ϕx174 viral  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85

    Structured Review

    New England Biolabs ϕx174 viral
    Purification and ATP hydrolysis activity of wild type and Walker A variants of hDMC1. (A) hDMC1 Walker A motif consisting of amino acid residues 124–138. The bars depict the conserved residues of the Walker A motif. The conserved lysine at position 132 (K) residue was substituted with either arginine (R) or alanine (A). (B) Purified hDMC1 WT (hDMC1; lane 1), hDMC1 K132R (K132R; lane 2), and hDMC1 K132A (K132A; lane 3) 1.5 μg each variant was resolved on 12% SDS-PAGE polyacrylamide gel stained with Coomassie Blue. * Denotes a C-terminal truncation of hDMC1. (C) Determination of ATP hydrolysis activity of hDMC1 and walker A motif variants. Purified hDMC1 WT (hDMC1), hDMC1 K132R (K132R), and hDMC1 K132A (K132A) were incubated with [γ- 32 P] ATP in the presence or absence of <t>ϕX174</t> (+) virion single strand (ssDNA) or ϕX174 replicative form I (dsDNA). The samples were withdrawn at the indicated time points and subjected to thin layer chromatography (TLC) followed by phosphorimager analysis.
    ϕx174 Viral, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ϕx174 viral/product/New England Biolabs
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    ϕx174 viral - by Bioz Stars, 2020-04
    85/100 stars

    Related Products / Commonly Used Together

    dna substrates
    i dsdna
    ϕx174 replicative

    Images

    1) Product Images from "Role of the conserved lysine within the Walker A motif of human DMC1"

    Article Title: Role of the conserved lysine within the Walker A motif of human DMC1

    Journal: DNA repair

    doi: 10.1016/j.dnarep.2012.10.005

    Purification and ATP hydrolysis activity of wild type and Walker A variants of hDMC1. (A) hDMC1 Walker A motif consisting of amino acid residues 124–138. The bars depict the conserved residues of the Walker A motif. The conserved lysine at position 132 (K) residue was substituted with either arginine (R) or alanine (A). (B) Purified hDMC1 WT (hDMC1; lane 1), hDMC1 K132R (K132R; lane 2), and hDMC1 K132A (K132A; lane 3) 1.5 μg each variant was resolved on 12% SDS-PAGE polyacrylamide gel stained with Coomassie Blue. * Denotes a C-terminal truncation of hDMC1. (C) Determination of ATP hydrolysis activity of hDMC1 and walker A motif variants. Purified hDMC1 WT (hDMC1), hDMC1 K132R (K132R), and hDMC1 K132A (K132A) were incubated with [γ- 32 P] ATP in the presence or absence of ϕX174 (+) virion single strand (ssDNA) or ϕX174 replicative form I (dsDNA). The samples were withdrawn at the indicated time points and subjected to thin layer chromatography (TLC) followed by phosphorimager analysis.
    Figure Legend Snippet: Purification and ATP hydrolysis activity of wild type and Walker A variants of hDMC1. (A) hDMC1 Walker A motif consisting of amino acid residues 124–138. The bars depict the conserved residues of the Walker A motif. The conserved lysine at position 132 (K) residue was substituted with either arginine (R) or alanine (A). (B) Purified hDMC1 WT (hDMC1; lane 1), hDMC1 K132R (K132R; lane 2), and hDMC1 K132A (K132A; lane 3) 1.5 μg each variant was resolved on 12% SDS-PAGE polyacrylamide gel stained with Coomassie Blue. * Denotes a C-terminal truncation of hDMC1. (C) Determination of ATP hydrolysis activity of hDMC1 and walker A motif variants. Purified hDMC1 WT (hDMC1), hDMC1 K132R (K132R), and hDMC1 K132A (K132A) were incubated with [γ- 32 P] ATP in the presence or absence of ϕX174 (+) virion single strand (ssDNA) or ϕX174 replicative form I (dsDNA). The samples were withdrawn at the indicated time points and subjected to thin layer chromatography (TLC) followed by phosphorimager analysis.

    Techniques Used: Purification, Activity Assay, Variant Assay, SDS Page, Staining, Incubation, Thin Layer Chromatography

    DNA binding activity of wild type and Walker A variants of hDMC1. (panel I) hDMC1 WT (1.4 μM, lane 2; 2.8 μM, lane 3; 5.6 μM, lane 4; 11.2 μM, lanes 5–11) was incubated with ϕX174 (+) ssDNA DNA (ss) and linearized ϕX174 RF (I) dsDNA (ds) in the absence (lane 9) or presence of ATP (lanes 1–5 and 10) and nucleotide analogs (ATP-γ-S, lane 6; AMP–PNP, lane 7; and ADP, lane 8). The reaction products were analyzed on 1% agarose gels. Lane 11, the reaction was deproteinized prior loading on the agarose gel. The hDMC1 K132R (panel II) and hDMC1 K132A (panel III) were analyzed as described for hDMC1 WT .
    Figure Legend Snippet: DNA binding activity of wild type and Walker A variants of hDMC1. (panel I) hDMC1 WT (1.4 μM, lane 2; 2.8 μM, lane 3; 5.6 μM, lane 4; 11.2 μM, lanes 5–11) was incubated with ϕX174 (+) ssDNA DNA (ss) and linearized ϕX174 RF (I) dsDNA (ds) in the absence (lane 9) or presence of ATP (lanes 1–5 and 10) and nucleotide analogs (ATP-γ-S, lane 6; AMP–PNP, lane 7; and ADP, lane 8). The reaction products were analyzed on 1% agarose gels. Lane 11, the reaction was deproteinized prior loading on the agarose gel. The hDMC1 K132R (panel II) and hDMC1 K132A (panel III) were analyzed as described for hDMC1 WT .

    Techniques Used: Binding Assay, Activity Assay, Incubation, Agarose Gel Electrophoresis

    Nucleotide binding by wild type and Walker A variants of hDMC1. (A) hDMC1 WT (lane 2 and 5), hDMC1 K132R (lane 3 and 6) and hDMC1 K132A (lane 4 and 7) were incubated with [α- 32 ] ATP in the absence (lanes 1–4) or presence of ϕX174 (+) strand (ssDNA) (lanes 5–7) either in the absence (A) or presence of 2 mM Ca 2+ (B) or 4 mM Ca 2+ (C). The reaction products were subjected to dot filtration through a nylon membrane in a mini-fold apparatus followed by immediate washes with reaction buffer. The relative amount of bound nucleotide was quantified using a phosphorimager.
    Figure Legend Snippet: Nucleotide binding by wild type and Walker A variants of hDMC1. (A) hDMC1 WT (lane 2 and 5), hDMC1 K132R (lane 3 and 6) and hDMC1 K132A (lane 4 and 7) were incubated with [α- 32 ] ATP in the absence (lanes 1–4) or presence of ϕX174 (+) strand (ssDNA) (lanes 5–7) either in the absence (A) or presence of 2 mM Ca 2+ (B) or 4 mM Ca 2+ (C). The reaction products were subjected to dot filtration through a nylon membrane in a mini-fold apparatus followed by immediate washes with reaction buffer. The relative amount of bound nucleotide was quantified using a phosphorimager.

    Techniques Used: Binding Assay, Incubation, Filtration

    Related Articles

    Purification:

    Article Title: Role of the conserved lysine within the Walker A motif of human DMC1
    Article Snippet: The ϕX174 viral (+) strand (ssDNA) and ϕX174 replicative form I (dsDNA) was purchased from New England Biolabs. .. The supercoiled pBluescript DNA was purified using a commercially available kit (Qiagen).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    New England Biolabs single stranded ϕx174 viral strand dna
    The <t>DNA</t> aggregation assay. ( A ) Schematic representation of the DNA aggregation assay. ( B ) The reaction was conducted with DMC1 (4 µM) and/or PSF (1.2 µM) in the presence of <t>ϕX174</t> ssDNA (10 µM) and linearized ϕX174 dsDNA (10 µM). The samples were centrifuged for 3 min at 20 400 g at room temperature, and the ssDNA and dsDNA recovered in the upper (15 µl) and bottom (5 µl) fractions were analyzed by 0.8% agarose gel electrophoresis with ethidium bromide staining. ( C ) The reaction was conducted by the same method as in panel B, except HOP2-MND1 (1.2 µM) was used instead of PSF.
    Single Stranded ϕx174 Viral Strand Dna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 86/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/single stranded ϕx174 viral strand dna/product/New England Biolabs
    Average 86 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    single stranded ϕx174 viral strand dna - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    85
    New England Biolabs ϕx174 viral
    Purification and ATP hydrolysis activity of wild type and Walker A variants of hDMC1. (A) hDMC1 Walker A motif consisting of amino acid residues 124–138. The bars depict the conserved residues of the Walker A motif. The conserved lysine at position 132 (K) residue was substituted with either arginine (R) or alanine (A). (B) Purified hDMC1 WT (hDMC1; lane 1), hDMC1 K132R (K132R; lane 2), and hDMC1 K132A (K132A; lane 3) 1.5 μg each variant was resolved on 12% SDS-PAGE polyacrylamide gel stained with Coomassie Blue. * Denotes a C-terminal truncation of hDMC1. (C) Determination of ATP hydrolysis activity of hDMC1 and walker A motif variants. Purified hDMC1 WT (hDMC1), hDMC1 K132R (K132R), and hDMC1 K132A (K132A) were incubated with [γ- 32 P] ATP in the presence or absence of <t>ϕX174</t> (+) virion single strand (ssDNA) or ϕX174 replicative form I (dsDNA). The samples were withdrawn at the indicated time points and subjected to thin layer chromatography (TLC) followed by phosphorimager analysis.
    ϕx174 Viral, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ϕx174 viral/product/New England Biolabs
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    ϕx174 viral - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    84
    New England Biolabs in vitro reactions single stranded ϕx174 viral
    GEMIN2 stimulates RAD51–DNA filament formation. ( A ) Polyacrylamide gel electrophoresis to examine the formation of the RAD51–DNA filament. RAD51 (4 µM) and GEMIN2 were incubated with 10 µM 49-mer ssDNA. DNA was visualized by SYBR Gold (Invitrogen) staining. The GEMIN2 concentrations were 0 µM (lane 2), 1 µM (lane 3), 2 µM (lane 4), 4 µM (lane 5) and 8 µM (lanes 6 and 7). Under these experimental conditions, 90% of the input ssDNA was estimated as being in the RAD51-bound fraction in the absence of the GEMIN2 protein. ( B ) Quantification of experiments shown in panel A. The amounts of complexes formed were estimated from the residual free DNA substrates, and unbound ssDNA fractions relative to lane 2 of panel A were plotted. Average values of three independent experiments are shown with standard deviation values. ( C ) Polyacrylamide gel electrophoresis, as in panel A. RAD51 (2 µM) and GEMIN2 were incubated with 6 µM 49-mer dsDNA. DNA was visualized by SYBR Gold (Invitrogen) staining. The GEMIN2 concentrations were 0 µM (lane 2), 0.5 µM (lane 3), 1 µM (lane 4), 2 µM (lane 5) and 4 µM (lanes 6 and 7). ( D ) Quantification of experiments shown in panel C. The amounts of complexes formed were estimated from the residual free DNA substrates, and unbound dsDNA fractions relative to lane 2 of panel C were plotted. Average values of three independent experiments are shown with standard deviation values. ( E ) Agarose gel electrophoresis to examine the formation of the RAD51-ssDNA filament. RAD51 was incubated in the presence or absence of the GEMIN2 protein, followed by addition of <t>ϕX174</t> ssDNA (20 µM). DNA was visualized by ethidium bromide staining. ( F ) Agarose gel electrophoresis to examine the formation of the RAD51–dsDNA filament. RAD51 was incubated in the presence or absence of the GEMIN2 protein, followed by addition of linear ϕX174 dsDNA (10 µM). Results presented as in panel E. ( G ) Agarose gel electrophoresis to assess the complex formation between the RAD51-dsDNA filament and GEMIN2. GEMIN2 was labeled with Cy5 and dsDNA was stained with EtBr. Note that GEMIN2 facilitated the formation of the RAD51-dsDNA filament, but did not bind to the filament.
    In Vitro Reactions Single Stranded ϕx174 Viral, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 84/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/in vitro reactions single stranded ϕx174 viral/product/New England Biolabs
    Average 84 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    in vitro reactions single stranded ϕx174 viral - by Bioz Stars, 2020-04
    84/100 stars
      Buy from Supplier

    92
    New England Biolabs ϕx174 virion ssdna
    Sgs1 can displace <t>ssDNA</t> annealed to <t>ϕX174</t> ssDNA. A , a 32 P-labeled oligonucleotide (66 nucleotides) was annealed to ϕX174 ssDNA (1 n m molecules) to create the substrate that was used for helicase assays; products were analyzed by electrophoresis,
    ϕx174 Virion Ssdna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 92/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ϕx174 virion ssdna/product/New England Biolabs
    Average 92 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    ϕx174 virion ssdna - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    Image Search Results


    The DNA aggregation assay. ( A ) Schematic representation of the DNA aggregation assay. ( B ) The reaction was conducted with DMC1 (4 µM) and/or PSF (1.2 µM) in the presence of ϕX174 ssDNA (10 µM) and linearized ϕX174 dsDNA (10 µM). The samples were centrifuged for 3 min at 20 400 g at room temperature, and the ssDNA and dsDNA recovered in the upper (15 µl) and bottom (5 µl) fractions were analyzed by 0.8% agarose gel electrophoresis with ethidium bromide staining. ( C ) The reaction was conducted by the same method as in panel B, except HOP2-MND1 (1.2 µM) was used instead of PSF.

    Journal: Nucleic Acids Research

    Article Title: Human PSF concentrates DNA and stimulates duplex capture in DMC1-mediated homologous pairing

    doi: 10.1093/nar/gkr1229

    Figure Lengend Snippet: The DNA aggregation assay. ( A ) Schematic representation of the DNA aggregation assay. ( B ) The reaction was conducted with DMC1 (4 µM) and/or PSF (1.2 µM) in the presence of ϕX174 ssDNA (10 µM) and linearized ϕX174 dsDNA (10 µM). The samples were centrifuged for 3 min at 20 400 g at room temperature, and the ssDNA and dsDNA recovered in the upper (15 µl) and bottom (5 µl) fractions were analyzed by 0.8% agarose gel electrophoresis with ethidium bromide staining. ( C ) The reaction was conducted by the same method as in panel B, except HOP2-MND1 (1.2 µM) was used instead of PSF.

    Article Snippet: Single-stranded ϕX174 viral (+) strand DNA and double-stranded ϕX174 replicative form I DNA were purchased from New England Biolabs.

    Techniques: Agarose Gel Electrophoresis, Staining

    Purification and ATP hydrolysis activity of wild type and Walker A variants of hDMC1. (A) hDMC1 Walker A motif consisting of amino acid residues 124–138. The bars depict the conserved residues of the Walker A motif. The conserved lysine at position 132 (K) residue was substituted with either arginine (R) or alanine (A). (B) Purified hDMC1 WT (hDMC1; lane 1), hDMC1 K132R (K132R; lane 2), and hDMC1 K132A (K132A; lane 3) 1.5 μg each variant was resolved on 12% SDS-PAGE polyacrylamide gel stained with Coomassie Blue. * Denotes a C-terminal truncation of hDMC1. (C) Determination of ATP hydrolysis activity of hDMC1 and walker A motif variants. Purified hDMC1 WT (hDMC1), hDMC1 K132R (K132R), and hDMC1 K132A (K132A) were incubated with [γ- 32 P] ATP in the presence or absence of ϕX174 (+) virion single strand (ssDNA) or ϕX174 replicative form I (dsDNA). The samples were withdrawn at the indicated time points and subjected to thin layer chromatography (TLC) followed by phosphorimager analysis.

    Journal: DNA repair

    Article Title: Role of the conserved lysine within the Walker A motif of human DMC1

    doi: 10.1016/j.dnarep.2012.10.005

    Figure Lengend Snippet: Purification and ATP hydrolysis activity of wild type and Walker A variants of hDMC1. (A) hDMC1 Walker A motif consisting of amino acid residues 124–138. The bars depict the conserved residues of the Walker A motif. The conserved lysine at position 132 (K) residue was substituted with either arginine (R) or alanine (A). (B) Purified hDMC1 WT (hDMC1; lane 1), hDMC1 K132R (K132R; lane 2), and hDMC1 K132A (K132A; lane 3) 1.5 μg each variant was resolved on 12% SDS-PAGE polyacrylamide gel stained with Coomassie Blue. * Denotes a C-terminal truncation of hDMC1. (C) Determination of ATP hydrolysis activity of hDMC1 and walker A motif variants. Purified hDMC1 WT (hDMC1), hDMC1 K132R (K132R), and hDMC1 K132A (K132A) were incubated with [γ- 32 P] ATP in the presence or absence of ϕX174 (+) virion single strand (ssDNA) or ϕX174 replicative form I (dsDNA). The samples were withdrawn at the indicated time points and subjected to thin layer chromatography (TLC) followed by phosphorimager analysis.

    Article Snippet: The ϕX174 viral (+) strand (ssDNA) and ϕX174 replicative form I (dsDNA) was purchased from New England Biolabs.

    Techniques: Purification, Activity Assay, Variant Assay, SDS Page, Staining, Incubation, Thin Layer Chromatography

    DNA binding activity of wild type and Walker A variants of hDMC1. (panel I) hDMC1 WT (1.4 μM, lane 2; 2.8 μM, lane 3; 5.6 μM, lane 4; 11.2 μM, lanes 5–11) was incubated with ϕX174 (+) ssDNA DNA (ss) and linearized ϕX174 RF (I) dsDNA (ds) in the absence (lane 9) or presence of ATP (lanes 1–5 and 10) and nucleotide analogs (ATP-γ-S, lane 6; AMP–PNP, lane 7; and ADP, lane 8). The reaction products were analyzed on 1% agarose gels. Lane 11, the reaction was deproteinized prior loading on the agarose gel. The hDMC1 K132R (panel II) and hDMC1 K132A (panel III) were analyzed as described for hDMC1 WT .

    Journal: DNA repair

    Article Title: Role of the conserved lysine within the Walker A motif of human DMC1

    doi: 10.1016/j.dnarep.2012.10.005

    Figure Lengend Snippet: DNA binding activity of wild type and Walker A variants of hDMC1. (panel I) hDMC1 WT (1.4 μM, lane 2; 2.8 μM, lane 3; 5.6 μM, lane 4; 11.2 μM, lanes 5–11) was incubated with ϕX174 (+) ssDNA DNA (ss) and linearized ϕX174 RF (I) dsDNA (ds) in the absence (lane 9) or presence of ATP (lanes 1–5 and 10) and nucleotide analogs (ATP-γ-S, lane 6; AMP–PNP, lane 7; and ADP, lane 8). The reaction products were analyzed on 1% agarose gels. Lane 11, the reaction was deproteinized prior loading on the agarose gel. The hDMC1 K132R (panel II) and hDMC1 K132A (panel III) were analyzed as described for hDMC1 WT .

    Article Snippet: The ϕX174 viral (+) strand (ssDNA) and ϕX174 replicative form I (dsDNA) was purchased from New England Biolabs.

    Techniques: Binding Assay, Activity Assay, Incubation, Agarose Gel Electrophoresis

    Nucleotide binding by wild type and Walker A variants of hDMC1. (A) hDMC1 WT (lane 2 and 5), hDMC1 K132R (lane 3 and 6) and hDMC1 K132A (lane 4 and 7) were incubated with [α- 32 ] ATP in the absence (lanes 1–4) or presence of ϕX174 (+) strand (ssDNA) (lanes 5–7) either in the absence (A) or presence of 2 mM Ca 2+ (B) or 4 mM Ca 2+ (C). The reaction products were subjected to dot filtration through a nylon membrane in a mini-fold apparatus followed by immediate washes with reaction buffer. The relative amount of bound nucleotide was quantified using a phosphorimager.

    Journal: DNA repair

    Article Title: Role of the conserved lysine within the Walker A motif of human DMC1

    doi: 10.1016/j.dnarep.2012.10.005

    Figure Lengend Snippet: Nucleotide binding by wild type and Walker A variants of hDMC1. (A) hDMC1 WT (lane 2 and 5), hDMC1 K132R (lane 3 and 6) and hDMC1 K132A (lane 4 and 7) were incubated with [α- 32 ] ATP in the absence (lanes 1–4) or presence of ϕX174 (+) strand (ssDNA) (lanes 5–7) either in the absence (A) or presence of 2 mM Ca 2+ (B) or 4 mM Ca 2+ (C). The reaction products were subjected to dot filtration through a nylon membrane in a mini-fold apparatus followed by immediate washes with reaction buffer. The relative amount of bound nucleotide was quantified using a phosphorimager.

    Article Snippet: The ϕX174 viral (+) strand (ssDNA) and ϕX174 replicative form I (dsDNA) was purchased from New England Biolabs.

    Techniques: Binding Assay, Incubation, Filtration

    GEMIN2 stimulates RAD51–DNA filament formation. ( A ) Polyacrylamide gel electrophoresis to examine the formation of the RAD51–DNA filament. RAD51 (4 µM) and GEMIN2 were incubated with 10 µM 49-mer ssDNA. DNA was visualized by SYBR Gold (Invitrogen) staining. The GEMIN2 concentrations were 0 µM (lane 2), 1 µM (lane 3), 2 µM (lane 4), 4 µM (lane 5) and 8 µM (lanes 6 and 7). Under these experimental conditions, 90% of the input ssDNA was estimated as being in the RAD51-bound fraction in the absence of the GEMIN2 protein. ( B ) Quantification of experiments shown in panel A. The amounts of complexes formed were estimated from the residual free DNA substrates, and unbound ssDNA fractions relative to lane 2 of panel A were plotted. Average values of three independent experiments are shown with standard deviation values. ( C ) Polyacrylamide gel electrophoresis, as in panel A. RAD51 (2 µM) and GEMIN2 were incubated with 6 µM 49-mer dsDNA. DNA was visualized by SYBR Gold (Invitrogen) staining. The GEMIN2 concentrations were 0 µM (lane 2), 0.5 µM (lane 3), 1 µM (lane 4), 2 µM (lane 5) and 4 µM (lanes 6 and 7). ( D ) Quantification of experiments shown in panel C. The amounts of complexes formed were estimated from the residual free DNA substrates, and unbound dsDNA fractions relative to lane 2 of panel C were plotted. Average values of three independent experiments are shown with standard deviation values. ( E ) Agarose gel electrophoresis to examine the formation of the RAD51-ssDNA filament. RAD51 was incubated in the presence or absence of the GEMIN2 protein, followed by addition of ϕX174 ssDNA (20 µM). DNA was visualized by ethidium bromide staining. ( F ) Agarose gel electrophoresis to examine the formation of the RAD51–dsDNA filament. RAD51 was incubated in the presence or absence of the GEMIN2 protein, followed by addition of linear ϕX174 dsDNA (10 µM). Results presented as in panel E. ( G ) Agarose gel electrophoresis to assess the complex formation between the RAD51-dsDNA filament and GEMIN2. GEMIN2 was labeled with Cy5 and dsDNA was stained with EtBr. Note that GEMIN2 facilitated the formation of the RAD51-dsDNA filament, but did not bind to the filament.

    Journal: Nucleic Acids Research

    Article Title: GEMIN2 promotes accumulation of RAD51 at double-strand breaks in homologous recombination

    doi: 10.1093/nar/gkq271

    Figure Lengend Snippet: GEMIN2 stimulates RAD51–DNA filament formation. ( A ) Polyacrylamide gel electrophoresis to examine the formation of the RAD51–DNA filament. RAD51 (4 µM) and GEMIN2 were incubated with 10 µM 49-mer ssDNA. DNA was visualized by SYBR Gold (Invitrogen) staining. The GEMIN2 concentrations were 0 µM (lane 2), 1 µM (lane 3), 2 µM (lane 4), 4 µM (lane 5) and 8 µM (lanes 6 and 7). Under these experimental conditions, 90% of the input ssDNA was estimated as being in the RAD51-bound fraction in the absence of the GEMIN2 protein. ( B ) Quantification of experiments shown in panel A. The amounts of complexes formed were estimated from the residual free DNA substrates, and unbound ssDNA fractions relative to lane 2 of panel A were plotted. Average values of three independent experiments are shown with standard deviation values. ( C ) Polyacrylamide gel electrophoresis, as in panel A. RAD51 (2 µM) and GEMIN2 were incubated with 6 µM 49-mer dsDNA. DNA was visualized by SYBR Gold (Invitrogen) staining. The GEMIN2 concentrations were 0 µM (lane 2), 0.5 µM (lane 3), 1 µM (lane 4), 2 µM (lane 5) and 4 µM (lanes 6 and 7). ( D ) Quantification of experiments shown in panel C. The amounts of complexes formed were estimated from the residual free DNA substrates, and unbound dsDNA fractions relative to lane 2 of panel C were plotted. Average values of three independent experiments are shown with standard deviation values. ( E ) Agarose gel electrophoresis to examine the formation of the RAD51-ssDNA filament. RAD51 was incubated in the presence or absence of the GEMIN2 protein, followed by addition of ϕX174 ssDNA (20 µM). DNA was visualized by ethidium bromide staining. ( F ) Agarose gel electrophoresis to examine the formation of the RAD51–dsDNA filament. RAD51 was incubated in the presence or absence of the GEMIN2 protein, followed by addition of linear ϕX174 dsDNA (10 µM). Results presented as in panel E. ( G ) Agarose gel electrophoresis to assess the complex formation between the RAD51-dsDNA filament and GEMIN2. GEMIN2 was labeled with Cy5 and dsDNA was stained with EtBr. Note that GEMIN2 facilitated the formation of the RAD51-dsDNA filament, but did not bind to the filament.

    Article Snippet: DNA substrates for in vitro reactions Single-stranded ϕX174 viral ( + ) strand DNA and double-stranded ϕX174 replicative form I DNA were purchased from New England Biolabs (Ipswich, MA, USA).

    Techniques: Polyacrylamide Gel Electrophoresis, Incubation, Staining, Standard Deviation, Agarose Gel Electrophoresis, Labeling

    GEMIN2 enhances the homologous-pairing and strand-exchange activities of RAD51. ( A ) GEMIN2 stimulates the RAD51-mediated homologous pairing. RAD51 and GEMIN2 were incubated at 37°C for 5 min. After this incubation, a 32 P-labeled 50-mer oligonucleotide (1 µM) was added, and the samples were further incubated at 37°C for 5 min. The reactions were then initiated by the addition of the pB5Sarray superhelical dsDNA (20 µM), and were continued at 37°C for 30 min. The reactions were stopped by the addition of SDS and proteinase K, and the deproteinized reaction products were separated by 1% agarose gel electrophoresis in 1× TAE buffer. The gels were dried, exposed to an imaging plate and visualized using an FLA-7000 imaging analyzer (Fujifilm, Tokyo, Japan). The reactions were conducted with 100 nM RAD51 in the presence of increasing amounts of GEMIN2. A schematic representation of the homologous pairing is presented on the top of the panel. ( B ) Graphic representation of the experiments shown in panel A. Amounts of D-loops relative to that of the RAD51 alone are plotted. The average values of three independent experiments are shown with the SD values. ( C ) Schematic representations of strand-exchange reactions. (i) The RAD51-ssDNA complexes are formed before the RPA addition. (ii) The RPA-ssDNA complexes are formed before the RAD51 addition. ( D ) Strand-exchange reactions where RPA was added to ϕX174 circular ssDNA (20 µM), after [lanes 1–4, panel C(i)] or before [lanes 5–8, panel C(ii)] incubation of the ssDNA with RAD51. Strand-exchange reactions were initiated by the addition of ϕX174 linear dsDNA (20 µM) and (NH 4 ) 2 SO 4 (100 mM), and incubated for 30 min. The deproteinized products of the reaction mixtures were separated using 1% agarose gel electrophoresis and were visualized by SYBR Gold (Invitrogen) staining. ( E ) GEMIN2 enhances strand exchange. ssDNA was incubated with RPA and then with RAD51 [panel C(ii)]. The indicated amounts of GEMIN2 were pre-incubated with RAD51, and subsequently added to the reaction mixture containing the ssDNA and RPA. ( F ) Quantification of panel E. The band intensities of the joint molecule (jm) products were quantified as the percentage of the entire input of the ssDNA and dsDNA molecules. Average values of three independent experiments are shown with standard deviation values.

    Journal: Nucleic Acids Research

    Article Title: GEMIN2 promotes accumulation of RAD51 at double-strand breaks in homologous recombination

    doi: 10.1093/nar/gkq271

    Figure Lengend Snippet: GEMIN2 enhances the homologous-pairing and strand-exchange activities of RAD51. ( A ) GEMIN2 stimulates the RAD51-mediated homologous pairing. RAD51 and GEMIN2 were incubated at 37°C for 5 min. After this incubation, a 32 P-labeled 50-mer oligonucleotide (1 µM) was added, and the samples were further incubated at 37°C for 5 min. The reactions were then initiated by the addition of the pB5Sarray superhelical dsDNA (20 µM), and were continued at 37°C for 30 min. The reactions were stopped by the addition of SDS and proteinase K, and the deproteinized reaction products were separated by 1% agarose gel electrophoresis in 1× TAE buffer. The gels were dried, exposed to an imaging plate and visualized using an FLA-7000 imaging analyzer (Fujifilm, Tokyo, Japan). The reactions were conducted with 100 nM RAD51 in the presence of increasing amounts of GEMIN2. A schematic representation of the homologous pairing is presented on the top of the panel. ( B ) Graphic representation of the experiments shown in panel A. Amounts of D-loops relative to that of the RAD51 alone are plotted. The average values of three independent experiments are shown with the SD values. ( C ) Schematic representations of strand-exchange reactions. (i) The RAD51-ssDNA complexes are formed before the RPA addition. (ii) The RPA-ssDNA complexes are formed before the RAD51 addition. ( D ) Strand-exchange reactions where RPA was added to ϕX174 circular ssDNA (20 µM), after [lanes 1–4, panel C(i)] or before [lanes 5–8, panel C(ii)] incubation of the ssDNA with RAD51. Strand-exchange reactions were initiated by the addition of ϕX174 linear dsDNA (20 µM) and (NH 4 ) 2 SO 4 (100 mM), and incubated for 30 min. The deproteinized products of the reaction mixtures were separated using 1% agarose gel electrophoresis and were visualized by SYBR Gold (Invitrogen) staining. ( E ) GEMIN2 enhances strand exchange. ssDNA was incubated with RPA and then with RAD51 [panel C(ii)]. The indicated amounts of GEMIN2 were pre-incubated with RAD51, and subsequently added to the reaction mixture containing the ssDNA and RPA. ( F ) Quantification of panel E. The band intensities of the joint molecule (jm) products were quantified as the percentage of the entire input of the ssDNA and dsDNA molecules. Average values of three independent experiments are shown with standard deviation values.

    Article Snippet: DNA substrates for in vitro reactions Single-stranded ϕX174 viral ( + ) strand DNA and double-stranded ϕX174 replicative form I DNA were purchased from New England Biolabs (Ipswich, MA, USA).

    Techniques: Incubation, Labeling, Agarose Gel Electrophoresis, Imaging, Recombinase Polymerase Amplification, Staining, Standard Deviation

    GEMIN2 stabilizes the RAD51–DNA filament. ( A ) Complex formation of RAD51 and dsDNA was evaluated by electrophoresis of unbound free DNA in agarose gel. Increased concentrations of competitor DNA were incubated with 2 µM of RAD51 in the presence or absence of 4 µM of GEMIN2, prior to the addition of ϕX174 dsDNA. ( B ) Quantification of results from panel A. The relative amounts of RAD51-unbound DNA are shown. Closed and open circles indicate experiments with and without GEMIN2. Average values and standard deviation were calculated from three independent experiments. ( C ) Complex formation of RAD51 and dsDNA in the presence of the BRC4 polypeptide. The experiments were done as described for panel A. ( D ) Quantification of the data from panel C. ( E ) Surface plasmon resonance analysis. The RAD51- or GEMIN2-conjugated sensor chips were used. Sensorgrams of RAD51-BRC4 and GEMIN2-BRC4 interactions are presented. The BRC4 polypeptide concentration was 10 µM. Time 0 of the horizontal axis indicates the initiation time of the peptide injection.

    Journal: Nucleic Acids Research

    Article Title: GEMIN2 promotes accumulation of RAD51 at double-strand breaks in homologous recombination

    doi: 10.1093/nar/gkq271

    Figure Lengend Snippet: GEMIN2 stabilizes the RAD51–DNA filament. ( A ) Complex formation of RAD51 and dsDNA was evaluated by electrophoresis of unbound free DNA in agarose gel. Increased concentrations of competitor DNA were incubated with 2 µM of RAD51 in the presence or absence of 4 µM of GEMIN2, prior to the addition of ϕX174 dsDNA. ( B ) Quantification of results from panel A. The relative amounts of RAD51-unbound DNA are shown. Closed and open circles indicate experiments with and without GEMIN2. Average values and standard deviation were calculated from three independent experiments. ( C ) Complex formation of RAD51 and dsDNA in the presence of the BRC4 polypeptide. The experiments were done as described for panel A. ( D ) Quantification of the data from panel C. ( E ) Surface plasmon resonance analysis. The RAD51- or GEMIN2-conjugated sensor chips were used. Sensorgrams of RAD51-BRC4 and GEMIN2-BRC4 interactions are presented. The BRC4 polypeptide concentration was 10 µM. Time 0 of the horizontal axis indicates the initiation time of the peptide injection.

    Article Snippet: DNA substrates for in vitro reactions Single-stranded ϕX174 viral ( + ) strand DNA and double-stranded ϕX174 replicative form I DNA were purchased from New England Biolabs (Ipswich, MA, USA).

    Techniques: Electrophoresis, Agarose Gel Electrophoresis, Incubation, Standard Deviation, SPR Assay, Concentration Assay, Injection

    Sgs1 can displace ssDNA annealed to ϕX174 ssDNA. A , a 32 P-labeled oligonucleotide (66 nucleotides) was annealed to ϕX174 ssDNA (1 n m molecules) to create the substrate that was used for helicase assays; products were analyzed by electrophoresis,

    Journal: The Journal of Biological Chemistry

    Article Title: The Full-length Saccharomyces cerevisiae Sgs1 Protein Is a Vigorous DNA Helicase That Preferentially Unwinds Holliday Junctions *

    doi: 10.1074/jbc.M109.083196

    Figure Lengend Snippet: Sgs1 can displace ssDNA annealed to ϕX174 ssDNA. A , a 32 P-labeled oligonucleotide (66 nucleotides) was annealed to ϕX174 ssDNA (1 n m molecules) to create the substrate that was used for helicase assays; products were analyzed by electrophoresis,

    Article Snippet: Substrates using ϕX174 DNA were prepared by annealing a 66-nt oligomer, PC63 (AGTGTTAACTTCTGCGTCATGGAAGCGATAAAACTCTGCAGGTTGGATACGCCAATCATTTTTATC), to ϕX174 virion ssDNA (New England Biolabs).

    Techniques: Labeling, Electrophoresis