qiaamp powerfecal dna kit  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    QIAamp PowerFecal DNA Kit
    Description:
    For the isolation of DNA from stool gut material and biosolids Kit contents For the isolation of DNA from stool gut material and biosolids Benefits High quality DNA from up to 250 mg samples in just 30 minutes Optimized for tough DNA samples from stool biosolids and gut material Efficient removal of downstream inhibitors with Inhibitor Removal Technology
    Catalog Number:
    12830-50
    Price:
    293
    Category:
    QIAamp PowerFecal DNA Kit
    Buy from Supplier


    Structured Review

    Qiagen qiaamp powerfecal dna kit
    QIAamp PowerFecal DNA Kit
    For the isolation of DNA from stool gut material and biosolids Kit contents For the isolation of DNA from stool gut material and biosolids Benefits High quality DNA from up to 250 mg samples in just 30 minutes Optimized for tough DNA samples from stool biosolids and gut material Efficient removal of downstream inhibitors with Inhibitor Removal Technology
    https://www.bioz.com/result/qiaamp powerfecal dna kit/product/Qiagen
    Average 90 stars, based on 33 article reviews
    Price from $9.99 to $1999.99
    qiaamp powerfecal dna kit - by Bioz Stars, 2020-01
    90/100 stars

    Images

    1) Product Images from "Comparative evaluation of a new magnetic bead-based DNA extraction method from fecal samples for downstream next-generation 16S rRNA gene sequencing"

    Article Title: Comparative evaluation of a new magnetic bead-based DNA extraction method from fecal samples for downstream next-generation 16S rRNA gene sequencing

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0202858

    Weighted Unifrac principal coordinate analysis (PCoA) of samples with successful amplification and sequencing. Colors denote DNA extraction method: QIAamp ® PowerFecal ® Kit ( red ) and Maxwell ® RSC PureFood GMO and Authentication Kit ( blue ).
    Figure Legend Snippet: Weighted Unifrac principal coordinate analysis (PCoA) of samples with successful amplification and sequencing. Colors denote DNA extraction method: QIAamp ® PowerFecal ® Kit ( red ) and Maxwell ® RSC PureFood GMO and Authentication Kit ( blue ).

    Techniques Used: Amplification, Sequencing, DNA Extraction

    Procrustes-based comparison of microbial composition where longer lines indicate more within-subject dissimilarity of the microbiome. Colors denote DNA extraction method: QIAamp ® PowerFecal ® Kit ( red ) and Maxwell ® RSC PureFood GMO and Authentication Kit ( blue ). Numbers 1–5 denote the 5 technical replicate pairs sequenced with each kit.
    Figure Legend Snippet: Procrustes-based comparison of microbial composition where longer lines indicate more within-subject dissimilarity of the microbiome. Colors denote DNA extraction method: QIAamp ® PowerFecal ® Kit ( red ) and Maxwell ® RSC PureFood GMO and Authentication Kit ( blue ). Numbers 1–5 denote the 5 technical replicate pairs sequenced with each kit.

    Techniques Used: DNA Extraction

    Comparison of DNA extraction methods on next generation sequencing (NGS) relative abundance at the genus level. NGS using DNA extracted with the QIAamp ® PowerFecal ® Kit ( n = 40) and the Maxwell ® RSC PureFood GMO and Authentication Kit ( n .
    Figure Legend Snippet: Comparison of DNA extraction methods on next generation sequencing (NGS) relative abundance at the genus level. NGS using DNA extracted with the QIAamp ® PowerFecal ® Kit ( n = 40) and the Maxwell ® RSC PureFood GMO and Authentication Kit ( n .

    Techniques Used: DNA Extraction, Next-Generation Sequencing

    Comparison of DNA extraction methods on next generation sequencing (NGS) relative abundance at the phylum level. NGS using DNA extracted with the QIAamp ® PowerFecal ® Kit ( n = 40) and the Maxwell ® RSC PureFood GMO and Authentication Kit ( n .
    Figure Legend Snippet: Comparison of DNA extraction methods on next generation sequencing (NGS) relative abundance at the phylum level. NGS using DNA extracted with the QIAamp ® PowerFecal ® Kit ( n = 40) and the Maxwell ® RSC PureFood GMO and Authentication Kit ( n .

    Techniques Used: DNA Extraction, Next-Generation Sequencing

    Alpha diversity metrics compared across DNA extraction methods. (A) Box plot comparing number of observed operational taxonomic units (OTUs) across kits. (B) Box plot of Chao1 diversity estimates for the microbial communities in DNA extracted with both the QIAamp ® PowerFecal ® Kit and the Maxwell ® RSC PureFood GMO and Authentication Kit. (C) Box plot of Shannon diversity index comparing the evenness and abundance of species extracted with the two kits.
    Figure Legend Snippet: Alpha diversity metrics compared across DNA extraction methods. (A) Box plot comparing number of observed operational taxonomic units (OTUs) across kits. (B) Box plot of Chao1 diversity estimates for the microbial communities in DNA extracted with both the QIAamp ® PowerFecal ® Kit and the Maxwell ® RSC PureFood GMO and Authentication Kit. (C) Box plot of Shannon diversity index comparing the evenness and abundance of species extracted with the two kits.

    Techniques Used: DNA Extraction

    2) Product Images from "Comparative evaluation of a new magnetic bead-based DNA extraction method from fecal samples for downstream next-generation 16S rRNA gene sequencing"

    Article Title: Comparative evaluation of a new magnetic bead-based DNA extraction method from fecal samples for downstream next-generation 16S rRNA gene sequencing

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0202858

    Weighted Unifrac principal coordinate analysis (PCoA) of samples with successful amplification and sequencing. Colors denote DNA extraction method: QIAamp ® PowerFecal ® Kit ( red ) and Maxwell ® RSC PureFood GMO and Authentication Kit ( blue ).
    Figure Legend Snippet: Weighted Unifrac principal coordinate analysis (PCoA) of samples with successful amplification and sequencing. Colors denote DNA extraction method: QIAamp ® PowerFecal ® Kit ( red ) and Maxwell ® RSC PureFood GMO and Authentication Kit ( blue ).

    Techniques Used: Amplification, Sequencing, DNA Extraction

    Procrustes-based comparison of microbial composition where longer lines indicate more within-subject dissimilarity of the microbiome. Colors denote DNA extraction method: QIAamp ® PowerFecal ® Kit ( red ) and Maxwell ® RSC PureFood GMO and Authentication Kit ( blue ). Numbers 1–5 denote the 5 technical replicate pairs sequenced with each kit.
    Figure Legend Snippet: Procrustes-based comparison of microbial composition where longer lines indicate more within-subject dissimilarity of the microbiome. Colors denote DNA extraction method: QIAamp ® PowerFecal ® Kit ( red ) and Maxwell ® RSC PureFood GMO and Authentication Kit ( blue ). Numbers 1–5 denote the 5 technical replicate pairs sequenced with each kit.

    Techniques Used: DNA Extraction

    Comparison of DNA extraction methods on next generation sequencing (NGS) relative abundance at the genus level. NGS using DNA extracted with the QIAamp ® PowerFecal ® Kit ( n = 40) and the Maxwell ® RSC PureFood GMO and Authentication Kit ( n = 39) revealed similar proportions of most prominent genera. Bacterial genera with a relative abundance ≥ 0.01 (1%) are visualized here. Relative abundances (mean ± s.d.) for the top 30 most abundant genera are available in S2 Table .
    Figure Legend Snippet: Comparison of DNA extraction methods on next generation sequencing (NGS) relative abundance at the genus level. NGS using DNA extracted with the QIAamp ® PowerFecal ® Kit ( n = 40) and the Maxwell ® RSC PureFood GMO and Authentication Kit ( n = 39) revealed similar proportions of most prominent genera. Bacterial genera with a relative abundance ≥ 0.01 (1%) are visualized here. Relative abundances (mean ± s.d.) for the top 30 most abundant genera are available in S2 Table .

    Techniques Used: DNA Extraction, Next-Generation Sequencing

    Comparison of DNA extraction methods on next generation sequencing (NGS) relative abundance at the phylum level. NGS using DNA extracted with the QIAamp ® PowerFecal ® Kit ( n = 40) and the Maxwell ® RSC PureFood GMO and Authentication Kit ( n = 39) revealed similar proportions of the 9 most prominent phyla. Relative abundances (mean ± s.d.) are available in S1 Table .
    Figure Legend Snippet: Comparison of DNA extraction methods on next generation sequencing (NGS) relative abundance at the phylum level. NGS using DNA extracted with the QIAamp ® PowerFecal ® Kit ( n = 40) and the Maxwell ® RSC PureFood GMO and Authentication Kit ( n = 39) revealed similar proportions of the 9 most prominent phyla. Relative abundances (mean ± s.d.) are available in S1 Table .

    Techniques Used: DNA Extraction, Next-Generation Sequencing

    Alpha diversity metrics compared across DNA extraction methods. (A) Box plot comparing number of observed operational taxonomic units (OTUs) across kits. (B) Box plot of Chao1 diversity estimates for the microbial communities in DNA extracted with both the QIAamp ® PowerFecal ® Kit and the Maxwell ® RSC PureFood GMO and Authentication Kit. (C) Box plot of Shannon diversity index comparing the evenness and abundance of species extracted with the two kits.
    Figure Legend Snippet: Alpha diversity metrics compared across DNA extraction methods. (A) Box plot comparing number of observed operational taxonomic units (OTUs) across kits. (B) Box plot of Chao1 diversity estimates for the microbial communities in DNA extracted with both the QIAamp ® PowerFecal ® Kit and the Maxwell ® RSC PureFood GMO and Authentication Kit. (C) Box plot of Shannon diversity index comparing the evenness and abundance of species extracted with the two kits.

    Techniques Used: DNA Extraction

    Related Articles

    DNA Extraction:

    Article Title: Gut Microbiota in Health and Disease: Disparate effects of antibiotics on hypertension
    Article Snippet: Paragraph title: Genomic DNA Isolation, 16S rRNA Gene Sequencing, and Analysis of Microbiotal Composition ... Fecal DNA was extracted from one fecal pellet (~0.2 g) using QIAamp PowerFecal DNA kit (Qiagen).

    Article Title: Altered fecal microbiota composition in the Flinders sensitive line rat model of depression
    Article Snippet: Paragraph title: DNA extraction ... DNA was extracted using QIAamp PowerFecal DNA Kit (including a bead-beating step; #12830-50; Qiagen, Germany) according to the manufacturer’s instructions and sent to DNASense (Aalborg, Denmark) for 16S rRNA amplicon sequencing.

    Article Title: A Comparison of 16S rRNA Profiles Through Slaughter in Australian Export Beef Abattoirs
    Article Snippet: .. The pellets were washed two times using ultrapure H2 O prior to DNA extraction using QIAamp PowerFecal DNA kit (Qiagen, Valencia, CA, USA) following the manufacturer’s instructions with a modified bead beating step. ..

    Article Title: The microbiota structure in the cecum of laying hens contributes to dissimilar H2S production
    Article Snippet: .. Bacterial DNA extraction, sequence processing and data analysis Approximately 200 mg of cecal content was used for total DNA extraction using a QIAamp PowerFecal DNA Kit (QIAGEN, Germany) following the manufacturer’s instructions. .. DNA quantity and quality were measured on a Qubit 2.0 fluorometer (Thermo Fisher scientific, MA, US) and gel electrophoresis.

    Article Title: The vaginal and fecal microbiomes are related to pregnancy status in beef heifers
    Article Snippet: .. DNA extraction and next-generation sequencing Approximately 0.1 g of thawed feces was used for DNA extraction using the QIAamp PowerFecal DNA Kit (QIAGEN Inc., Germantown, MD, USA) according to the manufacturer’s protocol. .. DNA was extracted from the vaginal swabs using the QIAAmp BiOStic Bacteremia DNA Kit (QIAGEN Inc., Germantown, MD, USA) according to the manufacturer’s protocol.

    Article Title: Microbiome-Metabolomics Analysis Investigating the Impacts of Dietary Starch Types on the Composition and Metabolism of Colonic Microbiota in Finishing Pigs
    Article Snippet: .. DNA Extraction, Illumina MiSeq Sequencing, and Data Processing Total genomic DNA from the individual samples of colonic digesta was extracted using a QIAamp PowerFecal DNA Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions. .. DNA concentrations of every sample were quantified using a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, United States).

    Article Title: Meta-taxonomic analysis of prokaryotic and eukaryotic gut flora in stool samples from visceral leishmaniasis cases and endemic controls in Bihar State India
    Article Snippet: Paragraph title: DNA extraction ... Genomic DNA was extracted with the QIAamp PowerFecal DNA Kit (QIAGEN) following the manufacturer’s protocol with the exception that proteinase K was added after the bead beating step and the sample incubated at 65°C for 30 minutes.

    Nucleic Acid Electrophoresis:

    Article Title: The microbiota structure in the cecum of laying hens contributes to dissimilar H2S production
    Article Snippet: Bacterial DNA extraction, sequence processing and data analysis Approximately 200 mg of cecal content was used for total DNA extraction using a QIAamp PowerFecal DNA Kit (QIAGEN, Germany) following the manufacturer’s instructions. .. DNA quantity and quality were measured on a Qubit 2.0 fluorometer (Thermo Fisher scientific, MA, US) and gel electrophoresis.

    Amplification:

    Article Title: The Ramazzini Institute 13-week pilot study on glyphosate and Roundup administered at human-equivalent dose to Sprague Dawley rats: effects on the microbiome
    Article Snippet: Bacterial 16S PCR and sequencing Rat fecal DNA was extracted using the QIAamp PowerFecal DNA Kit (Qiagen, Valencia, CA) following the manufacturer’s instructions. .. The phylogenetically informative V3–V4 region of 16S rRNA gene was amplified using universal primer 347F/803R [ , ] with dual-barcoding approach previously described [ ].

    Article Title: The Ramazzini Institute 13-week pilot study on glyphosate and Roundup administered at human-equivalent dose to Sprague Dawley rats: effects on the microbiome
    Article Snippet: Rat fecal DNA was extracted using the QIAamp PowerFecal DNA Kit (Qiagen, Valencia, CA) following the manufacturer’s instructions. .. The phylogenetically informative V3–V4 region of 16S rRNA gene was amplified using universal primer 347F/803R [ , ] with dual-barcoding approach previously described [ ].

    Article Title: Gut Microbiota in Health and Disease: Disparate effects of antibiotics on hypertension
    Article Snippet: Fecal DNA was extracted from one fecal pellet (~0.2 g) using QIAamp PowerFecal DNA kit (Qiagen). .. The 16S rRNA gene V3-V4 region was amplified by PCR using Illumina sequencing primers: 5′-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG and 5′-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT.

    Article Title: Altered fecal microbiota composition in the Flinders sensitive line rat model of depression
    Article Snippet: .. DNA was extracted using QIAamp PowerFecal DNA Kit (including a bead-beating step; #12830-50; Qiagen, Germany) according to the manufacturer’s instructions and sent to DNASense (Aalborg, Denmark) for 16S rRNA amplicon sequencing. .. Library preparation Bacterial V4 16S sequencing libraries were prepared using a custom protocol based on an Illumina protocol (#15044223 Rev.

    Article Title: The microbiota structure in the cecum of laying hens contributes to dissimilar H2S production
    Article Snippet: Bacterial DNA extraction, sequence processing and data analysis Approximately 200 mg of cecal content was used for total DNA extraction using a QIAamp PowerFecal DNA Kit (QIAGEN, Germany) following the manufacturer’s instructions. .. The V3-V4 hypervariable regions of 16S rRNA genes were amplified using primers (forward: 5′-CCTACGGGNGGCWGCAG-3′ and reverse: 5′-GACTACHVGGGTATCTAATCC-3′) [ ].

    Article Title: Different Gut Microbial Profiles in Sub-Saharan African and South Asian Women of Childbearing Age Are Primarily Associated With Dietary Intakes
    Article Snippet: Paragraph title: 16S Amplicon Library Construction ... In brief, DNA was extracted from 25 to 50 mg of stool using the QIAamp PowerFecal DNA kit (Qiagen Inc., Carlsbad, CA, United States), which employs chemical and mechanical disruption of biomass.

    Article Title: The vaginal and fecal microbiomes are related to pregnancy status in beef heifers
    Article Snippet: DNA extraction and next-generation sequencing Approximately 0.1 g of thawed feces was used for DNA extraction using the QIAamp PowerFecal DNA Kit (QIAGEN Inc., Germantown, MD, USA) according to the manufacturer’s protocol. .. For library preparation, 10 ng of DNA were used for PCR amplification targeting the V4 region of the 16S rRNA gene.

    Article Title: The impact of Rhodiola rosea on the gut microbial community of Drosophila melanogaster
    Article Snippet: All samples were DNA extracted, amplified, and sequenced by the Integrated Microbiome Resource lab (IMR) at Dalhousie University (Halifax, Canada). .. In brief, DNA was extracted from 5 mg of frozen flies per sample using the QIAamp PowerFecal DNA Kit (Qiagen) per manufacturer’s protocol.

    Article Title: Microbiome-Metabolomics Analysis Investigating the Impacts of Dietary Starch Types on the Composition and Metabolism of Colonic Microbiota in Finishing Pigs
    Article Snippet: DNA Extraction, Illumina MiSeq Sequencing, and Data Processing Total genomic DNA from the individual samples of colonic digesta was extracted using a QIAamp PowerFecal DNA Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions. .. The genes of all bacterial 16S rRNA in the region of V3–V4 were amplified by polymerase chain reaction (PCR) using a universal forward primer 338F (5′-ACTCCTRCGGGAGGCAGCAG-3′) and a reverse primer 806R (5′-GGACTACCVGGGTATCTAAT-3′) ( ).

    Article Title: Meta-taxonomic analysis of prokaryotic and eukaryotic gut flora in stool samples from visceral leishmaniasis cases and endemic controls in Bihar State India
    Article Snippet: Genomic DNA was extracted with the QIAamp PowerFecal DNA Kit (QIAGEN) following the manufacturer’s protocol with the exception that proteinase K was added after the bead beating step and the sample incubated at 65°C for 30 minutes. .. This was to ensure removal of histones from eukaryotic DNA which could inhibit downstream amplification.

    Article Title: Host genetic effects upon the early gut microbiota in a bovine model with graduated spectrum of genetic variation
    Article Snippet: 16S rRNA gene sequencing Genomic DNA was extracted from 500 µL of each fecal sample using the QIAamp PowerFecal DNA kit according to the manufacturer’s instructions (Qiagen, USA). .. Briefly, the V4 region of the 16S rRNA gene was amplified by polymerase chain reaction (PCR) with dual-index primers and Pfx AccuPrime master mix (Invitrogen, USA) [ ].

    Agarose Gel Electrophoresis:

    Article Title: The Ramazzini Institute 13-week pilot study on glyphosate and Roundup administered at human-equivalent dose to Sprague Dawley rats: effects on the microbiome
    Article Snippet: Bacterial 16S PCR and sequencing Rat fecal DNA was extracted using the QIAamp PowerFecal DNA Kit (Qiagen, Valencia, CA) following the manufacturer’s instructions. .. The integrity of the 16S PCR amplicons was verified by agarose gel electrophoresis.

    Article Title: The Ramazzini Institute 13-week pilot study on glyphosate and Roundup administered at human-equivalent dose to Sprague Dawley rats: effects on the microbiome
    Article Snippet: Rat fecal DNA was extracted using the QIAamp PowerFecal DNA Kit (Qiagen, Valencia, CA) following the manufacturer’s instructions. .. The integrity of the 16S PCR amplicons was verified by agarose gel electrophoresis.

    Ligation:

    Article Title: Does exercise impact gut microbiota composition in men receiving androgen deprivation therapy for prostate cancer? A single-blinded, two-armed, randomised controlled trial
    Article Snippet: To extract microbial DNA, samples will be lysed using both mechanical and enzymatic breakdown of the bacterial cell membranes and the DNA extracted using the QIAamp PowerFecal DNA kit (Qiagen; Hilden, Germany). .. For building the sequence libraries, a PCR-free ligation protocol will be deployed with sample barcodes that are never reused in our laboratory.

    Next-Generation Sequencing:

    Article Title: The vaginal and fecal microbiomes are related to pregnancy status in beef heifers
    Article Snippet: .. DNA extraction and next-generation sequencing Approximately 0.1 g of thawed feces was used for DNA extraction using the QIAamp PowerFecal DNA Kit (QIAGEN Inc., Germantown, MD, USA) according to the manufacturer’s protocol. .. DNA was extracted from the vaginal swabs using the QIAAmp BiOStic Bacteremia DNA Kit (QIAGEN Inc., Germantown, MD, USA) according to the manufacturer’s protocol.

    Transferring:

    Article Title: Meta-taxonomic analysis of prokaryotic and eukaryotic gut flora in stool samples from visceral leishmaniasis cases and endemic controls in Bihar State India
    Article Snippet: DNA extraction A portion (200μg) of each stool sample (as above) was transferred to OMNIgene GUT tubes (DNA Genotek) following the OMNIgene GUT protocol for transferring specimens from the collection tubes to this kit (protocol PD-PR-00434). .. Genomic DNA was extracted with the QIAamp PowerFecal DNA Kit (QIAGEN) following the manufacturer’s protocol with the exception that proteinase K was added after the bead beating step and the sample incubated at 65°C for 30 minutes.

    Generated:

    Article Title: Does exercise impact gut microbiota composition in men receiving androgen deprivation therapy for prostate cancer? A single-blinded, two-armed, randomised controlled trial
    Article Snippet: To extract microbial DNA, samples will be lysed using both mechanical and enzymatic breakdown of the bacterial cell membranes and the DNA extracted using the QIAamp PowerFecal DNA kit (Qiagen; Hilden, Germany). .. Microbiome signatures will be generated using the Illumina MiSeq platform using barcoded primer, V4 (515–806).

    Article Title: Different Gut Microbial Profiles in Sub-Saharan African and South Asian Women of Childbearing Age Are Primarily Associated With Dietary Intakes
    Article Snippet: In brief, DNA was extracted from 25 to 50 mg of stool using the QIAamp PowerFecal DNA kit (Qiagen Inc., Carlsbad, CA, United States), which employs chemical and mechanical disruption of biomass. .. PCR amplicons were generated using barcoded ( ) primers that target approximately 450 basepairs of the V3V4 variable region of the 16S rRNA gene (338F: 5′ACTCCTACGGGAGGCAGCAG and 806R: 5′ GGACTACHVGGGTWTCTAAT) ( ; ).

    Spectrophotometry:

    Article Title: Microbiome-Metabolomics Analysis Investigating the Impacts of Dietary Starch Types on the Composition and Metabolism of Colonic Microbiota in Finishing Pigs
    Article Snippet: DNA Extraction, Illumina MiSeq Sequencing, and Data Processing Total genomic DNA from the individual samples of colonic digesta was extracted using a QIAamp PowerFecal DNA Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions. .. DNA concentrations of every sample were quantified using a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, United States).

    Article Title: Host genetic effects upon the early gut microbiota in a bovine model with graduated spectrum of genetic variation
    Article Snippet: 16S rRNA gene sequencing Genomic DNA was extracted from 500 µL of each fecal sample using the QIAamp PowerFecal DNA kit according to the manufacturer’s instructions (Qiagen, USA). .. The concentration and purity of the DNA were measured using a Nanodrop instrument (Spectrophotometer ND-1000, Thermo Fisher Scientific, USA).

    Purification:

    Article Title: Different Gut Microbial Profiles in Sub-Saharan African and South Asian Women of Childbearing Age Are Primarily Associated With Dietary Intakes
    Article Snippet: In brief, DNA was extracted from 25 to 50 mg of stool using the QIAamp PowerFecal DNA kit (Qiagen Inc., Carlsbad, CA, United States), which employs chemical and mechanical disruption of biomass. .. The amplicon pool was partially lyophilized to reduce its volume then purified and concentrated using a DNA Clean and Concentrator Kit (Zymo, Irvine, CA, United States).

    Article Title: Microbiome-Metabolomics Analysis Investigating the Impacts of Dietary Starch Types on the Composition and Metabolism of Colonic Microbiota in Finishing Pigs
    Article Snippet: DNA Extraction, Illumina MiSeq Sequencing, and Data Processing Total genomic DNA from the individual samples of colonic digesta was extracted using a QIAamp PowerFecal DNA Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions. .. PCR amplicons were purified using the AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union City, CA, United States), according to the manufacturer’s instructions.

    Article Title: Meta-taxonomic analysis of prokaryotic and eukaryotic gut flora in stool samples from visceral leishmaniasis cases and endemic controls in Bihar State India
    Article Snippet: Genomic DNA was extracted with the QIAamp PowerFecal DNA Kit (QIAGEN) following the manufacturer’s protocol with the exception that proteinase K was added after the bead beating step and the sample incubated at 65°C for 30 minutes. .. Purified genomic DNA was eluted in 100μl of PCR-grade water.

    Article Title: Ancient DNA from mastics solidifies connection between material culture and genetics of mesolithic hunter–gatherers in Scandinavia
    Article Snippet: The extract was purified using MinElute spin columns and a buffer set (both Qiagen). .. We performed an extraction on ble008 sample using QIAamp PowerFecal DNA Kit (Qiagen), which is used to remove inhibitors in stool, gut and biosolid samples.

    Sequencing:

    Article Title: The Ramazzini Institute 13-week pilot study on glyphosate and Roundup administered at human-equivalent dose to Sprague Dawley rats: effects on the microbiome
    Article Snippet: .. Bacterial 16S PCR and sequencing Rat fecal DNA was extracted using the QIAamp PowerFecal DNA Kit (Qiagen, Valencia, CA) following the manufacturer’s instructions. .. Total DNA concentration was determined by Qubit 2.0 Fluorometer (Life technologies, Norwalk, CT).

    Article Title: The Ramazzini Institute 13-week pilot study on glyphosate and Roundup administered at human-equivalent dose to Sprague Dawley rats: effects on the microbiome
    Article Snippet: Paragraph title: Bacterial 16S PCR and sequencing ... Rat fecal DNA was extracted using the QIAamp PowerFecal DNA Kit (Qiagen, Valencia, CA) following the manufacturer’s instructions.

    Article Title: Gut Microbiota in Health and Disease: Disparate effects of antibiotics on hypertension
    Article Snippet: Paragraph title: Genomic DNA Isolation, 16S rRNA Gene Sequencing, and Analysis of Microbiotal Composition ... Fecal DNA was extracted from one fecal pellet (~0.2 g) using QIAamp PowerFecal DNA kit (Qiagen).

    Article Title: Does exercise impact gut microbiota composition in men receiving androgen deprivation therapy for prostate cancer? A single-blinded, two-armed, randomised controlled trial
    Article Snippet: To extract microbial DNA, samples will be lysed using both mechanical and enzymatic breakdown of the bacterial cell membranes and the DNA extracted using the QIAamp PowerFecal DNA kit (Qiagen; Hilden, Germany). .. Quality control samples are included in the analysis from sample collection to sequence analysis and all samples will be individually screened for PCR efficiency prior to building sequence libraries.

    Article Title: Altered fecal microbiota composition in the Flinders sensitive line rat model of depression
    Article Snippet: .. DNA was extracted using QIAamp PowerFecal DNA Kit (including a bead-beating step; #12830-50; Qiagen, Germany) according to the manufacturer’s instructions and sent to DNASense (Aalborg, Denmark) for 16S rRNA amplicon sequencing. .. Library preparation Bacterial V4 16S sequencing libraries were prepared using a custom protocol based on an Illumina protocol (#15044223 Rev.

    Article Title: The microbiota structure in the cecum of laying hens contributes to dissimilar H2S production
    Article Snippet: .. Bacterial DNA extraction, sequence processing and data analysis Approximately 200 mg of cecal content was used for total DNA extraction using a QIAamp PowerFecal DNA Kit (QIAGEN, Germany) following the manufacturer’s instructions. .. DNA quantity and quality were measured on a Qubit 2.0 fluorometer (Thermo Fisher scientific, MA, US) and gel electrophoresis.

    Article Title: Oral Administration of Clinically Relevant Antimalarial Drugs Does Not Modify the Murine Gut Microbiota
    Article Snippet: DNA was extracted using the QIAamp PowerFecal DNA kit (QIAGEN, Germantown, MD) according to the manufacturer’s instructions. .. DNA samples were then shipped overnight on ice to the Genome Technology Access Center at Washington University (GTAC, St. Louis, MO) for sequencing and analysis using the Multiple 16S Variable Region Species-Level IdentificatiON (MVRSION) algorithm .

    Article Title: Different Gut Microbial Profiles in Sub-Saharan African and South Asian Women of Childbearing Age Are Primarily Associated With Dietary Intakes
    Article Snippet: 16S Amplicon Library Construction Bacterial profiles were determined by broad-range amplification and sequence analysis of 16S rRNA genes following our previously described methods ( ; ). .. In brief, DNA was extracted from 25 to 50 mg of stool using the QIAamp PowerFecal DNA kit (Qiagen Inc., Carlsbad, CA, United States), which employs chemical and mechanical disruption of biomass.

    Article Title: The impact of Rhodiola rosea on the gut microbial community of Drosophila melanogaster
    Article Snippet: Paragraph title: 16S rRNA gene sequencing ... In brief, DNA was extracted from 5 mg of frozen flies per sample using the QIAamp PowerFecal DNA Kit (Qiagen) per manufacturer’s protocol.

    Article Title: Microbiome-Metabolomics Analysis Investigating the Impacts of Dietary Starch Types on the Composition and Metabolism of Colonic Microbiota in Finishing Pigs
    Article Snippet: .. DNA Extraction, Illumina MiSeq Sequencing, and Data Processing Total genomic DNA from the individual samples of colonic digesta was extracted using a QIAamp PowerFecal DNA Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions. .. DNA concentrations of every sample were quantified using a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, United States).

    Article Title: Host genetic effects upon the early gut microbiota in a bovine model with graduated spectrum of genetic variation
    Article Snippet: .. 16S rRNA gene sequencing Genomic DNA was extracted from 500 µL of each fecal sample using the QIAamp PowerFecal DNA kit according to the manufacturer’s instructions (Qiagen, USA). .. The concentration and purity of the DNA were measured using a Nanodrop instrument (Spectrophotometer ND-1000, Thermo Fisher Scientific, USA).

    Concentration Assay:

    Article Title: The Ramazzini Institute 13-week pilot study on glyphosate and Roundup administered at human-equivalent dose to Sprague Dawley rats: effects on the microbiome
    Article Snippet: Bacterial 16S PCR and sequencing Rat fecal DNA was extracted using the QIAamp PowerFecal DNA Kit (Qiagen, Valencia, CA) following the manufacturer’s instructions. .. Total DNA concentration was determined by Qubit 2.0 Fluorometer (Life technologies, Norwalk, CT).

    Article Title: The Ramazzini Institute 13-week pilot study on glyphosate and Roundup administered at human-equivalent dose to Sprague Dawley rats: effects on the microbiome
    Article Snippet: Rat fecal DNA was extracted using the QIAamp PowerFecal DNA Kit (Qiagen, Valencia, CA) following the manufacturer’s instructions. .. Total DNA concentration was determined by Qubit 2.0 Fluorometer (Life technologies, Norwalk, CT).

    Article Title: The vaginal and fecal microbiomes are related to pregnancy status in beef heifers
    Article Snippet: DNA extraction and next-generation sequencing Approximately 0.1 g of thawed feces was used for DNA extraction using the QIAamp PowerFecal DNA Kit (QIAGEN Inc., Germantown, MD, USA) according to the manufacturer’s protocol. .. Nanodrop One C (Fisher Scientific, Hanover Park, IL, USA) was used to measure the DNA concentration and purity.

    Article Title: Host genetic effects upon the early gut microbiota in a bovine model with graduated spectrum of genetic variation
    Article Snippet: 16S rRNA gene sequencing Genomic DNA was extracted from 500 µL of each fecal sample using the QIAamp PowerFecal DNA kit according to the manufacturer’s instructions (Qiagen, USA). .. The concentration and purity of the DNA were measured using a Nanodrop instrument (Spectrophotometer ND-1000, Thermo Fisher Scientific, USA).

    Incubation:

    Article Title: Meta-taxonomic analysis of prokaryotic and eukaryotic gut flora in stool samples from visceral leishmaniasis cases and endemic controls in Bihar State India
    Article Snippet: .. Genomic DNA was extracted with the QIAamp PowerFecal DNA Kit (QIAGEN) following the manufacturer’s protocol with the exception that proteinase K was added after the bead beating step and the sample incubated at 65°C for 30 minutes. .. This was to ensure removal of histones from eukaryotic DNA which could inhibit downstream amplification.

    Article Title: Ancient DNA from mastics solidifies connection between material culture and genetics of mesolithic hunter–gatherers in Scandinavia
    Article Snippet: We performed an extraction on ble008 sample using QIAamp PowerFecal DNA Kit (Qiagen), which is used to remove inhibitors in stool, gut and biosolid samples. .. After adding the reagents according to the protocol and performing the first incubation step, we used a thermoshaker and vortexed the samples at 65 °C for 30 min at the highest speed available.

    Polymerase Chain Reaction:

    Article Title: The Ramazzini Institute 13-week pilot study on glyphosate and Roundup administered at human-equivalent dose to Sprague Dawley rats: effects on the microbiome
    Article Snippet: .. Bacterial 16S PCR and sequencing Rat fecal DNA was extracted using the QIAamp PowerFecal DNA Kit (Qiagen, Valencia, CA) following the manufacturer’s instructions. .. Total DNA concentration was determined by Qubit 2.0 Fluorometer (Life technologies, Norwalk, CT).

    Article Title: The Ramazzini Institute 13-week pilot study on glyphosate and Roundup administered at human-equivalent dose to Sprague Dawley rats: effects on the microbiome
    Article Snippet: Paragraph title: Bacterial 16S PCR and sequencing ... Rat fecal DNA was extracted using the QIAamp PowerFecal DNA Kit (Qiagen, Valencia, CA) following the manufacturer’s instructions.

    Article Title: Gut Microbiota in Health and Disease: Disparate effects of antibiotics on hypertension
    Article Snippet: Fecal DNA was extracted from one fecal pellet (~0.2 g) using QIAamp PowerFecal DNA kit (Qiagen). .. The 16S rRNA gene V3-V4 region was amplified by PCR using Illumina sequencing primers: 5′-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG and 5′-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT.

    Article Title: Does exercise impact gut microbiota composition in men receiving androgen deprivation therapy for prostate cancer? A single-blinded, two-armed, randomised controlled trial
    Article Snippet: To extract microbial DNA, samples will be lysed using both mechanical and enzymatic breakdown of the bacterial cell membranes and the DNA extracted using the QIAamp PowerFecal DNA kit (Qiagen; Hilden, Germany). .. Quality control samples are included in the analysis from sample collection to sequence analysis and all samples will be individually screened for PCR efficiency prior to building sequence libraries.

    Article Title: The microbiota structure in the cecum of laying hens contributes to dissimilar H2S production
    Article Snippet: Bacterial DNA extraction, sequence processing and data analysis Approximately 200 mg of cecal content was used for total DNA extraction using a QIAamp PowerFecal DNA Kit (QIAGEN, Germany) following the manufacturer’s instructions. .. PCR amplifications were carried out using 25 μL reaction mixtures containing 12.5 μL 2X KAPA HiFi HotStart ReadyMix (Kapa Biosystems, UK), 5 μL forward and reverse primers and 2.5 μL DNA template.

    Article Title: Different Gut Microbial Profiles in Sub-Saharan African and South Asian Women of Childbearing Age Are Primarily Associated With Dietary Intakes
    Article Snippet: In brief, DNA was extracted from 25 to 50 mg of stool using the QIAamp PowerFecal DNA kit (Qiagen Inc., Carlsbad, CA, United States), which employs chemical and mechanical disruption of biomass. .. PCR amplicons were generated using barcoded ( ) primers that target approximately 450 basepairs of the V3V4 variable region of the 16S rRNA gene (338F: 5′ACTCCTACGGGAGGCAGCAG and 806R: 5′ GGACTACHVGGGTWTCTAAT) ( ; ).

    Article Title: The vaginal and fecal microbiomes are related to pregnancy status in beef heifers
    Article Snippet: DNA extraction and next-generation sequencing Approximately 0.1 g of thawed feces was used for DNA extraction using the QIAamp PowerFecal DNA Kit (QIAGEN Inc., Germantown, MD, USA) according to the manufacturer’s protocol. .. For library preparation, 10 ng of DNA were used for PCR amplification targeting the V4 region of the 16S rRNA gene.

    Article Title: The impact of Rhodiola rosea on the gut microbial community of Drosophila melanogaster
    Article Snippet: In brief, DNA was extracted from 5 mg of frozen flies per sample using the QIAamp PowerFecal DNA Kit (Qiagen) per manufacturer’s protocol. .. All DNA samples were amplified by PCR targeting the 16S rRNA gene sequence (regions V6–V8) as previously demonstrated [ ], and libraries were prepared by following the guidelines provided by Illumina (San Diego, USA; Part #15044223, Rev.

    Article Title: Microbiome-Metabolomics Analysis Investigating the Impacts of Dietary Starch Types on the Composition and Metabolism of Colonic Microbiota in Finishing Pigs
    Article Snippet: DNA Extraction, Illumina MiSeq Sequencing, and Data Processing Total genomic DNA from the individual samples of colonic digesta was extracted using a QIAamp PowerFecal DNA Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions. .. The genes of all bacterial 16S rRNA in the region of V3–V4 were amplified by polymerase chain reaction (PCR) using a universal forward primer 338F (5′-ACTCCTRCGGGAGGCAGCAG-3′) and a reverse primer 806R (5′-GGACTACCVGGGTATCTAAT-3′) ( ).

    Article Title: Host genetic effects upon the early gut microbiota in a bovine model with graduated spectrum of genetic variation
    Article Snippet: 16S rRNA gene sequencing Genomic DNA was extracted from 500 µL of each fecal sample using the QIAamp PowerFecal DNA kit according to the manufacturer’s instructions (Qiagen, USA). .. Briefly, the V4 region of the 16S rRNA gene was amplified by polymerase chain reaction (PCR) with dual-index primers and Pfx AccuPrime master mix (Invitrogen, USA) [ ].

    Modification:

    Article Title: A Comparison of 16S rRNA Profiles Through Slaughter in Australian Export Beef Abattoirs
    Article Snippet: .. The pellets were washed two times using ultrapure H2 O prior to DNA extraction using QIAamp PowerFecal DNA kit (Qiagen, Valencia, CA, USA) following the manufacturer’s instructions with a modified bead beating step. ..

    Gel Extraction:

    Article Title: Microbiome-Metabolomics Analysis Investigating the Impacts of Dietary Starch Types on the Composition and Metabolism of Colonic Microbiota in Finishing Pigs
    Article Snippet: DNA Extraction, Illumina MiSeq Sequencing, and Data Processing Total genomic DNA from the individual samples of colonic digesta was extracted using a QIAamp PowerFecal DNA Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions. .. PCR amplicons were purified using the AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union City, CA, United States), according to the manufacturer’s instructions.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Qiagen qiaamp powerfecal dna kit
    Qiaamp Powerfecal Dna Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 26 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qiaamp powerfecal dna kit/product/Qiagen
    Average 90 stars, based on 26 article reviews
    Price from $9.99 to $1999.99
    qiaamp powerfecal dna kit - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results