11842 type strain  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    ATCC 11842 type strain
    11842 Type Strain, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/11842 type strain/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    11842 type strain - by Bioz Stars, 2023-12
    86/100 stars

    Images

    l delbrueckii atcc 11842  (ATCC)


    Bioz Verified Symbol ATCC is a verified supplier
    Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    ATCC l delbrueckii atcc 11842
    In vitro effects of cell-free supernatants on CRC cells.
    L Delbrueckii Atcc 11842, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/l delbrueckii atcc 11842/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    l delbrueckii atcc 11842 - by Bioz Stars, 2023-12
    86/100 stars

    Images

    1) Product Images from "Probiotic-Derived Bioactive Compounds in Colorectal Cancer Treatment"

    Article Title: Probiotic-Derived Bioactive Compounds in Colorectal Cancer Treatment

    Journal: Microorganisms

    doi: 10.3390/microorganisms11081898

    In vitro effects of cell-free supernatants on CRC cells.
    Figure Legend Snippet: In vitro effects of cell-free supernatants on CRC cells.

    Techniques Used: In Vitro, Activity Assay, Inhibition, Expressing

    l delbrueckii subsp bulgaricus atcc 11842  (ATCC)


    Bioz Verified Symbol ATCC is a verified supplier
    Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    ATCC l delbrueckii subsp bulgaricus atcc 11842
    Multilocus sequence analysis (MLSA) of Lactobacillus <t>delbrueckii</t> strains. The subspecies are indicated by colored circles: L. delbrueckii subsp. bulgaricus in blue, L. delbrueckii subsp. lactis in red and L. delbrueckii subsp. delbrueckii in green. Lactococcus lactis SK11 (black circle) was used as an outgroup.
    L Delbrueckii Subsp Bulgaricus Atcc 11842, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/l delbrueckii subsp bulgaricus atcc 11842/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    l delbrueckii subsp bulgaricus atcc 11842 - by Bioz Stars, 2023-12
    86/100 stars

    Images

    1) Product Images from "In Silico Comparative Genomic Analysis Revealed a Highly Conserved Proteolytic System in Lactobacillus delbrueckii"

    Article Title: In Silico Comparative Genomic Analysis Revealed a Highly Conserved Proteolytic System in Lactobacillus delbrueckii

    Journal: International Journal of Molecular Sciences

    doi: 10.3390/ijms241411309

    Multilocus sequence analysis (MLSA) of Lactobacillus delbrueckii strains. The subspecies are indicated by colored circles: L. delbrueckii subsp. bulgaricus in blue, L. delbrueckii subsp. lactis in red and L. delbrueckii subsp. delbrueckii in green. Lactococcus lactis SK11 (black circle) was used as an outgroup.
    Figure Legend Snippet: Multilocus sequence analysis (MLSA) of Lactobacillus delbrueckii strains. The subspecies are indicated by colored circles: L. delbrueckii subsp. bulgaricus in blue, L. delbrueckii subsp. lactis in red and L. delbrueckii subsp. delbrueckii in green. Lactococcus lactis SK11 (black circle) was used as an outgroup.

    Techniques Used: Sequencing

    Pangenome analysis of principal peptidases of L. delbrueckii strains.
    Figure Legend Snippet: Pangenome analysis of principal peptidases of L. delbrueckii strains.

    Techniques Used:

    Structure prediction model of the proteinase from L. delbrueckii subsp . lactis CRL 581. A cartoon representation of a protein monomer shown in rainbow colors from red at the N-terminus to blue at the C-terminus. The active site of the enzyme contains the catalytic triad of amino acids: D, H, and S.
    Figure Legend Snippet: Structure prediction model of the proteinase from L. delbrueckii subsp . lactis CRL 581. A cartoon representation of a protein monomer shown in rainbow colors from red at the N-terminus to blue at the C-terminus. The active site of the enzyme contains the catalytic triad of amino acids: D, H, and S.

    Techniques Used:

    Phylogenetic analysis and identity percentage of proteinases in L. delbrueckii subspecies. Evolutionary relationships were inferred using the method of joining neighbors. Evolutionary distances were calculated using the p distance method and are expressed as the number of different amino acids per site. The PrtP proteinase from Lactococcus lactis subsp. cremoris SK11 was used as an outgroup. The percentages of identity between the proteinases of each strain are shown in the table. L. delbrueckii subsp. bulgaricus strains are marked with a blue dot, L. delbrueckii subsp. delbrueckii strains with a green dot, and L. delbrueckii subsp. lactis with a red dot.
    Figure Legend Snippet: Phylogenetic analysis and identity percentage of proteinases in L. delbrueckii subspecies. Evolutionary relationships were inferred using the method of joining neighbors. Evolutionary distances were calculated using the p distance method and are expressed as the number of different amino acids per site. The PrtP proteinase from Lactococcus lactis subsp. cremoris SK11 was used as an outgroup. The percentages of identity between the proteinases of each strain are shown in the table. L. delbrueckii subsp. bulgaricus strains are marked with a blue dot, L. delbrueckii subsp. delbrueckii strains with a green dot, and L. delbrueckii subsp. lactis with a red dot.

    Techniques Used:

    Synteny analysis of the prt region in L. delbrueckii type strains. ( A ). Comparison of synteny in L. delbrueckii strains for the prt region (14 Kb). The following genes are represented: aspartate ammonium lyase asnA (dark blue), acetyltransferase LBLM1_05370 (blue), proteinase prt (red), cystathionine beta-lyase patC (yellow), heat shock protein htpX2 (green), and hypothetical proteins in gray. The black color indicates the insertion sequence in the DSM 20072 strain. ( B ). Representation of insertion sequences upstream of the gene patC in the DSM 20072 strain are represented. Black arrows indicate reversed repetitions, while white arrows indicate direct repetitions. The nucleotides in the sequence indicate the direct repeat where inserts of the IS110 insertion sequence are found.
    Figure Legend Snippet: Synteny analysis of the prt region in L. delbrueckii type strains. ( A ). Comparison of synteny in L. delbrueckii strains for the prt region (14 Kb). The following genes are represented: aspartate ammonium lyase asnA (dark blue), acetyltransferase LBLM1_05370 (blue), proteinase prt (red), cystathionine beta-lyase patC (yellow), heat shock protein htpX2 (green), and hypothetical proteins in gray. The black color indicates the insertion sequence in the DSM 20072 strain. ( B ). Representation of insertion sequences upstream of the gene patC in the DSM 20072 strain are represented. Black arrows indicate reversed repetitions, while white arrows indicate direct repetitions. The nucleotides in the sequence indicate the direct repeat where inserts of the IS110 insertion sequence are found.

    Techniques Used: Sequencing

    Putative promoter sequences of the prt gene for different strains of L. delbrueckii .
    Figure Legend Snippet: Putative promoter sequences of the prt gene for different strains of L. delbrueckii .

    Techniques Used:

    Comparative analysis of putative promoter sequences of CEPs from L. delbrueckii subspecies. Alignment of putative promoter sequences of CEPs from L. delbrueckii subsp. bulgaricus ATCC 11842, L. delbrueckii subsp. delbrueckii DSM 20074, and L. delbrueckii subsp. lactis DSM 20072. The figure depicts the 500 bp sequence upstream of the ATG start codon, indicating the UP element, the -0 element, the -35 element, and the ribosome binding site.
    Figure Legend Snippet: Comparative analysis of putative promoter sequences of CEPs from L. delbrueckii subspecies. Alignment of putative promoter sequences of CEPs from L. delbrueckii subsp. bulgaricus ATCC 11842, L. delbrueckii subsp. delbrueckii DSM 20074, and L. delbrueckii subsp. lactis DSM 20072. The figure depicts the 500 bp sequence upstream of the ATG start codon, indicating the UP element, the -0 element, the -35 element, and the ribosome binding site.

    Techniques Used: Sequencing, Binding Assay

    Sequence logo representation of the putative promoter consensus for the prt gene in Lactobacillus delbrueckii strains. Nucleotides that differ from those in the promoter described for the NCDO1489 strain are shown in blue.
    Figure Legend Snippet: Sequence logo representation of the putative promoter consensus for the prt gene in Lactobacillus delbrueckii strains. Nucleotides that differ from those in the promoter described for the NCDO1489 strain are shown in blue.

    Techniques Used: Sequencing

    Genomes of Lactobacillus delbrueckii strains used in this work.
    Figure Legend Snippet: Genomes of Lactobacillus delbrueckii strains used in this work.

    Techniques Used: Plasmid Preparation

    l delbrueckii subsp bulgaricus atcc 11842  (ATCC)


    Bioz Verified Symbol ATCC is a verified supplier
    Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    ATCC l delbrueckii subsp bulgaricus atcc 11842
    Multilocus sequence analysis (MLSA) of Lactobacillus <t>delbrueckii</t> strains. The subspecies are indicated by colored circles: L. delbrueckii subsp. bulgaricus in blue, L. delbrueckii subsp. lactis in red and L. delbrueckii subsp. delbrueckii in green. Lactococcus lactis SK11 (black circle) was used as an outgroup.
    L Delbrueckii Subsp Bulgaricus Atcc 11842, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/l delbrueckii subsp bulgaricus atcc 11842/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    l delbrueckii subsp bulgaricus atcc 11842 - by Bioz Stars, 2023-12
    86/100 stars

    Images

    1) Product Images from "In Silico Comparative Genomic Analysis Revealed a Highly Conserved Proteolytic System in Lactobacillus delbrueckii"

    Article Title: In Silico Comparative Genomic Analysis Revealed a Highly Conserved Proteolytic System in Lactobacillus delbrueckii

    Journal: International Journal of Molecular Sciences

    doi: 10.3390/ijms241411309

    Multilocus sequence analysis (MLSA) of Lactobacillus delbrueckii strains. The subspecies are indicated by colored circles: L. delbrueckii subsp. bulgaricus in blue, L. delbrueckii subsp. lactis in red and L. delbrueckii subsp. delbrueckii in green. Lactococcus lactis SK11 (black circle) was used as an outgroup.
    Figure Legend Snippet: Multilocus sequence analysis (MLSA) of Lactobacillus delbrueckii strains. The subspecies are indicated by colored circles: L. delbrueckii subsp. bulgaricus in blue, L. delbrueckii subsp. lactis in red and L. delbrueckii subsp. delbrueckii in green. Lactococcus lactis SK11 (black circle) was used as an outgroup.

    Techniques Used: Sequencing

    Pangenome analysis of principal peptidases of L. delbrueckii strains.
    Figure Legend Snippet: Pangenome analysis of principal peptidases of L. delbrueckii strains.

    Techniques Used:

    Structure prediction model of the proteinase from L. delbrueckii subsp . lactis CRL 581. A cartoon representation of a protein monomer shown in rainbow colors from red at the N-terminus to blue at the C-terminus. The active site of the enzyme contains the catalytic triad of amino acids: D, H, and S.
    Figure Legend Snippet: Structure prediction model of the proteinase from L. delbrueckii subsp . lactis CRL 581. A cartoon representation of a protein monomer shown in rainbow colors from red at the N-terminus to blue at the C-terminus. The active site of the enzyme contains the catalytic triad of amino acids: D, H, and S.

    Techniques Used:

    Phylogenetic analysis and identity percentage of proteinases in L. delbrueckii subspecies. Evolutionary relationships were inferred using the method of joining neighbors. Evolutionary distances were calculated using the p distance method and are expressed as the number of different amino acids per site. The PrtP proteinase from Lactococcus lactis subsp. cremoris SK11 was used as an outgroup. The percentages of identity between the proteinases of each strain are shown in the table. L. delbrueckii subsp. bulgaricus strains are marked with a blue dot, L. delbrueckii subsp. delbrueckii strains with a green dot, and L. delbrueckii subsp. lactis with a red dot.
    Figure Legend Snippet: Phylogenetic analysis and identity percentage of proteinases in L. delbrueckii subspecies. Evolutionary relationships were inferred using the method of joining neighbors. Evolutionary distances were calculated using the p distance method and are expressed as the number of different amino acids per site. The PrtP proteinase from Lactococcus lactis subsp. cremoris SK11 was used as an outgroup. The percentages of identity between the proteinases of each strain are shown in the table. L. delbrueckii subsp. bulgaricus strains are marked with a blue dot, L. delbrueckii subsp. delbrueckii strains with a green dot, and L. delbrueckii subsp. lactis with a red dot.

    Techniques Used:

    Synteny analysis of the prt region in L. delbrueckii type strains. ( A ). Comparison of synteny in L. delbrueckii strains for the prt region (14 Kb). The following genes are represented: aspartate ammonium lyase asnA (dark blue), acetyltransferase LBLM1_05370 (blue), proteinase prt (red), cystathionine beta-lyase patC (yellow), heat shock protein htpX2 (green), and hypothetical proteins in gray. The black color indicates the insertion sequence in the DSM 20072 strain. ( B ). Representation of insertion sequences upstream of the gene patC in the DSM 20072 strain are represented. Black arrows indicate reversed repetitions, while white arrows indicate direct repetitions. The nucleotides in the sequence indicate the direct repeat where inserts of the IS110 insertion sequence are found.
    Figure Legend Snippet: Synteny analysis of the prt region in L. delbrueckii type strains. ( A ). Comparison of synteny in L. delbrueckii strains for the prt region (14 Kb). The following genes are represented: aspartate ammonium lyase asnA (dark blue), acetyltransferase LBLM1_05370 (blue), proteinase prt (red), cystathionine beta-lyase patC (yellow), heat shock protein htpX2 (green), and hypothetical proteins in gray. The black color indicates the insertion sequence in the DSM 20072 strain. ( B ). Representation of insertion sequences upstream of the gene patC in the DSM 20072 strain are represented. Black arrows indicate reversed repetitions, while white arrows indicate direct repetitions. The nucleotides in the sequence indicate the direct repeat where inserts of the IS110 insertion sequence are found.

    Techniques Used: Sequencing

    Putative promoter sequences of the prt gene for different strains of L. delbrueckii .
    Figure Legend Snippet: Putative promoter sequences of the prt gene for different strains of L. delbrueckii .

    Techniques Used:

    Comparative analysis of putative promoter sequences of CEPs from L. delbrueckii subspecies. Alignment of putative promoter sequences of CEPs from L. delbrueckii subsp. bulgaricus ATCC 11842, L. delbrueckii subsp. delbrueckii DSM 20074, and L. delbrueckii subsp. lactis DSM 20072. The figure depicts the 500 bp sequence upstream of the ATG start codon, indicating the UP element, the -0 element, the -35 element, and the ribosome binding site.
    Figure Legend Snippet: Comparative analysis of putative promoter sequences of CEPs from L. delbrueckii subspecies. Alignment of putative promoter sequences of CEPs from L. delbrueckii subsp. bulgaricus ATCC 11842, L. delbrueckii subsp. delbrueckii DSM 20074, and L. delbrueckii subsp. lactis DSM 20072. The figure depicts the 500 bp sequence upstream of the ATG start codon, indicating the UP element, the -0 element, the -35 element, and the ribosome binding site.

    Techniques Used: Sequencing, Binding Assay

    Sequence logo representation of the putative promoter consensus for the prt gene in Lactobacillus delbrueckii strains. Nucleotides that differ from those in the promoter described for the NCDO1489 strain are shown in blue.
    Figure Legend Snippet: Sequence logo representation of the putative promoter consensus for the prt gene in Lactobacillus delbrueckii strains. Nucleotides that differ from those in the promoter described for the NCDO1489 strain are shown in blue.

    Techniques Used: Sequencing

    Genomes of Lactobacillus delbrueckii strains used in this work.
    Figure Legend Snippet: Genomes of Lactobacillus delbrueckii strains used in this work.

    Techniques Used: Plasmid Preparation

    bulgaricus atcc 11842  (ATCC)


    Bioz Verified Symbol ATCC is a verified supplier
    Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    ATCC bulgaricus atcc 11842
    Bulgaricus Atcc 11842, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bulgaricus atcc 11842/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    bulgaricus atcc 11842 - by Bioz Stars, 2023-12
    86/100 stars

    Images

    l delbrueckii subsp bulgaricus atcc 11842  (ATCC)


    Bioz Verified Symbol ATCC is a verified supplier
    Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    ATCC l delbrueckii subsp bulgaricus atcc 11842
    ( a ) L. <t>delbrueckii</t> subsp. bulgaricus ATCC 11842; ( b ) L. helveticus LH-B01; ( c ) L. delbrueckii subsp. lactis ATCC 4797; ( d ) L. acidophilus La-5. Survival of lactobacilli strains under digestive juice conditions (log(CFU/mL)); nd, not detected; a–f means with different lowercase letters in the same figure are significantly different ( p < 0.05).
    L Delbrueckii Subsp Bulgaricus Atcc 11842, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/l delbrueckii subsp bulgaricus atcc 11842/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    l delbrueckii subsp bulgaricus atcc 11842 - by Bioz Stars, 2023-12
    86/100 stars

    Images

    1) Product Images from "Exploring the Cholesterol-Modifying Abilities of Lactobacilli Cells in Digestive Models and Dairy Products"

    Article Title: Exploring the Cholesterol-Modifying Abilities of Lactobacilli Cells in Digestive Models and Dairy Products

    Journal: Microorganisms

    doi: 10.3390/microorganisms11061478

    ( a ) L. delbrueckii subsp. bulgaricus ATCC 11842; ( b ) L. helveticus LH-B01; ( c ) L. delbrueckii subsp. lactis ATCC 4797; ( d ) L. acidophilus La-5. Survival of lactobacilli strains under digestive juice conditions (log(CFU/mL)); nd, not detected; a–f means with different lowercase letters in the same figure are significantly different ( p < 0.05).
    Figure Legend Snippet: ( a ) L. delbrueckii subsp. bulgaricus ATCC 11842; ( b ) L. helveticus LH-B01; ( c ) L. delbrueckii subsp. lactis ATCC 4797; ( d ) L. acidophilus La-5. Survival of lactobacilli strains under digestive juice conditions (log(CFU/mL)); nd, not detected; a–f means with different lowercase letters in the same figure are significantly different ( p < 0.05).

    Techniques Used:

    ( a ) gastric juice 3 h; ( b ) intestinal juice 5 h. Graphs of correlation matrix showing the relationship between pH, fat content, dry-matter content, and the viability of tested lactobacilli strains ( L. delbrueckii subsp. bulgaricus ATCC 11842, L. helveticus LH-B01, L. delbrueckii subsp. lactis ATCC 4797, and L. acidophilus La-5) ( a ) after 3 h of incubation under gastric juice conditions, and ( b ) after 5 h under intestinal juice conditions (with a confidence level of 95.0%); x, not significant at 0.05.
    Figure Legend Snippet: ( a ) gastric juice 3 h; ( b ) intestinal juice 5 h. Graphs of correlation matrix showing the relationship between pH, fat content, dry-matter content, and the viability of tested lactobacilli strains ( L. delbrueckii subsp. bulgaricus ATCC 11842, L. helveticus LH-B01, L. delbrueckii subsp. lactis ATCC 4797, and L. acidophilus La-5) ( a ) after 3 h of incubation under gastric juice conditions, and ( b ) after 5 h under intestinal juice conditions (with a confidence level of 95.0%); x, not significant at 0.05.

    Techniques Used: Incubation

    l delbrueckii subsp bulgaricus atcc 11842  (ATCC)


    Bioz Verified Symbol ATCC is a verified supplier
    Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    ATCC l delbrueckii subsp bulgaricus atcc 11842
    ( a ) L. <t>delbrueckii</t> subsp. bulgaricus ATCC 11842; ( b ) L. helveticus LH-B01; ( c ) L. delbrueckii subsp. lactis ATCC 4797; ( d ) L. acidophilus La-5. Survival of lactobacilli strains under digestive juice conditions (log(CFU/mL)); nd, not detected; a–f means with different lowercase letters in the same figure are significantly different ( p < 0.05).
    L Delbrueckii Subsp Bulgaricus Atcc 11842, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/l delbrueckii subsp bulgaricus atcc 11842/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    l delbrueckii subsp bulgaricus atcc 11842 - by Bioz Stars, 2023-12
    86/100 stars

    Images

    1) Product Images from "Exploring the Cholesterol-Modifying Abilities of Lactobacilli Cells in Digestive Models and Dairy Products"

    Article Title: Exploring the Cholesterol-Modifying Abilities of Lactobacilli Cells in Digestive Models and Dairy Products

    Journal: Microorganisms

    doi: 10.3390/microorganisms11061478

    ( a ) L. delbrueckii subsp. bulgaricus ATCC 11842; ( b ) L. helveticus LH-B01; ( c ) L. delbrueckii subsp. lactis ATCC 4797; ( d ) L. acidophilus La-5. Survival of lactobacilli strains under digestive juice conditions (log(CFU/mL)); nd, not detected; a–f means with different lowercase letters in the same figure are significantly different ( p < 0.05).
    Figure Legend Snippet: ( a ) L. delbrueckii subsp. bulgaricus ATCC 11842; ( b ) L. helveticus LH-B01; ( c ) L. delbrueckii subsp. lactis ATCC 4797; ( d ) L. acidophilus La-5. Survival of lactobacilli strains under digestive juice conditions (log(CFU/mL)); nd, not detected; a–f means with different lowercase letters in the same figure are significantly different ( p < 0.05).

    Techniques Used:

    ( a ) gastric juice 3 h; ( b ) intestinal juice 5 h. Graphs of correlation matrix showing the relationship between pH, fat content, dry-matter content, and the viability of tested lactobacilli strains ( L. delbrueckii subsp. bulgaricus ATCC 11842, L. helveticus LH-B01, L. delbrueckii subsp. lactis ATCC 4797, and L. acidophilus La-5) ( a ) after 3 h of incubation under gastric juice conditions, and ( b ) after 5 h under intestinal juice conditions (with a confidence level of 95.0%); x, not significant at 0.05.
    Figure Legend Snippet: ( a ) gastric juice 3 h; ( b ) intestinal juice 5 h. Graphs of correlation matrix showing the relationship between pH, fat content, dry-matter content, and the viability of tested lactobacilli strains ( L. delbrueckii subsp. bulgaricus ATCC 11842, L. helveticus LH-B01, L. delbrueckii subsp. lactis ATCC 4797, and L. acidophilus La-5) ( a ) after 3 h of incubation under gastric juice conditions, and ( b ) after 5 h under intestinal juice conditions (with a confidence level of 95.0%); x, not significant at 0.05.

    Techniques Used: Incubation

    l delbrueckii subsp bulgaricus atcc 11842  (ATCC)


    Bioz Verified Symbol ATCC is a verified supplier
    Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    ATCC l delbrueckii subsp bulgaricus atcc 11842
    ( a ) L. <t>delbrueckii</t> subsp. bulgaricus ATCC 11842; ( b ) L. helveticus LH-B01; ( c ) L. delbrueckii subsp. lactis ATCC 4797; ( d ) L. acidophilus La-5. Survival of lactobacilli strains under digestive juice conditions (log(CFU/mL)); nd, not detected; a–f means with different lowercase letters in the same figure are significantly different ( p < 0.05).
    L Delbrueckii Subsp Bulgaricus Atcc 11842, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/l delbrueckii subsp bulgaricus atcc 11842/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    l delbrueckii subsp bulgaricus atcc 11842 - by Bioz Stars, 2023-12
    86/100 stars

    Images

    1) Product Images from "Exploring the Cholesterol-Modifying Abilities of Lactobacilli Cells in Digestive Models and Dairy Products"

    Article Title: Exploring the Cholesterol-Modifying Abilities of Lactobacilli Cells in Digestive Models and Dairy Products

    Journal: Microorganisms

    doi: 10.3390/microorganisms11061478

    ( a ) L. delbrueckii subsp. bulgaricus ATCC 11842; ( b ) L. helveticus LH-B01; ( c ) L. delbrueckii subsp. lactis ATCC 4797; ( d ) L. acidophilus La-5. Survival of lactobacilli strains under digestive juice conditions (log(CFU/mL)); nd, not detected; a–f means with different lowercase letters in the same figure are significantly different ( p < 0.05).
    Figure Legend Snippet: ( a ) L. delbrueckii subsp. bulgaricus ATCC 11842; ( b ) L. helveticus LH-B01; ( c ) L. delbrueckii subsp. lactis ATCC 4797; ( d ) L. acidophilus La-5. Survival of lactobacilli strains under digestive juice conditions (log(CFU/mL)); nd, not detected; a–f means with different lowercase letters in the same figure are significantly different ( p < 0.05).

    Techniques Used:

    ( a ) gastric juice 3 h; ( b ) intestinal juice 5 h. Graphs of correlation matrix showing the relationship between pH, fat content, dry-matter content, and the viability of tested lactobacilli strains ( L. delbrueckii subsp. bulgaricus ATCC 11842, L. helveticus LH-B01, L. delbrueckii subsp. lactis ATCC 4797, and L. acidophilus La-5) ( a ) after 3 h of incubation under gastric juice conditions, and ( b ) after 5 h under intestinal juice conditions (with a confidence level of 95.0%); x, not significant at 0.05.
    Figure Legend Snippet: ( a ) gastric juice 3 h; ( b ) intestinal juice 5 h. Graphs of correlation matrix showing the relationship between pH, fat content, dry-matter content, and the viability of tested lactobacilli strains ( L. delbrueckii subsp. bulgaricus ATCC 11842, L. helveticus LH-B01, L. delbrueckii subsp. lactis ATCC 4797, and L. acidophilus La-5) ( a ) after 3 h of incubation under gastric juice conditions, and ( b ) after 5 h under intestinal juice conditions (with a confidence level of 95.0%); x, not significant at 0.05.

    Techniques Used: Incubation

    l delbrueckii subsp bulgaricus atcc 11842  (ATCC)


    Bioz Verified Symbol ATCC is a verified supplier
    Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    ATCC l delbrueckii subsp bulgaricus atcc 11842
    ( a ) L. <t>delbrueckii</t> subsp. bulgaricus ATCC 11842; ( b ) L. helveticus LH-B01; ( c ) L. delbrueckii subsp. lactis ATCC 4797; ( d ) L. acidophilus La-5. Survival of lactobacilli strains under digestive juice conditions (log(CFU/mL)); nd, not detected; a–f means with different lowercase letters in the same figure are significantly different ( p < 0.05).
    L Delbrueckii Subsp Bulgaricus Atcc 11842, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/l delbrueckii subsp bulgaricus atcc 11842/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    l delbrueckii subsp bulgaricus atcc 11842 - by Bioz Stars, 2023-12
    86/100 stars

    Images

    1) Product Images from "Exploring the Cholesterol-Modifying Abilities of Lactobacilli Cells in Digestive Models and Dairy Products"

    Article Title: Exploring the Cholesterol-Modifying Abilities of Lactobacilli Cells in Digestive Models and Dairy Products

    Journal: Microorganisms

    doi: 10.3390/microorganisms11061478

    ( a ) L. delbrueckii subsp. bulgaricus ATCC 11842; ( b ) L. helveticus LH-B01; ( c ) L. delbrueckii subsp. lactis ATCC 4797; ( d ) L. acidophilus La-5. Survival of lactobacilli strains under digestive juice conditions (log(CFU/mL)); nd, not detected; a–f means with different lowercase letters in the same figure are significantly different ( p < 0.05).
    Figure Legend Snippet: ( a ) L. delbrueckii subsp. bulgaricus ATCC 11842; ( b ) L. helveticus LH-B01; ( c ) L. delbrueckii subsp. lactis ATCC 4797; ( d ) L. acidophilus La-5. Survival of lactobacilli strains under digestive juice conditions (log(CFU/mL)); nd, not detected; a–f means with different lowercase letters in the same figure are significantly different ( p < 0.05).

    Techniques Used:

    ( a ) gastric juice 3 h; ( b ) intestinal juice 5 h. Graphs of correlation matrix showing the relationship between pH, fat content, dry-matter content, and the viability of tested lactobacilli strains ( L. delbrueckii subsp. bulgaricus ATCC 11842, L. helveticus LH-B01, L. delbrueckii subsp. lactis ATCC 4797, and L. acidophilus La-5) ( a ) after 3 h of incubation under gastric juice conditions, and ( b ) after 5 h under intestinal juice conditions (with a confidence level of 95.0%); x, not significant at 0.05.
    Figure Legend Snippet: ( a ) gastric juice 3 h; ( b ) intestinal juice 5 h. Graphs of correlation matrix showing the relationship between pH, fat content, dry-matter content, and the viability of tested lactobacilli strains ( L. delbrueckii subsp. bulgaricus ATCC 11842, L. helveticus LH-B01, L. delbrueckii subsp. lactis ATCC 4797, and L. acidophilus La-5) ( a ) after 3 h of incubation under gastric juice conditions, and ( b ) after 5 h under intestinal juice conditions (with a confidence level of 95.0%); x, not significant at 0.05.

    Techniques Used: Incubation

    l delbrueckii subsp bulgaricus atcc 11842  (ATCC)


    Bioz Verified Symbol ATCC is a verified supplier
    Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    ATCC l delbrueckii subsp bulgaricus atcc 11842
    ( a ) L. <t>delbrueckii</t> subsp. bulgaricus ATCC 11842; ( b ) L. helveticus LH-B01; ( c ) L. delbrueckii subsp. lactis ATCC 4797; ( d ) L. acidophilus La-5. Survival of lactobacilli strains under digestive juice conditions (log(CFU/mL)); nd, not detected; a–f means with different lowercase letters in the same figure are significantly different ( p < 0.05).
    L Delbrueckii Subsp Bulgaricus Atcc 11842, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/l delbrueckii subsp bulgaricus atcc 11842/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    l delbrueckii subsp bulgaricus atcc 11842 - by Bioz Stars, 2023-12
    86/100 stars

    Images

    1) Product Images from "Exploring the Cholesterol-Modifying Abilities of Lactobacilli Cells in Digestive Models and Dairy Products"

    Article Title: Exploring the Cholesterol-Modifying Abilities of Lactobacilli Cells in Digestive Models and Dairy Products

    Journal: Microorganisms

    doi: 10.3390/microorganisms11061478

    ( a ) L. delbrueckii subsp. bulgaricus ATCC 11842; ( b ) L. helveticus LH-B01; ( c ) L. delbrueckii subsp. lactis ATCC 4797; ( d ) L. acidophilus La-5. Survival of lactobacilli strains under digestive juice conditions (log(CFU/mL)); nd, not detected; a–f means with different lowercase letters in the same figure are significantly different ( p < 0.05).
    Figure Legend Snippet: ( a ) L. delbrueckii subsp. bulgaricus ATCC 11842; ( b ) L. helveticus LH-B01; ( c ) L. delbrueckii subsp. lactis ATCC 4797; ( d ) L. acidophilus La-5. Survival of lactobacilli strains under digestive juice conditions (log(CFU/mL)); nd, not detected; a–f means with different lowercase letters in the same figure are significantly different ( p < 0.05).

    Techniques Used:

    ( a ) gastric juice 3 h; ( b ) intestinal juice 5 h. Graphs of correlation matrix showing the relationship between pH, fat content, dry-matter content, and the viability of tested lactobacilli strains ( L. delbrueckii subsp. bulgaricus ATCC 11842, L. helveticus LH-B01, L. delbrueckii subsp. lactis ATCC 4797, and L. acidophilus La-5) ( a ) after 3 h of incubation under gastric juice conditions, and ( b ) after 5 h under intestinal juice conditions (with a confidence level of 95.0%); x, not significant at 0.05.
    Figure Legend Snippet: ( a ) gastric juice 3 h; ( b ) intestinal juice 5 h. Graphs of correlation matrix showing the relationship between pH, fat content, dry-matter content, and the viability of tested lactobacilli strains ( L. delbrueckii subsp. bulgaricus ATCC 11842, L. helveticus LH-B01, L. delbrueckii subsp. lactis ATCC 4797, and L. acidophilus La-5) ( a ) after 3 h of incubation under gastric juice conditions, and ( b ) after 5 h under intestinal juice conditions (with a confidence level of 95.0%); x, not significant at 0.05.

    Techniques Used: Incubation

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 11842 type strain  (ATCC)
    86
    ATCC 11842 type strain
    11842 Type Strain, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/11842 type strain/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    11842 type strain - by Bioz Stars, 2023-12
    86/100 stars
    		  Buy from Supplier
    l delbrueckii atcc 11842  (ATCC)
    86
    ATCC l delbrueckii atcc 11842
    In vitro effects of cell-free supernatants on CRC cells.
    L Delbrueckii Atcc 11842, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/l delbrueckii atcc 11842/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    l delbrueckii atcc 11842 - by Bioz Stars, 2023-12
    86/100 stars
    		  Buy from Supplier
    l delbrueckii subsp bulgaricus atcc 11842  (ATCC)
    86
    ATCC l delbrueckii subsp bulgaricus atcc 11842
    Multilocus sequence analysis (MLSA) of Lactobacillus <t>delbrueckii</t> strains. The subspecies are indicated by colored circles: L. delbrueckii subsp. bulgaricus in blue, L. delbrueckii subsp. lactis in red and L. delbrueckii subsp. delbrueckii in green. Lactococcus lactis SK11 (black circle) was used as an outgroup.
    L Delbrueckii Subsp Bulgaricus Atcc 11842, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/l delbrueckii subsp bulgaricus atcc 11842/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    l delbrueckii subsp bulgaricus atcc 11842 - by Bioz Stars, 2023-12
    86/100 stars
    		  Buy from Supplier
    bulgaricus atcc 11842  (ATCC)
    86
    ATCC bulgaricus atcc 11842
    Multilocus sequence analysis (MLSA) of Lactobacillus <t>delbrueckii</t> strains. The subspecies are indicated by colored circles: L. delbrueckii subsp. bulgaricus in blue, L. delbrueckii subsp. lactis in red and L. delbrueckii subsp. delbrueckii in green. Lactococcus lactis SK11 (black circle) was used as an outgroup.
    Bulgaricus Atcc 11842, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bulgaricus atcc 11842/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    bulgaricus atcc 11842 - by Bioz Stars, 2023-12
    86/100 stars
    		  Buy from Supplier

    Image Search Results


    In vitro effects of cell-free supernatants on CRC cells.

    Journal: Microorganisms

    Article Title: Probiotic-Derived Bioactive Compounds in Colorectal Cancer Treatment

    doi: 10.3390/microorganisms11081898

    Figure Lengend Snippet: In vitro effects of cell-free supernatants on CRC cells.

    Article Snippet: L. delbrueckii ATCC 11842 , HT-29 , antiproliferative and antioxidant properties, apoptosis induction (↑ caspase-3,-9/↑ Bax/Bcl-2 ratio) , [ ] .

    Techniques: In Vitro, Activity Assay, Inhibition, Expressing

    Multilocus sequence analysis (MLSA) of Lactobacillus delbrueckii strains. The subspecies are indicated by colored circles: L. delbrueckii subsp. bulgaricus in blue, L. delbrueckii subsp. lactis in red and L. delbrueckii subsp. delbrueckii in green. Lactococcus lactis SK11 (black circle) was used as an outgroup.

    Journal: International Journal of Molecular Sciences

    Article Title: In Silico Comparative Genomic Analysis Revealed a Highly Conserved Proteolytic System in Lactobacillus delbrueckii

    doi: 10.3390/ijms241411309

    Figure Lengend Snippet: Multilocus sequence analysis (MLSA) of Lactobacillus delbrueckii strains. The subspecies are indicated by colored circles: L. delbrueckii subsp. bulgaricus in blue, L. delbrueckii subsp. lactis in red and L. delbrueckii subsp. delbrueckii in green. Lactococcus lactis SK11 (black circle) was used as an outgroup.

    Article Snippet: L. delbrueckii subsp. bulgaricus ATCC 11842 , TAATGTGCTTTTTGTTTTTT , 4 , TTCAGA , 16 , TTTGAT.

    Techniques: Sequencing

    Pangenome analysis of principal peptidases of L. delbrueckii strains.

    Journal: International Journal of Molecular Sciences

    Article Title: In Silico Comparative Genomic Analysis Revealed a Highly Conserved Proteolytic System in Lactobacillus delbrueckii

    doi: 10.3390/ijms241411309

    Figure Lengend Snippet: Pangenome analysis of principal peptidases of L. delbrueckii strains.

    Article Snippet: L. delbrueckii subsp. bulgaricus ATCC 11842 , TAATGTGCTTTTTGTTTTTT , 4 , TTCAGA , 16 , TTTGAT.

    Techniques:

    Structure prediction model of the proteinase from L. delbrueckii subsp . lactis CRL 581. A cartoon representation of a protein monomer shown in rainbow colors from red at the N-terminus to blue at the C-terminus. The active site of the enzyme contains the catalytic triad of amino acids: D, H, and S.

    Journal: International Journal of Molecular Sciences

    Article Title: In Silico Comparative Genomic Analysis Revealed a Highly Conserved Proteolytic System in Lactobacillus delbrueckii

    doi: 10.3390/ijms241411309

    Figure Lengend Snippet: Structure prediction model of the proteinase from L. delbrueckii subsp . lactis CRL 581. A cartoon representation of a protein monomer shown in rainbow colors from red at the N-terminus to blue at the C-terminus. The active site of the enzyme contains the catalytic triad of amino acids: D, H, and S.

    Article Snippet: L. delbrueckii subsp. bulgaricus ATCC 11842 , TAATGTGCTTTTTGTTTTTT , 4 , TTCAGA , 16 , TTTGAT.

    Techniques:

    Phylogenetic analysis and identity percentage of proteinases in L. delbrueckii subspecies. Evolutionary relationships were inferred using the method of joining neighbors. Evolutionary distances were calculated using the p distance method and are expressed as the number of different amino acids per site. The PrtP proteinase from Lactococcus lactis subsp. cremoris SK11 was used as an outgroup. The percentages of identity between the proteinases of each strain are shown in the table. L. delbrueckii subsp. bulgaricus strains are marked with a blue dot, L. delbrueckii subsp. delbrueckii strains with a green dot, and L. delbrueckii subsp. lactis with a red dot.

    Journal: International Journal of Molecular Sciences

    Article Title: In Silico Comparative Genomic Analysis Revealed a Highly Conserved Proteolytic System in Lactobacillus delbrueckii

    doi: 10.3390/ijms241411309

    Figure Lengend Snippet: Phylogenetic analysis and identity percentage of proteinases in L. delbrueckii subspecies. Evolutionary relationships were inferred using the method of joining neighbors. Evolutionary distances were calculated using the p distance method and are expressed as the number of different amino acids per site. The PrtP proteinase from Lactococcus lactis subsp. cremoris SK11 was used as an outgroup. The percentages of identity between the proteinases of each strain are shown in the table. L. delbrueckii subsp. bulgaricus strains are marked with a blue dot, L. delbrueckii subsp. delbrueckii strains with a green dot, and L. delbrueckii subsp. lactis with a red dot.

    Article Snippet: L. delbrueckii subsp. bulgaricus ATCC 11842 , TAATGTGCTTTTTGTTTTTT , 4 , TTCAGA , 16 , TTTGAT.

    Techniques:

    Synteny analysis of the prt region in L. delbrueckii type strains. ( A ). Comparison of synteny in L. delbrueckii strains for the prt region (14 Kb). The following genes are represented: aspartate ammonium lyase asnA (dark blue), acetyltransferase LBLM1_05370 (blue), proteinase prt (red), cystathionine beta-lyase patC (yellow), heat shock protein htpX2 (green), and hypothetical proteins in gray. The black color indicates the insertion sequence in the DSM 20072 strain. ( B ). Representation of insertion sequences upstream of the gene patC in the DSM 20072 strain are represented. Black arrows indicate reversed repetitions, while white arrows indicate direct repetitions. The nucleotides in the sequence indicate the direct repeat where inserts of the IS110 insertion sequence are found.

    Journal: International Journal of Molecular Sciences

    Article Title: In Silico Comparative Genomic Analysis Revealed a Highly Conserved Proteolytic System in Lactobacillus delbrueckii

    doi: 10.3390/ijms241411309

    Figure Lengend Snippet: Synteny analysis of the prt region in L. delbrueckii type strains. ( A ). Comparison of synteny in L. delbrueckii strains for the prt region (14 Kb). The following genes are represented: aspartate ammonium lyase asnA (dark blue), acetyltransferase LBLM1_05370 (blue), proteinase prt (red), cystathionine beta-lyase patC (yellow), heat shock protein htpX2 (green), and hypothetical proteins in gray. The black color indicates the insertion sequence in the DSM 20072 strain. ( B ). Representation of insertion sequences upstream of the gene patC in the DSM 20072 strain are represented. Black arrows indicate reversed repetitions, while white arrows indicate direct repetitions. The nucleotides in the sequence indicate the direct repeat where inserts of the IS110 insertion sequence are found.

    Article Snippet: L. delbrueckii subsp. bulgaricus ATCC 11842 , TAATGTGCTTTTTGTTTTTT , 4 , TTCAGA , 16 , TTTGAT.

    Techniques: Sequencing

    Putative promoter sequences of the prt gene for different strains of L. delbrueckii .

    Journal: International Journal of Molecular Sciences

    Article Title: In Silico Comparative Genomic Analysis Revealed a Highly Conserved Proteolytic System in Lactobacillus delbrueckii

    doi: 10.3390/ijms241411309

    Figure Lengend Snippet: Putative promoter sequences of the prt gene for different strains of L. delbrueckii .

    Article Snippet: L. delbrueckii subsp. bulgaricus ATCC 11842 , TAATGTGCTTTTTGTTTTTT , 4 , TTCAGA , 16 , TTTGAT.

    Techniques:

    Comparative analysis of putative promoter sequences of CEPs from L. delbrueckii subspecies. Alignment of putative promoter sequences of CEPs from L. delbrueckii subsp. bulgaricus ATCC 11842, L. delbrueckii subsp. delbrueckii DSM 20074, and L. delbrueckii subsp. lactis DSM 20072. The figure depicts the 500 bp sequence upstream of the ATG start codon, indicating the UP element, the -0 element, the -35 element, and the ribosome binding site.

    Journal: International Journal of Molecular Sciences

    Article Title: In Silico Comparative Genomic Analysis Revealed a Highly Conserved Proteolytic System in Lactobacillus delbrueckii

    doi: 10.3390/ijms241411309

    Figure Lengend Snippet: Comparative analysis of putative promoter sequences of CEPs from L. delbrueckii subspecies. Alignment of putative promoter sequences of CEPs from L. delbrueckii subsp. bulgaricus ATCC 11842, L. delbrueckii subsp. delbrueckii DSM 20074, and L. delbrueckii subsp. lactis DSM 20072. The figure depicts the 500 bp sequence upstream of the ATG start codon, indicating the UP element, the -0 element, the -35 element, and the ribosome binding site.

    Article Snippet: L. delbrueckii subsp. bulgaricus ATCC 11842 , TAATGTGCTTTTTGTTTTTT , 4 , TTCAGA , 16 , TTTGAT.

    Techniques: Sequencing, Binding Assay

    Sequence logo representation of the putative promoter consensus for the prt gene in Lactobacillus delbrueckii strains. Nucleotides that differ from those in the promoter described for the NCDO1489 strain are shown in blue.

    Journal: International Journal of Molecular Sciences

    Article Title: In Silico Comparative Genomic Analysis Revealed a Highly Conserved Proteolytic System in Lactobacillus delbrueckii

    doi: 10.3390/ijms241411309

    Figure Lengend Snippet: Sequence logo representation of the putative promoter consensus for the prt gene in Lactobacillus delbrueckii strains. Nucleotides that differ from those in the promoter described for the NCDO1489 strain are shown in blue.

    Article Snippet: L. delbrueckii subsp. bulgaricus ATCC 11842 , TAATGTGCTTTTTGTTTTTT , 4 , TTCAGA , 16 , TTTGAT.

    Techniques: Sequencing

    Genomes of Lactobacillus delbrueckii strains used in this work.

    Journal: International Journal of Molecular Sciences

    Article Title: In Silico Comparative Genomic Analysis Revealed a Highly Conserved Proteolytic System in Lactobacillus delbrueckii

    doi: 10.3390/ijms241411309

    Figure Lengend Snippet: Genomes of Lactobacillus delbrueckii strains used in this work.

    Article Snippet: L. delbrueckii subsp. bulgaricus ATCC 11842 , TAATGTGCTTTTTGTTTTTT , 4 , TTCAGA , 16 , TTTGAT.

    Techniques: Plasmid Preparation