ϕx174 replicative  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 81

    Structured Review

    New England Biolabs ϕx174 replicative
    BCCIPβ binds DNA. ( A ) BCCIPβ (0.24 μM, 0.47 μM, 0.96 μM, 1.8 μM, 2.8 μM and 4.7 μM; lanes 2–7, respectively) incubated with <t>ϕX174</t> (+) ssDNA (ss; 30 μM nucleotides). ( B ) BCCIPβ (0.24 μM, 0.47 μM, 0.96 μM, 1.8 μM, 2.8 μM and 4.7 μM; lanes 2–7, respectively) was incubated with ϕX174 RF (I) dsDNA (ds; 30 μM base pairs). The reaction products were separated on a 1.0% agarose gel, and were stained with ethidium bromide. Lane 1 contained no protein, and lane 8 was deproteinized with SDS and Proteinase K (S/P) prior to loading.
    ϕx174 Replicative, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 81/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ϕx174 replicative/product/New England Biolabs
    Average 81 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    ϕx174 replicative - by Bioz Stars, 2020-01
    81/100 stars

    Images

    1) Product Images from "The β-isoform of BCCIP promotes ADP release from the RAD51 presynaptic filament and enhances homologous DNA pairing"

    Article Title: The β-isoform of BCCIP promotes ADP release from the RAD51 presynaptic filament and enhances homologous DNA pairing

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkw877

    BCCIPβ binds DNA. ( A ) BCCIPβ (0.24 μM, 0.47 μM, 0.96 μM, 1.8 μM, 2.8 μM and 4.7 μM; lanes 2–7, respectively) incubated with ϕX174 (+) ssDNA (ss; 30 μM nucleotides). ( B ) BCCIPβ (0.24 μM, 0.47 μM, 0.96 μM, 1.8 μM, 2.8 μM and 4.7 μM; lanes 2–7, respectively) was incubated with ϕX174 RF (I) dsDNA (ds; 30 μM base pairs). The reaction products were separated on a 1.0% agarose gel, and were stained with ethidium bromide. Lane 1 contained no protein, and lane 8 was deproteinized with SDS and Proteinase K (S/P) prior to loading.
    Figure Legend Snippet: BCCIPβ binds DNA. ( A ) BCCIPβ (0.24 μM, 0.47 μM, 0.96 μM, 1.8 μM, 2.8 μM and 4.7 μM; lanes 2–7, respectively) incubated with ϕX174 (+) ssDNA (ss; 30 μM nucleotides). ( B ) BCCIPβ (0.24 μM, 0.47 μM, 0.96 μM, 1.8 μM, 2.8 μM and 4.7 μM; lanes 2–7, respectively) was incubated with ϕX174 RF (I) dsDNA (ds; 30 μM base pairs). The reaction products were separated on a 1.0% agarose gel, and were stained with ethidium bromide. Lane 1 contained no protein, and lane 8 was deproteinized with SDS and Proteinase K (S/P) prior to loading.

    Techniques Used: Incubation, Agarose Gel Electrophoresis, Staining

    Interaction with BCCIPβ induces conformational changes in RAD51. ( A ) RAD51 (5 μM) was incubated with trypsin (20 μg/ml) in the presence and absence of ATP (2 mM), ϕX174 ssDNA (30 μM nucleotides), calcium (1.8 mM) and BCCIPβ (10 μM), as indicated. The reactions were stopped with SDS and heat. The reaction products were resolved using SDS-PAGE followed by western blot analysis. Antibodies against RAD51 were used to develop the membrane. ( B ) The amounts of each band from undigested RAD51 and Fragments A, B, C and D were graphed based on the relative intensity of each band. Quantitation of the proteolytic fragmentation of RAD51 was determined from three independent experiments.
    Figure Legend Snippet: Interaction with BCCIPβ induces conformational changes in RAD51. ( A ) RAD51 (5 μM) was incubated with trypsin (20 μg/ml) in the presence and absence of ATP (2 mM), ϕX174 ssDNA (30 μM nucleotides), calcium (1.8 mM) and BCCIPβ (10 μM), as indicated. The reactions were stopped with SDS and heat. The reaction products were resolved using SDS-PAGE followed by western blot analysis. Antibodies against RAD51 were used to develop the membrane. ( B ) The amounts of each band from undigested RAD51 and Fragments A, B, C and D were graphed based on the relative intensity of each band. Quantitation of the proteolytic fragmentation of RAD51 was determined from three independent experiments.

    Techniques Used: Incubation, SDS Page, Western Blot, Quantitation Assay

    BCCIPβ stimulates RAD51 ATP hydrolysis and promotes ADP release. ( A ) RAD51 (0.5 μM) ATP hydrolysis assay in the presence or absence of ϕX174 ssDNA (60 μM nucleotides) and BCCIPβ (1 μM). ( B ) Time course analysis of RAD51 (0.5 μM) ATP hydrolysis in the presence of ϕX174 ssDNA (60 μM nucleotides), with or without BCCIPβ (1 μM). Error bars represent s.e.m. ( n = 3); P -value *
    Figure Legend Snippet: BCCIPβ stimulates RAD51 ATP hydrolysis and promotes ADP release. ( A ) RAD51 (0.5 μM) ATP hydrolysis assay in the presence or absence of ϕX174 ssDNA (60 μM nucleotides) and BCCIPβ (1 μM). ( B ) Time course analysis of RAD51 (0.5 μM) ATP hydrolysis in the presence of ϕX174 ssDNA (60 μM nucleotides), with or without BCCIPβ (1 μM). Error bars represent s.e.m. ( n = 3); P -value *

    Techniques Used: Hydrolysis Assay

    2) Product Images from "Characterization of the recombination activities of the Entamoeba histolytica Rad51 recombinase"

    Article Title: Characterization of the recombination activities of the Entamoeba histolytica Rad51 recombinase

    Journal:

    doi: 10.1016/j.molbiopara.2016.09.001

    eh Rad51 hydrolyzes ATP and binds DNA. (A) Purified recombinant eh Rad51 (0.5 μg) on a 12% SDS-polyacrylamide gel stained with Coomassie blue. (B) Time course analysis of eh Rad51 ATPase activity in the absence and presence of ϕX174 ssDNA or linearized ϕX174 dsDNA. (C) Increasing concentrations of eh Rad51 (lanes 2–6) were incubated with 32 P-labeled ssDNA, and were resolved on a 12% polyacrylamide gel. (D) Increasing concentrations of eh Rad51 (lanes 2–6) were incubated with 32 P-labeled dsDNA. The samples were resolved on a 12% polyacrylamide gel. The results for B, C and D were quantified using a phosphorimager and graphed. Lane 1 for C and D contained no protein, and lane 7 for C and D was treated with SDS/PK (S/P). Error bars represent SEM (n = 3).
    Figure Legend Snippet: eh Rad51 hydrolyzes ATP and binds DNA. (A) Purified recombinant eh Rad51 (0.5 μg) on a 12% SDS-polyacrylamide gel stained with Coomassie blue. (B) Time course analysis of eh Rad51 ATPase activity in the absence and presence of ϕX174 ssDNA or linearized ϕX174 dsDNA. (C) Increasing concentrations of eh Rad51 (lanes 2–6) were incubated with 32 P-labeled ssDNA, and were resolved on a 12% polyacrylamide gel. (D) Increasing concentrations of eh Rad51 (lanes 2–6) were incubated with 32 P-labeled dsDNA. The samples were resolved on a 12% polyacrylamide gel. The results for B, C and D were quantified using a phosphorimager and graphed. Lane 1 for C and D contained no protein, and lane 7 for C and D was treated with SDS/PK (S/P). Error bars represent SEM (n = 3).

    Techniques Used: Purification, Recombinant, Staining, Activity Assay, Incubation, Labeling

    3) Product Images from "Characterization of the recombination activities of the Entamoeba histolytica Rad51 recombinase"

    Article Title: Characterization of the recombination activities of the Entamoeba histolytica Rad51 recombinase

    Journal:

    doi: 10.1016/j.molbiopara.2016.09.001

    eh Rad51 hydrolyzes ATP and binds DNA. (A) Purified recombinant eh Rad51 (0.5 μg) on a 12% SDS-polyacrylamide gel stained with Coomassie blue. (B) Time course analysis of eh Rad51 ATPase activity in the absence and presence of ϕX174 ssDNA or linearized ϕX174 dsDNA. (C) Increasing concentrations of eh Rad51 (lanes 2–6) were incubated with 32 P-labeled ssDNA, and were resolved on a 12% polyacrylamide gel. (D) Increasing concentrations of eh Rad51 (lanes 2–6) were incubated with 32 P-labeled dsDNA. The samples were resolved on a 12% polyacrylamide gel. The results for B, C and D were quantified using a phosphorimager and graphed. Lane 1 for C and D contained no protein, and lane 7 for C and D was treated with SDS/PK (S/P). Error bars represent SEM (n = 3).
    Figure Legend Snippet: eh Rad51 hydrolyzes ATP and binds DNA. (A) Purified recombinant eh Rad51 (0.5 μg) on a 12% SDS-polyacrylamide gel stained with Coomassie blue. (B) Time course analysis of eh Rad51 ATPase activity in the absence and presence of ϕX174 ssDNA or linearized ϕX174 dsDNA. (C) Increasing concentrations of eh Rad51 (lanes 2–6) were incubated with 32 P-labeled ssDNA, and were resolved on a 12% polyacrylamide gel. (D) Increasing concentrations of eh Rad51 (lanes 2–6) were incubated with 32 P-labeled dsDNA. The samples were resolved on a 12% polyacrylamide gel. The results for B, C and D were quantified using a phosphorimager and graphed. Lane 1 for C and D contained no protein, and lane 7 for C and D was treated with SDS/PK (S/P). Error bars represent SEM (n = 3).

    Techniques Used: Purification, Recombinant, Staining, Activity Assay, Incubation, Labeling

    4) Product Images from "Regulation of Rad51 Recombinase Presynaptic Filament Assembly via Interactions with the Rad52 Mediator and the Srs2 Anti-recombinase"

    Article Title: Regulation of Rad51 Recombinase Presynaptic Filament Assembly via Interactions with the Rad52 Mediator and the Srs2 Anti-recombinase

    Journal:

    doi: 10.1074/jbc.M109.032953

    Homologous DNA pairing and strand exchange by rad51 mutants. A , scheme of the homologous DNA pairing and strand exchange reaction. Pairing between the circular ϕX174 (+) ssDNA and linear ϕX174 dsDNA yields a joint molecule ( jm ), which
    Figure Legend Snippet: Homologous DNA pairing and strand exchange by rad51 mutants. A , scheme of the homologous DNA pairing and strand exchange reaction. Pairing between the circular ϕX174 (+) ssDNA and linear ϕX174 dsDNA yields a joint molecule ( jm ), which

    Techniques Used:

    Related Articles

    Amplification:

    Article Title: The β-isoform of BCCIP promotes ADP release from the RAD51 presynaptic filament and enhances homologous DNA pairing
    Article Snippet: The amplified product was inserted into the bacterial expression plasmid pET11c (Novagen), and sequenced to ensure no undesired mutations occurred. .. All oligonucleotides were purchased from Integrated DNA Technologies. pBluescript was purified from E. coli using a Giga Kit (Qiagen). ϕX174 (+) virion ssDNA and ϕX174 replicative form I double-stranded DNA (dsDNA) were purchased from New England BioLabs—ϕX174 dsDNA was linearized with ApaLI (New England BioLabs).

    Purification:

    Article Title: The β-isoform of BCCIP promotes ADP release from the RAD51 presynaptic filament and enhances homologous DNA pairing
    Article Snippet: The oligonucleotide OL90 (5′-AAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTT) was radiolabeled using T4 polynucleotide kinase and [32P-γ]-ATP as described ( ). .. All oligonucleotides were purchased from Integrated DNA Technologies. pBluescript was purified from E. coli using a Giga Kit (Qiagen). ϕX174 (+) virion ssDNA and ϕX174 replicative form I double-stranded DNA (dsDNA) were purchased from New England BioLabs—ϕX174 dsDNA was linearized with ApaLI (New England BioLabs). .. The BCCIPβ-(HIS)6 pET11c expression plasmid was transformed into the E. coli strain BL21(DE3).

    Article Title: Characterization of the recombination activities of the Entamoeba histolytica Rad51 recombinase
    Article Snippet: OL90 (ssDNA) was used in the nuclease protection assay and D-loop assay. .. All oligonucleotides indicated as radiolabeled were done so using T4 polynucleotide kinase and [32 P-γ]-ATP as described [ ]. ϕX174 (+) virion ssDNA and ϕX174 replicative form I dsDNA were purchased from New England BioLabs; the ϕX174 replicative form I dsDNA was linearized with Apa LI (New England BioLabs). pBluescript was purified from E. coli using a Plasmid Giga kit (Qiagen). .. 4,4′-diisothiocyanostilbene-2,2′-disulfonic acid, DIDS was purchased from Sigma-Aldrich. ( E )-2-(2-(pyridin-3-yl)vinyl)quinazolin-4(3H)-one, B02 was purchased from Ryan Scientific Inc. [ ].

    DNA Binding Assay:

    Article Title: Characterization of the recombination activities of the Entamoeba histolytica Rad51 recombinase
    Article Snippet: H3c was annealed to H3 for dsDNA in the DNA binding assay. .. All oligonucleotides indicated as radiolabeled were done so using T4 polynucleotide kinase and [32 P-γ]-ATP as described [ ]. ϕX174 (+) virion ssDNA and ϕX174 replicative form I dsDNA were purchased from New England BioLabs; the ϕX174 replicative form I dsDNA was linearized with Apa LI (New England BioLabs). pBluescript was purified from E. coli using a Plasmid Giga kit (Qiagen).

    Mobility Shift:

    Article Title: Regulation of Rad51 Recombinase Presynaptic Filament Assembly via Interactions with the Rad52 Mediator and the Srs2 Anti-recombinase
    Article Snippet: The ϕX174 replicative form I DNA and viral (+) strand DNA were purchased from New England Biolabs. .. The ϕX174 replicative form I DNA and viral (+) strand DNA were purchased from New England Biolabs.

    Expressing:

    Article Title: The β-isoform of BCCIP promotes ADP release from the RAD51 presynaptic filament and enhances homologous DNA pairing
    Article Snippet: The amplified product was inserted into the bacterial expression plasmid pET11c (Novagen), and sequenced to ensure no undesired mutations occurred. .. All oligonucleotides were purchased from Integrated DNA Technologies. pBluescript was purified from E. coli using a Giga Kit (Qiagen). ϕX174 (+) virion ssDNA and ϕX174 replicative form I double-stranded DNA (dsDNA) were purchased from New England BioLabs—ϕX174 dsDNA was linearized with ApaLI (New England BioLabs).

    Polymerase Chain Reaction:

    Article Title: The β-isoform of BCCIP promotes ADP release from the RAD51 presynaptic filament and enhances homologous DNA pairing
    Article Snippet: A (HIS)6 tag was added to the 3′ end of BCCIPβ via PCR using the forward primer 5′-GGGAATCCCATATGGCGTCCAGGTCTAAGCGGCGTG and reverse primer 5′-CCCATATGGAATTCTTAATGATGATGATGATGATGAGGACCACCGACAGATAGATATTCTTTCAGTTTATCCATG. .. All oligonucleotides were purchased from Integrated DNA Technologies. pBluescript was purified from E. coli using a Giga Kit (Qiagen). ϕX174 (+) virion ssDNA and ϕX174 replicative form I double-stranded DNA (dsDNA) were purchased from New England BioLabs—ϕX174 dsDNA was linearized with ApaLI (New England BioLabs).

    Plasmid Preparation:

    Article Title: The β-isoform of BCCIP promotes ADP release from the RAD51 presynaptic filament and enhances homologous DNA pairing
    Article Snippet: The amplified product was inserted into the bacterial expression plasmid pET11c (Novagen), and sequenced to ensure no undesired mutations occurred. .. All oligonucleotides were purchased from Integrated DNA Technologies. pBluescript was purified from E. coli using a Giga Kit (Qiagen). ϕX174 (+) virion ssDNA and ϕX174 replicative form I double-stranded DNA (dsDNA) were purchased from New England BioLabs—ϕX174 dsDNA was linearized with ApaLI (New England BioLabs).

    Article Title: Characterization of the recombination activities of the Entamoeba histolytica Rad51 recombinase
    Article Snippet: OL90 (ssDNA) was used in the nuclease protection assay and D-loop assay. .. All oligonucleotides indicated as radiolabeled were done so using T4 polynucleotide kinase and [32 P-γ]-ATP as described [ ]. ϕX174 (+) virion ssDNA and ϕX174 replicative form I dsDNA were purchased from New England BioLabs; the ϕX174 replicative form I dsDNA was linearized with Apa LI (New England BioLabs). pBluescript was purified from E. coli using a Plasmid Giga kit (Qiagen). .. 4,4′-diisothiocyanostilbene-2,2′-disulfonic acid, DIDS was purchased from Sigma-Aldrich. ( E )-2-(2-(pyridin-3-yl)vinyl)quinazolin-4(3H)-one, B02 was purchased from Ryan Scientific Inc. [ ].

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 81
    New England Biolabs ϕx174 replicative
    BCCIPβ binds DNA. ( A ) BCCIPβ (0.24 μM, 0.47 μM, 0.96 μM, 1.8 μM, 2.8 μM and 4.7 μM; lanes 2–7, respectively) incubated with <t>ϕX174</t> (+) ssDNA (ss; 30 μM nucleotides). ( B ) BCCIPβ (0.24 μM, 0.47 μM, 0.96 μM, 1.8 μM, 2.8 μM and 4.7 μM; lanes 2–7, respectively) was incubated with ϕX174 RF (I) dsDNA (ds; 30 μM base pairs). The reaction products were separated on a 1.0% agarose gel, and were stained with ethidium bromide. Lane 1 contained no protein, and lane 8 was deproteinized with SDS and Proteinase K (S/P) prior to loading.
    ϕx174 Replicative, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 81/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ϕx174 replicative/product/New England Biolabs
    Average 81 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    ϕx174 replicative - by Bioz Stars, 2020-01
    81/100 stars
      Buy from Supplier

    Image Search Results


    BCCIPβ binds DNA. ( A ) BCCIPβ (0.24 μM, 0.47 μM, 0.96 μM, 1.8 μM, 2.8 μM and 4.7 μM; lanes 2–7, respectively) incubated with ϕX174 (+) ssDNA (ss; 30 μM nucleotides). ( B ) BCCIPβ (0.24 μM, 0.47 μM, 0.96 μM, 1.8 μM, 2.8 μM and 4.7 μM; lanes 2–7, respectively) was incubated with ϕX174 RF (I) dsDNA (ds; 30 μM base pairs). The reaction products were separated on a 1.0% agarose gel, and were stained with ethidium bromide. Lane 1 contained no protein, and lane 8 was deproteinized with SDS and Proteinase K (S/P) prior to loading.

    Journal: Nucleic Acids Research

    Article Title: The β-isoform of BCCIP promotes ADP release from the RAD51 presynaptic filament and enhances homologous DNA pairing

    doi: 10.1093/nar/gkw877

    Figure Lengend Snippet: BCCIPβ binds DNA. ( A ) BCCIPβ (0.24 μM, 0.47 μM, 0.96 μM, 1.8 μM, 2.8 μM and 4.7 μM; lanes 2–7, respectively) incubated with ϕX174 (+) ssDNA (ss; 30 μM nucleotides). ( B ) BCCIPβ (0.24 μM, 0.47 μM, 0.96 μM, 1.8 μM, 2.8 μM and 4.7 μM; lanes 2–7, respectively) was incubated with ϕX174 RF (I) dsDNA (ds; 30 μM base pairs). The reaction products were separated on a 1.0% agarose gel, and were stained with ethidium bromide. Lane 1 contained no protein, and lane 8 was deproteinized with SDS and Proteinase K (S/P) prior to loading.

    Article Snippet: All oligonucleotides were purchased from Integrated DNA Technologies. pBluescript was purified from E. coli using a Giga Kit (Qiagen). ϕX174 (+) virion ssDNA and ϕX174 replicative form I double-stranded DNA (dsDNA) were purchased from New England BioLabs—ϕX174 dsDNA was linearized with ApaLI (New England BioLabs).

    Techniques: Incubation, Agarose Gel Electrophoresis, Staining

    Interaction with BCCIPβ induces conformational changes in RAD51. ( A ) RAD51 (5 μM) was incubated with trypsin (20 μg/ml) in the presence and absence of ATP (2 mM), ϕX174 ssDNA (30 μM nucleotides), calcium (1.8 mM) and BCCIPβ (10 μM), as indicated. The reactions were stopped with SDS and heat. The reaction products were resolved using SDS-PAGE followed by western blot analysis. Antibodies against RAD51 were used to develop the membrane. ( B ) The amounts of each band from undigested RAD51 and Fragments A, B, C and D were graphed based on the relative intensity of each band. Quantitation of the proteolytic fragmentation of RAD51 was determined from three independent experiments.

    Journal: Nucleic Acids Research

    Article Title: The β-isoform of BCCIP promotes ADP release from the RAD51 presynaptic filament and enhances homologous DNA pairing

    doi: 10.1093/nar/gkw877

    Figure Lengend Snippet: Interaction with BCCIPβ induces conformational changes in RAD51. ( A ) RAD51 (5 μM) was incubated with trypsin (20 μg/ml) in the presence and absence of ATP (2 mM), ϕX174 ssDNA (30 μM nucleotides), calcium (1.8 mM) and BCCIPβ (10 μM), as indicated. The reactions were stopped with SDS and heat. The reaction products were resolved using SDS-PAGE followed by western blot analysis. Antibodies against RAD51 were used to develop the membrane. ( B ) The amounts of each band from undigested RAD51 and Fragments A, B, C and D were graphed based on the relative intensity of each band. Quantitation of the proteolytic fragmentation of RAD51 was determined from three independent experiments.

    Article Snippet: All oligonucleotides were purchased from Integrated DNA Technologies. pBluescript was purified from E. coli using a Giga Kit (Qiagen). ϕX174 (+) virion ssDNA and ϕX174 replicative form I double-stranded DNA (dsDNA) were purchased from New England BioLabs—ϕX174 dsDNA was linearized with ApaLI (New England BioLabs).

    Techniques: Incubation, SDS Page, Western Blot, Quantitation Assay

    BCCIPβ stimulates RAD51 ATP hydrolysis and promotes ADP release. ( A ) RAD51 (0.5 μM) ATP hydrolysis assay in the presence or absence of ϕX174 ssDNA (60 μM nucleotides) and BCCIPβ (1 μM). ( B ) Time course analysis of RAD51 (0.5 μM) ATP hydrolysis in the presence of ϕX174 ssDNA (60 μM nucleotides), with or without BCCIPβ (1 μM). Error bars represent s.e.m. ( n = 3); P -value *

    Journal: Nucleic Acids Research

    Article Title: The β-isoform of BCCIP promotes ADP release from the RAD51 presynaptic filament and enhances homologous DNA pairing

    doi: 10.1093/nar/gkw877

    Figure Lengend Snippet: BCCIPβ stimulates RAD51 ATP hydrolysis and promotes ADP release. ( A ) RAD51 (0.5 μM) ATP hydrolysis assay in the presence or absence of ϕX174 ssDNA (60 μM nucleotides) and BCCIPβ (1 μM). ( B ) Time course analysis of RAD51 (0.5 μM) ATP hydrolysis in the presence of ϕX174 ssDNA (60 μM nucleotides), with or without BCCIPβ (1 μM). Error bars represent s.e.m. ( n = 3); P -value *

    Article Snippet: All oligonucleotides were purchased from Integrated DNA Technologies. pBluescript was purified from E. coli using a Giga Kit (Qiagen). ϕX174 (+) virion ssDNA and ϕX174 replicative form I double-stranded DNA (dsDNA) were purchased from New England BioLabs—ϕX174 dsDNA was linearized with ApaLI (New England BioLabs).

    Techniques: Hydrolysis Assay

    eh Rad51 hydrolyzes ATP and binds DNA. (A) Purified recombinant eh Rad51 (0.5 μg) on a 12% SDS-polyacrylamide gel stained with Coomassie blue. (B) Time course analysis of eh Rad51 ATPase activity in the absence and presence of ϕX174 ssDNA or linearized ϕX174 dsDNA. (C) Increasing concentrations of eh Rad51 (lanes 2–6) were incubated with 32 P-labeled ssDNA, and were resolved on a 12% polyacrylamide gel. (D) Increasing concentrations of eh Rad51 (lanes 2–6) were incubated with 32 P-labeled dsDNA. The samples were resolved on a 12% polyacrylamide gel. The results for B, C and D were quantified using a phosphorimager and graphed. Lane 1 for C and D contained no protein, and lane 7 for C and D was treated with SDS/PK (S/P). Error bars represent SEM (n = 3).

    Journal:

    Article Title: Characterization of the recombination activities of the Entamoeba histolytica Rad51 recombinase

    doi: 10.1016/j.molbiopara.2016.09.001

    Figure Lengend Snippet: eh Rad51 hydrolyzes ATP and binds DNA. (A) Purified recombinant eh Rad51 (0.5 μg) on a 12% SDS-polyacrylamide gel stained with Coomassie blue. (B) Time course analysis of eh Rad51 ATPase activity in the absence and presence of ϕX174 ssDNA or linearized ϕX174 dsDNA. (C) Increasing concentrations of eh Rad51 (lanes 2–6) were incubated with 32 P-labeled ssDNA, and were resolved on a 12% polyacrylamide gel. (D) Increasing concentrations of eh Rad51 (lanes 2–6) were incubated with 32 P-labeled dsDNA. The samples were resolved on a 12% polyacrylamide gel. The results for B, C and D were quantified using a phosphorimager and graphed. Lane 1 for C and D contained no protein, and lane 7 for C and D was treated with SDS/PK (S/P). Error bars represent SEM (n = 3).

    Article Snippet: All oligonucleotides indicated as radiolabeled were done so using T4 polynucleotide kinase and [32 P-γ]-ATP as described [ ]. ϕX174 (+) virion ssDNA and ϕX174 replicative form I dsDNA were purchased from New England BioLabs; the ϕX174 replicative form I dsDNA was linearized with Apa LI (New England BioLabs). pBluescript was purified from E. coli using a Plasmid Giga kit (Qiagen).

    Techniques: Purification, Recombinant, Staining, Activity Assay, Incubation, Labeling

    Homologous DNA pairing and strand exchange by rad51 mutants. A , scheme of the homologous DNA pairing and strand exchange reaction. Pairing between the circular ϕX174 (+) ssDNA and linear ϕX174 dsDNA yields a joint molecule ( jm ), which

    Journal:

    Article Title: Regulation of Rad51 Recombinase Presynaptic Filament Assembly via Interactions with the Rad52 Mediator and the Srs2 Anti-recombinase

    doi: 10.1074/jbc.M109.032953

    Figure Lengend Snippet: Homologous DNA pairing and strand exchange by rad51 mutants. A , scheme of the homologous DNA pairing and strand exchange reaction. Pairing between the circular ϕX174 (+) ssDNA and linear ϕX174 dsDNA yields a joint molecule ( jm ), which

    Article Snippet: The ϕX174 replicative form I DNA and viral (+) strand DNA were purchased from New England Biolabs.

    Techniques: