16 doxylstearic acid spin probes  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Custom qPCR Probes
    Description:
    Design your qPCR probe with our complimentary online design tool OligoArchitect Learn more about our custom qPCR probes To place an order for your qPCR probe visit our order center
    Catalog Number:
    probes
    Price:
    None
    Buy from Supplier


    Structured Review

    Millipore 16 doxylstearic acid spin probes
    Custom qPCR Probes
    Design your qPCR probe with our complimentary online design tool OligoArchitect Learn more about our custom qPCR probes To place an order for your qPCR probe visit our order center
    https://www.bioz.com/result/16 doxylstearic acid spin probes/product/Millipore
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    16 doxylstearic acid spin probes - by Bioz Stars, 2020-09
    99/100 stars

    Images

    Related Articles

    Double Immunostaining:

    Article Title: Soluble Siglec-5 associates to PSGL-1 and displays anti-inflammatory activity
    Article Snippet: .. For Duolink experiments to detect close proximity between PSGL1 and Siglec-5, a similar double immunostaining was performed with the secondary antibodies replaced by secondary PLA-probes from the Duolink kit (Sigma Aldrich). ..

    Electroporation:

    Article Title: Identification of a Novel Immunosubversion Mechanism Mediated by a Virologue of the B-Lymphocyte Receptor TACI ▿
    Article Snippet: .. At 24 h after electroporation, apoptosis was induced in 1.2 × 106 cells with 8 μM thapsigargin (Sigma) for 24 h. Apoptosis was assayed by measuring externalization of phosphatidylserine with annexin V conjugated to Alexa Fluor 647 (Molecular Probes) according the manufacturer's protocol using propidium iodide (PI) as a dead-cell counterstain. .. Fluorescence-activated cell sorting (FACS) was performed with a FACSCalibur instrument (Becton Dickinson) and analyzed with FlowJo software (Tree Star, Ashland, OR).

    Proximity Ligation Assay:

    Article Title: Soluble Siglec-5 associates to PSGL-1 and displays anti-inflammatory activity
    Article Snippet: .. For Duolink experiments to detect close proximity between PSGL1 and Siglec-5, a similar double immunostaining was performed with the secondary antibodies replaced by secondary PLA-probes from the Duolink kit (Sigma Aldrich). ..

    Synthesized:

    Article Title: Defects Can Increase the Melting Temperature of DNA-Nanoparticle Assemblies
    Article Snippet: .. DNA-nanoparticle probes are synthesized by saturating the surface of colloidal gold particles (Sigma), 10 nm in diameter, with functionalized probe DNA. .. Salt was filtered using NAP-5 or NAP-10 columns, to prevent the colloidal gold particles from irreversible aggregation.

    Article Title: Separate roles for Med12 and Wnt signaling in regulation of oxytocin expression
    Article Snippet: .. The trh and crh probes were generated by PCR using F1 and T7 primers; forward and reverse primers were designed and purchased (Sigma-Aldrich) with the below sequences: TRH_F1: 5′ CGAAGCGACAGTTCAAAGCC TRH_R1-T7: 5′ TAATACGACTCACTATAGGGGCAAAAGTGCGAGATCCGTG CRH_F1: 5′ TACGCACAGATTCTCCTCGC CRH_R1-T7: 5′ TAATACGACTCACTATAGGGCTGATGGGTTCGCTTGTGGTT Embryo cDNA was synthesized by reverse transcription from 2 dpf embryo RNA as per protocol for oligo dT20 primed Superscript kit (Invitrogen). .. PCR reactions [1 µl cDNA; 0.4 µM TRH-F1 or CRH_F1; 0.4 µM TRH-R1-T7 OR CRH-R1-T7; 1× PCR mix (Thermo Fisher Scientific)] were amplified using the following parameters for TRH: 94, 2 min; 15 cycles of 94, 30 s; 62, 10 s; 72, 1 min; 72, 10 min; 4, hold and for CRH: 94, 2 min; 30 cycles of 94, 30 s; 60, 30 s; 68, 30 s; 68, 10 min; 4, hold.

    Purification:

    Article Title: Novel cis-trans interactions are involved in post-transcriptional regulation of cyclin-dependent kinase inhibitor p21WAF1/CIP1 mRNA
    Article Snippet: .. The radiolabelled RNA probes were subsequently purified using G25 spin columns (BMB) or Microcon YM-3 spin cartridges with a 3000-dalton molecular weight cut-off (Millipore, Bedford, MA) and utilized in the gel-mobility shift assays below. ..

    Generated:

    Article Title: Separate roles for Med12 and Wnt signaling in regulation of oxytocin expression
    Article Snippet: .. The trh and crh probes were generated by PCR using F1 and T7 primers; forward and reverse primers were designed and purchased (Sigma-Aldrich) with the below sequences: TRH_F1: 5′ CGAAGCGACAGTTCAAAGCC TRH_R1-T7: 5′ TAATACGACTCACTATAGGGGCAAAAGTGCGAGATCCGTG CRH_F1: 5′ TACGCACAGATTCTCCTCGC CRH_R1-T7: 5′ TAATACGACTCACTATAGGGCTGATGGGTTCGCTTGTGGTT Embryo cDNA was synthesized by reverse transcription from 2 dpf embryo RNA as per protocol for oligo dT20 primed Superscript kit (Invitrogen). .. PCR reactions [1 µl cDNA; 0.4 µM TRH-F1 or CRH_F1; 0.4 µM TRH-R1-T7 OR CRH-R1-T7; 1× PCR mix (Thermo Fisher Scientific)] were amplified using the following parameters for TRH: 94, 2 min; 15 cycles of 94, 30 s; 62, 10 s; 72, 1 min; 72, 10 min; 4, hold and for CRH: 94, 2 min; 30 cycles of 94, 30 s; 60, 30 s; 68, 30 s; 68, 10 min; 4, hold.

    Polymerase Chain Reaction:

    Article Title: Separate roles for Med12 and Wnt signaling in regulation of oxytocin expression
    Article Snippet: .. The trh and crh probes were generated by PCR using F1 and T7 primers; forward and reverse primers were designed and purchased (Sigma-Aldrich) with the below sequences: TRH_F1: 5′ CGAAGCGACAGTTCAAAGCC TRH_R1-T7: 5′ TAATACGACTCACTATAGGGGCAAAAGTGCGAGATCCGTG CRH_F1: 5′ TACGCACAGATTCTCCTCGC CRH_R1-T7: 5′ TAATACGACTCACTATAGGGCTGATGGGTTCGCTTGTGGTT Embryo cDNA was synthesized by reverse transcription from 2 dpf embryo RNA as per protocol for oligo dT20 primed Superscript kit (Invitrogen). .. PCR reactions [1 µl cDNA; 0.4 µM TRH-F1 or CRH_F1; 0.4 µM TRH-R1-T7 OR CRH-R1-T7; 1× PCR mix (Thermo Fisher Scientific)] were amplified using the following parameters for TRH: 94, 2 min; 15 cycles of 94, 30 s; 62, 10 s; 72, 1 min; 72, 10 min; 4, hold and for CRH: 94, 2 min; 30 cycles of 94, 30 s; 60, 30 s; 68, 30 s; 68, 10 min; 4, hold.

    Binding Assay:

    Article Title: Long Non-coding RNA LINC01787 Drives Breast Cancer Progression via Disrupting miR-125b Generation
    Article Snippet: .. In addition, the binding between RNA and RNA was verified using LINC01787 antisense biotinylated probes and the EZ- Magna ChIRP RNA Interactome Kit (Millipore, Bedford, MA, USA) following the provided protocol. ..

    Molecular Weight:

    Article Title: Novel cis-trans interactions are involved in post-transcriptional regulation of cyclin-dependent kinase inhibitor p21WAF1/CIP1 mRNA
    Article Snippet: .. The radiolabelled RNA probes were subsequently purified using G25 spin columns (BMB) or Microcon YM-3 spin cartridges with a 3000-dalton molecular weight cut-off (Millipore, Bedford, MA) and utilized in the gel-mobility shift assays below. ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85
    Millipore hpv16 organotypic raft total dna
    Transformation of an 18-day-old <t>HPV16</t> - low <t>folate-organotypic</t> raft into a malignant tumor within 12 weeks after subcutaneous implantation in a folate-replete beige nude XID mouse ( A–D ) and demonstration of highly aggressive growth characteristics
    Hpv16 Organotypic Raft Total Dna, supplied by Millipore, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hpv16 organotypic raft total dna/product/Millipore
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    hpv16 organotypic raft total dna - by Bioz Stars, 2020-09
    85/100 stars
      Buy from Supplier

    Image Search Results


    Transformation of an 18-day-old HPV16 - low folate-organotypic raft into a malignant tumor within 12 weeks after subcutaneous implantation in a folate-replete beige nude XID mouse ( A–D ) and demonstration of highly aggressive growth characteristics

    Journal: The Journal of Biological Chemistry

    Article Title: Influence of Physiologic Folate Deficiency on Human Papillomavirus Type 16 (HPV16)-harboring Human Keratinocytes in Vitro and in Vivo *

    doi: 10.1074/jbc.M111.317040

    Figure Lengend Snippet: Transformation of an 18-day-old HPV16 - low folate-organotypic raft into a malignant tumor within 12 weeks after subcutaneous implantation in a folate-replete beige nude XID mouse ( A–D ) and demonstration of highly aggressive growth characteristics

    Article Snippet: To prepare HPV16-organotypic raft total DNA for analysis of the HPV16 viral load by qPCR, four 18-day-old HPV16 - high folate - organotypic rafts as well as four HPV16 - low folate - organotypic rafts were separately ground in 5 ml of Dulbecco's PBS with autoclaved sea sand (EMD Chemicals Inc.) using a mortar and pestle (Fisher).

    Techniques: Transformation Assay

    Comparison of HPV16 RNA ( A–F ), HPV16 viral load ( E and F ), HPV16 viral particles ( G–J ), and HPV16 DNA integration into genomic DNA ( K–M ) in HPV16 - high folate - organotypic rafts ( HF ) and HPV16 - low folate - organotypic rafts ( LF ). Unless

    Journal: The Journal of Biological Chemistry

    Article Title: Influence of Physiologic Folate Deficiency on Human Papillomavirus Type 16 (HPV16)-harboring Human Keratinocytes in Vitro and in Vivo *

    doi: 10.1074/jbc.M111.317040

    Figure Lengend Snippet: Comparison of HPV16 RNA ( A–F ), HPV16 viral load ( E and F ), HPV16 viral particles ( G–J ), and HPV16 DNA integration into genomic DNA ( K–M ) in HPV16 - high folate - organotypic rafts ( HF ) and HPV16 - low folate - organotypic rafts ( LF ). Unless

    Article Snippet: To prepare HPV16-organotypic raft total DNA for analysis of the HPV16 viral load by qPCR, four 18-day-old HPV16 - high folate - organotypic rafts as well as four HPV16 - low folate - organotypic rafts were separately ground in 5 ml of Dulbecco's PBS with autoclaved sea sand (EMD Chemicals Inc.) using a mortar and pestle (Fisher).

    Techniques: