geneclean turbo kit  (Valiant)


Bioz Verified Symbol Valiant is a verified supplier
Bioz Manufacturer Symbol Valiant manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Name:
    GENECLEAN Turbo Kit
    Description:
    GeneClean Turbo Kit is a flexible kit designed for purification of DNA fragments of sizes 0 1 kb to 300 kb from TAE or TBE buffered agarose gels PCR reactions and other enzymatic solutions It purifies larger fragments due to less manipulation of bound DNA Process with either vacuum or centrifugation save time with patented Turbo filter design
    Catalog Number:
    111102200-cf
    Price:
    None
    Applications:
    Purification of DNA fragments from agarose gels; PCR reactions, Elimination of proteins from enzymatic reactions
    Category:
    Life Sciences Sample Preparation DNA RNA Isolation and Purification DNA Clean up
    Buy from Supplier


    Structured Review

    Valiant geneclean turbo kit
    GENECLEAN Turbo Kit
    GeneClean Turbo Kit is a flexible kit designed for purification of DNA fragments of sizes 0 1 kb to 300 kb from TAE or TBE buffered agarose gels PCR reactions and other enzymatic solutions It purifies larger fragments due to less manipulation of bound DNA Process with either vacuum or centrifugation save time with patented Turbo filter design
    https://www.bioz.com/result/geneclean turbo kit/product/Valiant
    Average 94 stars, based on 130 article reviews
    Price from $9.99 to $1999.99
    geneclean turbo kit - by Bioz Stars, 2021-02
    94/100 stars

    Images

    Related Articles

    Polymerase Chain Reaction:

    Article Title: Genetic diversity of STLV-2 and interspecies transmission of STLV-3 in wild-living bonobos
    Article Snippet: .. After purification with the Geneclean Turbo Kit (Qbiogene, Inc., Carlsbad, CA), PCR products were directly sequenced using an automated sequencer (3130xl Genetic Analyzer, Applied Biosystems, Foster City, CA). .. 2.4 STLV prevalence estimation The prevalence of STLV infection was estimated based on the proportion of STLV PCR-positive samples, but correcting for sample degradation and redundant sampling as identified by microsatellite analysis and described in previous surveys ( ).

    Article Title: Quantitative Real-Time PCR Detection of Toxic Nodularia Cyanobacteria in the Baltic Sea ▿
    Article Snippet: .. To improve the quality and reduce the amount of PCR inhibitors, the extracted DNA samples were purified using a Geneclean Turbo kit (Q-Biogene) with two elution steps containing 30 μl of Tris-EDTA buffer (10 mM Tris [pH 8]-1 mM EDTA). .. PCR primers were designed to amplify the nodularin synthetase gene subunit F ( ndaF ) of Nodularia .

    Staining:

    Article Title: µgreen-db: a reference database for the 23S rRNA gene of eukaryotic plastids and cyanobacteria
    Article Snippet: .. Crude DNA extracts were quantified by agarose gel electrophoresis and then purified using a GENECLEAN turbo kit (MpBiomedical), and quantified using a QuantiFluor staining kit (Promega) prior to further investigation. .. A 23S rRNA gene fragment targeting the V5 domain to characterise photosynthetic microeukaryote and cyanobacterial diversity was amplified using the primers p23SrV_f1 (5′GGACAGAAAGACCCTATGAA3′) and p23SrV_r1 (5′TCAGCCTGTTATCCCTAGAG3′) .

    Agarose Gel Electrophoresis:

    Article Title: µgreen-db: a reference database for the 23S rRNA gene of eukaryotic plastids and cyanobacteria
    Article Snippet: .. Crude DNA extracts were quantified by agarose gel electrophoresis and then purified using a GENECLEAN turbo kit (MpBiomedical), and quantified using a QuantiFluor staining kit (Promega) prior to further investigation. .. A 23S rRNA gene fragment targeting the V5 domain to characterise photosynthetic microeukaryote and cyanobacterial diversity was amplified using the primers p23SrV_f1 (5′GGACAGAAAGACCCTATGAA3′) and p23SrV_r1 (5′TCAGCCTGTTATCCCTAGAG3′) .

    Purification:

    Article Title: Tillage intensity and pasture in rotation effectively shape soil microbial communities at a landscape scale, et al. Tillage intensity and pasture in rotation effectively shape soil microbial communities at a landscape scale
    Article Snippet: .. The eluates were then collected and purified for residual impurities using the Geneclean Turbo Kit (MP‐Biomedicals, NY, USA). .. The purified DNA extracts were quantified using the Quantifluor staining kit (Promega, Madison, Wisconsin, USA).

    Article Title: Genetic diversity of STLV-2 and interspecies transmission of STLV-3 in wild-living bonobos
    Article Snippet: .. After purification with the Geneclean Turbo Kit (Qbiogene, Inc., Carlsbad, CA), PCR products were directly sequenced using an automated sequencer (3130xl Genetic Analyzer, Applied Biosystems, Foster City, CA). .. 2.4 STLV prevalence estimation The prevalence of STLV infection was estimated based on the proportion of STLV PCR-positive samples, but correcting for sample degradation and redundant sampling as identified by microsatellite analysis and described in previous surveys ( ).

    Article Title: Regulation of HER2 Oncogene Transcription by a Multifunctional Coactivator/Corepressor Complex
    Article Snippet: .. DNA was purified using the GENECLEAN Turbo kit (Qbiogene Inc). .. Samples were analyzed by qPCR to analyze recruitment to the suggested EREs.

    Article Title: Quantitative Real-Time PCR Detection of Toxic Nodularia Cyanobacteria in the Baltic Sea ▿
    Article Snippet: .. To improve the quality and reduce the amount of PCR inhibitors, the extracted DNA samples were purified using a Geneclean Turbo kit (Q-Biogene) with two elution steps containing 30 μl of Tris-EDTA buffer (10 mM Tris [pH 8]-1 mM EDTA). .. PCR primers were designed to amplify the nodularin synthetase gene subunit F ( ndaF ) of Nodularia .

    Article Title: µgreen-db: a reference database for the 23S rRNA gene of eukaryotic plastids and cyanobacteria
    Article Snippet: .. Crude DNA extracts were quantified by agarose gel electrophoresis and then purified using a GENECLEAN turbo kit (MpBiomedical), and quantified using a QuantiFluor staining kit (Promega) prior to further investigation. .. A 23S rRNA gene fragment targeting the V5 domain to characterise photosynthetic microeukaryote and cyanobacterial diversity was amplified using the primers p23SrV_f1 (5′GGACAGAAAGACCCTATGAA3′) and p23SrV_r1 (5′TCAGCCTGTTATCCCTAGAG3′) .

    Article Title: Differences between the rhizosphere microbiome of Beta vulgaris ssp. maritima—ancestor of all beet crops—and modern sugar beets
    Article Snippet: .. DNA was additionally purified by the GeneClean Turbo Kit (MP Biomedicals, Illkirch, France) containing guanidine thiocyanate to remove humic acids. .. Extracted DNA was treated with RNase (0.02 ng μl−1 ) for 5 min at 65°C to obtain the template for PCR amplification of 16S rRNA genes from total community DNA.