10x t4 rna ligase buffer  (Thermo Fisher)

Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher 10x t4 rna ligase buffer
    10x T4 Rna Ligase Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/10x t4 rna ligase buffer/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    10x t4 rna ligase buffer - by Bioz Stars, 2020-04
    99/100 stars


    Related Articles

    Clone Assay:

    Article Title: Corrigendum to “GoldCLIP: Gel-omitted Ligation-dependent CLIP” [Genomics Proteomics Bioinformatics 16 (2) (2018) 136–143]
    Article Snippet: The RNAs crosslinked with the PTB proteins were ligated with an RNA adapter (/5′P/AGATCGGAAGAGCGGTTCAG/3ddC/) at 3′ end using T4 RNA Ligase I (catalog No. AM2141; Ambion) on beads at 16 °C overnight. .. The RNA–peptide adducts were cloned following the iCLIP library cloning protocol [11].

    Article Title: Preparation of Multiplexed Small RNA Libraries From Plants
    Article Snippet: .. 8-Strip PCR thin-walled, 200 μl tubes (Corning Incorporated, Axygen® , catalog number: PCR-0208-CP-C) miRNA cloning linker 1 (/5′App/CTGTAGGCACCATCAAT/3′ddC/; 1 nm) (Integrated DNA Technologies, catalog number: 11-04-03-05) Truncated, K227Q mutation T4 RNA Ligase 2 (New England Biolabs, catalog number: M0351L) De-adenylase (New England Biolabs, catalog number: M0331S) Exonuclease VII (United State Biological, catalog number: 70082Z) RNA 5′ Adapter (GUUCAGAGUUCUACAGUCCGACGAUC) (Illumina RA5, catalog number: 15013205) dATP (Life Technologies, catalog number: 55082) T4 RNA Ligase I (Life Technologies, catalog number: AM2141) RT-PCR Primer (ATTGATGGTGCCTACAG; 25 nmol; de-salted) (Integrated DNA Technologies) SuperScript III (Life Technologies, catalog number: 18080051) Phusion High Fidelity II (Thermo Fisher Scientific, catalog number: F549L) 5′ PCR Primer (Illumina small RNA PCR primer 2: AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA) 3′ Indexed PCR Primer I1 – I12 (100 nmol; PAGE-purified) (Integrated DNA Technologies) Note: The barcodes below (underlined sequences) are reverse complemented in the final Illumina output sequence (see sequence in square brackets for each primer). .. I1 [CGATGT]: CAAGCAGAAGACGGCATACGA ACATCG ATTGATGGTGCCTACAG I2 [GATCAC]: CAAGCAGAAGACGGCATACGA GTGATC ATTGATGGTGCCTACAG I3 [CAGATG]: CAAGCAGAAGACGGCATACGA CATCTG ATTGATGGTGCCTACAG I4 [TACGTT]: CAAGCAGAAGACGGCATACGA AACGTA ATTGATGGTGCCTACAG I5 [TTACCA]: CAAGCAGAAGACGGCATACGA TGGTAA ATTGATGGTGCCTACAG I6 [ACTGTA]: CAAGCAGAAGACGGCATACGA TACAGT ATTGATGGTGCCTACAG I7 [ATCACG]: CAAGCAGAAGACGGCATACGA CGTGAT ATTGATGGTGCCTACAG I8 [ACTTGT]: CAAGCAGAAGACGGCATACGA ACAAGT ATTGATGGTGCCTACAG I9 [GCCAAT]: CAAGCAGAAGACGGCATACGA ATTGGC ATTGATGGTGCCTACAG I10 [TGCTAG]: CAAGCAGAAGACGGCATACGA CTAGCA ATTGATGGTGCCTACAG I11 [CTTGTA]: CAAGCAGAAGACGGCATACGA TACAAG ATTGATGGTGCCTACAG I12 [TCAGGC]: CAAGCAGAAGACGGCATACGA GCCTGA ATTGATGGTGCCTACAG QIAquick PCR Purification Kit (QIAGEN, catalog number: 28106) Diethylpyrocarbonate (DEPC)-H2 O/ RNase-free H2 O DNA size marker suitable for detecting a ~120 bp fragment (50 bp step ladder, Promega Corporation, catalog number: G4521; 25 bp step ladder, Promega Corporation, catalog number: G4511) 3 M sodium acetate (NaOAc) (pH 5.5) Reagents for 6% native PAGE 37.5: 1 polyacrylamide:bisacrylamide (see Recipes) TEMED (Life Technologies, catalog number: 15524-010) 10% Ammonium persulfate (Sigma, catalog number: A3678-100G) (See Recipes)

    Article Title: GoldCLIP: Gel-omitted Ligation-dependent CLIP
    Article Snippet: The RNAs crosslinked with the PTB proteins were ligated with an RNA adapter (/5′P/AGGTCGGAAGAGCGGTTCAG/3ddC/) at 3′ end using T4 RNA Ligase I (catalog No. AM2141; Ambion) on beads at 16 °C overnight. .. The RNA–peptide adducts were cloned following the iCLIP library cloning protocol .


    Article Title: A Reverse Genetics Platform That Spans the Zika Virus Family Tree
    Article Snippet: .. After another phenol-chloroform extraction and isopropanol precipitation, the RNA was incubated with T4 RNA ligase I (Ambion) for 1 h at 37°C and then overnight at 4°C, to ligate the 5′ and 3′ ends. cDNA (Superscript III; Invitrogen) was made and used to generate an amplicon containing both the 5′ and 3′ UTR sequences, which was Sanger sequenced. ..

    Article Title: Differentially expressed genes in mycorrhized and nodulated roots of common bean are associated with defense, cell wall architecture, N metabolism, and P metabolism
    Article Snippet: AM2141, Life Technologies) for 30 min at 30°C to ligate the adapters. .. The purified cDNA libraries were subjected to PCR amplification using Platinum PCR Supermix High Fidelity and Ion Xpress Barcode reverse and forward primers (Thermo Fisher Scientific) with the following conditions: 95°C for 2 min; two cycles of 94°C for 30 s, 50°C for 30 s, and 68°C for 30 s; 14 cycles of 94°C for 30 s, 62°C for 30 s, and 68°C for 30 s; and a final extension at 68°C for 5 min.

    Article Title: Automated high throughput nucleic acid purification from formalin-fixed paraffin-embedded tissue samples for next generation sequence analysis
    Article Snippet: Following two rounds of bead-based removal of unligated adapters, 5’-end adapter was introduced using T4 RNA ligase (Ambion; Catalog# AM2141). .. Following bead-based size selection, cDNA was amplified using Phusion Hotstart (Thermo Fisher; Catalog# F540L).

    Article Title: Epigenetic and transcriptional determinants of the human breast
    Article Snippet: An RNA 5′ adapter was then added, using a T4 RNA ligase (Ambion USA, cat. AM2141) and ATP, and is incubated at 37 °C for 1 h. Following ligation 1st strand cDNA is synthesized using Superscript II reverse transcriptase (Invitrogen, cat.18064 014). .. The resulting product was PCR amplified using the 3′ PCR primer (5′-CAAGCAGAAGACGGCATACGAGAT-3′) and an indexed 5′ PCR primer (5′-AATGATACGGCGACCACCGACAGNNNNNNGTTCAGAGTTCTACAGTCCGA-3′), Phusion Hot Start High Fidelity DNA polymerase (NEB Canada, cat. F-540 l), buffer, dNTPs and dimethylsulphoxide (DMSO).


    Article Title: The Microprocessor controls the activity of mammalian retrotransposons
    Article Snippet: An RNA linker was synthesized in vitro using Mmessage Mmachine T7 Ultra Kit (Ambion) and Eco RI- digested pBluescript KS plasmid (Stratagene) as template. .. 1 μg of total RNA was ligated directly to 15 pmol of the 5′ linker, requiring the presence of 5′phosphates on the ligated RNA, in a 20 μl volume (2 μl 10X T4 RNAligase buffer, 10μl PEG 8000 40% and2 μl 10X T4 RNA ligase (Ambion)).

    Article Title: Large-scale profiling of microRNAs for The Cancer Genome Atlas
    Article Snippet: An RNA 5′ adapter was then added, using a T4 RNA ligase (Ambion USA, cat. AM2141) and ATP, and was incubated at 37°C for 1 h. The sequence of the single strand RNA adapter is 5′GUUCAGAGUUCUACAGUCCGACGAUCUGGUCAA3′. .. When ligation was completed, first strand cDNA was synthesized using Superscript II Reverse Transcriptase (Invitrogen, cat. 18064 014) and an RT primer (5′-CAAGCAGAAGACGGCATACGAGAT-3′).

    Article Title: Landscape of Fluid Sets of Hairpin-Derived 21-/24-nt-Long Small RNAs at Seed Set Uncovers Special Epigenetic Features in Picea glauca
    Article Snippet: A 5′ adapter was then added using a T4 RNA ligase (Ambion USA, cat. AM2141) and ATPs. .. After ligation, first-strand cDNA was synthesized using a Superscript II Reverse Transcriptase (Invitrogen, cat. 18064 014) and one RT primer.

    Article Title: Epigenetic and transcriptional determinants of the human breast
    Article Snippet: .. An RNA 5′ adapter was then added, using a T4 RNA ligase (Ambion USA, cat. AM2141) and ATP, and is incubated at 37 °C for 1 h. Following ligation 1st strand cDNA is synthesized using Superscript II reverse transcriptase (Invitrogen, cat.18064 014). .. The resulting product was PCR amplified using the 3′ PCR primer (5′-CAAGCAGAAGACGGCATACGAGAT-3′) and an indexed 5′ PCR primer (5′-AATGATACGGCGACCACCGACAGNNNNNNGTTCAGAGTTCTACAGTCCGA-3′), Phusion Hot Start High Fidelity DNA polymerase (NEB Canada, cat. F-540 l), buffer, dNTPs and dimethylsulphoxide (DMSO).

    Article Title: Global Analysis of Small RNA Dynamics during Seed Development of Picea glauca and Arabidopsis thaliana Populations Reveals Insights on their Evolutionary Trajectories
    Article Snippet: A 5′ adapter was then added using a T4 RNA ligase (Ambion USA, cat. AM2141) and ATPs. .. After ligation, first strand cDNA was synthesized using a Superscript II Reverse Transcriptase (Invitrogen, cat. 18064 014) and one RT primer.


    Article Title: Large-scale profiling of microRNAs for The Cancer Genome Atlas
    Article Snippet: Library construction and sequencing miRNA-seq libraries were constructed using a strand-specific, plate-based protocol developed at the GSC (Figure ). .. An RNA 5′ adapter was then added, using a T4 RNA ligase (Ambion USA, cat. AM2141) and ATP, and was incubated at 37°C for 1 h. The sequence of the single strand RNA adapter is 5′GUUCAGAGUUCUACAGUCCGACGAUCUGGUCAA3′.

    Article Title: Landscape of Fluid Sets of Hairpin-Derived 21-/24-nt-Long Small RNAs at Seed Set Uncovers Special Epigenetic Features in Picea glauca
    Article Snippet: Briefly, sRNA-seq libraries were constructed using a strand-specific and plate-based protocol. .. A 5′ adapter was then added using a T4 RNA ligase (Ambion USA, cat. AM2141) and ATPs.

    Article Title: Global Analysis of Small RNA Dynamics during Seed Development of Picea glauca and Arabidopsis thaliana Populations Reveals Insights on their Evolutionary Trajectories
    Article Snippet: The sRNA-seq libraries were constructed using a strand-specific and plate-based protocol. .. A 5′ adapter was then added using a T4 RNA ligase (Ambion USA, cat. AM2141) and ATPs.


    Article Title: Corrigendum to “GoldCLIP: Gel-omitted Ligation-dependent CLIP” [Genomics Proteomics Bioinformatics 16 (2) (2018) 136–143]
    Article Snippet: Magne® HaloTag® Beads (catalog No. G7281; Promega) were incubated with the lysates with rotation at 4 °C for about 10–16 h. Beads associated with Halo-PTB complexes were first washed with PBST (PBS + 0.1% Triton X-100), dephosphorylated with calf intestinal phosphatase (catalog No. M0290S; New England Biolabs) at 37 °C for 30 min. Then the beads were washed with Trizol LS reagent and equilibrated with 8 M urea. .. The RNAs crosslinked with the PTB proteins were ligated with an RNA adapter (/5′P/AGATCGGAAGAGCGGTTCAG/3ddC/) at 3′ end using T4 RNA Ligase I (catalog No. AM2141; Ambion) on beads at 16 °C overnight.

    Article Title: A Reverse Genetics Platform That Spans the Zika Virus Family Tree
    Article Snippet: .. After another phenol-chloroform extraction and isopropanol precipitation, the RNA was incubated with T4 RNA ligase I (Ambion) for 1 h at 37°C and then overnight at 4°C, to ligate the 5′ and 3′ ends. cDNA (Superscript III; Invitrogen) was made and used to generate an amplicon containing both the 5′ and 3′ UTR sequences, which was Sanger sequenced. ..

    Article Title: Large-scale profiling of microRNAs for The Cancer Genome Atlas
    Article Snippet: .. An RNA 5′ adapter was then added, using a T4 RNA ligase (Ambion USA, cat. AM2141) and ATP, and was incubated at 37°C for 1 h. The sequence of the single strand RNA adapter is 5′GUUCAGAGUUCUACAGUCCGACGAUCUGGUCAA3′. .. When ligation was completed, first strand cDNA was synthesized using Superscript II Reverse Transcriptase (Invitrogen, cat. 18064 014) and an RT primer (5′-CAAGCAGAAGACGGCATACGAGAT-3′).

    Article Title: Differentially expressed genes in mycorrhized and nodulated roots of common bean are associated with defense, cell wall architecture, N metabolism, and P metabolism
    Article Snippet: Hybridized fragmented mRNA was incubated with ligase (Cat. nr. .. AM2141, Life Technologies) for 30 min at 30°C to ligate the adapters.

    Article Title: GoldCLIP: Gel-omitted Ligation-dependent CLIP
    Article Snippet: Magne® HaloTag® Beads (catalog No. G7281; Promega) were incubated with the lysates with rotation at 4 °C for about 10–16 h. Beads associated with Halo-PTB complexes were first washed with PBST (PBS + 0.1% Triton X-100), dephosphorylated with calf intestinal phosphatase (catalog No. M0290S; New England Biolabs) at 37 °C for 30 min. Then the beads were washed with Trizol LS reagent and equilibrated with 8 M urea. .. The RNAs crosslinked with the PTB proteins were ligated with an RNA adapter (/5′P/AGGTCGGAAGAGCGGTTCAG/3ddC/) at 3′ end using T4 RNA Ligase I (catalog No. AM2141; Ambion) on beads at 16 °C overnight.

    Article Title: Epigenetic and transcriptional determinants of the human breast
    Article Snippet: .. An RNA 5′ adapter was then added, using a T4 RNA ligase (Ambion USA, cat. AM2141) and ATP, and is incubated at 37 °C for 1 h. Following ligation 1st strand cDNA is synthesized using Superscript II reverse transcriptase (Invitrogen, cat.18064 014). .. The resulting product was PCR amplified using the 3′ PCR primer (5′-CAAGCAGAAGACGGCATACGAGAT-3′) and an indexed 5′ PCR primer (5′-AATGATACGGCGACCACCGACAGNNNNNNGTTCAGAGTTCTACAGTCCGA-3′), Phusion Hot Start High Fidelity DNA polymerase (NEB Canada, cat. F-540 l), buffer, dNTPs and dimethylsulphoxide (DMSO).


    Article Title: Corrigendum to “GoldCLIP: Gel-omitted Ligation-dependent CLIP” [Genomics Proteomics Bioinformatics 16 (2) (2018) 136–143]
    Article Snippet: Crosslinked cells were then scraped off the plates and mixed with ∼5 × 105 of Drosophila S2 cells expressing a Halo-CG7544 fusion protein (serving as an internal normalizing control), dounced with type B pestle in lysis buffer (see above) and digested using micrococcal nuclease (1:1000; catalog No. M0247S; New England Biolabs) for 3 min at 37 °C. .. The RNAs crosslinked with the PTB proteins were ligated with an RNA adapter (/5′P/AGATCGGAAGAGCGGTTCAG/3ddC/) at 3′ end using T4 RNA Ligase I (catalog No. AM2141; Ambion) on beads at 16 °C overnight.

    Article Title: GoldCLIP: Gel-omitted Ligation-dependent CLIP
    Article Snippet: Crosslinked cells were then scraped off the plates and mixed with ∼5 × 105 of Drosophila S2 cells expressing a Halo-CG7544 fusion protein (serving as an internal normalizing control), dounced with type B pestle in lysis buffer (see above) and digested using micrococcal nuclease (1:1000; catalog No. M0247S; New England Biolabs) for 3 min at 37 °C. .. The RNAs crosslinked with the PTB proteins were ligated with an RNA adapter (/5′P/AGGTCGGAAGAGCGGTTCAG/3ddC/) at 3′ end using T4 RNA Ligase I (catalog No. AM2141; Ambion) on beads at 16 °C overnight.


    Article Title: A Reverse Genetics Platform That Spans the Zika Virus Family Tree
    Article Snippet: Paragraph title: Viral genome sequencing and modified 5′-3′ RACE. ... After another phenol-chloroform extraction and isopropanol precipitation, the RNA was incubated with T4 RNA ligase I (Ambion) for 1 h at 37°C and then overnight at 4°C, to ligate the 5′ and 3′ ends. cDNA (Superscript III; Invitrogen) was made and used to generate an amplicon containing both the 5′ and 3′ UTR sequences, which was Sanger sequenced.


    Article Title: Large-scale profiling of microRNAs for The Cancer Genome Atlas
    Article Snippet: An RNA 5′ adapter was then added, using a T4 RNA ligase (Ambion USA, cat. AM2141) and ATP, and was incubated at 37°C for 1 h. The sequence of the single strand RNA adapter is 5′GUUCAGAGUUCUACAGUCCGACGAUCUGGUCAA3′. .. When ligation was completed, first strand cDNA was synthesized using Superscript II Reverse Transcriptase (Invitrogen, cat. 18064 014) and an RT primer (5′-CAAGCAGAAGACGGCATACGAGAT-3′).

    Article Title: Landscape of Fluid Sets of Hairpin-Derived 21-/24-nt-Long Small RNAs at Seed Set Uncovers Special Epigenetic Features in Picea glauca
    Article Snippet: A 5′ adapter was then added using a T4 RNA ligase (Ambion USA, cat. AM2141) and ATPs. .. After ligation, first-strand cDNA was synthesized using a Superscript II Reverse Transcriptase (Invitrogen, cat. 18064 014) and one RT primer.

    Article Title: Automated high throughput nucleic acid purification from formalin-fixed paraffin-embedded tissue samples for next generation sequence analysis
    Article Snippet: miRNA libraries Total RNA/nucleic acid was used for RNA ligation-based library construction as described in detail in . .. Following two rounds of bead-based removal of unligated adapters, 5’-end adapter was introduced using T4 RNA ligase (Ambion; Catalog# AM2141).

    Article Title: Epigenetic and transcriptional determinants of the human breast
    Article Snippet: .. An RNA 5′ adapter was then added, using a T4 RNA ligase (Ambion USA, cat. AM2141) and ATP, and is incubated at 37 °C for 1 h. Following ligation 1st strand cDNA is synthesized using Superscript II reverse transcriptase (Invitrogen, cat.18064 014). .. The resulting product was PCR amplified using the 3′ PCR primer (5′-CAAGCAGAAGACGGCATACGAGAT-3′) and an indexed 5′ PCR primer (5′-AATGATACGGCGACCACCGACAGNNNNNNGTTCAGAGTTCTACAGTCCGA-3′), Phusion Hot Start High Fidelity DNA polymerase (NEB Canada, cat. F-540 l), buffer, dNTPs and dimethylsulphoxide (DMSO).

    Article Title: Global Analysis of Small RNA Dynamics during Seed Development of Picea glauca and Arabidopsis thaliana Populations Reveals Insights on their Evolutionary Trajectories
    Article Snippet: A 5′ adapter was then added using a T4 RNA ligase (Ambion USA, cat. AM2141) and ATPs. .. After ligation, first strand cDNA was synthesized using a Superscript II Reverse Transcriptase (Invitrogen, cat. 18064 014) and one RT primer.


    Article Title: A Reverse Genetics Platform That Spans the Zika Virus Family Tree
    Article Snippet: Sanger sequencing was performed on PCR templates generated using Phusion High-Fidelity DNA polymerase (New England BioLabs) and analyzed using Sequencher (Gene Codes) and Lasergene (DNAStar) software. .. After another phenol-chloroform extraction and isopropanol precipitation, the RNA was incubated with T4 RNA ligase I (Ambion) for 1 h at 37°C and then overnight at 4°C, to ligate the 5′ and 3′ ends. cDNA (Superscript III; Invitrogen) was made and used to generate an amplicon containing both the 5′ and 3′ UTR sequences, which was Sanger sequenced.

    Polymerase Chain Reaction:

    Article Title: The Microprocessor controls the activity of mammalian retrotransposons
    Article Snippet: 1 μg of total RNA was ligated directly to 15 pmol of the 5′ linker, requiring the presence of 5′phosphates on the ligated RNA, in a 20 μl volume (2 μl 10X T4 RNAligase buffer, 10μl PEG 8000 40% and2 μl 10X T4 RNA ligase (Ambion)). .. PCR reactions on 4 μl of resulting cDNAs were carried out using Taq polymerase (Invitrogen) and specific primers (upSK primer and 484as primer).

    Article Title: A Reverse Genetics Platform That Spans the Zika Virus Family Tree
    Article Snippet: Sanger sequencing was performed on PCR templates generated using Phusion High-Fidelity DNA polymerase (New England BioLabs) and analyzed using Sequencher (Gene Codes) and Lasergene (DNAStar) software. .. After another phenol-chloroform extraction and isopropanol precipitation, the RNA was incubated with T4 RNA ligase I (Ambion) for 1 h at 37°C and then overnight at 4°C, to ligate the 5′ and 3′ ends. cDNA (Superscript III; Invitrogen) was made and used to generate an amplicon containing both the 5′ and 3′ UTR sequences, which was Sanger sequenced.

    Article Title: Large-scale profiling of microRNAs for The Cancer Genome Atlas
    Article Snippet: An RNA 5′ adapter was then added, using a T4 RNA ligase (Ambion USA, cat. AM2141) and ATP, and was incubated at 37°C for 1 h. The sequence of the single strand RNA adapter is 5′GUUCAGAGUUCUACAGUCCGACGAUCUGGUCAA3′. .. This was the template for the final library polymerase chain reaction (PCR), into which we introduced 6-nt index sequences that enabled libraries to be identified (i.e. demultiplexed) from a sequenced pool that contained multiple libraries.

    Article Title: Landscape of Fluid Sets of Hairpin-Derived 21-/24-nt-Long Small RNAs at Seed Set Uncovers Special Epigenetic Features in Picea glauca
    Article Snippet: A 5′ adapter was then added using a T4 RNA ligase (Ambion USA, cat. AM2141) and ATPs. .. This was the template for the final library PCR, into which 6-nt mers index was introduced to identify libraries (i.e., demultiplexed) from a sequenced pool.

    Article Title: Differentially expressed genes in mycorrhized and nodulated roots of common bean are associated with defense, cell wall architecture, N metabolism, and P metabolism
    Article Snippet: AM2141, Life Technologies) for 30 min at 30°C to ligate the adapters. .. The purified cDNA libraries were subjected to PCR amplification using Platinum PCR Supermix High Fidelity and Ion Xpress Barcode reverse and forward primers (Thermo Fisher Scientific) with the following conditions: 95°C for 2 min; two cycles of 94°C for 30 s, 50°C for 30 s, and 68°C for 30 s; 14 cycles of 94°C for 30 s, 62°C for 30 s, and 68°C for 30 s; and a final extension at 68°C for 5 min.

    Article Title: Preparation of Multiplexed Small RNA Libraries From Plants
    Article Snippet: .. 8-Strip PCR thin-walled, 200 μl tubes (Corning Incorporated, Axygen® , catalog number: PCR-0208-CP-C) miRNA cloning linker 1 (/5′App/CTGTAGGCACCATCAAT/3′ddC/; 1 nm) (Integrated DNA Technologies, catalog number: 11-04-03-05) Truncated, K227Q mutation T4 RNA Ligase 2 (New England Biolabs, catalog number: M0351L) De-adenylase (New England Biolabs, catalog number: M0331S) Exonuclease VII (United State Biological, catalog number: 70082Z) RNA 5′ Adapter (GUUCAGAGUUCUACAGUCCGACGAUC) (Illumina RA5, catalog number: 15013205) dATP (Life Technologies, catalog number: 55082) T4 RNA Ligase I (Life Technologies, catalog number: AM2141) RT-PCR Primer (ATTGATGGTGCCTACAG; 25 nmol; de-salted) (Integrated DNA Technologies) SuperScript III (Life Technologies, catalog number: 18080051) Phusion High Fidelity II (Thermo Fisher Scientific, catalog number: F549L) 5′ PCR Primer (Illumina small RNA PCR primer 2: AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA) 3′ Indexed PCR Primer I1 – I12 (100 nmol; PAGE-purified) (Integrated DNA Technologies) Note: The barcodes below (underlined sequences) are reverse complemented in the final Illumina output sequence (see sequence in square brackets for each primer). .. I1 [CGATGT]: CAAGCAGAAGACGGCATACGA ACATCG ATTGATGGTGCCTACAG I2 [GATCAC]: CAAGCAGAAGACGGCATACGA GTGATC ATTGATGGTGCCTACAG I3 [CAGATG]: CAAGCAGAAGACGGCATACGA CATCTG ATTGATGGTGCCTACAG I4 [TACGTT]: CAAGCAGAAGACGGCATACGA AACGTA ATTGATGGTGCCTACAG I5 [TTACCA]: CAAGCAGAAGACGGCATACGA TGGTAA ATTGATGGTGCCTACAG I6 [ACTGTA]: CAAGCAGAAGACGGCATACGA TACAGT ATTGATGGTGCCTACAG I7 [ATCACG]: CAAGCAGAAGACGGCATACGA CGTGAT ATTGATGGTGCCTACAG I8 [ACTTGT]: CAAGCAGAAGACGGCATACGA ACAAGT ATTGATGGTGCCTACAG I9 [GCCAAT]: CAAGCAGAAGACGGCATACGA ATTGGC ATTGATGGTGCCTACAG I10 [TGCTAG]: CAAGCAGAAGACGGCATACGA CTAGCA ATTGATGGTGCCTACAG I11 [CTTGTA]: CAAGCAGAAGACGGCATACGA TACAAG ATTGATGGTGCCTACAG I12 [TCAGGC]: CAAGCAGAAGACGGCATACGA GCCTGA ATTGATGGTGCCTACAG QIAquick PCR Purification Kit (QIAGEN, catalog number: 28106) Diethylpyrocarbonate (DEPC)-H2 O/ RNase-free H2 O DNA size marker suitable for detecting a ~120 bp fragment (50 bp step ladder, Promega Corporation, catalog number: G4521; 25 bp step ladder, Promega Corporation, catalog number: G4511) 3 M sodium acetate (NaOAc) (pH 5.5) Reagents for 6% native PAGE 37.5: 1 polyacrylamide:bisacrylamide (see Recipes) TEMED (Life Technologies, catalog number: 15524-010) 10% Ammonium persulfate (Sigma, catalog number: A3678-100G) (See Recipes)

    Article Title: Epigenetic and transcriptional determinants of the human breast
    Article Snippet: An RNA 5′ adapter was then added, using a T4 RNA ligase (Ambion USA, cat. AM2141) and ATP, and is incubated at 37 °C for 1 h. Following ligation 1st strand cDNA is synthesized using Superscript II reverse transcriptase (Invitrogen, cat.18064 014). .. The resulting product was PCR amplified using the 3′ PCR primer (5′-CAAGCAGAAGACGGCATACGAGAT-3′) and an indexed 5′ PCR primer (5′-AATGATACGGCGACCACCGACAGNNNNNNGTTCAGAGTTCTACAGTCCGA-3′), Phusion Hot Start High Fidelity DNA polymerase (NEB Canada, cat. F-540 l), buffer, dNTPs and dimethylsulphoxide (DMSO).

    Article Title: Global Analysis of Small RNA Dynamics during Seed Development of Picea glauca and Arabidopsis thaliana Populations Reveals Insights on their Evolutionary Trajectories
    Article Snippet: A 5′ adapter was then added using a T4 RNA ligase (Ambion USA, cat. AM2141) and ATPs. .. This was the template for the final library PCR, into which 6-nt mers index was introduced to identify libraries (i.e., demultiplexed) from a sequenced pool.


    Article Title: A Reverse Genetics Platform That Spans the Zika Virus Family Tree
    Article Snippet: Paragraph title: Viral genome sequencing and modified 5′-3′ RACE. ... After another phenol-chloroform extraction and isopropanol precipitation, the RNA was incubated with T4 RNA ligase I (Ambion) for 1 h at 37°C and then overnight at 4°C, to ligate the 5′ and 3′ ends. cDNA (Superscript III; Invitrogen) was made and used to generate an amplicon containing both the 5′ and 3′ UTR sequences, which was Sanger sequenced.

    Article Title: Large-scale profiling of microRNAs for The Cancer Genome Atlas
    Article Snippet: .. An RNA 5′ adapter was then added, using a T4 RNA ligase (Ambion USA, cat. AM2141) and ATP, and was incubated at 37°C for 1 h. The sequence of the single strand RNA adapter is 5′GUUCAGAGUUCUACAGUCCGACGAUCUGGUCAA3′. .. When ligation was completed, first strand cDNA was synthesized using Superscript II Reverse Transcriptase (Invitrogen, cat. 18064 014) and an RT primer (5′-CAAGCAGAAGACGGCATACGAGAT-3′).

    Article Title: Landscape of Fluid Sets of Hairpin-Derived 21-/24-nt-Long Small RNAs at Seed Set Uncovers Special Epigenetic Features in Picea glauca
    Article Snippet: Paragraph title: RNA Isolation, Library Construction, and sRNA Sequencing ... A 5′ adapter was then added using a T4 RNA ligase (Ambion USA, cat. AM2141) and ATPs.

    Article Title: Preparation of Multiplexed Small RNA Libraries From Plants
    Article Snippet: .. 8-Strip PCR thin-walled, 200 μl tubes (Corning Incorporated, Axygen® , catalog number: PCR-0208-CP-C) miRNA cloning linker 1 (/5′App/CTGTAGGCACCATCAAT/3′ddC/; 1 nm) (Integrated DNA Technologies, catalog number: 11-04-03-05) Truncated, K227Q mutation T4 RNA Ligase 2 (New England Biolabs, catalog number: M0351L) De-adenylase (New England Biolabs, catalog number: M0331S) Exonuclease VII (United State Biological, catalog number: 70082Z) RNA 5′ Adapter (GUUCAGAGUUCUACAGUCCGACGAUC) (Illumina RA5, catalog number: 15013205) dATP (Life Technologies, catalog number: 55082) T4 RNA Ligase I (Life Technologies, catalog number: AM2141) RT-PCR Primer (ATTGATGGTGCCTACAG; 25 nmol; de-salted) (Integrated DNA Technologies) SuperScript III (Life Technologies, catalog number: 18080051) Phusion High Fidelity II (Thermo Fisher Scientific, catalog number: F549L) 5′ PCR Primer (Illumina small RNA PCR primer 2: AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA) 3′ Indexed PCR Primer I1 – I12 (100 nmol; PAGE-purified) (Integrated DNA Technologies) Note: The barcodes below (underlined sequences) are reverse complemented in the final Illumina output sequence (see sequence in square brackets for each primer). .. I1 [CGATGT]: CAAGCAGAAGACGGCATACGA ACATCG ATTGATGGTGCCTACAG I2 [GATCAC]: CAAGCAGAAGACGGCATACGA GTGATC ATTGATGGTGCCTACAG I3 [CAGATG]: CAAGCAGAAGACGGCATACGA CATCTG ATTGATGGTGCCTACAG I4 [TACGTT]: CAAGCAGAAGACGGCATACGA AACGTA ATTGATGGTGCCTACAG I5 [TTACCA]: CAAGCAGAAGACGGCATACGA TGGTAA ATTGATGGTGCCTACAG I6 [ACTGTA]: CAAGCAGAAGACGGCATACGA TACAGT ATTGATGGTGCCTACAG I7 [ATCACG]: CAAGCAGAAGACGGCATACGA CGTGAT ATTGATGGTGCCTACAG I8 [ACTTGT]: CAAGCAGAAGACGGCATACGA ACAAGT ATTGATGGTGCCTACAG I9 [GCCAAT]: CAAGCAGAAGACGGCATACGA ATTGGC ATTGATGGTGCCTACAG I10 [TGCTAG]: CAAGCAGAAGACGGCATACGA CTAGCA ATTGATGGTGCCTACAG I11 [CTTGTA]: CAAGCAGAAGACGGCATACGA TACAAG ATTGATGGTGCCTACAG I12 [TCAGGC]: CAAGCAGAAGACGGCATACGA GCCTGA ATTGATGGTGCCTACAG QIAquick PCR Purification Kit (QIAGEN, catalog number: 28106) Diethylpyrocarbonate (DEPC)-H2 O/ RNase-free H2 O DNA size marker suitable for detecting a ~120 bp fragment (50 bp step ladder, Promega Corporation, catalog number: G4521; 25 bp step ladder, Promega Corporation, catalog number: G4511) 3 M sodium acetate (NaOAc) (pH 5.5) Reagents for 6% native PAGE 37.5: 1 polyacrylamide:bisacrylamide (see Recipes) TEMED (Life Technologies, catalog number: 15524-010) 10% Ammonium persulfate (Sigma, catalog number: A3678-100G) (See Recipes)

    Article Title: Epigenetic and transcriptional determinants of the human breast
    Article Snippet: Paragraph title: miRNA sequencing ... An RNA 5′ adapter was then added, using a T4 RNA ligase (Ambion USA, cat. AM2141) and ATP, and is incubated at 37 °C for 1 h. Following ligation 1st strand cDNA is synthesized using Superscript II reverse transcriptase (Invitrogen, cat.18064 014).

    Article Title: Global Analysis of Small RNA Dynamics during Seed Development of Picea glauca and Arabidopsis thaliana Populations Reveals Insights on their Evolutionary Trajectories
    Article Snippet: Paragraph title: RNA isolation, library construction, and sRNA sequencing ... A 5′ adapter was then added using a T4 RNA ligase (Ambion USA, cat. AM2141) and ATPs.

    Binding Assay:

    Article Title: Differentially expressed genes in mycorrhized and nodulated roots of common bean are associated with defense, cell wall architecture, N metabolism, and P metabolism
    Article Snippet: Fragmented RNA was purified using nucleic acid binding beads and binding buffers according to the manufacturer’s instructions (Cat. nr. .. AM2141, Life Technologies) for 30 min at 30°C to ligate the adapters.

    In Vivo:

    Article Title: The Microprocessor controls the activity of mammalian retrotransposons
    Article Snippet: Paragraph title: Mapping cleavage sites in vivo using 5′ Phosphate-dependent 5′RACE ... 1 μg of total RNA was ligated directly to 15 pmol of the 5′ linker, requiring the presence of 5′phosphates on the ligated RNA, in a 20 μl volume (2 μl 10X T4 RNAligase buffer, 10μl PEG 8000 40% and2 μl 10X T4 RNA ligase (Ambion)).

    RNA Sequencing Assay:

    Article Title: Epigenetic and transcriptional determinants of the human breast
    Article Snippet: miRNA sequencing Standard operating procedures for RNA-seq library construction are available ( http://www.roadmapepigenomics.org/protocols/type/experimental/ ) or by request. miRNA-seq library construction involves the following SOPs in order: (1) Purification of polyA+ mRNA and mRNA(−) flowthrough total RNA using MultiMACS 96 separation unit; (2) miRNA3—plate format miRNA library construction. .. An RNA 5′ adapter was then added, using a T4 RNA ligase (Ambion USA, cat. AM2141) and ATP, and is incubated at 37 °C for 1 h. Following ligation 1st strand cDNA is synthesized using Superscript II reverse transcriptase (Invitrogen, cat.18064 014).


    Article Title: Preparation of Multiplexed Small RNA Libraries From Plants
    Article Snippet: .. 8-Strip PCR thin-walled, 200 μl tubes (Corning Incorporated, Axygen® , catalog number: PCR-0208-CP-C) miRNA cloning linker 1 (/5′App/CTGTAGGCACCATCAAT/3′ddC/; 1 nm) (Integrated DNA Technologies, catalog number: 11-04-03-05) Truncated, K227Q mutation T4 RNA Ligase 2 (New England Biolabs, catalog number: M0351L) De-adenylase (New England Biolabs, catalog number: M0331S) Exonuclease VII (United State Biological, catalog number: 70082Z) RNA 5′ Adapter (GUUCAGAGUUCUACAGUCCGACGAUC) (Illumina RA5, catalog number: 15013205) dATP (Life Technologies, catalog number: 55082) T4 RNA Ligase I (Life Technologies, catalog number: AM2141) RT-PCR Primer (ATTGATGGTGCCTACAG; 25 nmol; de-salted) (Integrated DNA Technologies) SuperScript III (Life Technologies, catalog number: 18080051) Phusion High Fidelity II (Thermo Fisher Scientific, catalog number: F549L) 5′ PCR Primer (Illumina small RNA PCR primer 2: AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA) 3′ Indexed PCR Primer I1 – I12 (100 nmol; PAGE-purified) (Integrated DNA Technologies) Note: The barcodes below (underlined sequences) are reverse complemented in the final Illumina output sequence (see sequence in square brackets for each primer). .. I1 [CGATGT]: CAAGCAGAAGACGGCATACGA ACATCG ATTGATGGTGCCTACAG I2 [GATCAC]: CAAGCAGAAGACGGCATACGA GTGATC ATTGATGGTGCCTACAG I3 [CAGATG]: CAAGCAGAAGACGGCATACGA CATCTG ATTGATGGTGCCTACAG I4 [TACGTT]: CAAGCAGAAGACGGCATACGA AACGTA ATTGATGGTGCCTACAG I5 [TTACCA]: CAAGCAGAAGACGGCATACGA TGGTAA ATTGATGGTGCCTACAG I6 [ACTGTA]: CAAGCAGAAGACGGCATACGA TACAGT ATTGATGGTGCCTACAG I7 [ATCACG]: CAAGCAGAAGACGGCATACGA CGTGAT ATTGATGGTGCCTACAG I8 [ACTTGT]: CAAGCAGAAGACGGCATACGA ACAAGT ATTGATGGTGCCTACAG I9 [GCCAAT]: CAAGCAGAAGACGGCATACGA ATTGGC ATTGATGGTGCCTACAG I10 [TGCTAG]: CAAGCAGAAGACGGCATACGA CTAGCA ATTGATGGTGCCTACAG I11 [CTTGTA]: CAAGCAGAAGACGGCATACGA TACAAG ATTGATGGTGCCTACAG I12 [TCAGGC]: CAAGCAGAAGACGGCATACGA GCCTGA ATTGATGGTGCCTACAG QIAquick PCR Purification Kit (QIAGEN, catalog number: 28106) Diethylpyrocarbonate (DEPC)-H2 O/ RNase-free H2 O DNA size marker suitable for detecting a ~120 bp fragment (50 bp step ladder, Promega Corporation, catalog number: G4521; 25 bp step ladder, Promega Corporation, catalog number: G4511) 3 M sodium acetate (NaOAc) (pH 5.5) Reagents for 6% native PAGE 37.5: 1 polyacrylamide:bisacrylamide (see Recipes) TEMED (Life Technologies, catalog number: 15524-010) 10% Ammonium persulfate (Sigma, catalog number: A3678-100G) (See Recipes)


    Article Title: A Reverse Genetics Platform That Spans the Zika Virus Family Tree
    Article Snippet: Briefly, viral RNA was isolated and treated with calf intestinal phosphatase (Ambion) for 1 h at 37°C to remove terminal phosphates of uncapped RNAs. .. After another phenol-chloroform extraction and isopropanol precipitation, the RNA was incubated with T4 RNA ligase I (Ambion) for 1 h at 37°C and then overnight at 4°C, to ligate the 5′ and 3′ ends. cDNA (Superscript III; Invitrogen) was made and used to generate an amplicon containing both the 5′ and 3′ UTR sequences, which was Sanger sequenced.

    Article Title: Landscape of Fluid Sets of Hairpin-Derived 21-/24-nt-Long Small RNAs at Seed Set Uncovers Special Epigenetic Features in Picea glauca
    Article Snippet: Paragraph title: RNA Isolation, Library Construction, and sRNA Sequencing ... A 5′ adapter was then added using a T4 RNA ligase (Ambion USA, cat. AM2141) and ATPs.

    Article Title: Global Analysis of Small RNA Dynamics during Seed Development of Picea glauca and Arabidopsis thaliana Populations Reveals Insights on their Evolutionary Trajectories
    Article Snippet: Paragraph title: RNA isolation, library construction, and sRNA sequencing ... A 5′ adapter was then added using a T4 RNA ligase (Ambion USA, cat. AM2141) and ATPs.


    Article Title: Differentially expressed genes in mycorrhized and nodulated roots of common bean are associated with defense, cell wall architecture, N metabolism, and P metabolism
    Article Snippet: Purified samples were evaluated on an Agilent 2100 Bioanalyzer to assess yield and mRNA fragment size distribution. .. AM2141, Life Technologies) for 30 min at 30°C to ligate the adapters.

    Article Title: Preparation of Multiplexed Small RNA Libraries From Plants
    Article Snippet: 8-Strip PCR thin-walled, 200 μl tubes (Corning Incorporated, Axygen® , catalog number: PCR-0208-CP-C) miRNA cloning linker 1 (/5′App/CTGTAGGCACCATCAAT/3′ddC/; 1 nm) (Integrated DNA Technologies, catalog number: 11-04-03-05) Truncated, K227Q mutation T4 RNA Ligase 2 (New England Biolabs, catalog number: M0351L) De-adenylase (New England Biolabs, catalog number: M0331S) Exonuclease VII (United State Biological, catalog number: 70082Z) RNA 5′ Adapter (GUUCAGAGUUCUACAGUCCGACGAUC) (Illumina RA5, catalog number: 15013205) dATP (Life Technologies, catalog number: 55082) T4 RNA Ligase I (Life Technologies, catalog number: AM2141) RT-PCR Primer (ATTGATGGTGCCTACAG; 25 nmol; de-salted) (Integrated DNA Technologies) SuperScript III (Life Technologies, catalog number: 18080051) Phusion High Fidelity II (Thermo Fisher Scientific, catalog number: F549L) 5′ PCR Primer (Illumina small RNA PCR primer 2: AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA) 3′ Indexed PCR Primer I1 – I12 (100 nmol; PAGE-purified) (Integrated DNA Technologies) Note: The barcodes below (underlined sequences) are reverse complemented in the final Illumina output sequence (see sequence in square brackets for each primer). .. I1 [CGATGT]: CAAGCAGAAGACGGCATACGA ACATCG ATTGATGGTGCCTACAG I2 [GATCAC]: CAAGCAGAAGACGGCATACGA GTGATC ATTGATGGTGCCTACAG I3 [CAGATG]: CAAGCAGAAGACGGCATACGA CATCTG ATTGATGGTGCCTACAG I4 [TACGTT]: CAAGCAGAAGACGGCATACGA AACGTA ATTGATGGTGCCTACAG I5 [TTACCA]: CAAGCAGAAGACGGCATACGA TGGTAA ATTGATGGTGCCTACAG I6 [ACTGTA]: CAAGCAGAAGACGGCATACGA TACAGT ATTGATGGTGCCTACAG I7 [ATCACG]: CAAGCAGAAGACGGCATACGA CGTGAT ATTGATGGTGCCTACAG I8 [ACTTGT]: CAAGCAGAAGACGGCATACGA ACAAGT ATTGATGGTGCCTACAG I9 [GCCAAT]: CAAGCAGAAGACGGCATACGA ATTGGC ATTGATGGTGCCTACAG I10 [TGCTAG]: CAAGCAGAAGACGGCATACGA CTAGCA ATTGATGGTGCCTACAG I11 [CTTGTA]: CAAGCAGAAGACGGCATACGA TACAAG ATTGATGGTGCCTACAG I12 [TCAGGC]: CAAGCAGAAGACGGCATACGA GCCTGA ATTGATGGTGCCTACAG QIAquick PCR Purification Kit (QIAGEN, catalog number: 28106) Diethylpyrocarbonate (DEPC)-H2 O/ RNase-free H2 O DNA size marker suitable for detecting a ~120 bp fragment (50 bp step ladder, Promega Corporation, catalog number: G4521; 25 bp step ladder, Promega Corporation, catalog number: G4511) 3 M sodium acetate (NaOAc) (pH 5.5) Reagents for 6% native PAGE 37.5: 1 polyacrylamide:bisacrylamide (see Recipes) TEMED (Life Technologies, catalog number: 15524-010) 10% Ammonium persulfate (Sigma, catalog number: A3678-100G) (See Recipes)

    Article Title: Epigenetic and transcriptional determinants of the human breast
    Article Snippet: miRNA sequencing Standard operating procedures for RNA-seq library construction are available ( http://www.roadmapepigenomics.org/protocols/type/experimental/ ) or by request. miRNA-seq library construction involves the following SOPs in order: (1) Purification of polyA+ mRNA and mRNA(−) flowthrough total RNA using MultiMACS 96 separation unit; (2) miRNA3—plate format miRNA library construction. .. An RNA 5′ adapter was then added, using a T4 RNA ligase (Ambion USA, cat. AM2141) and ATP, and is incubated at 37 °C for 1 h. Following ligation 1st strand cDNA is synthesized using Superscript II reverse transcriptase (Invitrogen, cat.18064 014).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Preparation of Multiplexed Small RNA Libraries From Plants
    Article Snippet: .. 8-Strip PCR thin-walled, 200 μl tubes (Corning Incorporated, Axygen® , catalog number: PCR-0208-CP-C) miRNA cloning linker 1 (/5′App/CTGTAGGCACCATCAAT/3′ddC/; 1 nm) (Integrated DNA Technologies, catalog number: 11-04-03-05) Truncated, K227Q mutation T4 RNA Ligase 2 (New England Biolabs, catalog number: M0351L) De-adenylase (New England Biolabs, catalog number: M0331S) Exonuclease VII (United State Biological, catalog number: 70082Z) RNA 5′ Adapter (GUUCAGAGUUCUACAGUCCGACGAUC) (Illumina RA5, catalog number: 15013205) dATP (Life Technologies, catalog number: 55082) T4 RNA Ligase I (Life Technologies, catalog number: AM2141) RT-PCR Primer (ATTGATGGTGCCTACAG; 25 nmol; de-salted) (Integrated DNA Technologies) SuperScript III (Life Technologies, catalog number: 18080051) Phusion High Fidelity II (Thermo Fisher Scientific, catalog number: F549L) 5′ PCR Primer (Illumina small RNA PCR primer 2: AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA) 3′ Indexed PCR Primer I1 – I12 (100 nmol; PAGE-purified) (Integrated DNA Technologies) Note: The barcodes below (underlined sequences) are reverse complemented in the final Illumina output sequence (see sequence in square brackets for each primer). .. I1 [CGATGT]: CAAGCAGAAGACGGCATACGA ACATCG ATTGATGGTGCCTACAG I2 [GATCAC]: CAAGCAGAAGACGGCATACGA GTGATC ATTGATGGTGCCTACAG I3 [CAGATG]: CAAGCAGAAGACGGCATACGA CATCTG ATTGATGGTGCCTACAG I4 [TACGTT]: CAAGCAGAAGACGGCATACGA AACGTA ATTGATGGTGCCTACAG I5 [TTACCA]: CAAGCAGAAGACGGCATACGA TGGTAA ATTGATGGTGCCTACAG I6 [ACTGTA]: CAAGCAGAAGACGGCATACGA TACAGT ATTGATGGTGCCTACAG I7 [ATCACG]: CAAGCAGAAGACGGCATACGA CGTGAT ATTGATGGTGCCTACAG I8 [ACTTGT]: CAAGCAGAAGACGGCATACGA ACAAGT ATTGATGGTGCCTACAG I9 [GCCAAT]: CAAGCAGAAGACGGCATACGA ATTGGC ATTGATGGTGCCTACAG I10 [TGCTAG]: CAAGCAGAAGACGGCATACGA CTAGCA ATTGATGGTGCCTACAG I11 [CTTGTA]: CAAGCAGAAGACGGCATACGA TACAAG ATTGATGGTGCCTACAG I12 [TCAGGC]: CAAGCAGAAGACGGCATACGA GCCTGA ATTGATGGTGCCTACAG QIAquick PCR Purification Kit (QIAGEN, catalog number: 28106) Diethylpyrocarbonate (DEPC)-H2 O/ RNase-free H2 O DNA size marker suitable for detecting a ~120 bp fragment (50 bp step ladder, Promega Corporation, catalog number: G4521; 25 bp step ladder, Promega Corporation, catalog number: G4511) 3 M sodium acetate (NaOAc) (pH 5.5) Reagents for 6% native PAGE 37.5: 1 polyacrylamide:bisacrylamide (see Recipes) TEMED (Life Technologies, catalog number: 15524-010) 10% Ammonium persulfate (Sigma, catalog number: A3678-100G) (See Recipes)

    Polyacrylamide Gel Electrophoresis:

    Article Title: Preparation of Multiplexed Small RNA Libraries From Plants
    Article Snippet: .. 8-Strip PCR thin-walled, 200 μl tubes (Corning Incorporated, Axygen® , catalog number: PCR-0208-CP-C) miRNA cloning linker 1 (/5′App/CTGTAGGCACCATCAAT/3′ddC/; 1 nm) (Integrated DNA Technologies, catalog number: 11-04-03-05) Truncated, K227Q mutation T4 RNA Ligase 2 (New England Biolabs, catalog number: M0351L) De-adenylase (New England Biolabs, catalog number: M0331S) Exonuclease VII (United State Biological, catalog number: 70082Z) RNA 5′ Adapter (GUUCAGAGUUCUACAGUCCGACGAUC) (Illumina RA5, catalog number: 15013205) dATP (Life Technologies, catalog number: 55082) T4 RNA Ligase I (Life Technologies, catalog number: AM2141) RT-PCR Primer (ATTGATGGTGCCTACAG; 25 nmol; de-salted) (Integrated DNA Technologies) SuperScript III (Life Technologies, catalog number: 18080051) Phusion High Fidelity II (Thermo Fisher Scientific, catalog number: F549L) 5′ PCR Primer (Illumina small RNA PCR primer 2: AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA) 3′ Indexed PCR Primer I1 – I12 (100 nmol; PAGE-purified) (Integrated DNA Technologies) Note: The barcodes below (underlined sequences) are reverse complemented in the final Illumina output sequence (see sequence in square brackets for each primer). .. I1 [CGATGT]: CAAGCAGAAGACGGCATACGA ACATCG ATTGATGGTGCCTACAG I2 [GATCAC]: CAAGCAGAAGACGGCATACGA GTGATC ATTGATGGTGCCTACAG I3 [CAGATG]: CAAGCAGAAGACGGCATACGA CATCTG ATTGATGGTGCCTACAG I4 [TACGTT]: CAAGCAGAAGACGGCATACGA AACGTA ATTGATGGTGCCTACAG I5 [TTACCA]: CAAGCAGAAGACGGCATACGA TGGTAA ATTGATGGTGCCTACAG I6 [ACTGTA]: CAAGCAGAAGACGGCATACGA TACAGT ATTGATGGTGCCTACAG I7 [ATCACG]: CAAGCAGAAGACGGCATACGA CGTGAT ATTGATGGTGCCTACAG I8 [ACTTGT]: CAAGCAGAAGACGGCATACGA ACAAGT ATTGATGGTGCCTACAG I9 [GCCAAT]: CAAGCAGAAGACGGCATACGA ATTGGC ATTGATGGTGCCTACAG I10 [TGCTAG]: CAAGCAGAAGACGGCATACGA CTAGCA ATTGATGGTGCCTACAG I11 [CTTGTA]: CAAGCAGAAGACGGCATACGA TACAAG ATTGATGGTGCCTACAG I12 [TCAGGC]: CAAGCAGAAGACGGCATACGA GCCTGA ATTGATGGTGCCTACAG QIAquick PCR Purification Kit (QIAGEN, catalog number: 28106) Diethylpyrocarbonate (DEPC)-H2 O/ RNase-free H2 O DNA size marker suitable for detecting a ~120 bp fragment (50 bp step ladder, Promega Corporation, catalog number: G4521; 25 bp step ladder, Promega Corporation, catalog number: G4511) 3 M sodium acetate (NaOAc) (pH 5.5) Reagents for 6% native PAGE 37.5: 1 polyacrylamide:bisacrylamide (see Recipes) TEMED (Life Technologies, catalog number: 15524-010) 10% Ammonium persulfate (Sigma, catalog number: A3678-100G) (See Recipes)

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Epigenetic and transcriptional determinants of the human breast
    Article Snippet: .. An RNA 5′ adapter was then added, using a T4 RNA ligase (Ambion USA, cat. AM2141) and ATP, and is incubated at 37 °C for 1 h. Following ligation 1st strand cDNA is synthesized using Superscript II reverse transcriptase (Invitrogen, cat.18064 014). .. The resulting product was PCR amplified using the 3′ PCR primer (5′-CAAGCAGAAGACGGCATACGAGAT-3′) and an indexed 5′ PCR primer (5′-AATGATACGGCGACCACCGACAGNNNNNNGTTCAGAGTTCTACAGTCCGA-3′), Phusion Hot Start High Fidelity DNA polymerase (NEB Canada, cat. F-540 l), buffer, dNTPs and dimethylsulphoxide (DMSO).

    Chromatin Immunoprecipitation:

    Article Title: Epigenetic and transcriptional determinants of the human breast
    Article Snippet: Flowthrough RNA quality was checked for a subset of samples using an Agilent Bioanalyzer RNA nano chip. .. An RNA 5′ adapter was then added, using a T4 RNA ligase (Ambion USA, cat. AM2141) and ATP, and is incubated at 37 °C for 1 h. Following ligation 1st strand cDNA is synthesized using Superscript II reverse transcriptase (Invitrogen, cat.18064 014).

    Plasmid Preparation:

    Article Title: The Microprocessor controls the activity of mammalian retrotransposons
    Article Snippet: An RNA linker was synthesized in vitro using Mmessage Mmachine T7 Ultra Kit (Ambion) and Eco RI- digested pBluescript KS plasmid (Stratagene) as template. .. 1 μg of total RNA was ligated directly to 15 pmol of the 5′ linker, requiring the presence of 5′phosphates on the ligated RNA, in a 20 μl volume (2 μl 10X T4 RNAligase buffer, 10μl PEG 8000 40% and2 μl 10X T4 RNA ligase (Ambion)).


    Article Title: A Reverse Genetics Platform That Spans the Zika Virus Family Tree
    Article Snippet: Sanger sequencing was performed on PCR templates generated using Phusion High-Fidelity DNA polymerase (New England BioLabs) and analyzed using Sequencher (Gene Codes) and Lasergene (DNAStar) software. .. After another phenol-chloroform extraction and isopropanol precipitation, the RNA was incubated with T4 RNA ligase I (Ambion) for 1 h at 37°C and then overnight at 4°C, to ligate the 5′ and 3′ ends. cDNA (Superscript III; Invitrogen) was made and used to generate an amplicon containing both the 5′ and 3′ UTR sequences, which was Sanger sequenced.


    Article Title: Landscape of Fluid Sets of Hairpin-Derived 21-/24-nt-Long Small RNAs at Seed Set Uncovers Special Epigenetic Features in Picea glauca
    Article Snippet: To enrich sRNAs, total RNA samples underwent polyA selection using Miltenyi MultiMACS mRNA isolation kit (cat. 130-092-519) following the manufacturer’s protocol and the flowthrough (i.e., containing sRNA species without mRNA) was used for plate-based sRNA construction. .. A 5′ adapter was then added using a T4 RNA ligase (Ambion USA, cat. AM2141) and ATPs.

    Article Title: Automated high throughput nucleic acid purification from formalin-fixed paraffin-embedded tissue samples for next generation sequence analysis
    Article Snippet: Following two rounds of bead-based removal of unligated adapters, 5’-end adapter was introduced using T4 RNA ligase (Ambion; Catalog# AM2141). .. Following bead-based size selection, cDNA was amplified using Phusion Hotstart (Thermo Fisher; Catalog# F540L).

    Article Title: Global Analysis of Small RNA Dynamics during Seed Development of Picea glauca and Arabidopsis thaliana Populations Reveals Insights on their Evolutionary Trajectories
    Article Snippet: To enrich sRNAs, total RNA samples underwent polyA selection using Miltenyi MultiMACS mRNA isolation kit (cat. 130-092-519) following the manufacturer's protocol and the flowthrough (i.e., containing sRNA species without mRNAs) was used for plate-based sRNA construction. .. A 5′ adapter was then added using a T4 RNA ligase (Ambion USA, cat. AM2141) and ATPs.

    In Vitro:

    Article Title: The Microprocessor controls the activity of mammalian retrotransposons
    Article Snippet: An RNA linker was synthesized in vitro using Mmessage Mmachine T7 Ultra Kit (Ambion) and Eco RI- digested pBluescript KS plasmid (Stratagene) as template. .. 1 μg of total RNA was ligated directly to 15 pmol of the 5′ linker, requiring the presence of 5′phosphates on the ligated RNA, in a 20 μl volume (2 μl 10X T4 RNAligase buffer, 10μl PEG 8000 40% and2 μl 10X T4 RNA ligase (Ambion)).

    Ethanol Precipitation:

    Article Title: Epigenetic and transcriptional determinants of the human breast
    Article Snippet: In brief, flowthrough total MultiMACS RNA was recovered by ethanol precipitation and arrayed into 96-well plates, with controls as described below. .. An RNA 5′ adapter was then added, using a T4 RNA ligase (Ambion USA, cat. AM2141) and ATP, and is incubated at 37 °C for 1 h. Following ligation 1st strand cDNA is synthesized using Superscript II reverse transcriptase (Invitrogen, cat.18064 014).


    Article Title: Landscape of Fluid Sets of Hairpin-Derived 21-/24-nt-Long Small RNAs at Seed Set Uncovers Special Epigenetic Features in Picea glauca
    Article Snippet: The integrity and the quantity of the RNAs were assessed by BioAnalyser 2100 (Agilent Technologies) and Nanodrop ND-1000 spectrophotometer (Thermo Fisher Scientific). .. A 5′ adapter was then added using a T4 RNA ligase (Ambion USA, cat. AM2141) and ATPs.

    Article Title: Global Analysis of Small RNA Dynamics during Seed Development of Picea glauca and Arabidopsis thaliana Populations Reveals Insights on their Evolutionary Trajectories
    Article Snippet: The intergrity and quantity of the RNA samples were assessed on a BioAnalyser 2100 (Agilent Technologies) and a Nanodrop ND-1000 spectrophotometer (Thermo Fisher Scientific). .. A 5′ adapter was then added using a T4 RNA ligase (Ambion USA, cat. AM2141) and ATPs.


    Article Title: Preparation of Multiplexed Small RNA Libraries From Plants
    Article Snippet: 8-Strip PCR thin-walled, 200 μl tubes (Corning Incorporated, Axygen® , catalog number: PCR-0208-CP-C) miRNA cloning linker 1 (/5′App/CTGTAGGCACCATCAAT/3′ddC/; 1 nm) (Integrated DNA Technologies, catalog number: 11-04-03-05) Truncated, K227Q mutation T4 RNA Ligase 2 (New England Biolabs, catalog number: M0351L) De-adenylase (New England Biolabs, catalog number: M0331S) Exonuclease VII (United State Biological, catalog number: 70082Z) RNA 5′ Adapter (GUUCAGAGUUCUACAGUCCGACGAUC) (Illumina RA5, catalog number: 15013205) dATP (Life Technologies, catalog number: 55082) T4 RNA Ligase I (Life Technologies, catalog number: AM2141) RT-PCR Primer (ATTGATGGTGCCTACAG; 25 nmol; de-salted) (Integrated DNA Technologies) SuperScript III (Life Technologies, catalog number: 18080051) Phusion High Fidelity II (Thermo Fisher Scientific, catalog number: F549L) 5′ PCR Primer (Illumina small RNA PCR primer 2: AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA) 3′ Indexed PCR Primer I1 – I12 (100 nmol; PAGE-purified) (Integrated DNA Technologies) Note: The barcodes below (underlined sequences) are reverse complemented in the final Illumina output sequence (see sequence in square brackets for each primer). .. I1 [CGATGT]: CAAGCAGAAGACGGCATACGA ACATCG ATTGATGGTGCCTACAG I2 [GATCAC]: CAAGCAGAAGACGGCATACGA GTGATC ATTGATGGTGCCTACAG I3 [CAGATG]: CAAGCAGAAGACGGCATACGA CATCTG ATTGATGGTGCCTACAG I4 [TACGTT]: CAAGCAGAAGACGGCATACGA AACGTA ATTGATGGTGCCTACAG I5 [TTACCA]: CAAGCAGAAGACGGCATACGA TGGTAA ATTGATGGTGCCTACAG I6 [ACTGTA]: CAAGCAGAAGACGGCATACGA TACAGT ATTGATGGTGCCTACAG I7 [ATCACG]: CAAGCAGAAGACGGCATACGA CGTGAT ATTGATGGTGCCTACAG I8 [ACTTGT]: CAAGCAGAAGACGGCATACGA ACAAGT ATTGATGGTGCCTACAG I9 [GCCAAT]: CAAGCAGAAGACGGCATACGA ATTGGC ATTGATGGTGCCTACAG I10 [TGCTAG]: CAAGCAGAAGACGGCATACGA CTAGCA ATTGATGGTGCCTACAG I11 [CTTGTA]: CAAGCAGAAGACGGCATACGA TACAAG ATTGATGGTGCCTACAG I12 [TCAGGC]: CAAGCAGAAGACGGCATACGA GCCTGA ATTGATGGTGCCTACAG QIAquick PCR Purification Kit (QIAGEN, catalog number: 28106) Diethylpyrocarbonate (DEPC)-H2 O/ RNase-free H2 O DNA size marker suitable for detecting a ~120 bp fragment (50 bp step ladder, Promega Corporation, catalog number: G4521; 25 bp step ladder, Promega Corporation, catalog number: G4511) 3 M sodium acetate (NaOAc) (pH 5.5) Reagents for 6% native PAGE 37.5: 1 polyacrylamide:bisacrylamide (see Recipes) TEMED (Life Technologies, catalog number: 15524-010) 10% Ammonium persulfate (Sigma, catalog number: A3678-100G) (See Recipes)


    Article Title: Corrigendum to “GoldCLIP: Gel-omitted Ligation-dependent CLIP” [Genomics Proteomics Bioinformatics 16 (2) (2018) 136–143]
    Article Snippet: Crosslinked cells were then scraped off the plates and mixed with ∼5 × 105 of Drosophila S2 cells expressing a Halo-CG7544 fusion protein (serving as an internal normalizing control), dounced with type B pestle in lysis buffer (see above) and digested using micrococcal nuclease (1:1000; catalog No. M0247S; New England Biolabs) for 3 min at 37 °C. .. The RNAs crosslinked with the PTB proteins were ligated with an RNA adapter (/5′P/AGATCGGAAGAGCGGTTCAG/3ddC/) at 3′ end using T4 RNA Ligase I (catalog No. AM2141; Ambion) on beads at 16 °C overnight.

    Article Title: GoldCLIP: Gel-omitted Ligation-dependent CLIP
    Article Snippet: Crosslinked cells were then scraped off the plates and mixed with ∼5 × 105 of Drosophila S2 cells expressing a Halo-CG7544 fusion protein (serving as an internal normalizing control), dounced with type B pestle in lysis buffer (see above) and digested using micrococcal nuclease (1:1000; catalog No. M0247S; New England Biolabs) for 3 min at 37 °C. .. The RNAs crosslinked with the PTB proteins were ligated with an RNA adapter (/5′P/AGGTCGGAAGAGCGGTTCAG/3ddC/) at 3′ end using T4 RNA Ligase I (catalog No. AM2141; Ambion) on beads at 16 °C overnight.

    Clear Native PAGE:

    Article Title: Preparation of Multiplexed Small RNA Libraries From Plants
    Article Snippet: 8-Strip PCR thin-walled, 200 μl tubes (Corning Incorporated, Axygen® , catalog number: PCR-0208-CP-C) miRNA cloning linker 1 (/5′App/CTGTAGGCACCATCAAT/3′ddC/; 1 nm) (Integrated DNA Technologies, catalog number: 11-04-03-05) Truncated, K227Q mutation T4 RNA Ligase 2 (New England Biolabs, catalog number: M0351L) De-adenylase (New England Biolabs, catalog number: M0331S) Exonuclease VII (United State Biological, catalog number: 70082Z) RNA 5′ Adapter (GUUCAGAGUUCUACAGUCCGACGAUC) (Illumina RA5, catalog number: 15013205) dATP (Life Technologies, catalog number: 55082) T4 RNA Ligase I (Life Technologies, catalog number: AM2141) RT-PCR Primer (ATTGATGGTGCCTACAG; 25 nmol; de-salted) (Integrated DNA Technologies) SuperScript III (Life Technologies, catalog number: 18080051) Phusion High Fidelity II (Thermo Fisher Scientific, catalog number: F549L) 5′ PCR Primer (Illumina small RNA PCR primer 2: AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA) 3′ Indexed PCR Primer I1 – I12 (100 nmol; PAGE-purified) (Integrated DNA Technologies) Note: The barcodes below (underlined sequences) are reverse complemented in the final Illumina output sequence (see sequence in square brackets for each primer). .. I1 [CGATGT]: CAAGCAGAAGACGGCATACGA ACATCG ATTGATGGTGCCTACAG I2 [GATCAC]: CAAGCAGAAGACGGCATACGA GTGATC ATTGATGGTGCCTACAG I3 [CAGATG]: CAAGCAGAAGACGGCATACGA CATCTG ATTGATGGTGCCTACAG I4 [TACGTT]: CAAGCAGAAGACGGCATACGA AACGTA ATTGATGGTGCCTACAG I5 [TTACCA]: CAAGCAGAAGACGGCATACGA TGGTAA ATTGATGGTGCCTACAG I6 [ACTGTA]: CAAGCAGAAGACGGCATACGA TACAGT ATTGATGGTGCCTACAG I7 [ATCACG]: CAAGCAGAAGACGGCATACGA CGTGAT ATTGATGGTGCCTACAG I8 [ACTTGT]: CAAGCAGAAGACGGCATACGA ACAAGT ATTGATGGTGCCTACAG I9 [GCCAAT]: CAAGCAGAAGACGGCATACGA ATTGGC ATTGATGGTGCCTACAG I10 [TGCTAG]: CAAGCAGAAGACGGCATACGA CTAGCA ATTGATGGTGCCTACAG I11 [CTTGTA]: CAAGCAGAAGACGGCATACGA TACAAG ATTGATGGTGCCTACAG I12 [TCAGGC]: CAAGCAGAAGACGGCATACGA GCCTGA ATTGATGGTGCCTACAG QIAquick PCR Purification Kit (QIAGEN, catalog number: 28106) Diethylpyrocarbonate (DEPC)-H2 O/ RNase-free H2 O DNA size marker suitable for detecting a ~120 bp fragment (50 bp step ladder, Promega Corporation, catalog number: G4521; 25 bp step ladder, Promega Corporation, catalog number: G4511) 3 M sodium acetate (NaOAc) (pH 5.5) Reagents for 6% native PAGE 37.5: 1 polyacrylamide:bisacrylamide (see Recipes) TEMED (Life Technologies, catalog number: 15524-010) 10% Ammonium persulfate (Sigma, catalog number: A3678-100G) (See Recipes)

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher t4 rna ligase buffer
    Preparation and analysis on circular RNA in vitro . (A) Schematic of in vitro circularization constructs. Transcripts to be circularized consist of a terminal 10 nt open loop structure (black) and a reverse-complementary repeat sequence of 11 nt, which forms an intramolecular stem (red). This structure is followed by a 63 nt constant region for detection by northern blot or PCR (blue), followed by the miRNA-122 sponge (bulge; perfect) or a scrambled control sequence (shuffle) in grey. (B) Schematic of the in vitro ligation reaction. 4-fold excess of GMP over GTP results in ∼80% of the transcripts containing a 5′-monophosphate, enabling efficient in vitro ligation by <t>T4</t> RNA ligase. Ligation products are circular RNAs (intramolecular ligation) or linear dimers (intermolecular ligation). (C) In vitro ligation reactions described in (B) were analyzed on 5%, 6% or 7% polyacrylamide-urea gels by ethidium bromide staining. While mobility of linear RNAs remains unchanged compared to RNA marker, the apparent mobility of circular RNA is lower in higher percentage gels (indicated by dash/double dash or circle). (D) Purified linear or circular RNAs from (C) were transfected in HuH-7.5 cells and total RNA was prepared after 4, 8, 14, 24 and 32 h. RNAs were detected by ³²P-northern blot analysis using identical probes in the constant region [labeled blue in (A)]. (E) HuH-7.5 cells transfected with circular RNA or linear RNA from (C) were subjected to sub-cellular fractionation and cytoplasmic or nuclear fractions were analyzed by ³²P-northern blot detecting transfected RNAs along with U1 snRNA and by western blot against hnRNP A1 or GAPDH proteins as a fractionation control. In the circRNA-transfected samples, a degradation product is detected at linear monomer size (“linearized”).
    T4 Rna Ligase Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 rna ligase buffer/product/Thermo Fisher
    Average 99 stars, based on 14 article reviews
    Price from $9.99 to $1999.99
    t4 rna ligase buffer - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Thermo Fisher ligation buffer
    Preparation and analysis on circular RNA in vitro . (A) Schematic of in vitro circularization constructs. Transcripts to be circularized consist of a terminal 10 nt open loop structure (black) and a reverse-complementary repeat sequence of 11 nt, which forms an intramolecular stem (red). This structure is followed by a 63 nt constant region for detection by northern blot or PCR (blue), followed by the miRNA-122 sponge (bulge; perfect) or a scrambled control sequence (shuffle) in grey. (B) Schematic of the in vitro ligation reaction. 4-fold excess of GMP over GTP results in ∼80% of the transcripts containing a 5′-monophosphate, enabling efficient in vitro ligation by <t>T4</t> RNA ligase. Ligation products are circular RNAs (intramolecular ligation) or linear dimers (intermolecular ligation). (C) In vitro ligation reactions described in (B) were analyzed on 5%, 6% or 7% polyacrylamide-urea gels by ethidium bromide staining. While mobility of linear RNAs remains unchanged compared to RNA marker, the apparent mobility of circular RNA is lower in higher percentage gels (indicated by dash/double dash or circle). (D) Purified linear or circular RNAs from (C) were transfected in HuH-7.5 cells and total RNA was prepared after 4, 8, 14, 24 and 32 h. RNAs were detected by ³²P-northern blot analysis using identical probes in the constant region [labeled blue in (A)]. (E) HuH-7.5 cells transfected with circular RNA or linear RNA from (C) were subjected to sub-cellular fractionation and cytoplasmic or nuclear fractions were analyzed by ³²P-northern blot detecting transfected RNAs along with U1 snRNA and by western blot against hnRNP A1 or GAPDH proteins as a fractionation control. In the circRNA-transfected samples, a degradation product is detected at linear monomer size (“linearized”).
    Ligation Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 80 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ligation buffer/product/Thermo Fisher
    Average 90 stars, based on 80 article reviews
    Price from $9.99 to $1999.99
    ligation buffer - by Bioz Stars, 2020-04
    90/100 stars
      Buy from Supplier

    Image Search Results

    Preparation and analysis on circular RNA in vitro . (A) Schematic of in vitro circularization constructs. Transcripts to be circularized consist of a terminal 10 nt open loop structure (black) and a reverse-complementary repeat sequence of 11 nt, which forms an intramolecular stem (red). This structure is followed by a 63 nt constant region for detection by northern blot or PCR (blue), followed by the miRNA-122 sponge (bulge; perfect) or a scrambled control sequence (shuffle) in grey. (B) Schematic of the in vitro ligation reaction. 4-fold excess of GMP over GTP results in ∼80% of the transcripts containing a 5′-monophosphate, enabling efficient in vitro ligation by T4 RNA ligase. Ligation products are circular RNAs (intramolecular ligation) or linear dimers (intermolecular ligation). (C) In vitro ligation reactions described in (B) were analyzed on 5%, 6% or 7% polyacrylamide-urea gels by ethidium bromide staining. While mobility of linear RNAs remains unchanged compared to RNA marker, the apparent mobility of circular RNA is lower in higher percentage gels (indicated by dash/double dash or circle). (D) Purified linear or circular RNAs from (C) were transfected in HuH-7.5 cells and total RNA was prepared after 4, 8, 14, 24 and 32 h. RNAs were detected by ³²P-northern blot analysis using identical probes in the constant region [labeled blue in (A)]. (E) HuH-7.5 cells transfected with circular RNA or linear RNA from (C) were subjected to sub-cellular fractionation and cytoplasmic or nuclear fractions were analyzed by ³²P-northern blot detecting transfected RNAs along with U1 snRNA and by western blot against hnRNP A1 or GAPDH proteins as a fractionation control. In the circRNA-transfected samples, a degradation product is detected at linear monomer size (“linearized”).

    Journal: RNA Biology

    Article Title: Functional sequestration of microRNA-122 from Hepatitis C Virus by circular RNA sponges

    doi: 10.1080/15476286.2018.1435248

    Figure Lengend Snippet: Preparation and analysis on circular RNA in vitro . (A) Schematic of in vitro circularization constructs. Transcripts to be circularized consist of a terminal 10 nt open loop structure (black) and a reverse-complementary repeat sequence of 11 nt, which forms an intramolecular stem (red). This structure is followed by a 63 nt constant region for detection by northern blot or PCR (blue), followed by the miRNA-122 sponge (bulge; perfect) or a scrambled control sequence (shuffle) in grey. (B) Schematic of the in vitro ligation reaction. 4-fold excess of GMP over GTP results in ∼80% of the transcripts containing a 5′-monophosphate, enabling efficient in vitro ligation by T4 RNA ligase. Ligation products are circular RNAs (intramolecular ligation) or linear dimers (intermolecular ligation). (C) In vitro ligation reactions described in (B) were analyzed on 5%, 6% or 7% polyacrylamide-urea gels by ethidium bromide staining. While mobility of linear RNAs remains unchanged compared to RNA marker, the apparent mobility of circular RNA is lower in higher percentage gels (indicated by dash/double dash or circle). (D) Purified linear or circular RNAs from (C) were transfected in HuH-7.5 cells and total RNA was prepared after 4, 8, 14, 24 and 32 h. RNAs were detected by ³²P-northern blot analysis using identical probes in the constant region [labeled blue in (A)]. (E) HuH-7.5 cells transfected with circular RNA or linear RNA from (C) were subjected to sub-cellular fractionation and cytoplasmic or nuclear fractions were analyzed by ³²P-northern blot detecting transfected RNAs along with U1 snRNA and by western blot against hnRNP A1 or GAPDH proteins as a fractionation control. In the circRNA-transfected samples, a degradation product is detected at linear monomer size (“linearized”).

    Article Snippet: Next, T4 RNA ligase buffer and RNaseOUT (Thermo Fisher Scientific) were added and incubated for 10 min at 37°C.

    Techniques: In Vitro, Construct, Sequencing, Northern Blot, Polymerase Chain Reaction, Ligation, Staining, Marker, Purification, Transfection, Labeling, Cell Fractionation, Western Blot, Fractionation