dneasy powerlyzer powersoil kit  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    DNeasy PowerLyzer PowerSoil Kit
    Description:
    For the bead based isolation of DNA from tough soil microbes Kit contents For the isolation of DNA from tough soil microbes optimized for use with bead based homogenizers Benefits Optimized to lyse tough microbes and isolate DNA using the PowerLyzer 24 Homogenizer Highly purified DNA produced with Inhibitor Removal Technology that removes humic acid Ready to use high quality DNA for downstream applications Short and simple protocol for DNA isolation from up to 250 mg samples in just 30 minu
    Catalog Number:
    12855-100
    Price:
    550
    Category:
    DNeasy PowerLyzer PowerSoil Kit
    Buy from Supplier


    Structured Review

    Qiagen dneasy powerlyzer powersoil kit
    DNeasy PowerLyzer PowerSoil Kit
    For the bead based isolation of DNA from tough soil microbes Kit contents For the isolation of DNA from tough soil microbes optimized for use with bead based homogenizers Benefits Optimized to lyse tough microbes and isolate DNA using the PowerLyzer 24 Homogenizer Highly purified DNA produced with Inhibitor Removal Technology that removes humic acid Ready to use high quality DNA for downstream applications Short and simple protocol for DNA isolation from up to 250 mg samples in just 30 minu
    https://www.bioz.com/result/dneasy powerlyzer powersoil kit/product/Qiagen
    Average 90 stars, based on 29 article reviews
    Price from $9.99 to $1999.99
    dneasy powerlyzer powersoil kit - by Bioz Stars, 2020-01
    90/100 stars

    Images

    Related Articles

    DNA Extraction:

    Article Title: Effect of artificial barriers on the distribution of the invasive signal crayfish and Chinese mitten crab
    Article Snippet: .. Analysis of eDNA field samples DNA extraction was performed using Qiagen® DNeasy Powerlyzer PowerSoil Kit (Qiagen, UK), for both field eDNA water samples (n = 177; Table ) and sediment eDNA samples (n = 39; Table ), including negative controls, following the manufacturer’s instructions, apart from a reduction in the elution volume from 60 µl to 50 µl, to maximise DNA yield. .. We opted for Qiagen® DNeasy Powerlyzer PowerSoil Kit for all samples based on the effectiveness of the kit to remove inhibitors and produce high DNA yields , .

    Article Title: Development of quantitative PCR for the detection of Alkalilimnicola ehrlichii, Thioalkalivibrio sulfidiphilus and Thioalkalibacter halophilus in gas biodesulfurization processes
    Article Snippet: .. DNA isolation and purification Genomic DNA was extracted using the DNeasy PowerLyzer PowerSoil Kit (Qiagen, Venlo, the Netherlands) following the manufacturer’s instructions. .. After DNA extraction, DNA was purified with the DNA Clean and Concentrator kit (Zymo Research, Irvine, CA, USA).

    Article Title: Oleoylethanolamide treatment affects gut microbiota composition and the expression of intestinal cytokines in Peyer’s patches of mice
    Article Snippet: .. The bacterial genomic DNA extraction was carried out with DNeasy PowerLyzer PowerSoil Kit (Qiagen, Hilden, Germania) following the manufacturer’s instructions. ..

    Article Title: An intramembrane sensory circuit monitors sortase A–mediated processing of streptococcal adhesins
    Article Snippet: .. Biofilms that remained attached to the wells were collected for DNA isolation with DNeasy PowerLyzer PowerSoil Kit (Qiagen). .. S. gordonii presence in the ex vivo community was determined by qPCR amplification of the JHMD1 cassette with primer pairs Fwd and Rev ( ) and normalized to total 16s rRNA gene DNA, which was amplified with primer pair (BAC1 and BAC2) ( ).

    Article Title: Effect of Cell Concentration on the Persistence in the Human Intestine of Four Probiotic Strains Administered through a Multispecies Formulation
    Article Snippet: Paragraph title: 2.2. DNA Extraction from Fecal Samples ... After homogenization, 250 mg of feces were weighed and processed using a DNeasy PowerLyzer PowerSoil kit (Qiagen, Hilden, Germany) for the isolation of total DNA with a minor modification that included incubating samples at 65 °C for 10 min after the addition of the power bead and C1 solutions provided with the kit.

    Article Title: Nutrient germination improves DNA recovery from industrial Bacillus subtilis endospores during qPCR enumeration assays
    Article Snippet: Paragraph title: Genomic DNA extraction and qPCR ... Genomic DNA was isolated using a QIAGEN DNEasy Powerlyzer Powersoil kit (QIAGEN, Inc., Germantown MD) following manufacturer's instructions.

    Article Title: Bacterial Dispersers along Preferential Flow Paths of a Clay Till Depth Profile
    Article Snippet: Paragraph title: DNA extraction and sequencing. ... DNA was extracted using the DNeasy PowerLyzer PowerSoil kit (Qiagen; Hilden, Germany) according to the manufacturer’s protocol with a few adjustments, as in Krüger et al. ( ).

    Article Title: Application of a Neutral Community Model To Assess Structuring of the Human Lung Microbiome
    Article Snippet: Paragraph title: DNA extraction from upper GI tract samples. ... Seven hundred-fifty microliters of PowerSoil DNA kit bead solution (Mo Bio catalog no. 12855-50-BS) and 60 µl of PowerSoil DNA kit solution C1 were added to each dry bead tube (containing pellet from 10 ml of gastric contents).

    Article Title: Urbanization Altered Bacterial and Archaeal Composition in Tidal Freshwater Wetlands Near Washington DC, USA, and Buenos Aires, Argentina
    Article Snippet: .. DNA Extraction and Illumina Library Preparation DNA extractions were carried out using the Qiagen DNeasy PowerLyzer PowerSoil kit (Qiagen, Hilden, Germany). ..

    Article Title: Development and validation of a physiologically based kinetic model for starting up and operation of the biological gas desulfurization process under haloalkaline conditions
    Article Snippet: Paragraph title: DNA extraction and 16S rRNA sequencing ... Afterward, the genomic DNA was extracted from the washed biomass using the DNeasy PowerLyzer PowerSoil Kit (Qiagen) following the manufacturer's instructions.

    Flow Cytometry:

    Article Title: Effect of artificial barriers on the distribution of the invasive signal crayfish and Chinese mitten crab
    Article Snippet: Analysis of eDNA field samples DNA extraction was performed using Qiagen® DNeasy Powerlyzer PowerSoil Kit (Qiagen, UK), for both field eDNA water samples (n = 177; Table ) and sediment eDNA samples (n = 39; Table ), including negative controls, following the manufacturer’s instructions, apart from a reduction in the elution volume from 60 µl to 50 µl, to maximise DNA yield. .. DNA extractions were undertaken in a dedicated eDNA area within an extraction cabinet, fully equipped with flow-through air system and UV light and to minimise contamination; additionally, dedicated eDNA laboratory coat and nitrile gloves were worn during the process.

    Amplification:

    Article Title: An intramembrane sensory circuit monitors sortase A–mediated processing of streptococcal adhesins
    Article Snippet: Biofilms that remained attached to the wells were collected for DNA isolation with DNeasy PowerLyzer PowerSoil Kit (Qiagen). .. S. gordonii presence in the ex vivo community was determined by qPCR amplification of the JHMD1 cassette with primer pairs Fwd and Rev ( ) and normalized to total 16s rRNA gene DNA, which was amplified with primer pair (BAC1 and BAC2) ( ).

    Article Title: Bacterial Dispersers along Preferential Flow Paths of a Clay Till Depth Profile
    Article Snippet: DNA was extracted using the DNeasy PowerLyzer PowerSoil kit (Qiagen; Hilden, Germany) according to the manufacturer’s protocol with a few adjustments, as in Krüger et al. ( ). .. The DNA was PCR amplified using the primer set 341F (5′-CCTACGGGNGGCWGCAG-3′) and 806R (5′-GACTACHVGGGTATCTAATCC-3′) ( ) targeting the hypervariable V3-V4 regions of bacterial 16S rRNA genes.

    Article Title: Urbanization Altered Bacterial and Archaeal Composition in Tidal Freshwater Wetlands Near Washington DC, USA, and Buenos Aires, Argentina
    Article Snippet: DNA Extraction and Illumina Library Preparation DNA extractions were carried out using the Qiagen DNeasy PowerLyzer PowerSoil kit (Qiagen, Hilden, Germany). .. Samples were quantified using a Qubit 2.0 fluorometer (Invitrogen) and diluted to 5ng/ul for PCR amplification and subsequent amplicon sequencing.

    Article Title: Development and validation of a physiologically based kinetic model for starting up and operation of the biological gas desulfurization process under haloalkaline conditions
    Article Snippet: Afterward, the genomic DNA was extracted from the washed biomass using the DNeasy PowerLyzer PowerSoil Kit (Qiagen) following the manufacturer's instructions. .. The workflow started from 16S rRNA gene amplification in the V3-V5 variable region using 357F (5′- CCTACGGGAGGCAGCAG - 3′) and 926R (5′- CCGTCAATTCMTTTRAGT - 3′) primer set, afterward merging read pairs by overlapping was performed using FLASh ( ) with maximum mismatch density of 0.25.

    Homogenization:

    Article Title: Effect of Cell Concentration on the Persistence in the Human Intestine of Four Probiotic Strains Administered through a Multispecies Formulation
    Article Snippet: .. After homogenization, 250 mg of feces were weighed and processed using a DNeasy PowerLyzer PowerSoil kit (Qiagen, Hilden, Germany) for the isolation of total DNA with a minor modification that included incubating samples at 65 °C for 10 min after the addition of the power bead and C1 solutions provided with the kit. .. Steps of mechanical bacterial cell disruption were performed using a Precellys bead beater (Advanced Biotech Italia s.r.l., Seveso, Italy) that was kept in a cold room (3 cycles of 6800 rpm × 30 s).

    Article Title: Urbanization Altered Bacterial and Archaeal Composition in Tidal Freshwater Wetlands Near Washington DC, USA, and Buenos Aires, Argentina
    Article Snippet: DNA Extraction and Illumina Library Preparation DNA extractions were carried out using the Qiagen DNeasy PowerLyzer PowerSoil kit (Qiagen, Hilden, Germany). .. These were carried out following the manufacturer’s instructions, except for the homogenization step that was done using a FastPrep-24 (45 s at 6 m/s; MP Biomedicals, LLC, Solon, OH).

    Isolation:

    Article Title: Effect of Cell Concentration on the Persistence in the Human Intestine of Four Probiotic Strains Administered through a Multispecies Formulation
    Article Snippet: .. After homogenization, 250 mg of feces were weighed and processed using a DNeasy PowerLyzer PowerSoil kit (Qiagen, Hilden, Germany) for the isolation of total DNA with a minor modification that included incubating samples at 65 °C for 10 min after the addition of the power bead and C1 solutions provided with the kit. .. Steps of mechanical bacterial cell disruption were performed using a Precellys bead beater (Advanced Biotech Italia s.r.l., Seveso, Italy) that was kept in a cold room (3 cycles of 6800 rpm × 30 s).

    Article Title: Nutrient germination improves DNA recovery from industrial Bacillus subtilis endospores during qPCR enumeration assays
    Article Snippet: .. Genomic DNA was isolated using a QIAGEN DNEasy Powerlyzer Powersoil kit (QIAGEN, Inc., Germantown MD) following manufacturer's instructions. ..

    Article Title: Evaluating rectal swab collection method for gut microbiome analysis in the common marmoset (Callithrix jacchus)
    Article Snippet: .. Preparation of DNA from rectal and fecal samples Swabs and feces were retrieved from -80°C and DNA was isolated using the DNeasy PowerLyzer PowerSoil Kit according to the supplier’s protocol (Qiagen Inc., Valencia, CA). .. Bead beating of rectal swab and fecal samples was performed with a Next Advance Bullet blender (Troy, NY) for 8 min at the maximum speed.

    Picogreen Assay:

    Article Title: Spatial impacts of a multi-individual grave on microbial and microfaunal communities and soil biogeochemistry
    Article Snippet: DNA was extracted from soils that had been stored at -80°C using the DNeasy Powerlyzer Powersoil kit (QIAGEN Inc.) per manufacturer’s instructions, following recommendations for clay soils. .. All soil DNA extracts were quantified for total DNA concentration using the Quant-iT PicoGreen dsDNA Assay Kit (Invitrogen) on a 96-well microplate reader using reduced assay volumes of 200 μL.

    Article Title: Spatial impacts of a multi-individual grave on microbial and microfaunal communities and soil biogeochemistry
    Article Snippet: Soil biological community assessment methods DNA was extracted from soils that had been stored at -80°C using the DNeasy Powerlyzer Powersoil kit (QIAGEN Inc.) per manufacturer’s instructions, following recommendations for clay soils. .. All soil DNA extracts were quantified for total DNA concentration using the Quant-iT PicoGreen dsDNA Assay Kit (Invitrogen) on a 96-well microplate reader using reduced assay volumes of 200 μL.

    Polymerase Chain Reaction:

    Article Title: Bacterial Dispersers along Preferential Flow Paths of a Clay Till Depth Profile
    Article Snippet: DNA was extracted using the DNeasy PowerLyzer PowerSoil kit (Qiagen; Hilden, Germany) according to the manufacturer’s protocol with a few adjustments, as in Krüger et al. ( ). .. The DNA was PCR amplified using the primer set 341F (5′-CCTACGGGNGGCWGCAG-3′) and 806R (5′-GACTACHVGGGTATCTAATCC-3′) ( ) targeting the hypervariable V3-V4 regions of bacterial 16S rRNA genes.

    Article Title: Urbanization Altered Bacterial and Archaeal Composition in Tidal Freshwater Wetlands Near Washington DC, USA, and Buenos Aires, Argentina
    Article Snippet: DNA Extraction and Illumina Library Preparation DNA extractions were carried out using the Qiagen DNeasy PowerLyzer PowerSoil kit (Qiagen, Hilden, Germany). .. Samples were quantified using a Qubit 2.0 fluorometer (Invitrogen) and diluted to 5ng/ul for PCR amplification and subsequent amplicon sequencing.

    Construct:

    Article Title: Application of a Neutral Community Model To Assess Structuring of the Human Lung Microbiome
    Article Snippet: Seven hundred-fifty microliters of PowerSoil DNA kit bead solution (Mo Bio catalog no. 12855-50-BS) and 60 µl of PowerSoil DNA kit solution C1 were added to each dry bead tube (containing pellet from 10 ml of gastric contents). .. Libraries of 16S rRNA gene amplicons (v3-5 hypervariable region) were constructed based on the HMP Consortium protocol ( http://www.hmpdacc.org/doc/16S_Sequencing_SOP_4.2.2.pdf ) with the modifications described below.

    Mouse Assay:

    Article Title: Oleoylethanolamide treatment affects gut microbiota composition and the expression of intestinal cytokines in Peyer’s patches of mice
    Article Snippet: For each group of mice, the pellets were collected in sterile conditions and stored at −80 °C until extraction of nucleic acids. .. The bacterial genomic DNA extraction was carried out with DNeasy PowerLyzer PowerSoil Kit (Qiagen, Hilden, Germania) following the manufacturer’s instructions.

    Real-time Polymerase Chain Reaction:

    Article Title: Spatial impacts of a multi-individual grave on microbial and microfaunal communities and soil biogeochemistry
    Article Snippet: DNA was extracted from soils that had been stored at -80°C using the DNeasy Powerlyzer Powersoil kit (QIAGEN Inc.) per manufacturer’s instructions, following recommendations for clay soils. .. As a proxy for bacterial and fungal abundances, qPCR was used to quantify 16S rRNA and ITS gene abundances in soil using the Femto Bacterial DNA Quantification Kit and the Femto Fungal DNA Quantification Kit, respectively.

    Article Title: An intramembrane sensory circuit monitors sortase A–mediated processing of streptococcal adhesins
    Article Snippet: Biofilms that remained attached to the wells were collected for DNA isolation with DNeasy PowerLyzer PowerSoil Kit (Qiagen). .. S. gordonii presence in the ex vivo community was determined by qPCR amplification of the JHMD1 cassette with primer pairs Fwd and Rev ( ) and normalized to total 16s rRNA gene DNA, which was amplified with primer pair (BAC1 and BAC2) ( ).

    Article Title: Nutrient germination improves DNA recovery from industrial Bacillus subtilis endospores during qPCR enumeration assays
    Article Snippet: Paragraph title: Genomic DNA extraction and qPCR ... Genomic DNA was isolated using a QIAGEN DNEasy Powerlyzer Powersoil kit (QIAGEN, Inc., Germantown MD) following manufacturer's instructions.

    Article Title: Spatial impacts of a multi-individual grave on microbial and microfaunal communities and soil biogeochemistry
    Article Snippet: Soil biological community assessment methods DNA was extracted from soils that had been stored at -80°C using the DNeasy Powerlyzer Powersoil kit (QIAGEN Inc.) per manufacturer’s instructions, following recommendations for clay soils. .. As a proxy for bacterial and fungal abundances, qPCR was used to quantify 16S rRNA and ITS gene abundances in soil using the Femto Bacterial DNA Quantification Kit and the Femto Fungal DNA Quantification Kit, respectively.

    Sequencing:

    Article Title: Nutrient germination improves DNA recovery from industrial Bacillus subtilis endospores during qPCR enumeration assays
    Article Snippet: Genomic DNA was isolated using a QIAGEN DNEasy Powerlyzer Powersoil kit (QIAGEN, Inc., Germantown MD) following manufacturer's instructions. .. The forward primer sequence used was CCAACATATAAGACCTCTAC, the reverse primer sequence used was TTATTTCATCCCATCCTGAC and the customized TaqMan probe sequence used was CCCAACCAGCGATCCATAC. qPCR reactions were conducted using a Bio-Rad CFX 96 Deep Well C1000 Touch thermal cycler (Bio-Rad Laboratories, Hercules CA).

    Article Title: Bacterial Dispersers along Preferential Flow Paths of a Clay Till Depth Profile
    Article Snippet: Paragraph title: DNA extraction and sequencing. ... DNA was extracted using the DNeasy PowerLyzer PowerSoil kit (Qiagen; Hilden, Germany) according to the manufacturer’s protocol with a few adjustments, as in Krüger et al. ( ).

    Article Title: Urbanization Altered Bacterial and Archaeal Composition in Tidal Freshwater Wetlands Near Washington DC, USA, and Buenos Aires, Argentina
    Article Snippet: DNA Extraction and Illumina Library Preparation DNA extractions were carried out using the Qiagen DNeasy PowerLyzer PowerSoil kit (Qiagen, Hilden, Germany). .. Samples were quantified using a Qubit 2.0 fluorometer (Invitrogen) and diluted to 5ng/ul for PCR amplification and subsequent amplicon sequencing.

    Article Title: Development and validation of a physiologically based kinetic model for starting up and operation of the biological gas desulfurization process under haloalkaline conditions
    Article Snippet: Paragraph title: DNA extraction and 16S rRNA sequencing ... Afterward, the genomic DNA was extracted from the washed biomass using the DNeasy PowerLyzer PowerSoil Kit (Qiagen) following the manufacturer's instructions.

    other:

    Article Title: Does the endometrial cavity have a molecular microbial signature?
    Article Snippet: Extraction of DNA from samples Genomic DNA was extracted from swab samples using a QIAGEN DNeasy PowerLyzer PowerSoil Kit with minor modifications to the manufacturer’s protocol.

    Ex Vivo:

    Article Title: An intramembrane sensory circuit monitors sortase A–mediated processing of streptococcal adhesins
    Article Snippet: For biofilm integration, the ex vivo plaque community was grown overnight in SHI medium and diluted to an absorbance of 0.1 (λ=600 nm) in fresh SHI medium. .. Biofilms that remained attached to the wells were collected for DNA isolation with DNeasy PowerLyzer PowerSoil Kit (Qiagen).

    Modification:

    Article Title: Effect of Cell Concentration on the Persistence in the Human Intestine of Four Probiotic Strains Administered through a Multispecies Formulation
    Article Snippet: .. After homogenization, 250 mg of feces were weighed and processed using a DNeasy PowerLyzer PowerSoil kit (Qiagen, Hilden, Germany) for the isolation of total DNA with a minor modification that included incubating samples at 65 °C for 10 min after the addition of the power bead and C1 solutions provided with the kit. .. Steps of mechanical bacterial cell disruption were performed using a Precellys bead beater (Advanced Biotech Italia s.r.l., Seveso, Italy) that was kept in a cold room (3 cycles of 6800 rpm × 30 s).

    Purification:

    Article Title: Development of quantitative PCR for the detection of Alkalilimnicola ehrlichii, Thioalkalivibrio sulfidiphilus and Thioalkalibacter halophilus in gas biodesulfurization processes
    Article Snippet: .. DNA isolation and purification Genomic DNA was extracted using the DNeasy PowerLyzer PowerSoil Kit (Qiagen, Venlo, the Netherlands) following the manufacturer’s instructions. .. After DNA extraction, DNA was purified with the DNA Clean and Concentrator kit (Zymo Research, Irvine, CA, USA).

    Article Title: Bacterial Dispersers along Preferential Flow Paths of a Clay Till Depth Profile
    Article Snippet: DNA was extracted using the DNeasy PowerLyzer PowerSoil kit (Qiagen; Hilden, Germany) according to the manufacturer’s protocol with a few adjustments, as in Krüger et al. ( ). .. The purified PCR products (2 × 300-bp reads) were sequenced on the Illumina MiSeq platform by Macrogen (Seoul, South Korea).

    Next-Generation Sequencing:

    Article Title: Development and validation of a physiologically based kinetic model for starting up and operation of the biological gas desulfurization process under haloalkaline conditions
    Article Snippet: Afterward, the genomic DNA was extracted from the washed biomass using the DNeasy PowerLyzer PowerSoil Kit (Qiagen) following the manufacturer's instructions. .. Library construction and Next-generation sequencing were carried out at the European genome and diagnostics center Eurofins GATC Biotech GmbH (Constance, Germany).

    Concentration Assay:

    Article Title: Spatial impacts of a multi-individual grave on microbial and microfaunal communities and soil biogeochemistry
    Article Snippet: DNA was extracted from soils that had been stored at -80°C using the DNeasy Powerlyzer Powersoil kit (QIAGEN Inc.) per manufacturer’s instructions, following recommendations for clay soils. .. All soil DNA extracts were quantified for total DNA concentration using the Quant-iT PicoGreen dsDNA Assay Kit (Invitrogen) on a 96-well microplate reader using reduced assay volumes of 200 μL.

    Article Title: Spatial impacts of a multi-individual grave on microbial and microfaunal communities and soil biogeochemistry
    Article Snippet: Soil biological community assessment methods DNA was extracted from soils that had been stored at -80°C using the DNeasy Powerlyzer Powersoil kit (QIAGEN Inc.) per manufacturer’s instructions, following recommendations for clay soils. .. All soil DNA extracts were quantified for total DNA concentration using the Quant-iT PicoGreen dsDNA Assay Kit (Invitrogen) on a 96-well microplate reader using reduced assay volumes of 200 μL.

    Software:

    Article Title: Effect of Cell Concentration on the Persistence in the Human Intestine of Four Probiotic Strains Administered through a Multispecies Formulation
    Article Snippet: After homogenization, 250 mg of feces were weighed and processed using a DNeasy PowerLyzer PowerSoil kit (Qiagen, Hilden, Germany) for the isolation of total DNA with a minor modification that included incubating samples at 65 °C for 10 min after the addition of the power bead and C1 solutions provided with the kit. .. After isolation, DNA was quantified, and the 260/280 ratio was measured with a Take3 Micro-Volume analyzed in a microplate reader using Gen5 software (BioTek Instruments, Inc., Winooski, VT, USA).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Qiagen dneasy powerlyzer powersoil kit
    Dneasy Powerlyzer Powersoil Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 22 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dneasy powerlyzer powersoil kit/product/Qiagen
    Average 90 stars, based on 22 article reviews
    Price from $9.99 to $1999.99
    dneasy powerlyzer powersoil kit - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results