100 mm petri dish  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Name:
    Petri Dish Replica Plating Tool
    Description:
    Use this economical device to accurately replicate colonies grown on 90 to 100 mm petri dishes
    Catalog Number:
    CP1421000
    Price:
    None
    Category:
    Lab Supplies Plastics Glassware
    Buy from Supplier


    Structured Review

    Thermo Fisher 100 mm petri dish
    A. fumigatus hyphae induces TSLP expression in DCs. DCs were stimulated with heat-killed A. fumigatus hyphae (1 × 10 6 pieces/mL) for 1, 3, 6, 12, 24, and 48 hours. (A) qRT-PCR and (B) ELISA were performed to analyze the mRNA and protein levels of TSLP. (C) Protein levels of TSLP in DCs were detected by Western blot. (D) DCs were transfected with TSLP siRNA (80 nM) for 48 hours or treated with heat-killed A. fumigatus hyphae for 12 hours, then subjected to immunofluorescence analysis of TSLP (red) and CD11c ( green ). Scale bar = 20 µM. C57BL/6 mice corneas were scratched with 26G needles followed by treatment with A. fumigatus for 0.5, 1, and 3 days. (E) qRT-PCR was used to assess CD11c mRNA levels in mouse corneas. (F) Immunofluorescence analysis of CD11c and TSLP co-staining on the cornea at 0.5, 1, and 3 days after A. fumigatus infection. Nuclei were counterstained with DAPI ( blue ). The CD11c and TSLP co-staining presented the bright yellow fluorescent light. Scale bar = <t>100</t> µM. (Data are mean ± SEM, * P
    Use this economical device to accurately replicate colonies grown on 90 to 100 mm petri dishes
    https://www.bioz.com/result/100 mm petri dish/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    100 mm petri dish - by Bioz Stars, 2021-04
    86/100 stars

    Images

    1) Product Images from "TSLP Produced by Aspergillus fumigatus-Stimulated DCs Promotes a Th17 Response Through the JAK/STAT Signaling Pathway in Fungal Keratitis"

    Article Title: TSLP Produced by Aspergillus fumigatus-Stimulated DCs Promotes a Th17 Response Through the JAK/STAT Signaling Pathway in Fungal Keratitis

    Journal: Investigative Ophthalmology & Visual Science

    doi: 10.1167/iovs.61.14.24

    A. fumigatus hyphae induces TSLP expression in DCs. DCs were stimulated with heat-killed A. fumigatus hyphae (1 × 10 6 pieces/mL) for 1, 3, 6, 12, 24, and 48 hours. (A) qRT-PCR and (B) ELISA were performed to analyze the mRNA and protein levels of TSLP. (C) Protein levels of TSLP in DCs were detected by Western blot. (D) DCs were transfected with TSLP siRNA (80 nM) for 48 hours or treated with heat-killed A. fumigatus hyphae for 12 hours, then subjected to immunofluorescence analysis of TSLP (red) and CD11c ( green ). Scale bar = 20 µM. C57BL/6 mice corneas were scratched with 26G needles followed by treatment with A. fumigatus for 0.5, 1, and 3 days. (E) qRT-PCR was used to assess CD11c mRNA levels in mouse corneas. (F) Immunofluorescence analysis of CD11c and TSLP co-staining on the cornea at 0.5, 1, and 3 days after A. fumigatus infection. Nuclei were counterstained with DAPI ( blue ). The CD11c and TSLP co-staining presented the bright yellow fluorescent light. Scale bar = 100 µM. (Data are mean ± SEM, * P
    Figure Legend Snippet: A. fumigatus hyphae induces TSLP expression in DCs. DCs were stimulated with heat-killed A. fumigatus hyphae (1 × 10 6 pieces/mL) for 1, 3, 6, 12, 24, and 48 hours. (A) qRT-PCR and (B) ELISA were performed to analyze the mRNA and protein levels of TSLP. (C) Protein levels of TSLP in DCs were detected by Western blot. (D) DCs were transfected with TSLP siRNA (80 nM) for 48 hours or treated with heat-killed A. fumigatus hyphae for 12 hours, then subjected to immunofluorescence analysis of TSLP (red) and CD11c ( green ). Scale bar = 20 µM. C57BL/6 mice corneas were scratched with 26G needles followed by treatment with A. fumigatus for 0.5, 1, and 3 days. (E) qRT-PCR was used to assess CD11c mRNA levels in mouse corneas. (F) Immunofluorescence analysis of CD11c and TSLP co-staining on the cornea at 0.5, 1, and 3 days after A. fumigatus infection. Nuclei were counterstained with DAPI ( blue ). The CD11c and TSLP co-staining presented the bright yellow fluorescent light. Scale bar = 100 µM. (Data are mean ± SEM, * P

    Techniques Used: Expressing, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay, Western Blot, Transfection, Immunofluorescence, Mouse Assay, Staining, Infection

    TSLP promotes CD4 + T cell proliferation and Th17 cytokine expression. (A) CD4 + T cells were stained with CFSE and then cultured with or without 100 ng/mL rmTSLP for 4 days, flow cytometry was performed to detect the proliferation of CD4 + T cells. (B) Quantification of cell proliferation rate in (A). CD4 + T cells were cultured with rmTSLP (100 ng/mL) for 1, 2, and 3 days. (C) qRT-PCR and (D) ELISA were performed to detect the mRNA and protein levels of IL-17A, IL-17F, and IL-22 in CD4 + T cells. (E) Flow cytometry was conducted to analyze the protein levels of IL-17A in CD4 + T cells. (F) Quantification of IL-17A levels in (E). Ctr, control. (Data are mean ± SEM, * P
    Figure Legend Snippet: TSLP promotes CD4 + T cell proliferation and Th17 cytokine expression. (A) CD4 + T cells were stained with CFSE and then cultured with or without 100 ng/mL rmTSLP for 4 days, flow cytometry was performed to detect the proliferation of CD4 + T cells. (B) Quantification of cell proliferation rate in (A). CD4 + T cells were cultured with rmTSLP (100 ng/mL) for 1, 2, and 3 days. (C) qRT-PCR and (D) ELISA were performed to detect the mRNA and protein levels of IL-17A, IL-17F, and IL-22 in CD4 + T cells. (E) Flow cytometry was conducted to analyze the protein levels of IL-17A in CD4 + T cells. (F) Quantification of IL-17A levels in (E). Ctr, control. (Data are mean ± SEM, * P

    Techniques Used: Expressing, Staining, Cell Culture, Flow Cytometry, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay

    2) Product Images from "The Dentin Sialoprotein (DSP) Domain Regulates Dental Mesenchymal Cell Differentiation through a Novel Surface Receptor"

    Article Title: The Dentin Sialoprotein (DSP) Domain Regulates Dental Mesenchymal Cell Differentiation through a Novel Surface Receptor

    Journal: Scientific Reports

    doi: 10.1038/srep29666

    DSP-β6 interaction activates P38, ERK1/2, and SMAD1/5/8 phosphorylation and the nuclear translocation of SMAD1/5/8. ( A ) Western blot analysis of phospho-P38, phospho-ERK1/2, and phospho-SMAD1/5/8 of mDPC6T cells subject to DSP aa183-219 stimulation for 0, 2, 5, 15, 30, 60, and 120 min. ( B ) Immunofluorescence assay of phospho-P38, phospho-ERK1/2, and phospho-PMAD1/5/8 of mDPC6T with or without DSP aa183-219 stimulation. ( C ) Western blot analysis of phospho-SMAD1/5/8 in mDPC6T cells treated with or without 20 μM SB203580 and/or 100 μM PD98059 for 1 h followed by 200 ng/ml DSP aa183-219 for 0, 5, 15, 30, 60, and 120 min. ( D ) Immunofluorescence analysis of phospho-SMAD1/5/8 in mDPC6T cells treated with or without 20 μM P38 SB203580 and/or 100 μM PD98059 followed by 200 ng/ml DSP aa183-219 . ( E ) mDPC6T cells were treated with or without DSP aa183-219 for 15 min; treated with 25 μg/ml anti-integrin β6 antibody for 1 h followed by 200 ng/ml DSP aa183-219 for 15 min; or treated with 80 nM integrin siRNA for 24 h followed by 200 ng/ml DSP aa183-219 for 15 min. Phospho-P38, phospho-ERK1/2, phospho-SMAD1/5/8 and DSP were analyzed with anti-phospho-P38, anti-phospho-ERK1/2, anti-phospho-SMAD1/5/8 and anti-DSP antibodies.
    Figure Legend Snippet: DSP-β6 interaction activates P38, ERK1/2, and SMAD1/5/8 phosphorylation and the nuclear translocation of SMAD1/5/8. ( A ) Western blot analysis of phospho-P38, phospho-ERK1/2, and phospho-SMAD1/5/8 of mDPC6T cells subject to DSP aa183-219 stimulation for 0, 2, 5, 15, 30, 60, and 120 min. ( B ) Immunofluorescence assay of phospho-P38, phospho-ERK1/2, and phospho-PMAD1/5/8 of mDPC6T with or without DSP aa183-219 stimulation. ( C ) Western blot analysis of phospho-SMAD1/5/8 in mDPC6T cells treated with or without 20 μM SB203580 and/or 100 μM PD98059 for 1 h followed by 200 ng/ml DSP aa183-219 for 0, 5, 15, 30, 60, and 120 min. ( D ) Immunofluorescence analysis of phospho-SMAD1/5/8 in mDPC6T cells treated with or without 20 μM P38 SB203580 and/or 100 μM PD98059 followed by 200 ng/ml DSP aa183-219 . ( E ) mDPC6T cells were treated with or without DSP aa183-219 for 15 min; treated with 25 μg/ml anti-integrin β6 antibody for 1 h followed by 200 ng/ml DSP aa183-219 for 15 min; or treated with 80 nM integrin siRNA for 24 h followed by 200 ng/ml DSP aa183-219 for 15 min. Phospho-P38, phospho-ERK1/2, phospho-SMAD1/5/8 and DSP were analyzed with anti-phospho-P38, anti-phospho-ERK1/2, anti-phospho-SMAD1/5/8 and anti-DSP antibodies.

    Techniques Used: Translocation Assay, Western Blot, Immunofluorescence

    SMAD4 and SMAD1/5/8 bind to SBEs in mDSPP promoter region. ( A ) 32 P-labeled double stranded DSPP probes were incubated with 5 μg of SMAD4 overexpressing cell nuclear extracts. The sequences selected for DSPP probes are listed below: -316/-288 (GCAGGGTGACAGA GTCTAAGTGGCTCTTT), -258/-231 (TAAGACACAAAACAGTCTTCCAGGAGCT), -211/-183 (AGTCTAGTCCTTTTGGAACCAAAGGTCT), and -188/-163 (GGTCTCAGTGAGCCAACGTAC CGGCG). Competition analysis of the SMAD4-DSPP ( B ) and SMAD1/5/8-DSPP ( C ) complex formation with 100- or 300- fold excesses of standard SBE or unlabeled competitors. ( D ) supershift analysis of SMAD4-DSPP and SMAD1/5/8-DSPP complex with anti-SMAD4 and anti-PSMAD1/5/8 antibodies. ( E ) ChIP analysis of SMAD4-DSPP and SMAD1/5/8-DSPP binding after SMADs and DSPP promoter region were overexpressed in 293T for 48 h; qualitative analysis of SMAD4 ( F ) and SMAD1/5/8 ( G ) binding to the DSPP promoter region at 2, 6, 12, 24, and 48 h with ChIP.
    Figure Legend Snippet: SMAD4 and SMAD1/5/8 bind to SBEs in mDSPP promoter region. ( A ) 32 P-labeled double stranded DSPP probes were incubated with 5 μg of SMAD4 overexpressing cell nuclear extracts. The sequences selected for DSPP probes are listed below: -316/-288 (GCAGGGTGACAGA GTCTAAGTGGCTCTTT), -258/-231 (TAAGACACAAAACAGTCTTCCAGGAGCT), -211/-183 (AGTCTAGTCCTTTTGGAACCAAAGGTCT), and -188/-163 (GGTCTCAGTGAGCCAACGTAC CGGCG). Competition analysis of the SMAD4-DSPP ( B ) and SMAD1/5/8-DSPP ( C ) complex formation with 100- or 300- fold excesses of standard SBE or unlabeled competitors. ( D ) supershift analysis of SMAD4-DSPP and SMAD1/5/8-DSPP complex with anti-SMAD4 and anti-PSMAD1/5/8 antibodies. ( E ) ChIP analysis of SMAD4-DSPP and SMAD1/5/8-DSPP binding after SMADs and DSPP promoter region were overexpressed in 293T for 48 h; qualitative analysis of SMAD4 ( F ) and SMAD1/5/8 ( G ) binding to the DSPP promoter region at 2, 6, 12, 24, and 48 h with ChIP.

    Techniques Used: Labeling, Incubation, Chromatin Immunoprecipitation, Binding Assay

    DSP aa183-219 up-regulates DSPP gene transcription through SMAD1/5/8. ( A ) pGL-Luc-mDSPP-241/+54 (p241) were co-transfected with 100 ng of pcDNA-Smad4, pCMV-Smad1/5/8, or pcDNA3.1. The transcription results were computed as luciferase activities per mg of total protein. The value obtained from the control group was considered as 1-fold. Fold increases were calculated by dividing the individual value by the control group. ( B ) p241 Wt, p241 Mut-1, p241 Mut-2, or p241 Mut-3 were co-transfected with 100 ng pcDNA-Smad4. ( C ) p241 Wt, p241 Mut-1, p241 Mut-2, or p241 Mut-3 were co-transfected with 100 ng pcDNA-Smad1/5/8. ( D ) p241 Wt, p241 Mut-1, p241 Mut-2, or p241 Mut-3 were co-transfected with 100 ng pcDNA-Smad4 and 20 ng Smad1/5/8. The data are the mean ± S.D. from independent experiments performed in triplicate.
    Figure Legend Snippet: DSP aa183-219 up-regulates DSPP gene transcription through SMAD1/5/8. ( A ) pGL-Luc-mDSPP-241/+54 (p241) were co-transfected with 100 ng of pcDNA-Smad4, pCMV-Smad1/5/8, or pcDNA3.1. The transcription results were computed as luciferase activities per mg of total protein. The value obtained from the control group was considered as 1-fold. Fold increases were calculated by dividing the individual value by the control group. ( B ) p241 Wt, p241 Mut-1, p241 Mut-2, or p241 Mut-3 were co-transfected with 100 ng pcDNA-Smad4. ( C ) p241 Wt, p241 Mut-1, p241 Mut-2, or p241 Mut-3 were co-transfected with 100 ng pcDNA-Smad1/5/8. ( D ) p241 Wt, p241 Mut-1, p241 Mut-2, or p241 Mut-3 were co-transfected with 100 ng pcDNA-Smad4 and 20 ng Smad1/5/8. The data are the mean ± S.D. from independent experiments performed in triplicate.

    Techniques Used: Transfection, Luciferase

    3) Product Images from "Optimized methods for rapidly dissecting spinal cords and harvesting spinal motor neurons with high survival and purity from rats at different embryonic stages"

    Article Title: Optimized methods for rapidly dissecting spinal cords and harvesting spinal motor neurons with high survival and purity from rats at different embryonic stages

    Journal: The Journal of Spinal Cord Medicine

    doi: 10.1080/10790268.2017.1329075

    Phase contrast micrographs of purified cells obtained from 16 d embryonic rats. (A) 2 h after plating, almost all the cells had been adherent to the bottom and even several already grew tiny neurites; (B) Until 24 h, most cells had grown neurites and exhibited a bright and ovoid cell body, with a ring-shaped halo, but all cells were solitary; (C) 6 d in culture, cells grew with big body and high refraction, and formed obvious neurite networks; (D) 10 days in culture, cells grew more mature and showed vastly interconnected neurite networks. Scale bars represent 100 μm.
    Figure Legend Snippet: Phase contrast micrographs of purified cells obtained from 16 d embryonic rats. (A) 2 h after plating, almost all the cells had been adherent to the bottom and even several already grew tiny neurites; (B) Until 24 h, most cells had grown neurites and exhibited a bright and ovoid cell body, with a ring-shaped halo, but all cells were solitary; (C) 6 d in culture, cells grew with big body and high refraction, and formed obvious neurite networks; (D) 10 days in culture, cells grew more mature and showed vastly interconnected neurite networks. Scale bars represent 100 μm.

    Techniques Used: Purification

    4) Product Images from "Fabrication of In Vitro Cancer Microtissue Array on Fibroblast-Layered Nanofibrous Membrane by Inkjet Printing"

    Article Title: Fabrication of In Vitro Cancer Microtissue Array on Fibroblast-Layered Nanofibrous Membrane by Inkjet Printing

    Journal: International Journal of Molecular Sciences

    doi: 10.3390/ijms18112348

    Cancer microtissues ( a – f ); monocultured microtissue and fibroblast-layered microtissue (1 × 10 4 cell/mL) on day 7. Red, MMP2 ( a ) and MMP9 ( d ); green, F-actin ( b , e ). MMP2 ( g ) and MMP9 ( h ) expression in the mono-cultured and fibroblast-layered microtissues was quantified using ELISA. All experimental samples were n > 3. Unmarked Scale bars, 100 μm.
    Figure Legend Snippet: Cancer microtissues ( a – f ); monocultured microtissue and fibroblast-layered microtissue (1 × 10 4 cell/mL) on day 7. Red, MMP2 ( a ) and MMP9 ( d ); green, F-actin ( b , e ). MMP2 ( g ) and MMP9 ( h ) expression in the mono-cultured and fibroblast-layered microtissues was quantified using ELISA. All experimental samples were n > 3. Unmarked Scale bars, 100 μm.

    Techniques Used: Expressing, Cell Culture, Enzyme-linked Immunosorbent Assay

    Related Articles

    other:

    Article Title: CaNdt80 Is Involved in Drug Resistance in Candida albicans by Regulating CDR1
    Article Snippet: Strains were diluted to an optical density at 600 nm of 2 (approximately 2 × 107 cells/ml), and approximately 0.5 μl per spot was spotted onto plates containing different drugs with a replica plating device (Oxoid Inc., Nepean, Ontario, Canada).

    Article Title: Gene-Specific Assessment of Guanine Oxidation as an Epigenetic Modulator for Cardiac Specification of Mouse Embryonic Stem Cells
    Article Snippet: Twenty-four hours after ESC seeding, EBs were harvested and plated onto 100-mm Petri dish (Thermo Fisher Scientific) for another 5 days of differentiation with daily medium replacement.

    Article Title: Efg1 Involved in Drug Resistance by Regulating the Expression of ERG3 in Candida albicans
    Article Snippet: Cells from each strain (0.5 μl) were then spotted onto plates containing different drugs with a replica device (Oxoid, Inc., Nepean, Ontario, Canada), along with 10-fold serial dilutions of the cells.

    Article Title: Soluble Neuregulin and Schwann Cell Myelination: a Therapeutic Potential for Improving Remyelination of Adult Axons
    Article Snippet: The DRGs were removed and collected in a 100-mm Petri dish containing L-15 media (Invitrogen, Carlsbad, CA).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    Thermo Fisher 100 mm petri dishes
    The suppressive effect of endomorphins on T lymphocyte proliferation. Dendritic cells were activated with lipopolysaccharide (LPS; <t>100</t> ng/mL) and pretreated with different concentrations of endomorphin-1 (A) and endomorphin-2 (B) for 24 hours. Pre-treated matured dendritic cells were co-cultured with purified T cells (10 5 /well) for 72 hours in 96-well U-bottomed culture plates. CTOP (25 μM) was added into the upper chamber 30 minutes before the addition of endomorphin (10 -6 M). The culture was pulsed with [ 3 H] thymidine (0.5 µCi/well) for 18 hours of incubation. Dendritic cells not activated by LPS were used as controls. Data are expressed as mean ± SD of three independent experiments. a P
    100 Mm Petri Dishes, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/100 mm petri dishes/product/Thermo Fisher
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    100 mm petri dishes - by Bioz Stars, 2021-04
    97/100 stars
      Buy from Supplier

    93
    Thermo Fisher 100 mm culture dishes
    ARL11 depletion in macrophages results in defective killing of intracellular Salmonella . a , control and Arl11 -silenced RAW264.7 cells were infected with Salmonella for different time periods, and lysates were prepared and blotted with the indicated anti-phospho-antibodies. Total ERK1/2, p38, JNK1/2, and α-tubulin were probed as quantitative controls. b–d , densitometric analysis was performed to determine the ratio of phospho-ERK to total ERK ( b ), phospho-p38 to total p38 ( c ), and phospho-JNK to total JNK ( d ) in control and Arl11 -silenced RAW264.7 cells infected with Salmonella for different time periods, as indicated. e–g , control and Arl11 -silenced RAW264.7 cells were infected with Salmonella for different time periods, supernatants from the cultures were collected, the concentration of IL-6 ( e ) and TNFα ( f ) was measured by ELISA, and nitrite production (an indication of the presence of nitric oxide) was evaluated by the Griess reaction ( g ). h and i , control, Arl11 -silenced, and Arl11 rescue RAW264.7 cells were infected with Salmonella , and the -fold change in recoverable cfu was calculated (20 h/2 h p.i.) by a gentamicin protection assay. By using confocal microscopy, the intracellular bacteria were counted in <t>∼100</t> cells/experiment. These numbers were grouped according to the key and expressed as a percentage of the total infected cell population ( i ). Data shown represent mean ± S.D. ( error bars ) ( n = 3) ( n.s. , not significant; *, p
    100 Mm Culture Dishes, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/100 mm culture dishes/product/Thermo Fisher
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    100 mm culture dishes - by Bioz Stars, 2021-04
    93/100 stars
      Buy from Supplier

    99
    Thermo Fisher 100 mm petri dish
    Cancer microtissues ( a – f ); monocultured microtissue and fibroblast-layered microtissue (1 × 10 4 cell/mL) on day 7. Red, MMP2 ( a ) and MMP9 ( d ); green, F-actin ( b , e ). MMP2 ( g ) and MMP9 ( h ) expression in the mono-cultured and fibroblast-layered microtissues was quantified using ELISA. All experimental samples were n > 3. Unmarked Scale bars, <t>100</t> μm.
    100 Mm Petri Dish, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/100 mm petri dish/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    100 mm petri dish - by Bioz Stars, 2021-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    The suppressive effect of endomorphins on T lymphocyte proliferation. Dendritic cells were activated with lipopolysaccharide (LPS; 100 ng/mL) and pretreated with different concentrations of endomorphin-1 (A) and endomorphin-2 (B) for 24 hours. Pre-treated matured dendritic cells were co-cultured with purified T cells (10 5 /well) for 72 hours in 96-well U-bottomed culture plates. CTOP (25 μM) was added into the upper chamber 30 minutes before the addition of endomorphin (10 -6 M). The culture was pulsed with [ 3 H] thymidine (0.5 µCi/well) for 18 hours of incubation. Dendritic cells not activated by LPS were used as controls. Data are expressed as mean ± SD of three independent experiments. a P

    Journal: Neural Regeneration Research

    Article Title: Inducible expression of endomorphins in murine dendritic cells ★

    doi: 10.3969/j.issn.1673-5374.2012.35.009

    Figure Lengend Snippet: The suppressive effect of endomorphins on T lymphocyte proliferation. Dendritic cells were activated with lipopolysaccharide (LPS; 100 ng/mL) and pretreated with different concentrations of endomorphin-1 (A) and endomorphin-2 (B) for 24 hours. Pre-treated matured dendritic cells were co-cultured with purified T cells (10 5 /well) for 72 hours in 96-well U-bottomed culture plates. CTOP (25 μM) was added into the upper chamber 30 minutes before the addition of endomorphin (10 -6 M). The culture was pulsed with [ 3 H] thymidine (0.5 µCi/well) for 18 hours of incubation. Dendritic cells not activated by LPS were used as controls. Data are expressed as mean ± SD of three independent experiments. a P

    Article Snippet: The remaining marrow cells were cultured in 100-mm Petri dishes with 10 mL RPMI 1640 medium (Gibco, Carlsbad, CA, USA) containing 10% fetal bovine serum and 200 U/mL of mouse granulocyte macrophage colony stimulating factor (PeproTech, Rocky Hill, NJ, USA) at 37°C in 5% humidified CO2 .

    Techniques: Cell Culture, Purification, Incubation

    Morphology of cultured dendritic cells (DCs) (arrows; inverted microscopy, × 400). (A) Resting DCs; (B) DCs activated by 100 ng/mL lipopolysaccharide for 24 hours.

    Journal: Neural Regeneration Research

    Article Title: Inducible expression of endomorphins in murine dendritic cells ★

    doi: 10.3969/j.issn.1673-5374.2012.35.009

    Figure Lengend Snippet: Morphology of cultured dendritic cells (DCs) (arrows; inverted microscopy, × 400). (A) Resting DCs; (B) DCs activated by 100 ng/mL lipopolysaccharide for 24 hours.

    Article Snippet: The remaining marrow cells were cultured in 100-mm Petri dishes with 10 mL RPMI 1640 medium (Gibco, Carlsbad, CA, USA) containing 10% fetal bovine serum and 200 U/mL of mouse granulocyte macrophage colony stimulating factor (PeproTech, Rocky Hill, NJ, USA) at 37°C in 5% humidified CO2 .

    Techniques: Cell Culture, Inverted Microscopy

    GPIbα expression is reduced on cultured ESPs but not megakaryocytes. (A) On day 12 of the culture, ESC-derived megakaryocytes bearing proplatelets are represented in panel (i) (phase contrast image in culture dish). Bar, 100 μm. Panels (ii) and (iii) show TEM images of ESPs. The subcellular structure of ESPs showed an open canalicular system, dense granules (arrowhead), and α granules (arrow), which were similar to those of peripheral blood platelets. Bars, 1 μm. (B) Mouse platelets (12 wk old) or ESPs (day 12) were subjected to flow cytometry. Graphs show representative forward scatter (FSC) or side scatter (SSC) dot plots. ESPs vary in size compared with mouse platelets. The remaining six graphs show surface expression of αIIb integrin subunit, GPIbα, GPIbβ, GPV, GPVI, and GPIX on mouse platelets (red lines) or ESPs (blue lines) with control IgG (black lines). (C) (i) On the indicated days of culture (x axis), expression of GPIbα and GPIbβ in αIIb + megakaryocytes derived from ESCs and ESPs is shown. Panel (ii) shows the number of αIIb + ESPs on days 8 and 12 that are either GPIbα + (black bar) or GPIbα − (white bar). All results are mean ± SEM from four independent experiments.

    Journal: The Journal of Experimental Medicine

    Article Title: Metalloproteinase regulation improves in vitro generation of efficacious platelets from mouse embryonic stem cells

    doi: 10.1084/jem.20071482

    Figure Lengend Snippet: GPIbα expression is reduced on cultured ESPs but not megakaryocytes. (A) On day 12 of the culture, ESC-derived megakaryocytes bearing proplatelets are represented in panel (i) (phase contrast image in culture dish). Bar, 100 μm. Panels (ii) and (iii) show TEM images of ESPs. The subcellular structure of ESPs showed an open canalicular system, dense granules (arrowhead), and α granules (arrow), which were similar to those of peripheral blood platelets. Bars, 1 μm. (B) Mouse platelets (12 wk old) or ESPs (day 12) were subjected to flow cytometry. Graphs show representative forward scatter (FSC) or side scatter (SSC) dot plots. ESPs vary in size compared with mouse platelets. The remaining six graphs show surface expression of αIIb integrin subunit, GPIbα, GPIbβ, GPV, GPVI, and GPIX on mouse platelets (red lines) or ESPs (blue lines) with control IgG (black lines). (C) (i) On the indicated days of culture (x axis), expression of GPIbα and GPIbβ in αIIb + megakaryocytes derived from ESCs and ESPs is shown. Panel (ii) shows the number of αIIb + ESPs on days 8 and 12 that are either GPIbα + (black bar) or GPIbα − (white bar). All results are mean ± SEM from four independent experiments.

    Article Snippet: For EB formation, 2 × 105 ESCs were placed in 100-mm bacterial Petri dishes containing Iscove's modified Dulbecco's medium supplemented with a cocktail of 300 μg/ml human transferrin, 0.45 mM monothioglycerol, 50 μg/ml ascorbic acid, and penicillin-streptomycin/l -glutamine solution (Invitrogen).

    Techniques: Expressing, Cell Culture, Derivative Assay, Transmission Electron Microscopy, Flow Cytometry, Cytometry

    ESPs treated with GM6001 but not without GM6001 contribute to thrombus formation under flow conditions. (A) Schema of the experimental design. (B) Representative two-dimensional fluorescence images at 6 min. Glass slides coated with type I collagen were perfused at a wall shear rate of 1,500 s −1 for 6 min. Samples included reconstituted whole blood composed of ESPs (red, arrowheads) in blood obtained from 10–12 mice (per experiment), or a mixture of PE-labeled mouse platelets (red, arrowheads) in whole blood pooled from 10–12 mice. All murine platelets or ESPs were stained with mepacrine (green). ESPs capture fluorescent mepacrine as indicated by their dual expression of green and red by flow cytometer. Bars, 100 μm. (C) After 6 min, platelet thrombi formed on the collagen surface were quantified using NIH Images software from a recorded video. The results summarize four independent experiments (mean ± SEM).

    Journal: The Journal of Experimental Medicine

    Article Title: Metalloproteinase regulation improves in vitro generation of efficacious platelets from mouse embryonic stem cells

    doi: 10.1084/jem.20071482

    Figure Lengend Snippet: ESPs treated with GM6001 but not without GM6001 contribute to thrombus formation under flow conditions. (A) Schema of the experimental design. (B) Representative two-dimensional fluorescence images at 6 min. Glass slides coated with type I collagen were perfused at a wall shear rate of 1,500 s −1 for 6 min. Samples included reconstituted whole blood composed of ESPs (red, arrowheads) in blood obtained from 10–12 mice (per experiment), or a mixture of PE-labeled mouse platelets (red, arrowheads) in whole blood pooled from 10–12 mice. All murine platelets or ESPs were stained with mepacrine (green). ESPs capture fluorescent mepacrine as indicated by their dual expression of green and red by flow cytometer. Bars, 100 μm. (C) After 6 min, platelet thrombi formed on the collagen surface were quantified using NIH Images software from a recorded video. The results summarize four independent experiments (mean ± SEM).

    Article Snippet: For EB formation, 2 × 105 ESCs were placed in 100-mm bacterial Petri dishes containing Iscove's modified Dulbecco's medium supplemented with a cocktail of 300 μg/ml human transferrin, 0.45 mM monothioglycerol, 50 μg/ml ascorbic acid, and penicillin-streptomycin/l -glutamine solution (Invitrogen).

    Techniques: Flow Cytometry, Fluorescence, Mouse Assay, Labeling, Staining, Expressing, Cytometry, Software

    Inhibition of metalloproteinases in culture restores GPIbα expression in ESPs. (A) On day 10 of ESC culture, 1% DMSO alone (vehicle) or 100 μM GM6001 dissolved with 1% DMSO was added to the culture medium. On day 12 of culture, representative flow cytometry dot plots of mature megakaryocytes derived from ESCs (ESC-MKs) in the absence of GM6001 (left) and ESPs in the absence or presence of GM6001 are shown. (B) The graph shows the percentage of GPIbα + of all αIIb + ESPs on day 12 in the absence or presence of 1–10 μM TAPI-1 or 100 μM GM6001. Results are shown as mean ± SEM from three independent experiments. (C) The graph summarizes total numbers of αIIb + (αIIb + GPIbα + plus αIIb + GPIbα − ) ESPs per well of a 6-well plate on day 12. Results are the mean ± SEM from four independent experiments. (D) The graph shows the effects of the metalloproteinase inhibitor GM6001 on the surface expression of GPV or GPVI in αIIb + ESPs on day12. Results are mean ± SEM from four independent experiments. (E) Expression of GPIbα or GC in lysates from ESC-MKs (i), in lysates from pellets containing ESPs depleted of MKs (ii), or in supernatant (iii). In panel (i) or (ii), lysates were analyzed by Western blot (7.5% SDS-PAGE) with an anti-GPIbα antibody. In panel (iii), supernatant derived from culture media of ESPs pretreated with or without GM6001 were subjected to immunoprecipitation followed by immunoblotting with anti-GPIbα. In vitro–aged platelets from an adult mouse were used as a positive control in panel (iii). Similar results were obtained from three independent experiments. (F) The graphs show the percentage of positive cells of annexin V or P-selectin from the total αIIb + ESPs on day 12 in the absence or presence of GM6001. Results are the mean ± SEM from three independent experiments.

    Journal: The Journal of Experimental Medicine

    Article Title: Metalloproteinase regulation improves in vitro generation of efficacious platelets from mouse embryonic stem cells

    doi: 10.1084/jem.20071482

    Figure Lengend Snippet: Inhibition of metalloproteinases in culture restores GPIbα expression in ESPs. (A) On day 10 of ESC culture, 1% DMSO alone (vehicle) or 100 μM GM6001 dissolved with 1% DMSO was added to the culture medium. On day 12 of culture, representative flow cytometry dot plots of mature megakaryocytes derived from ESCs (ESC-MKs) in the absence of GM6001 (left) and ESPs in the absence or presence of GM6001 are shown. (B) The graph shows the percentage of GPIbα + of all αIIb + ESPs on day 12 in the absence or presence of 1–10 μM TAPI-1 or 100 μM GM6001. Results are shown as mean ± SEM from three independent experiments. (C) The graph summarizes total numbers of αIIb + (αIIb + GPIbα + plus αIIb + GPIbα − ) ESPs per well of a 6-well plate on day 12. Results are the mean ± SEM from four independent experiments. (D) The graph shows the effects of the metalloproteinase inhibitor GM6001 on the surface expression of GPV or GPVI in αIIb + ESPs on day12. Results are mean ± SEM from four independent experiments. (E) Expression of GPIbα or GC in lysates from ESC-MKs (i), in lysates from pellets containing ESPs depleted of MKs (ii), or in supernatant (iii). In panel (i) or (ii), lysates were analyzed by Western blot (7.5% SDS-PAGE) with an anti-GPIbα antibody. In panel (iii), supernatant derived from culture media of ESPs pretreated with or without GM6001 were subjected to immunoprecipitation followed by immunoblotting with anti-GPIbα. In vitro–aged platelets from an adult mouse were used as a positive control in panel (iii). Similar results were obtained from three independent experiments. (F) The graphs show the percentage of positive cells of annexin V or P-selectin from the total αIIb + ESPs on day 12 in the absence or presence of GM6001. Results are the mean ± SEM from three independent experiments.

    Article Snippet: For EB formation, 2 × 105 ESCs were placed in 100-mm bacterial Petri dishes containing Iscove's modified Dulbecco's medium supplemented with a cocktail of 300 μg/ml human transferrin, 0.45 mM monothioglycerol, 50 μg/ml ascorbic acid, and penicillin-streptomycin/l -glutamine solution (Invitrogen).

    Techniques: Inhibition, Expressing, Flow Cytometry, Cytometry, Derivative Assay, Western Blot, SDS Page, Immunoprecipitation, In Vitro, Positive Control

    Inhibition of metalloproteinases is required for platelet function mediated through integrin αIIbβ3 in ESPs. (A) (i) Representative flow cytometry dot plots showing three mM MnCl 2 -stimulated or 0.1 U/ml thrombin-stimulated fibrinogen binding to integrin αIIbβ3 in ESPs after pretreatment with 1% DMSO as a vehicle or 100 μM GM6001. (ii) The graphs show specific fibrinogen binding to αIIbβ3 stimulated with 3 mM MnCl 2 (reference 40 ), 0.1 U/ml thrombin, or 500 μM adenosine diphosphate. The value of control (vehicle) is defined as 100%. Results are the mean ± SEM from three independent experiments. (B) On day 14 of culture, washed ESPs pretreated with 1% DMSO or 100 μM GM6001 were plated on fibrinogen-coated coverslips for 45 min. An aliquot of each preparation was assayed in the presence of 1 U/ml thrombin. Cells were fixed, permeabilized, and stained with Alexa 488–phalloidin to stain F-actin (green) and with an anti-αIIb antibody followed by Alexa 567 (red). Bar, 10 μm. The value of control (vehicle) is defined as 100%. The right graph summarizes three independent experiments (mean ± SEM).

    Journal: The Journal of Experimental Medicine

    Article Title: Metalloproteinase regulation improves in vitro generation of efficacious platelets from mouse embryonic stem cells

    doi: 10.1084/jem.20071482

    Figure Lengend Snippet: Inhibition of metalloproteinases is required for platelet function mediated through integrin αIIbβ3 in ESPs. (A) (i) Representative flow cytometry dot plots showing three mM MnCl 2 -stimulated or 0.1 U/ml thrombin-stimulated fibrinogen binding to integrin αIIbβ3 in ESPs after pretreatment with 1% DMSO as a vehicle or 100 μM GM6001. (ii) The graphs show specific fibrinogen binding to αIIbβ3 stimulated with 3 mM MnCl 2 (reference 40 ), 0.1 U/ml thrombin, or 500 μM adenosine diphosphate. The value of control (vehicle) is defined as 100%. Results are the mean ± SEM from three independent experiments. (B) On day 14 of culture, washed ESPs pretreated with 1% DMSO or 100 μM GM6001 were plated on fibrinogen-coated coverslips for 45 min. An aliquot of each preparation was assayed in the presence of 1 U/ml thrombin. Cells were fixed, permeabilized, and stained with Alexa 488–phalloidin to stain F-actin (green) and with an anti-αIIb antibody followed by Alexa 567 (red). Bar, 10 μm. The value of control (vehicle) is defined as 100%. The right graph summarizes three independent experiments (mean ± SEM).

    Article Snippet: For EB formation, 2 × 105 ESCs were placed in 100-mm bacterial Petri dishes containing Iscove's modified Dulbecco's medium supplemented with a cocktail of 300 μg/ml human transferrin, 0.45 mM monothioglycerol, 50 μg/ml ascorbic acid, and penicillin-streptomycin/l -glutamine solution (Invitrogen).

    Techniques: Inhibition, Flow Cytometry, Cytometry, Binding Assay, Staining

    ARL11 depletion in macrophages results in defective killing of intracellular Salmonella . a , control and Arl11 -silenced RAW264.7 cells were infected with Salmonella for different time periods, and lysates were prepared and blotted with the indicated anti-phospho-antibodies. Total ERK1/2, p38, JNK1/2, and α-tubulin were probed as quantitative controls. b–d , densitometric analysis was performed to determine the ratio of phospho-ERK to total ERK ( b ), phospho-p38 to total p38 ( c ), and phospho-JNK to total JNK ( d ) in control and Arl11 -silenced RAW264.7 cells infected with Salmonella for different time periods, as indicated. e–g , control and Arl11 -silenced RAW264.7 cells were infected with Salmonella for different time periods, supernatants from the cultures were collected, the concentration of IL-6 ( e ) and TNFα ( f ) was measured by ELISA, and nitrite production (an indication of the presence of nitric oxide) was evaluated by the Griess reaction ( g ). h and i , control, Arl11 -silenced, and Arl11 rescue RAW264.7 cells were infected with Salmonella , and the -fold change in recoverable cfu was calculated (20 h/2 h p.i.) by a gentamicin protection assay. By using confocal microscopy, the intracellular bacteria were counted in ∼100 cells/experiment. These numbers were grouped according to the key and expressed as a percentage of the total infected cell population ( i ). Data shown represent mean ± S.D. ( error bars ) ( n = 3) ( n.s. , not significant; *, p

    Journal: The Journal of Biological Chemistry

    Article Title: ARL11 regulates lipopolysaccharide-stimulated macrophage activation by promoting mitogen-activated protein kinase (MAPK) signaling

    doi: 10.1074/jbc.RA117.000727

    Figure Lengend Snippet: ARL11 depletion in macrophages results in defective killing of intracellular Salmonella . a , control and Arl11 -silenced RAW264.7 cells were infected with Salmonella for different time periods, and lysates were prepared and blotted with the indicated anti-phospho-antibodies. Total ERK1/2, p38, JNK1/2, and α-tubulin were probed as quantitative controls. b–d , densitometric analysis was performed to determine the ratio of phospho-ERK to total ERK ( b ), phospho-p38 to total p38 ( c ), and phospho-JNK to total JNK ( d ) in control and Arl11 -silenced RAW264.7 cells infected with Salmonella for different time periods, as indicated. e–g , control and Arl11 -silenced RAW264.7 cells were infected with Salmonella for different time periods, supernatants from the cultures were collected, the concentration of IL-6 ( e ) and TNFα ( f ) was measured by ELISA, and nitrite production (an indication of the presence of nitric oxide) was evaluated by the Griess reaction ( g ). h and i , control, Arl11 -silenced, and Arl11 rescue RAW264.7 cells were infected with Salmonella , and the -fold change in recoverable cfu was calculated (20 h/2 h p.i.) by a gentamicin protection assay. By using confocal microscopy, the intracellular bacteria were counted in ∼100 cells/experiment. These numbers were grouped according to the key and expressed as a percentage of the total infected cell population ( i ). Data shown represent mean ± S.D. ( error bars ) ( n = 3) ( n.s. , not significant; *, p

    Article Snippet: The remaining marrow cells were washed twice with 1× PBS and centrifuged at 2000 rpm for 5 min. Isolated bone marrow cells were seeded in 100-mm culture dishes in growth medium supplemented with 30 ng/ml recombinant murine macrophage colony-stimulating factor (34-8983; eBioscience) and cultured at 37 °C with 5% CO2 in a humidified cell culture chamber.

    Techniques: Infection, Concentration Assay, Enzyme-linked Immunosorbent Assay, Confocal Microscopy

    ARL11 depletion impairs ERK1/2 and p38 MAPK phosphorylation in LPS-stimulated macrophages. a , control shRNA– and Arl11 shRNA 1–transfected RAW264.7 cells were treated with 1 μg/ml LPS for different time periods, and lysates were prepared and blotted with the indicated anti-phospho-antibodies. Total ERK1/2, p38, JNK1/2, and α-tubulin were probed as quantitative controls. b–d , densitometric analysis was performed to determine the ratio of phospho-ERK to total ERK ( b ), phospho-p38 to total p38 ( c ), and phospho-JNK to total JNK ( d ) in control shRNA– and Arl11 shRNA 1–transfected RAW264.7 cells treated with 1 μg/ml LPS for different time periods, as indicated. e , BMDMs were transfected with control or Arl11 siRNA. After 72 h of siRNA transfections, cells were stimulated with 100 ng/ml LPS for the indicated time periods, and the lysates were prepared and blotted with the indicated anti-phospho-antibodies. Total ERK1/2, p38, JNK1/2, and α-tubulin were probed as quantitative controls. f–h , densitometric analysis was performed to determine the ratio of phospho-ERK to total ERK ( f ), phospho-p38 to total p38 ( g ), and phospho-JNK to total JNK ( h ) in control siRNA– and Arl11 siRNA–transfected BMDMs treated with 100 ng/ml LPS for different time periods as indicated. i , cell lysates of control shRNA–, Arl11 shRNA–, and Arl11 shRNA (rescue)–RAW264.7 cells were treated with LPS, and the lysates were prepared and blotted with the indicated anti-phospho-antibodies. Total ERK1/2, p38, JNK1/2, and α-tubulin were probed as quantitative controls. To confirm the expression of human ARL11 -HA rescue plasmid, the lysates were probed with anti-HA antibody. j–l , control shRNA–, Arl11 shRNA–, and Arl11 shRNA (rescue)–RAW264.7 cells were treated with LPS for the indicated time periods, supernatants from the cultures were collected, the concentration of IL-6 ( j ) and TNFα ( k ) was measured by ELISA, and nitrite production (an indication of the presence of nitric oxide) was evaluated by the Griess reaction ( l ). Data shown represent mean ± S.D. ( error bars ) ( n = 3) ( n.s. , not significant; *, p

    Journal: The Journal of Biological Chemistry

    Article Title: ARL11 regulates lipopolysaccharide-stimulated macrophage activation by promoting mitogen-activated protein kinase (MAPK) signaling

    doi: 10.1074/jbc.RA117.000727

    Figure Lengend Snippet: ARL11 depletion impairs ERK1/2 and p38 MAPK phosphorylation in LPS-stimulated macrophages. a , control shRNA– and Arl11 shRNA 1–transfected RAW264.7 cells were treated with 1 μg/ml LPS for different time periods, and lysates were prepared and blotted with the indicated anti-phospho-antibodies. Total ERK1/2, p38, JNK1/2, and α-tubulin were probed as quantitative controls. b–d , densitometric analysis was performed to determine the ratio of phospho-ERK to total ERK ( b ), phospho-p38 to total p38 ( c ), and phospho-JNK to total JNK ( d ) in control shRNA– and Arl11 shRNA 1–transfected RAW264.7 cells treated with 1 μg/ml LPS for different time periods, as indicated. e , BMDMs were transfected with control or Arl11 siRNA. After 72 h of siRNA transfections, cells were stimulated with 100 ng/ml LPS for the indicated time periods, and the lysates were prepared and blotted with the indicated anti-phospho-antibodies. Total ERK1/2, p38, JNK1/2, and α-tubulin were probed as quantitative controls. f–h , densitometric analysis was performed to determine the ratio of phospho-ERK to total ERK ( f ), phospho-p38 to total p38 ( g ), and phospho-JNK to total JNK ( h ) in control siRNA– and Arl11 siRNA–transfected BMDMs treated with 100 ng/ml LPS for different time periods as indicated. i , cell lysates of control shRNA–, Arl11 shRNA–, and Arl11 shRNA (rescue)–RAW264.7 cells were treated with LPS, and the lysates were prepared and blotted with the indicated anti-phospho-antibodies. Total ERK1/2, p38, JNK1/2, and α-tubulin were probed as quantitative controls. To confirm the expression of human ARL11 -HA rescue plasmid, the lysates were probed with anti-HA antibody. j–l , control shRNA–, Arl11 shRNA–, and Arl11 shRNA (rescue)–RAW264.7 cells were treated with LPS for the indicated time periods, supernatants from the cultures were collected, the concentration of IL-6 ( j ) and TNFα ( k ) was measured by ELISA, and nitrite production (an indication of the presence of nitric oxide) was evaluated by the Griess reaction ( l ). Data shown represent mean ± S.D. ( error bars ) ( n = 3) ( n.s. , not significant; *, p

    Article Snippet: The remaining marrow cells were washed twice with 1× PBS and centrifuged at 2000 rpm for 5 min. Isolated bone marrow cells were seeded in 100-mm culture dishes in growth medium supplemented with 30 ng/ml recombinant murine macrophage colony-stimulating factor (34-8983; eBioscience) and cultured at 37 °C with 5% CO2 in a humidified cell culture chamber.

    Techniques: shRNA, Transfection, Expressing, Plasmid Preparation, Concentration Assay, Enzyme-linked Immunosorbent Assay

    ARL11 exhibits nucleo-cytosolic distribution and colocalizes with ERK on cortical actin structures. a and b , representative confocal micrographs of RAW264.7 cells ( a ) and BMDMs ( b ) treated with either control siRNA or Arl11 siRNA. After 48 h of siRNA treatment, cells were fixed and immunostained with anti-ARL11 antibody ( green ) to visualize endogenous staining of ARL11, actin was stained using phalloidin ( red ), and the nucleus was stained using DAPI. In Arl11 siRNA–treated cells, the endogenous staining of ARL11 was not observed. c , representative confocal micrographs of HeLa, MCF7, and COS-7 cells transfected with ARL11 -HA–expressing plasmid. Cells were fixed and immunostained with anti-HA antibody ( green ) to visualize ARL11 -transfected cells, and the nucleus was stained using DAPI. d , nuclear and cytoplasmic FRAP analysis on HeLa cells transfected with ARL11-GFP plasmid. HeLa-ARL11-GFP cells were seeded into 35-mm live-cell imaging dishes, and photobleaching was performed by the 488-nm laser line at 100% intensity for 20 s at an ROI (∼5 μm 2 ) near either the center of the nucleus (for nuclear FRAP) or in the cytoplasm (for cytoplasmic FRAP). Without any time-lapse post-bleach, fluorescence recovery was measured every 20 s for up to 10 min until the fluorescence recovery reached the plateau stage. Images acquired were processed in ImageJ software, and FRAP quantification is shown in Fig. S6 ( a and b ) . e and f , lysates of RAW264.7 cells ( e ) or HeLa cells transfected with ARL11 -HA plasmid ( f ) were subjected to nuclear/cytoplasmic fractionation. The isolated whole-cell lysates ( WCL ), nuclear fractions ( NF ), and cytosolic fractions ( CF ) were probed with anti-ARL11 antibody (for endogenous ARL11 distribution) in the case of RAW264.7 cells or anti-HA antibody (for ectopically expressed ARL11-HA) in the case of HeLa cells. The fractions were probed with anti-GAPDH and anti-histone H3 antibodies for checking the purity of cytosolic and nuclear fractions, respectively. g , ARL11 colocalized with the actin filaments in the lamellar ruffles. Representative confocal micrographs of the indicated cell type transfected with ARL11 -HA plasmid are shown. After 12 h post-transfection, cells were fixed and immunostained with anti-HA antibody ( green ) to identify ARL11 -transfected cells, actin was stained using phalloidin ( red ), and the nucleus was stained using DAPI. As shown in the magnified insets , ARL11 colocalizes with cortical actin. h , HeLa cells were transfected with ARL11 -HA plasmid. After 12 h, cells were either left untreated (control) or treated with 5 μ m cytochalasin D for 2 min to cause partial disruption of the actin cytoskeleton. Following treatment, cells were fixed and stained with anti-HA antibody ( green ) to visualize ARL11 -transfected cells, actin was stained using phalloidin ( red ), and the nucleus was stained using DAPI. As shown in the magnified insets , the ARL11 pattern closely mirrored the drug-induced actin distribution. i , HeLa cells were cotransfected with ARL11 -Myc– and HA-ERK2–expressing plasmids. After 12 h, cells were fixed and stained with anti-Myc antibody ( green ) to identify ARL11 -transfected cells and anti-HA antibody ( red ) to visualize ERK2 signal, and actin was stained using phalloidin ( blue ). As shown in the magnified insets , ARL11 colocalizes with ERK at cortical actin. Bars , 10 μm ( main figure ) and 2 μm ( insets ).

    Journal: The Journal of Biological Chemistry

    Article Title: ARL11 regulates lipopolysaccharide-stimulated macrophage activation by promoting mitogen-activated protein kinase (MAPK) signaling

    doi: 10.1074/jbc.RA117.000727

    Figure Lengend Snippet: ARL11 exhibits nucleo-cytosolic distribution and colocalizes with ERK on cortical actin structures. a and b , representative confocal micrographs of RAW264.7 cells ( a ) and BMDMs ( b ) treated with either control siRNA or Arl11 siRNA. After 48 h of siRNA treatment, cells were fixed and immunostained with anti-ARL11 antibody ( green ) to visualize endogenous staining of ARL11, actin was stained using phalloidin ( red ), and the nucleus was stained using DAPI. In Arl11 siRNA–treated cells, the endogenous staining of ARL11 was not observed. c , representative confocal micrographs of HeLa, MCF7, and COS-7 cells transfected with ARL11 -HA–expressing plasmid. Cells were fixed and immunostained with anti-HA antibody ( green ) to visualize ARL11 -transfected cells, and the nucleus was stained using DAPI. d , nuclear and cytoplasmic FRAP analysis on HeLa cells transfected with ARL11-GFP plasmid. HeLa-ARL11-GFP cells were seeded into 35-mm live-cell imaging dishes, and photobleaching was performed by the 488-nm laser line at 100% intensity for 20 s at an ROI (∼5 μm 2 ) near either the center of the nucleus (for nuclear FRAP) or in the cytoplasm (for cytoplasmic FRAP). Without any time-lapse post-bleach, fluorescence recovery was measured every 20 s for up to 10 min until the fluorescence recovery reached the plateau stage. Images acquired were processed in ImageJ software, and FRAP quantification is shown in Fig. S6 ( a and b ) . e and f , lysates of RAW264.7 cells ( e ) or HeLa cells transfected with ARL11 -HA plasmid ( f ) were subjected to nuclear/cytoplasmic fractionation. The isolated whole-cell lysates ( WCL ), nuclear fractions ( NF ), and cytosolic fractions ( CF ) were probed with anti-ARL11 antibody (for endogenous ARL11 distribution) in the case of RAW264.7 cells or anti-HA antibody (for ectopically expressed ARL11-HA) in the case of HeLa cells. The fractions were probed with anti-GAPDH and anti-histone H3 antibodies for checking the purity of cytosolic and nuclear fractions, respectively. g , ARL11 colocalized with the actin filaments in the lamellar ruffles. Representative confocal micrographs of the indicated cell type transfected with ARL11 -HA plasmid are shown. After 12 h post-transfection, cells were fixed and immunostained with anti-HA antibody ( green ) to identify ARL11 -transfected cells, actin was stained using phalloidin ( red ), and the nucleus was stained using DAPI. As shown in the magnified insets , ARL11 colocalizes with cortical actin. h , HeLa cells were transfected with ARL11 -HA plasmid. After 12 h, cells were either left untreated (control) or treated with 5 μ m cytochalasin D for 2 min to cause partial disruption of the actin cytoskeleton. Following treatment, cells were fixed and stained with anti-HA antibody ( green ) to visualize ARL11 -transfected cells, actin was stained using phalloidin ( red ), and the nucleus was stained using DAPI. As shown in the magnified insets , the ARL11 pattern closely mirrored the drug-induced actin distribution. i , HeLa cells were cotransfected with ARL11 -Myc– and HA-ERK2–expressing plasmids. After 12 h, cells were fixed and stained with anti-Myc antibody ( green ) to identify ARL11 -transfected cells and anti-HA antibody ( red ) to visualize ERK2 signal, and actin was stained using phalloidin ( blue ). As shown in the magnified insets , ARL11 colocalizes with ERK at cortical actin. Bars , 10 μm ( main figure ) and 2 μm ( insets ).

    Article Snippet: The remaining marrow cells were washed twice with 1× PBS and centrifuged at 2000 rpm for 5 min. Isolated bone marrow cells were seeded in 100-mm culture dishes in growth medium supplemented with 30 ng/ml recombinant murine macrophage colony-stimulating factor (34-8983; eBioscience) and cultured at 37 °C with 5% CO2 in a humidified cell culture chamber.

    Techniques: Staining, Transfection, Expressing, Plasmid Preparation, Live Cell Imaging, Fluorescence, Software, Fractionation, Isolation

    Cancer microtissues ( a – f ); monocultured microtissue and fibroblast-layered microtissue (1 × 10 4 cell/mL) on day 7. Red, MMP2 ( a ) and MMP9 ( d ); green, F-actin ( b , e ). MMP2 ( g ) and MMP9 ( h ) expression in the mono-cultured and fibroblast-layered microtissues was quantified using ELISA. All experimental samples were n > 3. Unmarked Scale bars, 100 μm.

    Journal: International Journal of Molecular Sciences

    Article Title: Fabrication of In Vitro Cancer Microtissue Array on Fibroblast-Layered Nanofibrous Membrane by Inkjet Printing

    doi: 10.3390/ijms18112348

    Figure Lengend Snippet: Cancer microtissues ( a – f ); monocultured microtissue and fibroblast-layered microtissue (1 × 10 4 cell/mL) on day 7. Red, MMP2 ( a ) and MMP9 ( d ); green, F-actin ( b , e ). MMP2 ( g ) and MMP9 ( h ) expression in the mono-cultured and fibroblast-layered microtissues was quantified using ELISA. All experimental samples were n > 3. Unmarked Scale bars, 100 μm.

    Article Snippet: Cell and Bioink Preparation Fibroblasts (CCD-1112SK, ATCC, Manassas, VA, USA) and HPV18-positive cervical cancer cells (HeLa; KCLB, Seoul, Korea) were cultured with a medium containing 10% FBS and 1% Pen Strep in a 100-mm Petri dish (Nunclon Delta Surface, Thermo Fisher Scientific, Waltham, MA, USA).

    Techniques: Expressing, Cell Culture, Enzyme-linked Immunosorbent Assay