancer exosomes a , Venn diagram of exosomal proteins from NIH/3T3 (blue), MCF 10A (red), HDF (green), E10 (yellow) and MDA-MB-231 (purple) cells. 48 proteins were exclusively detected in exosomes from MDA-MB-231 cells (n=3 protein samples, technical replicates). b , Transmission electron micrographs (TEM; left image) and immunogold TEM (right image) of GPC1. Upper right: digitally zoomed inset (n=2 experiments). c , Diagram of flow cytometry experiment to detect GPC1 on the surface of exosomes bound to beads. d , TEM of bead-bound exosomes and immunogold labeling of GPC1 (n=2 biological replicates). e , Percent beads with GPC1 + exosomes from cancer cells (red) and non-tumorigenic cells (black). f , Flow cytometry analyses of percent beads with GPC1 + exosomes from indicated cell lines (n=2 biological replicates). Negative control: secondary antibody only.

    Article Snippet: Exosomes-bound beads were washed 1 time in 1X PBS/2% BSA and centrifuge for 1 min at 10,000 rpm, blocked with 10% BSA with rotation at room temperature for 30 min, washed a second time in 1X PBS/2% BSA and centrifuged for 1 min at 10,000 rpm, and incubated with anti-GPC1 (PIPA528055, Thermo-Scientific, 3 μl of antibody in 20 μl of 2%BSA/1X PBS) during 30 min rotating at 4°C.

    Techniques: Multiple Displacement Amplification, Transmission Assay, Transmission Electron Microscopy, Flow Cytometry, Cytometry, Labeling, Negative Control

    PCR and RT-PCR of IL-17 cytokine family members in knee joint tissues at day 2 of AIA. ( a ) Representative PCR-ScreenTape (Agilent 2200 TapeStation) of IL-17 cytokine family members in tissues of WT and IL-17AKO mice. PCR analysis does not give information about expression quantity. Upper (magenta) and lower (green) markers are used as internal references to determine the molecular weight size of the sample. DNA ladder (25–1500 bp) on the left. GAPDH (Glyceraldehyde 3-phosphate dehydrogenase) serves as a housekeeping control gene. ( b ) Quantitative reverse transcriptase (RT)-PCR in tissues of sympathectomised IL-17AKO mice and IL-17AKO AIA control mice (n = 5 per group). mRNA level after sympathectomy are given in relation to non-sympathectomised control mice. Sympathectomy significantly (p = 0.012) decreases IL-17D-mRNA. Values are mean ± SEM. *p

    Journal: Scientific Reports

    Article Title: Interleukin-17A is involved in mechanical hyperalgesia but not in the severity of murine antigen-induced arthritis

    doi: 10.1038/s41598-017-10509-5

    Figure Lengend Snippet: PCR and RT-PCR of IL-17 cytokine family members in knee joint tissues at day 2 of AIA. ( a ) Representative PCR-ScreenTape (Agilent 2200 TapeStation) of IL-17 cytokine family members in tissues of WT and IL-17AKO mice. PCR analysis does not give information about expression quantity. Upper (magenta) and lower (green) markers are used as internal references to determine the molecular weight size of the sample. DNA ladder (25–1500 bp) on the left. GAPDH (Glyceraldehyde 3-phosphate dehydrogenase) serves as a housekeeping control gene. ( b ) Quantitative reverse transcriptase (RT)-PCR in tissues of sympathectomised IL-17AKO mice and IL-17AKO AIA control mice (n = 5 per group). mRNA level after sympathectomy are given in relation to non-sympathectomised control mice. Sympathectomy significantly (p = 0.012) decreases IL-17D-mRNA. Values are mean ± SEM. *p

    Article Snippet: The Master Mix consisted of 1x PCR buffer, 1 unit Taq DNA polymerase per 50 µl PCR mixture, 0.2 mM dNTP mixture (10 m M dNTP Mix; Thermo Fisher Scientific), and 0.5 µM primer.

    Techniques: Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Mouse Assay, Expressing, Molecular Weight