qiaquick pcr purification kit  (Qiagen)

Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    QIAquick PCR Purification Kit
    For purification of up to 10 μg PCR products 100 bp to 10 kb Kit contents Qiagen QIAquick PCR Purification Kit 50 rxns 30L Elution Volume 10g Binding Capacity Tube Format Manual Processing Silica Technology 100 bp to 10 kb Fragment 40mers Fragments Removed Ideal for Sequencing Microarray Analysis Ligation and Transformation Restriction Digestion Labeling Microinjection PCR and in vitro Transcription For Purification of up to 10μg PCR Products Includes 50 QIAquick Spin Columns Buffers 2mL Collection Tubes Benefits Up to 95 recovery of ready to use DNA Cleanup of DNA up to 10 kb in three easy steps Gel loading dye for convenient sample analysis
    Catalog Number:
    QIAquick PCR Purification Kit
    Buy from Supplier

    Structured Review

    Qiagen qiaquick pcr purification kit
    QIAquick PCR Purification Kit
    For purification of up to 10 μg PCR products 100 bp to 10 kb Kit contents Qiagen QIAquick PCR Purification Kit 50 rxns 30L Elution Volume 10g Binding Capacity Tube Format Manual Processing Silica Technology 100 bp to 10 kb Fragment 40mers Fragments Removed Ideal for Sequencing Microarray Analysis Ligation and Transformation Restriction Digestion Labeling Microinjection PCR and in vitro Transcription For Purification of up to 10μg PCR Products Includes 50 QIAquick Spin Columns Buffers 2mL Collection Tubes Benefits Up to 95 recovery of ready to use DNA Cleanup of DNA up to 10 kb in three easy steps Gel loading dye for convenient sample analysis
    https://www.bioz.com/result/qiaquick pcr purification kit/product/Qiagen
    Average 90 stars, based on 13923 article reviews
    Price from $9.99 to $1999.99
    qiaquick pcr purification kit - by Bioz Stars, 2020-01
    90/100 stars


    Related Articles

    Methylation Sequencing:

    Article Title: Epigenetic aspects of floral homeotic genes in relation to sexual dimorphism in the dioecious plant Mercurialis annua
    Article Snippet: DNA methylation analysis For cytosine methylation analysis, chop-PCR (methylation-sensitive enzyme digestion followed by PCR) and bisulfite sequencing were performed as described previously ( ). .. Bisulfite conversion was done by adding a mixture of sodium bisulfite, hydroquinone, and urea and incubating at 55 °C for 16 h. The samples were desalted using a PCR purification kit and desulfonated by adding NaOH to a final concentration of 0.3 M. The DNA was then purified using a QIAquick PCR purification kit (Qiagen).

    Clone Assay:

    Article Title: Epigenetic aspects of floral homeotic genes in relation to sexual dimorphism in the dioecious plant Mercurialis annua
    Article Snippet: Bisulfite conversion was done by adding a mixture of sodium bisulfite, hydroquinone, and urea and incubating at 55 °C for 16 h. The samples were desalted using a PCR purification kit and desulfonated by adding NaOH to a final concentration of 0.3 M. The DNA was then purified using a QIAquick PCR purification kit (Qiagen). .. The PCR products were cloned into the pJET1.2 vector.

    Article Title: Detection of torque teno sus virus infection in Indian pigs
    Article Snippet: The PCR-positive products were purified using the QIAquick PCR Purification Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions and eluted in 30 μl of elution buffer. .. The representative amplified products were cloned into the pGEM-T vector (Promega, USA) and subjected to NT sequencing using M13 primers (Eurofins Scientific, India).

    Article Title: Development of a Live Oral Attaching and Effacing Escherichia coli Vaccine Candidate Using Vibrio cholerae CVD 103-HgR as Antigen Vector
    Article Snippet: Paragraph title: 4.2. Cloning of the beta-intimin fragment into pSEC91 ... The 772 bp amplicon was purified using the Qiaquick PCR purification Kit (Qiagen).

    Article Title: The Absence of Pyruvate Kinase Affects Glucose-Dependent Carbon Catabolite Repression in Bacillus subtilis
    Article Snippet: Bacterial Strains and Growth Conditions Cloning and genetic manipulations were conducted using standard procedures [ , ]. .. The PCR product was purified using the QIAquick PCR Purification Kit (Qiagen; Hilden; Germany).

    Article Title: Identification, Typing, and Insecticidal Activity of Xenorhabdus Isolates from Entomopathogenic Nematodes in United Kingdom Soil and Characterization of the xpt Toxin Loci
    Article Snippet: .. PCR products were gel purified using a QIAquick PCR purification kit (QIAGEN) and products cloned using a pGEM Easy TA kit (Promega) according to the manufacturer's instructions. .. Cosmids and PCR products were sequenced using PCR, subcloning, and primer walking.

    Article Title: Lack of Relationship between Purine Biosynthesis and Vancomycin Resistance in Staphylococcus aureus: a Cautionary Tale for Microarray Interpretation ▿
    Article Snippet: PCR products were run on a 1% agarose gel in 0.5× TBE, excised, and purified using the QIAquick PCR purification kit (QIAGEN). .. Positive clones were selected on BHI agar containing 15 μg/ml kanamycin (Sigma-Aldrich).

    Article Title: Quantitative Real-Time Legionella PCR for Environmental Water Samples: Data Interpretation
    Article Snippet: .. The resulting fragment was purified (QIAquick PCR purification kit; QIAGEN, Hilden, Germany), cloned into the pDrive cloning vector, and transformed into Escherichia coli QIAGEN EZ by heat shock treatment, as recommended in the PCR cloning kit (QIAGEN, Hilden, Germany). ..


    Article Title: Molecular architecture of DesV from Streptomyces venezuelae: A PLP-dependent transaminase involved in the biosynthesis of the unusual sugar desosamine
    Article Snippet: The DesV coding sequence ( ) was PCR amplified with Platinum Pfx DNA polymerase (Invitrogen). .. PCR products were purified using a QIAquick PCR purification kit (Qiagen).

    Article Title: Toxin-Producing Ability among Bacillus spp. Outside the Bacillus cereus Group
    Article Snippet: The partial gyrA fragments, corresponding to B. subtilis gyrA numbering positions 43 to 1065 , were PCR amplified using two oligonucleotide primers: p-gyrA-f (5′-CAG TCA GGA AAT CGC TAC GTC CTT-′3) and p-gyrA-r (5′-CAA GGT AAT GCT CCA GGC ATT GCT-′3) ( ). .. The resultant amplicons were purified using a QIAquick PCR purification kit (QIAGEN) and sequenced in both directions by Lark Technologies, Inc.

    Article Title: Epigenetic aspects of floral homeotic genes in relation to sexual dimorphism in the dioecious plant Mercurialis annua
    Article Snippet: Bisulfite conversion was done by adding a mixture of sodium bisulfite, hydroquinone, and urea and incubating at 55 °C for 16 h. The samples were desalted using a PCR purification kit and desulfonated by adding NaOH to a final concentration of 0.3 M. The DNA was then purified using a QIAquick PCR purification kit (Qiagen). .. The bisulfite-converted DNA was used for PCR amplification of promoter and gene-body fragments.

    Article Title: Detection of torque teno sus virus infection in Indian pigs
    Article Snippet: The amplification was performed with the following reaction conditions: A 10 min initial denaturation step at 95°C, followed by 35 cycles at 95°C for 30 s, 55°C for 30 s, and 72°C for 30 s, finishing with 1 cycle for 10 min at 72°C. .. The PCR-positive products were purified using the QIAquick PCR Purification Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions and eluted in 30 μl of elution buffer.

    Article Title: Development of a Live Oral Attaching and Effacing Escherichia coli Vaccine Candidate Using Vibrio cholerae CVD 103-HgR as Antigen Vector
    Article Snippet: .. The 772 bp amplicon was purified using the Qiaquick PCR purification Kit (Qiagen). .. The β-intimin fragment and pSEC91 vector were digested with Nhe I and ligated using T4 DNA ligase (BioLabs).

    Article Title: Phenotypic differences between Salmonella and Escherichia coli resulting from the disparate regulation of homologous genes
    Article Snippet: Genes of interest were amplified with AccuPrime Taq DNA polymerase high fidelity (Invitrogen) by using primers upstream and downstream of the ORFs, by using the following primer pairs: Salmonella pmrA , 2876 and 2877; Salmonella pmrD , 641 and 1897; E. coli pmrA , 2591 and 2592; E. coli pmrD , 1782 and 2644; and E. coli pbgP , 4096 and 2416. .. PCR products were purified with the QIAquick PCR purification kit (Qiagen, Chatsworth, CA).

    Article Title: The Absence of Pyruvate Kinase Affects Glucose-Dependent Carbon Catabolite Repression in Bacillus subtilis
    Article Snippet: For that purpose, genes that mediate resistance against erythromycin were amplified from the plasmid pDG646 [ ]. .. The PCR product was purified using the QIAquick PCR Purification Kit (Qiagen; Hilden; Germany).

    Article Title: Structural implications of novel diversity in eucaryal RNase P RNA
    Article Snippet: .. Amplification products were purified with the QIAquick PCR Purification Kit (QIAGEN). ..

    Article Title: Lack of Relationship between Purine Biosynthesis and Vancomycin Resistance in Staphylococcus aureus: a Cautionary Tale for Microarray Interpretation ▿
    Article Snippet: purH and purM were amplified from N315 using primers PJM03 and PJM04 for purH and PJM01 and PJM02 for purM . .. PCR products were run on a 1% agarose gel in 0.5× TBE, excised, and purified using the QIAquick PCR purification kit (QIAGEN).

    Article Title: Quantitative Real-Time Legionella PCR for Environmental Water Samples: Data Interpretation
    Article Snippet: Briefly, to generate the internal control, lambda DNA (Roche Diagnostics, Mannheim, Germany) was amplified with the primers CIduoF (5′- CTC AGG GTT GAT AGG TTA AGA GC G CAT TGG TGC CGA TTT GG T ACG GAA AGC CGG TGG-3′) and CIduoR (5′-CTC CCA ACA GCT AGT TGA CAT CG G [ CT ] TT TGC CAT CAA ATC TTT CTG AA A GTC GAG TGC CTC ATT-3′) (Proligo, Paris, France) (underlined bases correspond to our Legionella -specific primers, and italic bases correspond to our Legionella pneumophila -specific primers). .. The resulting fragment was purified (QIAquick PCR purification kit; QIAGEN, Hilden, Germany), cloned into the pDrive cloning vector, and transformed into Escherichia coli QIAGEN EZ by heat shock treatment, as recommended in the PCR cloning kit (QIAGEN, Hilden, Germany).

    Article Title: PU.1 and Epigenetic Signals Modulate 1,25-Dihydroxyvitamin D3 and C/EBPα Regulation of the Human Cathelicidin Antimicrobial Peptide Gene in Lung Epithelial Cells
    Article Snippet: Qiagen QIAquick PCR purification kit (Qiagen Inc., Valencia, CA) was used to purify DNA fragments that were subjected to qPCR analysis. .. PCR analysis was performed in the linear range of DNA amplification.

    Article Title: Environmental Evidence for and Genomic Insight into the Preference of Iron-Oxidizing Bacteria for More-Corrosion-Resistant Stainless Steel at Higher Salinities
    Article Snippet: The 16S rRNA gene was PCR amplified using universal 16S primers 8F and 1492R ( , ). .. The PCR products were purified using a QIAquick PCR purification kit (Qiagen, Inc.).

    Lambda DNA Preparation:

    Article Title: Quantitative Real-Time Legionella PCR for Environmental Water Samples: Data Interpretation
    Article Snippet: Briefly, to generate the internal control, lambda DNA (Roche Diagnostics, Mannheim, Germany) was amplified with the primers CIduoF (5′- CTC AGG GTT GAT AGG TTA AGA GC G CAT TGG TGC CGA TTT GG T ACG GAA AGC CGG TGG-3′) and CIduoR (5′-CTC CCA ACA GCT AGT TGA CAT CG G [ CT ] TT TGC CAT CAA ATC TTT CTG AA A GTC GAG TGC CTC ATT-3′) (Proligo, Paris, France) (underlined bases correspond to our Legionella -specific primers, and italic bases correspond to our Legionella pneumophila -specific primers). .. The resulting fragment was purified (QIAquick PCR purification kit; QIAGEN, Hilden, Germany), cloned into the pDrive cloning vector, and transformed into Escherichia coli QIAGEN EZ by heat shock treatment, as recommended in the PCR cloning kit (QIAGEN, Hilden, Germany).


    Article Title: The Absence of Pyruvate Kinase Affects Glucose-Dependent Carbon Catabolite Repression in Bacillus subtilis
    Article Snippet: This was achieved by transformation with PCR products constructed using oligonucleotides to amplify DNA fragments flanking the target genes and an intervening antibiotic resistance cassette. .. The PCR product was purified using the QIAquick PCR Purification Kit (Qiagen; Hilden; Germany).

    Article Title: Structural implications of novel diversity in eucaryal RNase P RNA
    Article Snippet: To sequence the full-length A. castellanii RNase P RNA gene from genomic DNA, an adaptor-ligated genomic library was constructed and PCR amplification of target sequences was carried out using the Universal Genome Walker Kit (Clonetech). .. Amplification products were purified with the QIAquick PCR Purification Kit (QIAGEN).

    Article Title: Lack of Relationship between Purine Biosynthesis and Vancomycin Resistance in Staphylococcus aureus: a Cautionary Tale for Microarray Interpretation ▿
    Article Snippet: PCR products were run on a 1% agarose gel in 0.5× TBE, excised, and purified using the QIAquick PCR purification kit (QIAGEN). .. Both constructs pMC02 (containing purH ) and pMC01 (containing purM ) were transformed into chemically competent TOP10 E. coli cells (Invitrogen).

    Real-time Polymerase Chain Reaction:

    Article Title: PU.1 and Epigenetic Signals Modulate 1,25-Dihydroxyvitamin D3 and C/EBPα Regulation of the Human Cathelicidin Antimicrobial Peptide Gene in Lung Epithelial Cells
    Article Snippet: .. Qiagen QIAquick PCR purification kit (Qiagen Inc., Valencia, CA) was used to purify DNA fragments that were subjected to qPCR analysis. .. Primers were designed to amplify fragments in human CAMP promoter containing the C/EBP site (at −627/−619) (forward, 5′ - GTT ACC CAG GCT GGA GTG C - 3′; reverse, 5′ - ACG GTC TGC ACG CCT ATA AT - 3′) and the PU.1 binding site (at −195/−185) (forward, 5’-GCC ACC GTG CCC TGC CTC ATT CAT CAA TTC-3’; reverse, GGG TGT GGG CTG GGG TTT GCT TTA-3’).


    Article Title: Phenotypic differences between Salmonella and Escherichia coli resulting from the disparate regulation of homologous genes
    Article Snippet: Survival values were calculated by dividing the number of bacteria after treatment with polymyxin B relative to those incubated in the presence of PBS and then multiplied by 100. .. PCR products were purified with the QIAquick PCR purification kit (Qiagen, Chatsworth, CA).

    Transformation Assay:

    Article Title: Development of a Live Oral Attaching and Effacing Escherichia coli Vaccine Candidate Using Vibrio cholerae CVD 103-HgR as Antigen Vector
    Article Snippet: The 772 bp amplicon was purified using the Qiaquick PCR purification Kit (Qiagen). .. The ligation was transformed into competent E. coli DH-5α (Invitrogen) and V. cholerae CVD 103-HgR.

    Article Title: The Absence of Pyruvate Kinase Affects Glucose-Dependent Carbon Catabolite Repression in Bacillus subtilis
    Article Snippet: This was achieved by transformation with PCR products constructed using oligonucleotides to amplify DNA fragments flanking the target genes and an intervening antibiotic resistance cassette. .. The PCR product was purified using the QIAquick PCR Purification Kit (Qiagen; Hilden; Germany).

    Article Title: Lack of Relationship between Purine Biosynthesis and Vancomycin Resistance in Staphylococcus aureus: a Cautionary Tale for Microarray Interpretation ▿
    Article Snippet: PCR products were run on a 1% agarose gel in 0.5× TBE, excised, and purified using the QIAquick PCR purification kit (QIAGEN). .. Both constructs pMC02 (containing purH ) and pMC01 (containing purM ) were transformed into chemically competent TOP10 E. coli cells (Invitrogen).

    Article Title: Quantitative Real-Time Legionella PCR for Environmental Water Samples: Data Interpretation
    Article Snippet: .. The resulting fragment was purified (QIAquick PCR purification kit; QIAGEN, Hilden, Germany), cloned into the pDrive cloning vector, and transformed into Escherichia coli QIAGEN EZ by heat shock treatment, as recommended in the PCR cloning kit (QIAGEN, Hilden, Germany). ..

    Over Expression:

    Article Title: Lack of Relationship between Purine Biosynthesis and Vancomycin Resistance in Staphylococcus aureus: a Cautionary Tale for Microarray Interpretation ▿
    Article Snippet: Paragraph title: Construction of PurH and PurM overexpression vectors. ... PCR products were run on a 1% agarose gel in 0.5× TBE, excised, and purified using the QIAquick PCR purification kit (QIAGEN).

    Derivative Assay:

    Article Title: The Absence of Pyruvate Kinase Affects Glucose-Dependent Carbon Catabolite Repression in Bacillus subtilis
    Article Snippet: B. subtilis strains were derived from BSB1, a tryptophane (trp+ ) derivative of B. subtilis 168. .. The PCR product was purified using the QIAquick PCR Purification Kit (Qiagen; Hilden; Germany).

    Countercurrent Chromatography:

    Article Title: PU.1 and Epigenetic Signals Modulate 1,25-Dihydroxyvitamin D3 and C/EBPα Regulation of the Human Cathelicidin Antimicrobial Peptide Gene in Lung Epithelial Cells
    Article Snippet: Qiagen QIAquick PCR purification kit (Qiagen Inc., Valencia, CA) was used to purify DNA fragments that were subjected to qPCR analysis. .. Primers were designed to amplify fragments in human CAMP promoter containing the C/EBP site (at −627/−619) (forward, 5′ - GTT ACC CAG GCT GGA GTG C - 3′; reverse, 5′ - ACG GTC TGC ACG CCT ATA AT - 3′) and the PU.1 binding site (at −195/−185) (forward, 5’-GCC ACC GTG CCC TGC CTC ATT CAT CAA TTC-3’; reverse, GGG TGT GGG CTG GGG TTT GCT TTA-3’).

    Electron Microscopy:

    Article Title: Environmental Evidence for and Genomic Insight into the Preference of Iron-Oxidizing Bacteria for More-Corrosion-Resistant Stainless Steel at Higher Salinities
    Article Snippet: Samples for scanning electron microscopy were mounted on a 0.2-μm-pore-size polycarbonate filter, air dried, and coated with platinum. .. The PCR products were purified using a QIAquick PCR purification kit (Qiagen, Inc.).


    Article Title: Molecular architecture of DesV from Streptomyces venezuelae: A PLP-dependent transaminase involved in the biosynthesis of the unusual sugar desosamine
    Article Snippet: The DesV coding sequence ( ) was PCR amplified with Platinum Pfx DNA polymerase (Invitrogen). .. PCR products were purified using a QIAquick PCR purification kit (Qiagen).

    Article Title: Toxin-Producing Ability among Bacillus spp. Outside the Bacillus cereus Group
    Article Snippet: For partial gyrA gene sequence analysis, total DNA was extracted from strains B31, B75, and B162 by methods described below for detection of enterotoxin genes by PCR. .. The resultant amplicons were purified using a QIAquick PCR purification kit (QIAGEN) and sequenced in both directions by Lark Technologies, Inc.

    Article Title: Detection of torque teno sus virus infection in Indian pigs
    Article Snippet: The PCR-positive products were purified using the QIAquick PCR Purification Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions and eluted in 30 μl of elution buffer. .. The representative amplified products were cloned into the pGEM-T vector (Promega, USA) and subjected to NT sequencing using M13 primers (Eurofins Scientific, India).

    Article Title: Chikungunya Detection during Dengue Outbreak in Sumatra, Indonesia: Clinical Manifestations and Virological Profile
    Article Snippet: .. Templates were purified using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and used in cycle sequencing reactions performed using overlapping primers from both strands and BigDye Dideoxy Terminator sequencing kits v3.1 (Thermo Fisher Scientific), following manufacturer’s instructions. .. Purified DNA was subjected to capillary sequencing performed on a 3130xl genetic analyzer (Thermo Fisher Scientific).

    Article Title: Phenotypic differences between Salmonella and Escherichia coli resulting from the disparate regulation of homologous genes
    Article Snippet: Sequence Data. .. PCR products were purified with the QIAquick PCR purification kit (Qiagen, Chatsworth, CA).

    Article Title: The Absence of Pyruvate Kinase Affects Glucose-Dependent Carbon Catabolite Repression in Bacillus subtilis
    Article Snippet: The PCR product was purified using the QIAquick PCR Purification Kit (Qiagen; Hilden; Germany). .. The DNA sequence of the flanking regions was verified by sequencing.

    Article Title: Structural implications of novel diversity in eucaryal RNase P RNA
    Article Snippet: Paragraph title: Ligation-mediated PCR: Sequence determination of the Acanthamoebae RNase P RNA genes ... Amplification products were purified with the QIAquick PCR Purification Kit (QIAGEN).

    Article Title: Lack of Relationship between Purine Biosynthesis and Vancomycin Resistance in Staphylococcus aureus: a Cautionary Tale for Microarray Interpretation ▿
    Article Snippet: PCR products were run on a 1% agarose gel in 0.5× TBE, excised, and purified using the QIAquick PCR purification kit (QIAGEN). .. Purified PCR products were ligated at 14°C overnight into the pET24d(+) vector (Novagen), which contains an IPTG (isopropyl-β- d -thiogalactopyranoside)-inducible promoter and a C-terminal His tag sequence for protein purification.

    Article Title: Environmental Evidence for and Genomic Insight into the Preference of Iron-Oxidizing Bacteria for More-Corrosion-Resistant Stainless Steel at Higher Salinities
    Article Snippet: Paragraph title: Species isolation and sequencing. ... The PCR products were purified using a QIAquick PCR purification kit (Qiagen, Inc.).


    Article Title: Development of a Live Oral Attaching and Effacing Escherichia coli Vaccine Candidate Using Vibrio cholerae CVD 103-HgR as Antigen Vector
    Article Snippet: The 772 bp amplicon was purified using the Qiaquick PCR purification Kit (Qiagen). .. The ligation was transformed into competent E. coli DH-5α (Invitrogen) and V. cholerae CVD 103-HgR.

    Article Title: Structural implications of novel diversity in eucaryal RNase P RNA
    Article Snippet: Paragraph title: Ligation-mediated PCR: Sequence determination of the Acanthamoebae RNase P RNA genes ... Amplification products were purified with the QIAquick PCR Purification Kit (QIAGEN).

    Drug Susceptibility Assay:

    Article Title: Phenotypic differences between Salmonella and Escherichia coli resulting from the disparate regulation of homologous genes
    Article Snippet: Polymyxin B Susceptibility Assay. .. PCR products were purified with the QIAquick PCR purification kit (Qiagen, Chatsworth, CA).


    Article Title: Toxin-Producing Ability among Bacillus spp. Outside the Bacillus cereus Group
    Article Snippet: The patterns were generated using the restriction enzyme EcoRI. .. The resultant amplicons were purified using a QIAquick PCR purification kit (QIAGEN) and sequenced in both directions by Lark Technologies, Inc.

    DNA Sequencing:

    Article Title: Detection of torque teno sus virus infection in Indian pigs
    Article Snippet: Paragraph title: Polymerase chain reaction (PCR) and DNA sequencing ... The PCR-positive products were purified using the QIAquick PCR Purification Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions and eluted in 30 μl of elution buffer.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Chikungunya Detection during Dengue Outbreak in Sumatra, Indonesia: Clinical Manifestations and Virological Profile
    Article Snippet: Paragraph title: CHIKV RT-PCR and complete genome sequencing. ... Templates were purified using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and used in cycle sequencing reactions performed using overlapping primers from both strands and BigDye Dideoxy Terminator sequencing kits v3.1 (Thermo Fisher Scientific), following manufacturer’s instructions.

    Binding Assay:

    Article Title: PU.1 and Epigenetic Signals Modulate 1,25-Dihydroxyvitamin D3 and C/EBPα Regulation of the Human Cathelicidin Antimicrobial Peptide Gene in Lung Epithelial Cells
    Article Snippet: Qiagen QIAquick PCR purification kit (Qiagen Inc., Valencia, CA) was used to purify DNA fragments that were subjected to qPCR analysis. .. Primers were designed to amplify fragments in human CAMP promoter containing the C/EBP site (at −627/−619) (forward, 5′ - GTT ACC CAG GCT GGA GTG C - 3′; reverse, 5′ - ACG GTC TGC ACG CCT ATA AT - 3′) and the PU.1 binding site (at −195/−185) (forward, 5’-GCC ACC GTG CCC TGC CTC ATT CAT CAA TTC-3’; reverse, GGG TGT GGG CTG GGG TTT GCT TTA-3’).

    Cellular Antioxidant Activity Assay:

    Article Title: Quantitative Real-Time Legionella PCR for Environmental Water Samples: Data Interpretation
    Article Snippet: Briefly, to generate the internal control, lambda DNA (Roche Diagnostics, Mannheim, Germany) was amplified with the primers CIduoF (5′- CTC AGG GTT GAT AGG TTA AGA GC G CAT TGG TGC CGA TTT GG T ACG GAA AGC CGG TGG-3′) and CIduoR (5′-CTC CCA ACA GCT AGT TGA CAT CG G [ CT ] TT TGC CAT CAA ATC TTT CTG AA A GTC GAG TGC CTC ATT-3′) (Proligo, Paris, France) (underlined bases correspond to our Legionella -specific primers, and italic bases correspond to our Legionella pneumophila -specific primers). .. The resulting fragment was purified (QIAquick PCR purification kit; QIAGEN, Hilden, Germany), cloned into the pDrive cloning vector, and transformed into Escherichia coli QIAGEN EZ by heat shock treatment, as recommended in the PCR cloning kit (QIAGEN, Hilden, Germany).

    Article Title: PU.1 and Epigenetic Signals Modulate 1,25-Dihydroxyvitamin D3 and C/EBPα Regulation of the Human Cathelicidin Antimicrobial Peptide Gene in Lung Epithelial Cells
    Article Snippet: Qiagen QIAquick PCR purification kit (Qiagen Inc., Valencia, CA) was used to purify DNA fragments that were subjected to qPCR analysis. .. Primers were designed to amplify fragments in human CAMP promoter containing the C/EBP site (at −627/−619) (forward, 5′ - GTT ACC CAG GCT GGA GTG C - 3′; reverse, 5′ - ACG GTC TGC ACG CCT ATA AT - 3′) and the PU.1 binding site (at −195/−185) (forward, 5’-GCC ACC GTG CCC TGC CTC ATT CAT CAA TTC-3’; reverse, GGG TGT GGG CTG GGG TTT GCT TTA-3’).

    DNA Extraction:

    Article Title: Identification, Typing, and Insecticidal Activity of Xenorhabdus Isolates from Entomopathogenic Nematodes in United Kingdom Soil and Characterization of the xpt Toxin Loci
    Article Snippet: Chromosomal DNA was extracted from 1.5 ml of overnight X. nematophila culture by using a genomic DNA isolation kit (QIAGEN, Crawley, United Kingdom). .. PCR products were gel purified using a QIAquick PCR purification kit (QIAGEN) and products cloned using a pGEM Easy TA kit (Promega) according to the manufacturer's instructions.

    Molecular Cloning:

    Article Title: Molecular architecture of DesV from Streptomyces venezuelae: A PLP-dependent transaminase involved in the biosynthesis of the unusual sugar desosamine
    Article Snippet: Paragraph title: Molecular cloning of the DesV gene ... PCR products were purified using a QIAquick PCR purification kit (Qiagen).


    Article Title: Epigenetic aspects of floral homeotic genes in relation to sexual dimorphism in the dioecious plant Mercurialis annua
    Article Snippet: For the chop-PCR, genomic DNA was treated with the methylation-sensitive restriction enzymes Hpa II or Msp I and subjected to PCR to amplify various gene fragments containing the restriction site CCGG. .. Bisulfite conversion was done by adding a mixture of sodium bisulfite, hydroquinone, and urea and incubating at 55 °C for 16 h. The samples were desalted using a PCR purification kit and desulfonated by adding NaOH to a final concentration of 0.3 M. The DNA was then purified using a QIAquick PCR purification kit (Qiagen).


    Article Title: Molecular architecture of DesV from Streptomyces venezuelae: A PLP-dependent transaminase involved in the biosynthesis of the unusual sugar desosamine
    Article Snippet: S. venezuelae was purchased from ATCC (ATCC no. 15,439), grown overnight at 26°C in ISP Medium 1, and genomic DNA isolated according to standard procedures. .. PCR products were purified using a QIAquick PCR purification kit (Qiagen).

    Article Title: Quantitative Real-Time Legionella PCR for Environmental Water Samples: Data Interpretation
    Article Snippet: The resulting fragment was purified (QIAquick PCR purification kit; QIAGEN, Hilden, Germany), cloned into the pDrive cloning vector, and transformed into Escherichia coli QIAGEN EZ by heat shock treatment, as recommended in the PCR cloning kit (QIAGEN, Hilden, Germany). .. Plasmid DNA was isolated with a QIAprep Spin miniprep kit (QIAGEN, Hilden, Germany) and stored at −20°C until analysis.

    Article Title: Environmental Evidence for and Genomic Insight into the Preference of Iron-Oxidizing Bacteria for More-Corrosion-Resistant Stainless Steel at Higher Salinities
    Article Snippet: Paragraph title: Species isolation and sequencing. ... The PCR products were purified using a QIAquick PCR purification kit (Qiagen, Inc.).


    Article Title: Identification, Typing, and Insecticidal Activity of Xenorhabdus Isolates from Entomopathogenic Nematodes in United Kingdom Soil and Characterization of the xpt Toxin Loci
    Article Snippet: PCR products were gel purified using a QIAquick PCR purification kit (QIAGEN) and products cloned using a pGEM Easy TA kit (Promega) according to the manufacturer's instructions. .. Cosmids and PCR products were sequenced using PCR, subcloning, and primer walking.


    Article Title: Environmental Evidence for and Genomic Insight into the Preference of Iron-Oxidizing Bacteria for More-Corrosion-Resistant Stainless Steel at Higher Salinities
    Article Snippet: Samples were imaged at ×4,000 magnification with a Thermo Scientific Apreo scanning electron microscope, with an accelerating voltage of 2 kV. .. The PCR products were purified using a QIAquick PCR purification kit (Qiagen, Inc.).


    Article Title: Molecular architecture of DesV from Streptomyces venezuelae: A PLP-dependent transaminase involved in the biosynthesis of the unusual sugar desosamine
    Article Snippet: .. PCR products were purified using a QIAquick PCR purification kit (Qiagen). .. Following the addition of 3′-A overhangs using Taq Polymerase (Promega), the product was ligated into a pGEM-T vector and used to transform competent Escherichia coli DH5α cells.

    Article Title: Toxin-Producing Ability among Bacillus spp. Outside the Bacillus cereus Group
    Article Snippet: .. The resultant amplicons were purified using a QIAquick PCR purification kit (QIAGEN) and sequenced in both directions by Lark Technologies, Inc. .. The same primers were used for the sequencing reactions.

    Article Title: Epigenetic aspects of floral homeotic genes in relation to sexual dimorphism in the dioecious plant Mercurialis annua
    Article Snippet: .. Bisulfite conversion was done by adding a mixture of sodium bisulfite, hydroquinone, and urea and incubating at 55 °C for 16 h. The samples were desalted using a PCR purification kit and desulfonated by adding NaOH to a final concentration of 0.3 M. The DNA was then purified using a QIAquick PCR purification kit (Qiagen). .. The bisulfite-converted DNA was used for PCR amplification of promoter and gene-body fragments.

    Article Title: Detection of torque teno sus virus infection in Indian pigs
    Article Snippet: .. The PCR-positive products were purified using the QIAquick PCR Purification Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions and eluted in 30 μl of elution buffer. .. The representative amplified products were cloned into the pGEM-T vector (Promega, USA) and subjected to NT sequencing using M13 primers (Eurofins Scientific, India).

    Article Title: Chikungunya Detection during Dengue Outbreak in Sumatra, Indonesia: Clinical Manifestations and Virological Profile
    Article Snippet: .. Templates were purified using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and used in cycle sequencing reactions performed using overlapping primers from both strands and BigDye Dideoxy Terminator sequencing kits v3.1 (Thermo Fisher Scientific), following manufacturer’s instructions. .. Purified DNA was subjected to capillary sequencing performed on a 3130xl genetic analyzer (Thermo Fisher Scientific).

    Article Title: Development of a Live Oral Attaching and Effacing Escherichia coli Vaccine Candidate Using Vibrio cholerae CVD 103-HgR as Antigen Vector
    Article Snippet: .. The 772 bp amplicon was purified using the Qiaquick PCR purification Kit (Qiagen). .. The β-intimin fragment and pSEC91 vector were digested with Nhe I and ligated using T4 DNA ligase (BioLabs).

    Article Title: Phenotypic differences between Salmonella and Escherichia coli resulting from the disparate regulation of homologous genes
    Article Snippet: .. PCR products were purified with the QIAquick PCR purification kit (Qiagen, Chatsworth, CA). .. Sequencing reactions were initiated by using the following primers: Salmonella pmrA , 2878, 2879, and 2880; Salmonella pmrD , 2881; E. coli pmrA , 3080 and 2595; E. coli pmrD , 2131; and E. coli pbgP , 4097, performed by using big dye 3.1 (Applied Biosystems) and analyzed on a 310 Genetic Analyzer (Perkin–Elmer).

    Article Title: The Absence of Pyruvate Kinase Affects Glucose-Dependent Carbon Catabolite Repression in Bacillus subtilis
    Article Snippet: .. The PCR product was purified using the QIAquick PCR Purification Kit (Qiagen; Hilden; Germany). .. B. subtilis was transformed with the purified PCR products and transformants were selected on plates with the antibiotic.

    Article Title: Structural implications of novel diversity in eucaryal RNase P RNA
    Article Snippet: .. Amplification products were purified with the QIAquick PCR Purification Kit (QIAGEN). ..

    Article Title: Identification, Typing, and Insecticidal Activity of Xenorhabdus Isolates from Entomopathogenic Nematodes in United Kingdom Soil and Characterization of the xpt Toxin Loci
    Article Snippet: .. PCR products were gel purified using a QIAquick PCR purification kit (QIAGEN) and products cloned using a pGEM Easy TA kit (Promega) according to the manufacturer's instructions. .. Cosmids and PCR products were sequenced using PCR, subcloning, and primer walking.

    Article Title: Lack of Relationship between Purine Biosynthesis and Vancomycin Resistance in Staphylococcus aureus: a Cautionary Tale for Microarray Interpretation ▿
    Article Snippet: .. PCR products were run on a 1% agarose gel in 0.5× TBE, excised, and purified using the QIAquick PCR purification kit (QIAGEN). .. Purified PCR products were ligated at 14°C overnight into the pET24d(+) vector (Novagen), which contains an IPTG (isopropyl-β- d -thiogalactopyranoside)-inducible promoter and a C-terminal His tag sequence for protein purification.

    Article Title: Quantitative Real-Time Legionella PCR for Environmental Water Samples: Data Interpretation
    Article Snippet: .. The resulting fragment was purified (QIAquick PCR purification kit; QIAGEN, Hilden, Germany), cloned into the pDrive cloning vector, and transformed into Escherichia coli QIAGEN EZ by heat shock treatment, as recommended in the PCR cloning kit (QIAGEN, Hilden, Germany). ..

    Article Title: Receptor Activator of Nuclear Factor-?B Ligand-Induced Nuclear Factor of Activated T Cells (C1) Autoregulates Its Own Expression in Osteoclasts and Mediates the Up-Regulation of Tartrate-Resistant Acid Phosphatase
    Article Snippet: .. This was followed by 15 cycles at 95 C for 0.5 min, 55 C for 0.5 min, and 72 C for 1 min, and finished at 72 C for 4 min and then holding at 4 C. After each PCR, the samples were purified with the Qiaquick PCR purification kit. .. The resulting amplicons (∼500 bp) were then end labeled with oligos containing either Cy3 or Cy5 dyes.

    Article Title: PU.1 and Epigenetic Signals Modulate 1,25-Dihydroxyvitamin D3 and C/EBPα Regulation of the Human Cathelicidin Antimicrobial Peptide Gene in Lung Epithelial Cells
    Article Snippet: .. Qiagen QIAquick PCR purification kit (Qiagen Inc., Valencia, CA) was used to purify DNA fragments that were subjected to qPCR analysis. .. Primers were designed to amplify fragments in human CAMP promoter containing the C/EBP site (at −627/−619) (forward, 5′ - GTT ACC CAG GCT GGA GTG C - 3′; reverse, 5′ - ACG GTC TGC ACG CCT ATA AT - 3′) and the PU.1 binding site (at −195/−185) (forward, 5’-GCC ACC GTG CCC TGC CTC ATT CAT CAA TTC-3’; reverse, GGG TGT GGG CTG GGG TTT GCT TTA-3’).

    Article Title: Environmental Evidence for and Genomic Insight into the Preference of Iron-Oxidizing Bacteria for More-Corrosion-Resistant Stainless Steel at Higher Salinities
    Article Snippet: .. The PCR products were purified using a QIAquick PCR purification kit (Qiagen, Inc.). .. The 16S rRNA gene was sequenced by GeneWiz (South Plainfield, NJ) for identification of the isolates.

    Protein Purification:

    Article Title: Lack of Relationship between Purine Biosynthesis and Vancomycin Resistance in Staphylococcus aureus: a Cautionary Tale for Microarray Interpretation ▿
    Article Snippet: PCR products were run on a 1% agarose gel in 0.5× TBE, excised, and purified using the QIAquick PCR purification kit (QIAGEN). .. Purified PCR products were ligated at 14°C overnight into the pET24d(+) vector (Novagen), which contains an IPTG (isopropyl-β- d -thiogalactopyranoside)-inducible promoter and a C-terminal His tag sequence for protein purification.

    Polymerase Chain Reaction:

    Article Title: Molecular architecture of DesV from Streptomyces venezuelae: A PLP-dependent transaminase involved in the biosynthesis of the unusual sugar desosamine
    Article Snippet: .. PCR products were purified using a QIAquick PCR purification kit (Qiagen). .. Following the addition of 3′-A overhangs using Taq Polymerase (Promega), the product was ligated into a pGEM-T vector and used to transform competent Escherichia coli DH5α cells.

    Article Title: Toxin-Producing Ability among Bacillus spp. Outside the Bacillus cereus Group
    Article Snippet: .. The resultant amplicons were purified using a QIAquick PCR purification kit (QIAGEN) and sequenced in both directions by Lark Technologies, Inc. .. The same primers were used for the sequencing reactions.

    Article Title: Epigenetic aspects of floral homeotic genes in relation to sexual dimorphism in the dioecious plant Mercurialis annua
    Article Snippet: .. Bisulfite conversion was done by adding a mixture of sodium bisulfite, hydroquinone, and urea and incubating at 55 °C for 16 h. The samples were desalted using a PCR purification kit and desulfonated by adding NaOH to a final concentration of 0.3 M. The DNA was then purified using a QIAquick PCR purification kit (Qiagen). .. The bisulfite-converted DNA was used for PCR amplification of promoter and gene-body fragments.

    Article Title: Detection of torque teno sus virus infection in Indian pigs
    Article Snippet: .. The PCR-positive products were purified using the QIAquick PCR Purification Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions and eluted in 30 μl of elution buffer. .. The representative amplified products were cloned into the pGEM-T vector (Promega, USA) and subjected to NT sequencing using M13 primers (Eurofins Scientific, India).

    Article Title: Chikungunya Detection during Dengue Outbreak in Sumatra, Indonesia: Clinical Manifestations and Virological Profile
    Article Snippet: .. Templates were purified using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and used in cycle sequencing reactions performed using overlapping primers from both strands and BigDye Dideoxy Terminator sequencing kits v3.1 (Thermo Fisher Scientific), following manufacturer’s instructions. .. Purified DNA was subjected to capillary sequencing performed on a 3130xl genetic analyzer (Thermo Fisher Scientific).

    Article Title: Development of a Live Oral Attaching and Effacing Escherichia coli Vaccine Candidate Using Vibrio cholerae CVD 103-HgR as Antigen Vector
    Article Snippet: .. The 772 bp amplicon was purified using the Qiaquick PCR purification Kit (Qiagen). .. The β-intimin fragment and pSEC91 vector were digested with Nhe I and ligated using T4 DNA ligase (BioLabs).

    Article Title: Phenotypic differences between Salmonella and Escherichia coli resulting from the disparate regulation of homologous genes
    Article Snippet: .. PCR products were purified with the QIAquick PCR purification kit (Qiagen, Chatsworth, CA). .. Sequencing reactions were initiated by using the following primers: Salmonella pmrA , 2878, 2879, and 2880; Salmonella pmrD , 2881; E. coli pmrA , 3080 and 2595; E. coli pmrD , 2131; and E. coli pbgP , 4097, performed by using big dye 3.1 (Applied Biosystems) and analyzed on a 310 Genetic Analyzer (Perkin–Elmer).

    Article Title: The Absence of Pyruvate Kinase Affects Glucose-Dependent Carbon Catabolite Repression in Bacillus subtilis
    Article Snippet: .. The PCR product was purified using the QIAquick PCR Purification Kit (Qiagen; Hilden; Germany). .. B. subtilis was transformed with the purified PCR products and transformants were selected on plates with the antibiotic.

    Article Title: Structural implications of novel diversity in eucaryal RNase P RNA
    Article Snippet: .. Amplification products were purified with the QIAquick PCR Purification Kit (QIAGEN). ..

    Article Title: Identification, Typing, and Insecticidal Activity of Xenorhabdus Isolates from Entomopathogenic Nematodes in United Kingdom Soil and Characterization of the xpt Toxin Loci
    Article Snippet: .. PCR products were gel purified using a QIAquick PCR purification kit (QIAGEN) and products cloned using a pGEM Easy TA kit (Promega) according to the manufacturer's instructions. .. Cosmids and PCR products were sequenced using PCR, subcloning, and primer walking.

    Article Title: Lack of Relationship between Purine Biosynthesis and Vancomycin Resistance in Staphylococcus aureus: a Cautionary Tale for Microarray Interpretation ▿
    Article Snippet: .. PCR products were run on a 1% agarose gel in 0.5× TBE, excised, and purified using the QIAquick PCR purification kit (QIAGEN). .. Purified PCR products were ligated at 14°C overnight into the pET24d(+) vector (Novagen), which contains an IPTG (isopropyl-β- d -thiogalactopyranoside)-inducible promoter and a C-terminal His tag sequence for protein purification.

    Article Title: Quantitative Real-Time Legionella PCR for Environmental Water Samples: Data Interpretation
    Article Snippet: .. The resulting fragment was purified (QIAquick PCR purification kit; QIAGEN, Hilden, Germany), cloned into the pDrive cloning vector, and transformed into Escherichia coli QIAGEN EZ by heat shock treatment, as recommended in the PCR cloning kit (QIAGEN, Hilden, Germany). ..

    Article Title: Receptor Activator of Nuclear Factor-?B Ligand-Induced Nuclear Factor of Activated T Cells (C1) Autoregulates Its Own Expression in Osteoclasts and Mediates the Up-Regulation of Tartrate-Resistant Acid Phosphatase
    Article Snippet: .. This was followed by 15 cycles at 95 C for 0.5 min, 55 C for 0.5 min, and 72 C for 1 min, and finished at 72 C for 4 min and then holding at 4 C. After each PCR, the samples were purified with the Qiaquick PCR purification kit. .. The resulting amplicons (∼500 bp) were then end labeled with oligos containing either Cy3 or Cy5 dyes.

    Article Title: PU.1 and Epigenetic Signals Modulate 1,25-Dihydroxyvitamin D3 and C/EBPα Regulation of the Human Cathelicidin Antimicrobial Peptide Gene in Lung Epithelial Cells
    Article Snippet: .. Qiagen QIAquick PCR purification kit (Qiagen Inc., Valencia, CA) was used to purify DNA fragments that were subjected to qPCR analysis. .. Primers were designed to amplify fragments in human CAMP promoter containing the C/EBP site (at −627/−619) (forward, 5′ - GTT ACC CAG GCT GGA GTG C - 3′; reverse, 5′ - ACG GTC TGC ACG CCT ATA AT - 3′) and the PU.1 binding site (at −195/−185) (forward, 5’-GCC ACC GTG CCC TGC CTC ATT CAT CAA TTC-3’; reverse, GGG TGT GGG CTG GGG TTT GCT TTA-3’).

    Article Title: Environmental Evidence for and Genomic Insight into the Preference of Iron-Oxidizing Bacteria for More-Corrosion-Resistant Stainless Steel at Higher Salinities
    Article Snippet: .. The PCR products were purified using a QIAquick PCR purification kit (Qiagen, Inc.). .. The 16S rRNA gene was sequenced by GeneWiz (South Plainfield, NJ) for identification of the isolates.

    Gel Extraction:

    Article Title: Molecular architecture of DesV from Streptomyces venezuelae: A PLP-dependent transaminase involved in the biosynthesis of the unusual sugar desosamine
    Article Snippet: PCR products were purified using a QIAquick PCR purification kit (Qiagen). .. The pGEM-DesV vector was digested with XhoI and NdeI and the DNA fragments were separated by agarose gel electrophoresis and purified with a Qiagen QIAquick gel extraction kit.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Quantitative Real-Time Legionella PCR for Environmental Water Samples: Data Interpretation
    Article Snippet: Briefly, to generate the internal control, lambda DNA (Roche Diagnostics, Mannheim, Germany) was amplified with the primers CIduoF (5′- CTC AGG GTT GAT AGG TTA AGA GC G CAT TGG TGC CGA TTT GG T ACG GAA AGC CGG TGG-3′) and CIduoR (5′-CTC CCA ACA GCT AGT TGA CAT CG G [ CT ] TT TGC CAT CAA ATC TTT CTG AA A GTC GAG TGC CTC ATT-3′) (Proligo, Paris, France) (underlined bases correspond to our Legionella -specific primers, and italic bases correspond to our Legionella pneumophila -specific primers). .. The resulting fragment was purified (QIAquick PCR purification kit; QIAGEN, Hilden, Germany), cloned into the pDrive cloning vector, and transformed into Escherichia coli QIAGEN EZ by heat shock treatment, as recommended in the PCR cloning kit (QIAGEN, Hilden, Germany).

    Article Title: PU.1 and Epigenetic Signals Modulate 1,25-Dihydroxyvitamin D3 and C/EBPα Regulation of the Human Cathelicidin Antimicrobial Peptide Gene in Lung Epithelial Cells
    Article Snippet: Qiagen QIAquick PCR purification kit (Qiagen Inc., Valencia, CA) was used to purify DNA fragments that were subjected to qPCR analysis. .. Primers were designed to amplify fragments in human CAMP promoter containing the C/EBP site (at −627/−619) (forward, 5′ - GTT ACC CAG GCT GGA GTG C - 3′; reverse, 5′ - ACG GTC TGC ACG CCT ATA AT - 3′) and the PU.1 binding site (at −195/−185) (forward, 5’-GCC ACC GTG CCC TGC CTC ATT CAT CAA TTC-3’; reverse, GGG TGT GGG CTG GGG TTT GCT TTA-3’).

    Chromatin Immunoprecipitation:

    Article Title: PU.1 and Epigenetic Signals Modulate 1,25-Dihydroxyvitamin D3 and C/EBPα Regulation of the Human Cathelicidin Antimicrobial Peptide Gene in Lung Epithelial Cells
    Article Snippet: Paragraph title: Chromatin Immunoprecipitation (ChIP) assay ... Qiagen QIAquick PCR purification kit (Qiagen Inc., Valencia, CA) was used to purify DNA fragments that were subjected to qPCR analysis.

    Plasmid Preparation:

    Article Title: Molecular architecture of DesV from Streptomyces venezuelae: A PLP-dependent transaminase involved in the biosynthesis of the unusual sugar desosamine
    Article Snippet: The PCR primers were designed to enable product insertion into and excision from the Promega pGEM-T vector (forward primer with NdeI site, 5′-AAAA CATATG AGCAGCCGCGCCGAGACCC; reverse primer with XhoI site, 5′-AAAA CTCGAG CTAGGCCTGGTCGACCCGCTCG, University of Wisconsin Biotechnology Center). .. PCR products were purified using a QIAquick PCR purification kit (Qiagen).

    Article Title: Epigenetic aspects of floral homeotic genes in relation to sexual dimorphism in the dioecious plant Mercurialis annua
    Article Snippet: Bisulfite conversion was done by adding a mixture of sodium bisulfite, hydroquinone, and urea and incubating at 55 °C for 16 h. The samples were desalted using a PCR purification kit and desulfonated by adding NaOH to a final concentration of 0.3 M. The DNA was then purified using a QIAquick PCR purification kit (Qiagen). .. The PCR products were cloned into the pJET1.2 vector.

    Article Title: Detection of torque teno sus virus infection in Indian pigs
    Article Snippet: The PCR-positive products were purified using the QIAquick PCR Purification Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions and eluted in 30 μl of elution buffer. .. The representative amplified products were cloned into the pGEM-T vector (Promega, USA) and subjected to NT sequencing using M13 primers (Eurofins Scientific, India).

    Article Title: Development of a Live Oral Attaching and Effacing Escherichia coli Vaccine Candidate Using Vibrio cholerae CVD 103-HgR as Antigen Vector
    Article Snippet: The 772 bp amplicon was purified using the Qiaquick PCR purification Kit (Qiagen). .. The β-intimin fragment and pSEC91 vector were digested with Nhe I and ligated using T4 DNA ligase (BioLabs).

    Article Title: The Absence of Pyruvate Kinase Affects Glucose-Dependent Carbon Catabolite Repression in Bacillus subtilis
    Article Snippet: For that purpose, genes that mediate resistance against erythromycin were amplified from the plasmid pDG646 [ ]. .. The PCR product was purified using the QIAquick PCR Purification Kit (Qiagen; Hilden; Germany).

    Article Title: Lack of Relationship between Purine Biosynthesis and Vancomycin Resistance in Staphylococcus aureus: a Cautionary Tale for Microarray Interpretation ▿
    Article Snippet: PCR products were run on a 1% agarose gel in 0.5× TBE, excised, and purified using the QIAquick PCR purification kit (QIAGEN). .. Purified PCR products were ligated at 14°C overnight into the pET24d(+) vector (Novagen), which contains an IPTG (isopropyl-β- d -thiogalactopyranoside)-inducible promoter and a C-terminal His tag sequence for protein purification.

    Article Title: Quantitative Real-Time Legionella PCR for Environmental Water Samples: Data Interpretation
    Article Snippet: .. The resulting fragment was purified (QIAquick PCR purification kit; QIAGEN, Hilden, Germany), cloned into the pDrive cloning vector, and transformed into Escherichia coli QIAGEN EZ by heat shock treatment, as recommended in the PCR cloning kit (QIAGEN, Hilden, Germany). ..


    Article Title: Chikungunya Detection during Dengue Outbreak in Sumatra, Indonesia: Clinical Manifestations and Virological Profile
    Article Snippet: Templates were purified using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and used in cycle sequencing reactions performed using overlapping primers from both strands and BigDye Dideoxy Terminator sequencing kits v3.1 (Thermo Fisher Scientific), following manufacturer’s instructions. .. Sequence reads were assembled using SeqScape v.2.5 software (Thermo Fisher Scientific) with additional manual adjustments in case of discrepancies.

    RNA Extraction:

    Article Title: Chikungunya Detection during Dengue Outbreak in Sumatra, Indonesia: Clinical Manifestations and Virological Profile
    Article Snippet: After RNA extraction, a one-step RT-PCR targeting the CHIKV E1 gene was performed using an established protocol. .. Templates were purified using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and used in cycle sequencing reactions performed using overlapping primers from both strands and BigDye Dideoxy Terminator sequencing kits v3.1 (Thermo Fisher Scientific), following manufacturer’s instructions.

    Agarose Gel Electrophoresis:

    Article Title: Molecular architecture of DesV from Streptomyces venezuelae: A PLP-dependent transaminase involved in the biosynthesis of the unusual sugar desosamine
    Article Snippet: PCR products were purified using a QIAquick PCR purification kit (Qiagen). .. The pGEM-DesV vector was digested with XhoI and NdeI and the DNA fragments were separated by agarose gel electrophoresis and purified with a Qiagen QIAquick gel extraction kit.

    Article Title: Lack of Relationship between Purine Biosynthesis and Vancomycin Resistance in Staphylococcus aureus: a Cautionary Tale for Microarray Interpretation ▿
    Article Snippet: .. PCR products were run on a 1% agarose gel in 0.5× TBE, excised, and purified using the QIAquick PCR purification kit (QIAGEN). .. Purified PCR products were ligated at 14°C overnight into the pET24d(+) vector (Novagen), which contains an IPTG (isopropyl-β- d -thiogalactopyranoside)-inducible promoter and a C-terminal His tag sequence for protein purification.

    Article Title: PU.1 and Epigenetic Signals Modulate 1,25-Dihydroxyvitamin D3 and C/EBPα Regulation of the Human Cathelicidin Antimicrobial Peptide Gene in Lung Epithelial Cells
    Article Snippet: Qiagen QIAquick PCR purification kit (Qiagen Inc., Valencia, CA) was used to purify DNA fragments that were subjected to qPCR analysis. .. 2% agarose gel with ethidium bromide staining is used to visualize PCR products.

    Chromosome Walking:

    Article Title: Identification, Typing, and Insecticidal Activity of Xenorhabdus Isolates from Entomopathogenic Nematodes in United Kingdom Soil and Characterization of the xpt Toxin Loci
    Article Snippet: PCR products were gel purified using a QIAquick PCR purification kit (QIAGEN) and products cloned using a pGEM Easy TA kit (Promega) according to the manufacturer's instructions. .. Cosmids and PCR products were sequenced using PCR, subcloning, and primer walking.

    DNA Methylation Assay:

    Article Title: Epigenetic aspects of floral homeotic genes in relation to sexual dimorphism in the dioecious plant Mercurialis annua
    Article Snippet: Paragraph title: DNA methylation analysis ... Bisulfite conversion was done by adding a mixture of sodium bisulfite, hydroquinone, and urea and incubating at 55 °C for 16 h. The samples were desalted using a PCR purification kit and desulfonated by adding NaOH to a final concentration of 0.3 M. The DNA was then purified using a QIAquick PCR purification kit (Qiagen).

    Concentration Assay:

    Article Title: Epigenetic aspects of floral homeotic genes in relation to sexual dimorphism in the dioecious plant Mercurialis annua
    Article Snippet: .. Bisulfite conversion was done by adding a mixture of sodium bisulfite, hydroquinone, and urea and incubating at 55 °C for 16 h. The samples were desalted using a PCR purification kit and desulfonated by adding NaOH to a final concentration of 0.3 M. The DNA was then purified using a QIAquick PCR purification kit (Qiagen). .. The bisulfite-converted DNA was used for PCR amplification of promoter and gene-body fragments.

    Thin Layer Chromatography:

    Article Title: Toxin-Producing Ability among Bacillus spp. Outside the Bacillus cereus Group
    Article Snippet: Hydrolysates of whole cells were examined for the presence of meso -α,ɛ-diaminopimelic acid by thin-layer chromatography based on previously described methods ( , ). .. The resultant amplicons were purified using a QIAquick PCR purification kit (QIAGEN) and sequenced in both directions by Lark Technologies, Inc.

    CTG Assay:

    Article Title: Quantitative Real-Time Legionella PCR for Environmental Water Samples: Data Interpretation
    Article Snippet: Briefly, to generate the internal control, lambda DNA (Roche Diagnostics, Mannheim, Germany) was amplified with the primers CIduoF (5′- CTC AGG GTT GAT AGG TTA AGA GC G CAT TGG TGC CGA TTT GG T ACG GAA AGC CGG TGG-3′) and CIduoR (5′-CTC CCA ACA GCT AGT TGA CAT CG G [ CT ] TT TGC CAT CAA ATC TTT CTG AA A GTC GAG TGC CTC ATT-3′) (Proligo, Paris, France) (underlined bases correspond to our Legionella -specific primers, and italic bases correspond to our Legionella pneumophila -specific primers). .. The resulting fragment was purified (QIAquick PCR purification kit; QIAGEN, Hilden, Germany), cloned into the pDrive cloning vector, and transformed into Escherichia coli QIAGEN EZ by heat shock treatment, as recommended in the PCR cloning kit (QIAGEN, Hilden, Germany).

    Article Title: PU.1 and Epigenetic Signals Modulate 1,25-Dihydroxyvitamin D3 and C/EBPα Regulation of the Human Cathelicidin Antimicrobial Peptide Gene in Lung Epithelial Cells
    Article Snippet: Qiagen QIAquick PCR purification kit (Qiagen Inc., Valencia, CA) was used to purify DNA fragments that were subjected to qPCR analysis. .. Primers were designed to amplify fragments in human CAMP promoter containing the C/EBP site (at −627/−619) (forward, 5′ - GTT ACC CAG GCT GGA GTG C - 3′; reverse, 5′ - ACG GTC TGC ACG CCT ATA AT - 3′) and the PU.1 binding site (at −195/−185) (forward, 5’-GCC ACC GTG CCC TGC CTC ATT CAT CAA TTC-3’; reverse, GGG TGT GGG CTG GGG TTT GCT TTA-3’).


    Article Title: PU.1 and Epigenetic Signals Modulate 1,25-Dihydroxyvitamin D3 and C/EBPα Regulation of the Human Cathelicidin Antimicrobial Peptide Gene in Lung Epithelial Cells
    Article Snippet: Qiagen QIAquick PCR purification kit (Qiagen Inc., Valencia, CA) was used to purify DNA fragments that were subjected to qPCR analysis. .. 2% agarose gel with ethidium bromide staining is used to visualize PCR products.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Qiagen qiaquick pcr purificaton kit
    Qiaquick Pcr Purificaton Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qiaquick pcr purificaton kit/product/Qiagen
    Average 90 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    qiaquick pcr purificaton kit - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results