1 8 diazabicyclo  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    Thermo Fisher 1 8 diazabicyclo
    The catalyst systems for COS/epoxide copolymerization. a Metal catalysts (zinc-cobalt(III) double-metal cyanide complexes and (salen)CrX/onium salts), b TEB/LB pairs (triethylborane/Lewis bases), c TU/base pairs in this study (TU-1: diisopropyl thiourea; TU-2: 1-cyclohexyl-3-phenylthiourea; TU-3: 1-[3,5-bis(trifluoromethyl) phenyl]-3-cyclohexylthiourea; DBU: <t>8-diazabicyclo[5.4.0]undec-7-ene;</t> MTBD: N -methyl-1,5,7-triazabicyclododecene; t Bu-P 4 : P4 , 1- tert -butyl-4,4,4-tris(dimethylamino)-2,2-bis [tris(dimethylamino)- phosphoranylidenamino]-2λ5,4λ5-catenadi(phosphazene); t Bu-P 2 : P2 , 1- tert -Butyl-2,2,4,4,4-pentakis(dimethylamino)-2λ5,4λ5-catenadi(phosphazene); and t Bu-P 1 : P1 , tert -butylimino-tris(dimethylamino) phosphorene)
    1 8 Diazabicyclo, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/1 8 diazabicyclo/product/Thermo Fisher
    Average 95 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    1 8 diazabicyclo - by Bioz Stars, 2020-11
    95/100 stars

    Images

    1) Product Images from "Precise synthesis of sulfur-containing polymers via cooperative dual organocatalysts with high activity"

    Article Title: Precise synthesis of sulfur-containing polymers via cooperative dual organocatalysts with high activity

    Journal: Nature Communications

    doi: 10.1038/s41467-018-04554-5

    The catalyst systems for COS/epoxide copolymerization. a Metal catalysts (zinc-cobalt(III) double-metal cyanide complexes and (salen)CrX/onium salts), b TEB/LB pairs (triethylborane/Lewis bases), c TU/base pairs in this study (TU-1: diisopropyl thiourea; TU-2: 1-cyclohexyl-3-phenylthiourea; TU-3: 1-[3,5-bis(trifluoromethyl) phenyl]-3-cyclohexylthiourea; DBU: 8-diazabicyclo[5.4.0]undec-7-ene; MTBD: N -methyl-1,5,7-triazabicyclododecene; t Bu-P 4 : P4 , 1- tert -butyl-4,4,4-tris(dimethylamino)-2,2-bis [tris(dimethylamino)- phosphoranylidenamino]-2λ5,4λ5-catenadi(phosphazene); t Bu-P 2 : P2 , 1- tert -Butyl-2,2,4,4,4-pentakis(dimethylamino)-2λ5,4λ5-catenadi(phosphazene); and t Bu-P 1 : P1 , tert -butylimino-tris(dimethylamino) phosphorene)
    Figure Legend Snippet: The catalyst systems for COS/epoxide copolymerization. a Metal catalysts (zinc-cobalt(III) double-metal cyanide complexes and (salen)CrX/onium salts), b TEB/LB pairs (triethylborane/Lewis bases), c TU/base pairs in this study (TU-1: diisopropyl thiourea; TU-2: 1-cyclohexyl-3-phenylthiourea; TU-3: 1-[3,5-bis(trifluoromethyl) phenyl]-3-cyclohexylthiourea; DBU: 8-diazabicyclo[5.4.0]undec-7-ene; MTBD: N -methyl-1,5,7-triazabicyclododecene; t Bu-P 4 : P4 , 1- tert -butyl-4,4,4-tris(dimethylamino)-2,2-bis [tris(dimethylamino)- phosphoranylidenamino]-2λ5,4λ5-catenadi(phosphazene); t Bu-P 2 : P2 , 1- tert -Butyl-2,2,4,4,4-pentakis(dimethylamino)-2λ5,4λ5-catenadi(phosphazene); and t Bu-P 1 : P1 , tert -butylimino-tris(dimethylamino) phosphorene)

    Techniques Used:

    Related Articles

    Isolation:

    Article Title: Mapping the Encapsidation Determinants of Feline Immunodeficiency Virus
    Article Snippet: .. Virions (CT5Δpsi1 and CT5Δpsi2) isolated from day 15 supernatants of infected cultures were pelleted through a 20% sucrose cushion, RNA was isolated as described above, and reverse transcription was performed with 5 μl of RNA and 200 U of MoMLV RT (Gibco-BRL) in 50 mM Tris (pH 8.3)-75 mM KCl-3 mM MgCl2 -10 mM dithiothreitol-0.5 mM deoxynucleoside triphosphates and primer FIV999AS (TGCTTCTTTCATAGATGGCC) for 60 min at 37°C. .. Subsequently, PCR was performed with primers FIV214Eco (ATATGAATTCGAGGAGTCTCTTTGTTGAGG) and FIV929AS (ATATGACACCGTCATATTTAAAAGTCCTGC) and Taq polymerase.

    Distillation:

    Article Title: Precise synthesis of sulfur-containing polymers via cooperative dual organocatalysts with high activity
    Article Snippet: .. Benzyl alcohol (BnOH), N -methyl-1,5,7-triazabicyclododecene (MTBD) and 1,8-diazabicyclo[5,4,0]undec-7-ene (DBU) were purchased from Alfa Aesar Chemical Co. and Aldrich Chemical Co., respectively, which were purified by distillation over distillation over CaH2 and stored in an inert gas (N2 )-filled glove box. .. Sodium hydride (95%) was purchased from Sigma and used directly.

    Infection:

    Article Title: Mapping the Encapsidation Determinants of Feline Immunodeficiency Virus
    Article Snippet: .. Virions (CT5Δpsi1 and CT5Δpsi2) isolated from day 15 supernatants of infected cultures were pelleted through a 20% sucrose cushion, RNA was isolated as described above, and reverse transcription was performed with 5 μl of RNA and 200 U of MoMLV RT (Gibco-BRL) in 50 mM Tris (pH 8.3)-75 mM KCl-3 mM MgCl2 -10 mM dithiothreitol-0.5 mM deoxynucleoside triphosphates and primer FIV999AS (TGCTTCTTTCATAGATGGCC) for 60 min at 37°C. .. Subsequently, PCR was performed with primers FIV214Eco (ATATGAATTCGAGGAGTCTCTTTGTTGAGG) and FIV929AS (ATATGACACCGTCATATTTAAAAGTCCTGC) and Taq polymerase.

    Purification:

    Article Title: Precise synthesis of sulfur-containing polymers via cooperative dual organocatalysts with high activity
    Article Snippet: .. Benzyl alcohol (BnOH), N -methyl-1,5,7-triazabicyclododecene (MTBD) and 1,8-diazabicyclo[5,4,0]undec-7-ene (DBU) were purchased from Alfa Aesar Chemical Co. and Aldrich Chemical Co., respectively, which were purified by distillation over distillation over CaH2 and stored in an inert gas (N2 )-filled glove box. .. Sodium hydride (95%) was purchased from Sigma and used directly.

    Article Title: Increased C5a receptor expression in sepsis
    Article Snippet: .. After expression of mouse C5a in BL21 (DE3) pLysS cells (Novagen), the recombinant protein was purified over a Ni++ column and dialyzed with a tubing system (Pierce Chemical Co., Rockford, Illinois, USA). .. Biological activity of C5a was confirmed by conducting chemotaxis experiments with mouse neutrophils.

    Expressing:

    Article Title: Increased C5a receptor expression in sepsis
    Article Snippet: .. After expression of mouse C5a in BL21 (DE3) pLysS cells (Novagen), the recombinant protein was purified over a Ni++ column and dialyzed with a tubing system (Pierce Chemical Co., Rockford, Illinois, USA). .. Biological activity of C5a was confirmed by conducting chemotaxis experiments with mouse neutrophils.

    Recombinant:

    Article Title: Increased C5a receptor expression in sepsis
    Article Snippet: .. After expression of mouse C5a in BL21 (DE3) pLysS cells (Novagen), the recombinant protein was purified over a Ni++ column and dialyzed with a tubing system (Pierce Chemical Co., Rockford, Illinois, USA). .. Biological activity of C5a was confirmed by conducting chemotaxis experiments with mouse neutrophils.

    Software:

    Article Title: Mechanism of Action and Capsid-Stabilizing Properties of VHHs with an In Vitro Antipolioviral Activity
    Article Snippet: .. Automated data collection was carried out using EPU software (FEI Company), yielding 8,563 micrographs (of which 6,223 were usable) for PVSP6A and 3,575 micrographs (1,503 usable) for PVSP29F. ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    Thermo Fisher moxifloxacin
    A scanning electron microscope image of <t>moxifloxacin-loaded</t> microspheres.
    Moxifloxacin, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 18 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/moxifloxacin/product/Thermo Fisher
    Average 92 stars, based on 18 article reviews
    Price from $9.99 to $1999.99
    moxifloxacin - by Bioz Stars, 2020-11
    92/100 stars
      Buy from Supplier

    86
    Thermo Fisher mycothiol msh
    Mrx1 catalyzes specific equilibration between <t>mycothiol</t> redox system and roGFP2 in vitro and in vivo . (A) Pre-reduced roGFP2 (lane 1), Mrx1-roGFP2 (lane 2), Mrx1(AGYC)-roGFP2 (lane 3), and Mrx1(CGYA)-roGFP2 (lane 4) were exposed to 50 µM of MSSM for 10 min and ratiometric sensor response was measured. (B) Pre-reduced Mrx1-roGFP2 was treated with 1 µM of MSSM, GSSG, cystine (Cys 2 ) or 2-hydroxyethyl disulfide (HED) and ratiometric sensor response was measured at various time points. (C) Molecular mechanism showing the reduction of oxidized Mrx1-roGFP2 by <t>MSH/Mtr/NADPH</t> pathway. (D) Oxidized Mrx1-roGFP2 was added as a substrate to the MSH/Mtr/NADPH redox pathway and ratiometric sensor response was measured over time. A control reaction in the absence of MSH was performed in parallel. (E) Reduction of oxidized roGFP2 (lane 1), Mrx1-roGFP2 (lane 2), Mrx1(AGYC)-roGFP2 (lane 3), and Mrx1(CGYA)-roGFP2 (lane 4) by MSH/Mtr/NADPH redox pathway. Maximum ratio change after 150 min of incubation with MSH/Mtr/NADPH reaction mixture is shown. (F) Mrx1-roGFP2 is extremely sensitive towards small changes in OxD MSH . Reduced uncoupled roGFP2 and Mrx1-roGFP2 proteins were incubated with mycothiol solutions (1 mM total) containing increasing fractions of MSSM for a maximum of 30 sec and ratiometric sensor response was measured. Note that the response of Mrx1-roGFP2 becomes exceedingly linear in the window between 10% to 90% oxidation, suggesting that the biosensor can effectively measure changes in E MSH within this range of probe oxidation. (G) Excitation spectra of Msm expressing Mrx1-roGFP2 upon treatment with 0.4 mM of diamide (oxidant) or 10 mM of DTT (reductant) for 5 min. (H) Msm expressing Mrx1-roGFP2 was either left untreated (control) or exposed to 50 µM dequalinium, cisplatin and 5-methoxyindole-2-carboxylic acid (MICA) and ratiometric sensor response was measured after 2 h and 24 h post-exposure. p-values shown in the panel were calculated by comparing untreated group and dequalinium treated group. (I) Percentage of OxD Mrx1-roGFP2 in exponentially grown Msm , MsmΔmshA , MsmΔmshD , and MsmΔsigH was calculated (see Materials and Methods for mathematical definition). Note that biosensor is completely oxidized (∼95%) in the absence of MSH reducing system in MsmΔmshA . p-values shown in the panel were calculated by independently comparing MsmΔmshA and MsmΔmshD groups with the Msm group. Error bars represent standard deviations from the mean. * p
    Mycothiol Msh, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mycothiol msh/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mycothiol msh - by Bioz Stars, 2020-11
    86/100 stars
      Buy from Supplier

    Image Search Results


    A scanning electron microscope image of moxifloxacin-loaded microspheres.

    Journal: Translational Vision Science & Technology

    Article Title: Endophthalmitis Prophylaxis Using a Single Drop of Thermoresponsive Controlled-Release Microspheres Loaded with Moxifloxacin in a Rabbit Model

    doi: 10.1167/tvst.5.6.12

    Figure Lengend Snippet: A scanning electron microscope image of moxifloxacin-loaded microspheres.

    Article Snippet: Moxifloxacin released in vitro from the microspheres was determined using known masses of dry microspheres suspended in sufficient volumes of Dulbecco's phosphate buffered saline (DPBS plus calcium and magnesium; Thermo Fisher Scientific, Waltham, MA) to maintain sink-like conditions.

    Techniques: Microscopy

    Cumulative moxifloxacin release (μg) per mg of moxifloxacin-loaded microspheres from 0 to 60 minutes.

    Journal: Translational Vision Science & Technology

    Article Title: Endophthalmitis Prophylaxis Using a Single Drop of Thermoresponsive Controlled-Release Microspheres Loaded with Moxifloxacin in a Rabbit Model

    doi: 10.1167/tvst.5.6.12

    Figure Lengend Snippet: Cumulative moxifloxacin release (μg) per mg of moxifloxacin-loaded microspheres from 0 to 60 minutes.

    Article Snippet: Moxifloxacin released in vitro from the microspheres was determined using known masses of dry microspheres suspended in sufficient volumes of Dulbecco's phosphate buffered saline (DPBS plus calcium and magnesium; Thermo Fisher Scientific, Waltham, MA) to maintain sink-like conditions.

    Techniques:

    In vivo MPM images of mouse hind limb skin. ( a ) 3D rendered hind limb skin images based on autofluorescence (AF) and moxifloxacin fluorescence. Cellular structures in the dermis were captured by approximately 4 times higher laser power (19 mW) than that used for moxifloxacin-treated skin (5 mW). ( b ) Quantification of epidermis and dermis fluorescence intensities. The junction in between the epidermis and dermis was divided along the basal cell layer. ( c ) MPM hind limb skin images at different depths based on topically treated moxifloxacin (green), Hoechst 33342 (blue), and intravenously injected tetramethylrhodamine (TAMRA, red) for identification of cells, their nuclei, and blood vessels, respectively. The stratum spinosum is shown in the first MIP MPM image (2–6 μm). Thin fibrous structures (yellow arrowhead) branching from dermal cell bodies (red arrowhead) and capillary endothelial cells (white arrowhead) with blood vessel are shown in subsequent MIP MPM images (32–40 μm and 48–60 μm, respectively). Scale bars, 50 μm. ( d ) Mobile cell tracking in time-lapse imaging of the dermis after topical treatment of moxifloxacin, in vivo . Mobile cell (orange arrowhead) passing by a static cell (black arrowhead) is shown. Total elapsed imaging time is 25 min during anesthesia of the mouse. Scale bars, 50 μm.

    Journal: Scientific Reports

    Article Title: Moxifloxacin: Clinically compatible contrast agent for multiphoton imaging

    doi: 10.1038/srep27142

    Figure Lengend Snippet: In vivo MPM images of mouse hind limb skin. ( a ) 3D rendered hind limb skin images based on autofluorescence (AF) and moxifloxacin fluorescence. Cellular structures in the dermis were captured by approximately 4 times higher laser power (19 mW) than that used for moxifloxacin-treated skin (5 mW). ( b ) Quantification of epidermis and dermis fluorescence intensities. The junction in between the epidermis and dermis was divided along the basal cell layer. ( c ) MPM hind limb skin images at different depths based on topically treated moxifloxacin (green), Hoechst 33342 (blue), and intravenously injected tetramethylrhodamine (TAMRA, red) for identification of cells, their nuclei, and blood vessels, respectively. The stratum spinosum is shown in the first MIP MPM image (2–6 μm). Thin fibrous structures (yellow arrowhead) branching from dermal cell bodies (red arrowhead) and capillary endothelial cells (white arrowhead) with blood vessel are shown in subsequent MIP MPM images (32–40 μm and 48–60 μm, respectively). Scale bars, 50 μm. ( d ) Mobile cell tracking in time-lapse imaging of the dermis after topical treatment of moxifloxacin, in vivo . Mobile cell (orange arrowhead) passing by a static cell (black arrowhead) is shown. Total elapsed imaging time is 25 min during anesthesia of the mouse. Scale bars, 50 μm.

    Article Snippet: For fluorescent labeling of cells and cell nuclei, 100 μL of a mixture of 5% (v/v) Hoechst 33342 (b2261, Sigma-Aldrich, Saint Louis, US) dissolved in moxifloxacin solution was treated for 30 min. To identify vascular structures, we intravenously injected 100 μL of 10 mg/mL tetramethylrhodamine (TAMRA, D-7139, ThermoFisher Scientific, Waltham, US) in PBS.

    Techniques: In Vivo, Fluorescence, Injection, Cell Tracking Assay, Imaging

    In vitro multiphoton microscopy (MPM) images of cell lines and intracellular moxifloxacin fluorescence intensities. MPM and reflectance confocal microscopy (RCM) images of a freshly extracted rat cornea. All MPM and RCM images are based on moxifloxacin fluorescence. ( a ) Cultured cell lines: mouse embryonic fibroblast (NIH3T3), human normal colon (CCDTr841), and human colon carcinoma (HT29). Representative MPM images of cell lines are presented as maximum intensity projection (MIP) images with a stepwise increment of 1 μm in the z direction. Scale bars, 50 μm. ( b ) Quantification of intracellular moxifloxacin fluorescence intensities. Intracellular signal was enhanced significantly by approximately 10 times after moxifloxacin labeling. ( c ) MPM images of various layers of rat cornea comprising of superficial epithelium, basal epithelium, stroma, and endothelium. Corresponding RCM images of the same regions in the respective MPM images. Scale bars, 50 μm.

    Journal: Scientific Reports

    Article Title: Moxifloxacin: Clinically compatible contrast agent for multiphoton imaging

    doi: 10.1038/srep27142

    Figure Lengend Snippet: In vitro multiphoton microscopy (MPM) images of cell lines and intracellular moxifloxacin fluorescence intensities. MPM and reflectance confocal microscopy (RCM) images of a freshly extracted rat cornea. All MPM and RCM images are based on moxifloxacin fluorescence. ( a ) Cultured cell lines: mouse embryonic fibroblast (NIH3T3), human normal colon (CCDTr841), and human colon carcinoma (HT29). Representative MPM images of cell lines are presented as maximum intensity projection (MIP) images with a stepwise increment of 1 μm in the z direction. Scale bars, 50 μm. ( b ) Quantification of intracellular moxifloxacin fluorescence intensities. Intracellular signal was enhanced significantly by approximately 10 times after moxifloxacin labeling. ( c ) MPM images of various layers of rat cornea comprising of superficial epithelium, basal epithelium, stroma, and endothelium. Corresponding RCM images of the same regions in the respective MPM images. Scale bars, 50 μm.

    Article Snippet: For fluorescent labeling of cells and cell nuclei, 100 μL of a mixture of 5% (v/v) Hoechst 33342 (b2261, Sigma-Aldrich, Saint Louis, US) dissolved in moxifloxacin solution was treated for 30 min. To identify vascular structures, we intravenously injected 100 μL of 10 mg/mL tetramethylrhodamine (TAMRA, D-7139, ThermoFisher Scientific, Waltham, US) in PBS.

    Techniques: In Vitro, Microscopy, Fluorescence, Confocal Microscopy, Cell Culture, Labeling

    MPM images of freshly extracted mouse small intestine and rat bladder after topical treatment of moxifloxacin. ( a ) 3D rendered image of villus in small intestine (jejunum) and zoomed MPM images consisting of goblet cells (yellow arrowhead) and enterocytes (blue arrowhead) in epithelium, inner immune cells (white arrowhead), and capillaries (red arrowhead). Scale bars, 25 μm. ( b ) MPM images of rat bladder composed of structurally diverse layers such as the superficial urothelium (z = 2 μm), dense intermediate cell layer (z = 10 μm), lamina propria (z = 32 μm) with capillary endothelial cells (green arrow), and submucosa (z = 100 μm) consisting of muscle layer (black asterisk). Scale bars, 50 μm.

    Journal: Scientific Reports

    Article Title: Moxifloxacin: Clinically compatible contrast agent for multiphoton imaging

    doi: 10.1038/srep27142

    Figure Lengend Snippet: MPM images of freshly extracted mouse small intestine and rat bladder after topical treatment of moxifloxacin. ( a ) 3D rendered image of villus in small intestine (jejunum) and zoomed MPM images consisting of goblet cells (yellow arrowhead) and enterocytes (blue arrowhead) in epithelium, inner immune cells (white arrowhead), and capillaries (red arrowhead). Scale bars, 25 μm. ( b ) MPM images of rat bladder composed of structurally diverse layers such as the superficial urothelium (z = 2 μm), dense intermediate cell layer (z = 10 μm), lamina propria (z = 32 μm) with capillary endothelial cells (green arrow), and submucosa (z = 100 μm) consisting of muscle layer (black asterisk). Scale bars, 50 μm.

    Article Snippet: For fluorescent labeling of cells and cell nuclei, 100 μL of a mixture of 5% (v/v) Hoechst 33342 (b2261, Sigma-Aldrich, Saint Louis, US) dissolved in moxifloxacin solution was treated for 30 min. To identify vascular structures, we intravenously injected 100 μL of 10 mg/mL tetramethylrhodamine (TAMRA, D-7139, ThermoFisher Scientific, Waltham, US) in PBS.

    Techniques:

    In vitro effects of fluoroquinolones on preformed biofilm of 15 S. maltophilia strains randomly selected. Results are means ± SDs. MXF: Moxifloxacin; LVX: Levofloxacin; CIP: Ciprofloxacin. * P

    Journal: Scientific Reports

    Article Title: Effects of Fluoroquinolones and Azithromycin on Biofilm Formation of Stenotrophomonas maltophilia

    doi: 10.1038/srep29701

    Figure Lengend Snippet: In vitro effects of fluoroquinolones on preformed biofilm of 15 S. maltophilia strains randomly selected. Results are means ± SDs. MXF: Moxifloxacin; LVX: Levofloxacin; CIP: Ciprofloxacin. * P

    Article Snippet: In order to observe the morphological changes associated with biofilms following moxifloxacin treatment, biofilms were allowed to grow on sterile flat-bottom 6-well polystyrene tissue culture plates (LabServ, Thermo Fisher Scientific, USA) in the presence or absence of moxifloxacin treatment.

    Techniques: In Vitro

    Scanning electron microscopy images of biofilms of one S. maltophilia strain (10275), treated with moxifloxacin for 4 h (A–C), 10 h (D–F) and 18 h (G–I). The concentrations of moxifloxacin were: 10 μg/mL ( A,D , G ), 50 μg/mL ( B,E , H ), 100 μg/mL ( C,F , I ). Magnification: ×20,000.

    Journal: Scientific Reports

    Article Title: Effects of Fluoroquinolones and Azithromycin on Biofilm Formation of Stenotrophomonas maltophilia

    doi: 10.1038/srep29701

    Figure Lengend Snippet: Scanning electron microscopy images of biofilms of one S. maltophilia strain (10275), treated with moxifloxacin for 4 h (A–C), 10 h (D–F) and 18 h (G–I). The concentrations of moxifloxacin were: 10 μg/mL ( A,D , G ), 50 μg/mL ( B,E , H ), 100 μg/mL ( C,F , I ). Magnification: ×20,000.

    Article Snippet: In order to observe the morphological changes associated with biofilms following moxifloxacin treatment, biofilms were allowed to grow on sterile flat-bottom 6-well polystyrene tissue culture plates (LabServ, Thermo Fisher Scientific, USA) in the presence or absence of moxifloxacin treatment.

    Techniques: Electron Microscopy

    In vitro effects of moxifloxacin on viability of biofilms for 15 S. maltophilia strains randomly selected. ** P

    Journal: Scientific Reports

    Article Title: Effects of Fluoroquinolones and Azithromycin on Biofilm Formation of Stenotrophomonas maltophilia

    doi: 10.1038/srep29701

    Figure Lengend Snippet: In vitro effects of moxifloxacin on viability of biofilms for 15 S. maltophilia strains randomly selected. ** P

    Article Snippet: In order to observe the morphological changes associated with biofilms following moxifloxacin treatment, biofilms were allowed to grow on sterile flat-bottom 6-well polystyrene tissue culture plates (LabServ, Thermo Fisher Scientific, USA) in the presence or absence of moxifloxacin treatment.

    Techniques: In Vitro

    In vitro effects of fluoroquinolones combined with azithromycin on biofilms of 15 randomly selected S. maltophilia strains after 10 h or 18 h. Results are means ± SDs. MXF: Moxifloxacin; LVX: Levofloxacin; CIP: Ciprofloxacin; AZM: azithromycin. * P

    Journal: Scientific Reports

    Article Title: Effects of Fluoroquinolones and Azithromycin on Biofilm Formation of Stenotrophomonas maltophilia

    doi: 10.1038/srep29701

    Figure Lengend Snippet: In vitro effects of fluoroquinolones combined with azithromycin on biofilms of 15 randomly selected S. maltophilia strains after 10 h or 18 h. Results are means ± SDs. MXF: Moxifloxacin; LVX: Levofloxacin; CIP: Ciprofloxacin; AZM: azithromycin. * P

    Article Snippet: In order to observe the morphological changes associated with biofilms following moxifloxacin treatment, biofilms were allowed to grow on sterile flat-bottom 6-well polystyrene tissue culture plates (LabServ, Thermo Fisher Scientific, USA) in the presence or absence of moxifloxacin treatment.

    Techniques: In Vitro

    Mrx1 catalyzes specific equilibration between mycothiol redox system and roGFP2 in vitro and in vivo . (A) Pre-reduced roGFP2 (lane 1), Mrx1-roGFP2 (lane 2), Mrx1(AGYC)-roGFP2 (lane 3), and Mrx1(CGYA)-roGFP2 (lane 4) were exposed to 50 µM of MSSM for 10 min and ratiometric sensor response was measured. (B) Pre-reduced Mrx1-roGFP2 was treated with 1 µM of MSSM, GSSG, cystine (Cys 2 ) or 2-hydroxyethyl disulfide (HED) and ratiometric sensor response was measured at various time points. (C) Molecular mechanism showing the reduction of oxidized Mrx1-roGFP2 by MSH/Mtr/NADPH pathway. (D) Oxidized Mrx1-roGFP2 was added as a substrate to the MSH/Mtr/NADPH redox pathway and ratiometric sensor response was measured over time. A control reaction in the absence of MSH was performed in parallel. (E) Reduction of oxidized roGFP2 (lane 1), Mrx1-roGFP2 (lane 2), Mrx1(AGYC)-roGFP2 (lane 3), and Mrx1(CGYA)-roGFP2 (lane 4) by MSH/Mtr/NADPH redox pathway. Maximum ratio change after 150 min of incubation with MSH/Mtr/NADPH reaction mixture is shown. (F) Mrx1-roGFP2 is extremely sensitive towards small changes in OxD MSH . Reduced uncoupled roGFP2 and Mrx1-roGFP2 proteins were incubated with mycothiol solutions (1 mM total) containing increasing fractions of MSSM for a maximum of 30 sec and ratiometric sensor response was measured. Note that the response of Mrx1-roGFP2 becomes exceedingly linear in the window between 10% to 90% oxidation, suggesting that the biosensor can effectively measure changes in E MSH within this range of probe oxidation. (G) Excitation spectra of Msm expressing Mrx1-roGFP2 upon treatment with 0.4 mM of diamide (oxidant) or 10 mM of DTT (reductant) for 5 min. (H) Msm expressing Mrx1-roGFP2 was either left untreated (control) or exposed to 50 µM dequalinium, cisplatin and 5-methoxyindole-2-carboxylic acid (MICA) and ratiometric sensor response was measured after 2 h and 24 h post-exposure. p-values shown in the panel were calculated by comparing untreated group and dequalinium treated group. (I) Percentage of OxD Mrx1-roGFP2 in exponentially grown Msm , MsmΔmshA , MsmΔmshD , and MsmΔsigH was calculated (see Materials and Methods for mathematical definition). Note that biosensor is completely oxidized (∼95%) in the absence of MSH reducing system in MsmΔmshA . p-values shown in the panel were calculated by independently comparing MsmΔmshA and MsmΔmshD groups with the Msm group. Error bars represent standard deviations from the mean. * p

    Journal: PLoS Pathogens

    Article Title: Reengineering Redox Sensitive GFP to Measure Mycothiol Redox Potential of Mycobacterium tuberculosis during Infection

    doi: 10.1371/journal.ppat.1003902

    Figure Lengend Snippet: Mrx1 catalyzes specific equilibration between mycothiol redox system and roGFP2 in vitro and in vivo . (A) Pre-reduced roGFP2 (lane 1), Mrx1-roGFP2 (lane 2), Mrx1(AGYC)-roGFP2 (lane 3), and Mrx1(CGYA)-roGFP2 (lane 4) were exposed to 50 µM of MSSM for 10 min and ratiometric sensor response was measured. (B) Pre-reduced Mrx1-roGFP2 was treated with 1 µM of MSSM, GSSG, cystine (Cys 2 ) or 2-hydroxyethyl disulfide (HED) and ratiometric sensor response was measured at various time points. (C) Molecular mechanism showing the reduction of oxidized Mrx1-roGFP2 by MSH/Mtr/NADPH pathway. (D) Oxidized Mrx1-roGFP2 was added as a substrate to the MSH/Mtr/NADPH redox pathway and ratiometric sensor response was measured over time. A control reaction in the absence of MSH was performed in parallel. (E) Reduction of oxidized roGFP2 (lane 1), Mrx1-roGFP2 (lane 2), Mrx1(AGYC)-roGFP2 (lane 3), and Mrx1(CGYA)-roGFP2 (lane 4) by MSH/Mtr/NADPH redox pathway. Maximum ratio change after 150 min of incubation with MSH/Mtr/NADPH reaction mixture is shown. (F) Mrx1-roGFP2 is extremely sensitive towards small changes in OxD MSH . Reduced uncoupled roGFP2 and Mrx1-roGFP2 proteins were incubated with mycothiol solutions (1 mM total) containing increasing fractions of MSSM for a maximum of 30 sec and ratiometric sensor response was measured. Note that the response of Mrx1-roGFP2 becomes exceedingly linear in the window between 10% to 90% oxidation, suggesting that the biosensor can effectively measure changes in E MSH within this range of probe oxidation. (G) Excitation spectra of Msm expressing Mrx1-roGFP2 upon treatment with 0.4 mM of diamide (oxidant) or 10 mM of DTT (reductant) for 5 min. (H) Msm expressing Mrx1-roGFP2 was either left untreated (control) or exposed to 50 µM dequalinium, cisplatin and 5-methoxyindole-2-carboxylic acid (MICA) and ratiometric sensor response was measured after 2 h and 24 h post-exposure. p-values shown in the panel were calculated by comparing untreated group and dequalinium treated group. (I) Percentage of OxD Mrx1-roGFP2 in exponentially grown Msm , MsmΔmshA , MsmΔmshD , and MsmΔsigH was calculated (see Materials and Methods for mathematical definition). Note that biosensor is completely oxidized (∼95%) in the absence of MSH reducing system in MsmΔmshA . p-values shown in the panel were calculated by independently comparing MsmΔmshA and MsmΔmshD groups with the Msm group. Error bars represent standard deviations from the mean. * p

    Article Snippet: OxDMSH is the fraction of MSH total Reduced from of mycothiol (MSH) was obtained by reducing MSSM with immobilized TCEP disulfide reducing gel (Thermo Scientific) under anaerobic conditions as per manufacturer's instructions.

    Techniques: In Vitro, In Vivo, Incubation, Size-exclusion Chromatography, Expressing