ϕx174 virion ssdna  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Name:
    PhiX174 Virion DNA
    Description:
    PhiX174 Virion DNA 250 ug
    Catalog Number:
    n3023l
    Price:
    320
    Size:
    250 ug
    Category:
    Genomic DNA
    Buy from Supplier


    Structured Review

    New England Biolabs ϕx174 virion ssdna
    PhiX174 Virion DNA
    PhiX174 Virion DNA 250 ug
    https://www.bioz.com/result/ϕx174 virion ssdna/product/New England Biolabs
    Average 93 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    ϕx174 virion ssdna - by Bioz Stars, 2020-07
    93/100 stars

    Images

    1) Product Images from "Expression, Purification and Biochemical Evaluation of Human RAD51 Protein"

    Article Title: Expression, Purification and Biochemical Evaluation of Human RAD51 Protein

    Journal: Methods in enzymology

    doi: 10.1016/bs.mie.2017.11.011

    Three Strand Exchange Recombinase Assay A Active RAD51 nucleoprotein filament is formed on ϕX174 Virion circular ssDNA in reaction conditions permitting ATP hydrolysis followed by addition of RPA which helps remove secondary structures in the ssDNA allowing stable nucleoprotein filament formation. The RAD51 nucleoprotein then invades ϕX174 RFI linear dsDNA to form nicked circular dsDNA products through several joint-molecule intermediates showing various stages of branch migration. The RPA also helps sequester any free displaced ssDNA following strand exchange thereby preventing a reverse reaction. B . Typical agarose gel image from a strand exchange assay used to resolve the substrates, intermediates and the products of the reaction over a time course of 0, 30, 60, 120 and 180 minutes. In reactions containing the wild type protein, nicked circular products can be observed as early as 30 minutes. C. Quantitation of the strand exchange assay gel showing appearance of nicked circular products (black) and joint molecules (blue) on the left Y axis. Disappearance of the linear dsDNA substrate (red) is quantitated on the right Y axis. Time in minutes is indicated on the X axis.
    Figure Legend Snippet: Three Strand Exchange Recombinase Assay A Active RAD51 nucleoprotein filament is formed on ϕX174 Virion circular ssDNA in reaction conditions permitting ATP hydrolysis followed by addition of RPA which helps remove secondary structures in the ssDNA allowing stable nucleoprotein filament formation. The RAD51 nucleoprotein then invades ϕX174 RFI linear dsDNA to form nicked circular dsDNA products through several joint-molecule intermediates showing various stages of branch migration. The RPA also helps sequester any free displaced ssDNA following strand exchange thereby preventing a reverse reaction. B . Typical agarose gel image from a strand exchange assay used to resolve the substrates, intermediates and the products of the reaction over a time course of 0, 30, 60, 120 and 180 minutes. In reactions containing the wild type protein, nicked circular products can be observed as early as 30 minutes. C. Quantitation of the strand exchange assay gel showing appearance of nicked circular products (black) and joint molecules (blue) on the left Y axis. Disappearance of the linear dsDNA substrate (red) is quantitated on the right Y axis. Time in minutes is indicated on the X axis.

    Techniques Used: Recombinase Polymerase Amplification, Migration, Agarose Gel Electrophoresis, Quantitation Assay

    2) Product Images from "The β-isoform of BCCIP promotes ADP release from the RAD51 presynaptic filament and enhances homologous DNA pairing"

    Article Title: The β-isoform of BCCIP promotes ADP release from the RAD51 presynaptic filament and enhances homologous DNA pairing

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkw877

    BCCIPβ binds DNA. ( A ) BCCIPβ (0.24 μM, 0.47 μM, 0.96 μM, 1.8 μM, 2.8 μM and 4.7 μM; lanes 2–7, respectively) incubated with ϕX174 (+) ssDNA (ss; 30 μM nucleotides). ( B ) BCCIPβ (0.24 μM, 0.47 μM, 0.96 μM, 1.8 μM, 2.8 μM and 4.7 μM; lanes 2–7, respectively) was incubated with ϕX174 RF (I) dsDNA (ds; 30 μM base pairs). The reaction products were separated on a 1.0% agarose gel, and were stained with ethidium bromide. Lane 1 contained no protein, and lane 8 was deproteinized with SDS and Proteinase K (S/P) prior to loading.
    Figure Legend Snippet: BCCIPβ binds DNA. ( A ) BCCIPβ (0.24 μM, 0.47 μM, 0.96 μM, 1.8 μM, 2.8 μM and 4.7 μM; lanes 2–7, respectively) incubated with ϕX174 (+) ssDNA (ss; 30 μM nucleotides). ( B ) BCCIPβ (0.24 μM, 0.47 μM, 0.96 μM, 1.8 μM, 2.8 μM and 4.7 μM; lanes 2–7, respectively) was incubated with ϕX174 RF (I) dsDNA (ds; 30 μM base pairs). The reaction products were separated on a 1.0% agarose gel, and were stained with ethidium bromide. Lane 1 contained no protein, and lane 8 was deproteinized with SDS and Proteinase K (S/P) prior to loading.

    Techniques Used: Incubation, Agarose Gel Electrophoresis, Staining

    Interaction with BCCIPβ induces conformational changes in RAD51. ( A ) RAD51 (5 μM) was incubated with trypsin (20 μg/ml) in the presence and absence of ATP (2 mM), ϕX174 ssDNA (30 μM nucleotides), calcium (1.8 mM) and BCCIPβ (10 μM), as indicated. The reactions were stopped with SDS and heat. The reaction products were resolved using SDS-PAGE followed by western blot analysis. Antibodies against RAD51 were used to develop the membrane. ( B ) The amounts of each band from undigested RAD51 and Fragments A, B, C and D were graphed based on the relative intensity of each band. Quantitation of the proteolytic fragmentation of RAD51 was determined from three independent experiments.
    Figure Legend Snippet: Interaction with BCCIPβ induces conformational changes in RAD51. ( A ) RAD51 (5 μM) was incubated with trypsin (20 μg/ml) in the presence and absence of ATP (2 mM), ϕX174 ssDNA (30 μM nucleotides), calcium (1.8 mM) and BCCIPβ (10 μM), as indicated. The reactions were stopped with SDS and heat. The reaction products were resolved using SDS-PAGE followed by western blot analysis. Antibodies against RAD51 were used to develop the membrane. ( B ) The amounts of each band from undigested RAD51 and Fragments A, B, C and D were graphed based on the relative intensity of each band. Quantitation of the proteolytic fragmentation of RAD51 was determined from three independent experiments.

    Techniques Used: Incubation, SDS Page, Western Blot, Quantitation Assay

    BCCIPβ stimulates RAD51 ATP hydrolysis and promotes ADP release. ( A ) RAD51 (0.5 μM) ATP hydrolysis assay in the presence or absence of ϕX174 ssDNA (60 μM nucleotides) and BCCIPβ (1 μM). ( B ) Time course analysis of RAD51 (0.5 μM) ATP hydrolysis in the presence of ϕX174 ssDNA (60 μM nucleotides), with or without BCCIPβ (1 μM). Error bars represent s.e.m. ( n = 3); P -value *
    Figure Legend Snippet: BCCIPβ stimulates RAD51 ATP hydrolysis and promotes ADP release. ( A ) RAD51 (0.5 μM) ATP hydrolysis assay in the presence or absence of ϕX174 ssDNA (60 μM nucleotides) and BCCIPβ (1 μM). ( B ) Time course analysis of RAD51 (0.5 μM) ATP hydrolysis in the presence of ϕX174 ssDNA (60 μM nucleotides), with or without BCCIPβ (1 μM). Error bars represent s.e.m. ( n = 3); P -value *

    Techniques Used: Hydrolysis Assay

    3) Product Images from "Characterization of the recombination activities of the Entamoeba histolytica Rad51 recombinase"

    Article Title: Characterization of the recombination activities of the Entamoeba histolytica Rad51 recombinase

    Journal: Molecular and biochemical parasitology

    doi: 10.1016/j.molbiopara.2016.09.001

    DIDS disrupts the DNA binding activity of eh Rad51. (A) Time course analysis of eh Rad51 ATPase activity in the presence or absence of DIDS (67 μM), with and without ϕX174 ssDNA or linearized ϕX174 dsDNA. Reactions were stopped with the addition of EDTA at the indicated times prior to separation with thin-layer chromatography and phosphorimager analysis. (B) eh Rad51 (7 μM) incubated with 32 P-radiolabeled ssDNA and increasing amounts of DIDS (5 μM, 10 μM, 15 μM, 20 μM, 30 μM, 40 μM; lanes 3–8 respectively). Lane 1 contained no protein or DIDS. Lane 2 contained no DIDS. Lane 9 contained 40 μM DIDS without eh Rad51. (C) eh Rad51 (35 μM) incubated with the 32 P-radiolabled dsDNA and increasing concentrations of DIDS (20 μM, 40 μM, 80 μM, 100 μM, 150 μM, 200 μM; lanes 3–8 respectively). Lane 1 lacked protein and DIDS, lane 2 contained no DIDS and lane 9 contained 200 μM DIDS and no protein. (D) eh Rad51 (7 μM) was incubated with radiolabeled ssDNA in the absence (lane 3) and presence of increasing concentrations of DIDS (5 μM, 10 μM, 15 μM, 20 μM, 30 μM, and 40 μM; lanes 4–9) prior to the addition of DNase I. The reaction were deproteinized, and the products were separated using non-denaturing PAGE. Lane 1 contained radiolabeled ssDNA alone, lane 2 contained DNase with radiolabeled ssDNA, and lane 10 contained radiolabeled ssDNA in the presence of 40 μM DIDS and DNase I. Error bars represent SEM (n = 3).
    Figure Legend Snippet: DIDS disrupts the DNA binding activity of eh Rad51. (A) Time course analysis of eh Rad51 ATPase activity in the presence or absence of DIDS (67 μM), with and without ϕX174 ssDNA or linearized ϕX174 dsDNA. Reactions were stopped with the addition of EDTA at the indicated times prior to separation with thin-layer chromatography and phosphorimager analysis. (B) eh Rad51 (7 μM) incubated with 32 P-radiolabeled ssDNA and increasing amounts of DIDS (5 μM, 10 μM, 15 μM, 20 μM, 30 μM, 40 μM; lanes 3–8 respectively). Lane 1 contained no protein or DIDS. Lane 2 contained no DIDS. Lane 9 contained 40 μM DIDS without eh Rad51. (C) eh Rad51 (35 μM) incubated with the 32 P-radiolabled dsDNA and increasing concentrations of DIDS (20 μM, 40 μM, 80 μM, 100 μM, 150 μM, 200 μM; lanes 3–8 respectively). Lane 1 lacked protein and DIDS, lane 2 contained no DIDS and lane 9 contained 200 μM DIDS and no protein. (D) eh Rad51 (7 μM) was incubated with radiolabeled ssDNA in the absence (lane 3) and presence of increasing concentrations of DIDS (5 μM, 10 μM, 15 μM, 20 μM, 30 μM, and 40 μM; lanes 4–9) prior to the addition of DNase I. The reaction were deproteinized, and the products were separated using non-denaturing PAGE. Lane 1 contained radiolabeled ssDNA alone, lane 2 contained DNase with radiolabeled ssDNA, and lane 10 contained radiolabeled ssDNA in the presence of 40 μM DIDS and DNase I. Error bars represent SEM (n = 3).

    Techniques Used: Binding Assay, Activity Assay, Thin Layer Chromatography, Incubation, Polyacrylamide Gel Electrophoresis

    eh Rad51 hydrolyzes ATP and binds DNA. (A) Purified recombinant eh Rad51 (0.5 μg) on a 12% SDS-polyacrylamide gel stained with Coomassie blue. (B) Time course analysis of eh Rad51 ATPase activity in the absence and presence of ϕX174 ssDNA or linearized ϕX174 dsDNA. (C) Increasing concentrations of eh Rad51 (lanes 2–6) were incubated with 32 P-labeled ssDNA, and were resolved on a 12% polyacrylamide gel. (D) Increasing concentrations of eh Rad51 (lanes 2–6) were incubated with 32 P-labeled dsDNA. The samples were resolved on a 12% polyacrylamide gel. The results for B, C and D were quantified using a phosphorimager and graphed. Lane 1 for C and D contained no protein, and lane 7 for C and D was treated with SDS/PK (S/P). Error bars represent SEM (n = 3).
    Figure Legend Snippet: eh Rad51 hydrolyzes ATP and binds DNA. (A) Purified recombinant eh Rad51 (0.5 μg) on a 12% SDS-polyacrylamide gel stained with Coomassie blue. (B) Time course analysis of eh Rad51 ATPase activity in the absence and presence of ϕX174 ssDNA or linearized ϕX174 dsDNA. (C) Increasing concentrations of eh Rad51 (lanes 2–6) were incubated with 32 P-labeled ssDNA, and were resolved on a 12% polyacrylamide gel. (D) Increasing concentrations of eh Rad51 (lanes 2–6) were incubated with 32 P-labeled dsDNA. The samples were resolved on a 12% polyacrylamide gel. The results for B, C and D were quantified using a phosphorimager and graphed. Lane 1 for C and D contained no protein, and lane 7 for C and D was treated with SDS/PK (S/P). Error bars represent SEM (n = 3).

    Techniques Used: Purification, Recombinant, Staining, Activity Assay, Incubation, Labeling

    eh Rad51 facilitates plasmid length homologous DNA pairing and DNA strand exchange. (A) Schematic of plasmid length strand exchange assay. Css, circular ssDNA; lds, linearized dsDNA; jm, joint-molecule; nc, nicked-circular; lss, linearized ssDNA. (B) Increasing concentrations of eh Rad51 (lanes 2–8) were incubated with circular ϕX174 ssDNA (css). The reaction was initiated with the introduction of linearized ϕX174 dsDNA (lds) and was deproteinized after 90 min. Reaction products were resolved on an agarose gel and stained with ethidium bromide. Lane 1 contained no protein. (C) The percent product of nicked-circular and total product (jm + nc) were graphed.
    Figure Legend Snippet: eh Rad51 facilitates plasmid length homologous DNA pairing and DNA strand exchange. (A) Schematic of plasmid length strand exchange assay. Css, circular ssDNA; lds, linearized dsDNA; jm, joint-molecule; nc, nicked-circular; lss, linearized ssDNA. (B) Increasing concentrations of eh Rad51 (lanes 2–8) were incubated with circular ϕX174 ssDNA (css). The reaction was initiated with the introduction of linearized ϕX174 dsDNA (lds) and was deproteinized after 90 min. Reaction products were resolved on an agarose gel and stained with ethidium bromide. Lane 1 contained no protein. (C) The percent product of nicked-circular and total product (jm + nc) were graphed.

    Techniques Used: Plasmid Preparation, Incubation, Agarose Gel Electrophoresis, Staining

    Related Articles

    Ethanol Precipitation:

    Article Title: Distinct and redundant functions of three homologs of RNase III in the cyanobacterium Synechococcus sp. strain PCC 7002
    Article Snippet: .. A linear DNA spike-in was made by amplifying ΦX174 Virion DNA (NEB, N3023S) with primer JCC425 and primer JCC426 and purifying the product via ethanol precipitation. .. The spike-in was added immediately after addition of the TE (with lysozyme) to the frozen cell pellets at a concentration of 10 copies per cell.

    Labeling:

    Article Title: Proteolysis of Xenopus Cip-type CDK inhibitor, p16Xic2, is regulated by PCNA binding and CDK2 phosphorylation
    Article Snippet: .. Proteins labeled with 35 S-methionine were added to extracts at a final dilution of 1:15 in the presence or absence of 10 ng/ul demembranated XSC or ΦX174 single-stranded DNA (New England Biolab, N3023S). .. The reactions were analyzed by PhosphorImager and quantitation was performed using ImageQuant™ software (Molecular Dynamics).

    Purification:

    Article Title: Metagenomic Assay for Identification of Microbial Pathogens in Tumor Tissues
    Article Snippet: .. Purified phiX174 virion DNA was purchased from New England Biolabs (N3023S; Ipswich, MA, USA), total DNA from human MRC-5 cells infected with cytomegalovirus (human herpesvirus 5 strain AD169) was ATCC VR-538D, total DNA from human A549 cells infected with adenovirus type 5 (HAdV-5 strain Adenoid 75) was ATCC VR-5D, and total RNA from human HEp-2 cells infected with respiratory syncytial virus (HRSV strain Long) was ATCC VR-26D, all purchased from ATCC (Manassas, VA, USA). .. Plasmid minipreps were prepared from pBR322 subclones carrying JC or BK polyomavirus genomes (J. C. Alwine, University of Pennsylvania, Philadelphia, PA) and from pUC19 carrying the human papillomavirus 16 (HPV16) genome (obtained from Peter Howley, Harvard Medical School, Boston, MA).

    Polymerase Chain Reaction:

    Article Title: Ctp1 protein–DNA filaments promote DNA bridging and DNA double-strand break repair
    Article Snippet: .. 500-bp dsDNA was generated by PCR using a phiX174 Virion DNA template (New England BioLabs Inc., Ipswich, MA) and primers 5′-FAM-AGTTTTATCGCTTCCATGAC-3′ (where FAM represents fluorescein amidite) and 5′-TCAGAAAATCGAAATCATCTTC-3′ (Integrated DNA Technologies, Coralville, IA). .. The 500-bp dsDNA was gel-purified using a QiaQuick gel extraction kit (Qiagen, Hilden, Germany).

    Generated:

    Article Title: Ctp1 protein–DNA filaments promote DNA bridging and DNA double-strand break repair
    Article Snippet: .. 500-bp dsDNA was generated by PCR using a phiX174 Virion DNA template (New England BioLabs Inc., Ipswich, MA) and primers 5′-FAM-AGTTTTATCGCTTCCATGAC-3′ (where FAM represents fluorescein amidite) and 5′-TCAGAAAATCGAAATCATCTTC-3′ (Integrated DNA Technologies, Coralville, IA). .. The 500-bp dsDNA was gel-purified using a QiaQuick gel extraction kit (Qiagen, Hilden, Germany).

    Infection:

    Article Title: Metagenomic Assay for Identification of Microbial Pathogens in Tumor Tissues
    Article Snippet: .. Purified phiX174 virion DNA was purchased from New England Biolabs (N3023S; Ipswich, MA, USA), total DNA from human MRC-5 cells infected with cytomegalovirus (human herpesvirus 5 strain AD169) was ATCC VR-538D, total DNA from human A549 cells infected with adenovirus type 5 (HAdV-5 strain Adenoid 75) was ATCC VR-5D, and total RNA from human HEp-2 cells infected with respiratory syncytial virus (HRSV strain Long) was ATCC VR-26D, all purchased from ATCC (Manassas, VA, USA). .. Plasmid minipreps were prepared from pBR322 subclones carrying JC or BK polyomavirus genomes (J. C. Alwine, University of Pennsylvania, Philadelphia, PA) and from pUC19 carrying the human papillomavirus 16 (HPV16) genome (obtained from Peter Howley, Harvard Medical School, Boston, MA).

    IA:

    Article Title: Ctp1 protein–DNA filaments promote DNA bridging and DNA double-strand break repair
    Article Snippet: .. 500-bp dsDNA was generated by PCR using a phiX174 Virion DNA template (New England BioLabs Inc., Ipswich, MA) and primers 5′-FAM-AGTTTTATCGCTTCCATGAC-3′ (where FAM represents fluorescein amidite) and 5′-TCAGAAAATCGAAATCATCTTC-3′ (Integrated DNA Technologies, Coralville, IA). .. The 500-bp dsDNA was gel-purified using a QiaQuick gel extraction kit (Qiagen, Hilden, Germany).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    New England Biolabs ϕx174 virion ssdna
    Sgs1 can displace <t>ssDNA</t> annealed to <t>ϕX174</t> ssDNA. A , a 32 P-labeled oligonucleotide (66 nucleotides) was annealed to ϕX174 ssDNA (1 n m molecules) to create the substrate that was used for helicase assays; products were analyzed by electrophoresis,
    ϕx174 Virion Ssdna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 93/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ϕx174 virion ssdna/product/New England Biolabs
    Average 93 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    ϕx174 virion ssdna - by Bioz Stars, 2020-07
    93/100 stars
      Buy from Supplier

    Image Search Results


    Sgs1 can displace ssDNA annealed to ϕX174 ssDNA. A , a 32 P-labeled oligonucleotide (66 nucleotides) was annealed to ϕX174 ssDNA (1 n m molecules) to create the substrate that was used for helicase assays; products were analyzed by electrophoresis,

    Journal: The Journal of Biological Chemistry

    Article Title: The Full-length Saccharomyces cerevisiae Sgs1 Protein Is a Vigorous DNA Helicase That Preferentially Unwinds Holliday Junctions *

    doi: 10.1074/jbc.M109.083196

    Figure Lengend Snippet: Sgs1 can displace ssDNA annealed to ϕX174 ssDNA. A , a 32 P-labeled oligonucleotide (66 nucleotides) was annealed to ϕX174 ssDNA (1 n m molecules) to create the substrate that was used for helicase assays; products were analyzed by electrophoresis,

    Article Snippet: Substrates using ϕX174 DNA were prepared by annealing a 66-nt oligomer, PC63 (AGTGTTAACTTCTGCGTCATGGAAGCGATAAAACTCTGCAGGTTGGATACGCCAATCATTTTTATC), to ϕX174 virion ssDNA (New England Biolabs).

    Techniques: Labeling, Electrophoresis

    Three Strand Exchange Recombinase Assay A Active RAD51 nucleoprotein filament is formed on ϕX174 Virion circular ssDNA in reaction conditions permitting ATP hydrolysis followed by addition of RPA which helps remove secondary structures in the ssDNA allowing stable nucleoprotein filament formation. The RAD51 nucleoprotein then invades ϕX174 RFI linear dsDNA to form nicked circular dsDNA products through several joint-molecule intermediates showing various stages of branch migration. The RPA also helps sequester any free displaced ssDNA following strand exchange thereby preventing a reverse reaction. B . Typical agarose gel image from a strand exchange assay used to resolve the substrates, intermediates and the products of the reaction over a time course of 0, 30, 60, 120 and 180 minutes. In reactions containing the wild type protein, nicked circular products can be observed as early as 30 minutes. C. Quantitation of the strand exchange assay gel showing appearance of nicked circular products (black) and joint molecules (blue) on the left Y axis. Disappearance of the linear dsDNA substrate (red) is quantitated on the right Y axis. Time in minutes is indicated on the X axis.

    Journal: Methods in enzymology

    Article Title: Expression, Purification and Biochemical Evaluation of Human RAD51 Protein

    doi: 10.1016/bs.mie.2017.11.011

    Figure Lengend Snippet: Three Strand Exchange Recombinase Assay A Active RAD51 nucleoprotein filament is formed on ϕX174 Virion circular ssDNA in reaction conditions permitting ATP hydrolysis followed by addition of RPA which helps remove secondary structures in the ssDNA allowing stable nucleoprotein filament formation. The RAD51 nucleoprotein then invades ϕX174 RFI linear dsDNA to form nicked circular dsDNA products through several joint-molecule intermediates showing various stages of branch migration. The RPA also helps sequester any free displaced ssDNA following strand exchange thereby preventing a reverse reaction. B . Typical agarose gel image from a strand exchange assay used to resolve the substrates, intermediates and the products of the reaction over a time course of 0, 30, 60, 120 and 180 minutes. In reactions containing the wild type protein, nicked circular products can be observed as early as 30 minutes. C. Quantitation of the strand exchange assay gel showing appearance of nicked circular products (black) and joint molecules (blue) on the left Y axis. Disappearance of the linear dsDNA substrate (red) is quantitated on the right Y axis. Time in minutes is indicated on the X axis.

    Article Snippet: The oligonucleotides are resuspended in 10mM Tris (pH8.0) and stored at −20°C. ϕX174 Virion ssDNA (NEB# N3023) ϕX174 RFI dsDNA (NEB# N3021)

    Techniques: Recombinase Polymerase Amplification, Migration, Agarose Gel Electrophoresis, Quantitation Assay

    BCCIPβ binds DNA. ( A ) BCCIPβ (0.24 μM, 0.47 μM, 0.96 μM, 1.8 μM, 2.8 μM and 4.7 μM; lanes 2–7, respectively) incubated with ϕX174 (+) ssDNA (ss; 30 μM nucleotides). ( B ) BCCIPβ (0.24 μM, 0.47 μM, 0.96 μM, 1.8 μM, 2.8 μM and 4.7 μM; lanes 2–7, respectively) was incubated with ϕX174 RF (I) dsDNA (ds; 30 μM base pairs). The reaction products were separated on a 1.0% agarose gel, and were stained with ethidium bromide. Lane 1 contained no protein, and lane 8 was deproteinized with SDS and Proteinase K (S/P) prior to loading.

    Journal: Nucleic Acids Research

    Article Title: The β-isoform of BCCIP promotes ADP release from the RAD51 presynaptic filament and enhances homologous DNA pairing

    doi: 10.1093/nar/gkw877

    Figure Lengend Snippet: BCCIPβ binds DNA. ( A ) BCCIPβ (0.24 μM, 0.47 μM, 0.96 μM, 1.8 μM, 2.8 μM and 4.7 μM; lanes 2–7, respectively) incubated with ϕX174 (+) ssDNA (ss; 30 μM nucleotides). ( B ) BCCIPβ (0.24 μM, 0.47 μM, 0.96 μM, 1.8 μM, 2.8 μM and 4.7 μM; lanes 2–7, respectively) was incubated with ϕX174 RF (I) dsDNA (ds; 30 μM base pairs). The reaction products were separated on a 1.0% agarose gel, and were stained with ethidium bromide. Lane 1 contained no protein, and lane 8 was deproteinized with SDS and Proteinase K (S/P) prior to loading.

    Article Snippet: All oligonucleotides were purchased from Integrated DNA Technologies. pBluescript was purified from E. coli using a Giga Kit (Qiagen). ϕX174 (+) virion ssDNA and ϕX174 replicative form I double-stranded DNA (dsDNA) were purchased from New England BioLabs—ϕX174 dsDNA was linearized with ApaLI (New England BioLabs).

    Techniques: Incubation, Agarose Gel Electrophoresis, Staining

    Interaction with BCCIPβ induces conformational changes in RAD51. ( A ) RAD51 (5 μM) was incubated with trypsin (20 μg/ml) in the presence and absence of ATP (2 mM), ϕX174 ssDNA (30 μM nucleotides), calcium (1.8 mM) and BCCIPβ (10 μM), as indicated. The reactions were stopped with SDS and heat. The reaction products were resolved using SDS-PAGE followed by western blot analysis. Antibodies against RAD51 were used to develop the membrane. ( B ) The amounts of each band from undigested RAD51 and Fragments A, B, C and D were graphed based on the relative intensity of each band. Quantitation of the proteolytic fragmentation of RAD51 was determined from three independent experiments.

    Journal: Nucleic Acids Research

    Article Title: The β-isoform of BCCIP promotes ADP release from the RAD51 presynaptic filament and enhances homologous DNA pairing

    doi: 10.1093/nar/gkw877

    Figure Lengend Snippet: Interaction with BCCIPβ induces conformational changes in RAD51. ( A ) RAD51 (5 μM) was incubated with trypsin (20 μg/ml) in the presence and absence of ATP (2 mM), ϕX174 ssDNA (30 μM nucleotides), calcium (1.8 mM) and BCCIPβ (10 μM), as indicated. The reactions were stopped with SDS and heat. The reaction products were resolved using SDS-PAGE followed by western blot analysis. Antibodies against RAD51 were used to develop the membrane. ( B ) The amounts of each band from undigested RAD51 and Fragments A, B, C and D were graphed based on the relative intensity of each band. Quantitation of the proteolytic fragmentation of RAD51 was determined from three independent experiments.

    Article Snippet: All oligonucleotides were purchased from Integrated DNA Technologies. pBluescript was purified from E. coli using a Giga Kit (Qiagen). ϕX174 (+) virion ssDNA and ϕX174 replicative form I double-stranded DNA (dsDNA) were purchased from New England BioLabs—ϕX174 dsDNA was linearized with ApaLI (New England BioLabs).

    Techniques: Incubation, SDS Page, Western Blot, Quantitation Assay

    BCCIPβ stimulates RAD51 ATP hydrolysis and promotes ADP release. ( A ) RAD51 (0.5 μM) ATP hydrolysis assay in the presence or absence of ϕX174 ssDNA (60 μM nucleotides) and BCCIPβ (1 μM). ( B ) Time course analysis of RAD51 (0.5 μM) ATP hydrolysis in the presence of ϕX174 ssDNA (60 μM nucleotides), with or without BCCIPβ (1 μM). Error bars represent s.e.m. ( n = 3); P -value *

    Journal: Nucleic Acids Research

    Article Title: The β-isoform of BCCIP promotes ADP release from the RAD51 presynaptic filament and enhances homologous DNA pairing

    doi: 10.1093/nar/gkw877

    Figure Lengend Snippet: BCCIPβ stimulates RAD51 ATP hydrolysis and promotes ADP release. ( A ) RAD51 (0.5 μM) ATP hydrolysis assay in the presence or absence of ϕX174 ssDNA (60 μM nucleotides) and BCCIPβ (1 μM). ( B ) Time course analysis of RAD51 (0.5 μM) ATP hydrolysis in the presence of ϕX174 ssDNA (60 μM nucleotides), with or without BCCIPβ (1 μM). Error bars represent s.e.m. ( n = 3); P -value *

    Article Snippet: All oligonucleotides were purchased from Integrated DNA Technologies. pBluescript was purified from E. coli using a Giga Kit (Qiagen). ϕX174 (+) virion ssDNA and ϕX174 replicative form I double-stranded DNA (dsDNA) were purchased from New England BioLabs—ϕX174 dsDNA was linearized with ApaLI (New England BioLabs).

    Techniques: Hydrolysis Assay

    DIDS disrupts the DNA binding activity of eh Rad51. (A) Time course analysis of eh Rad51 ATPase activity in the presence or absence of DIDS (67 μM), with and without ϕX174 ssDNA or linearized ϕX174 dsDNA. Reactions were stopped with the addition of EDTA at the indicated times prior to separation with thin-layer chromatography and phosphorimager analysis. (B) eh Rad51 (7 μM) incubated with 32 P-radiolabeled ssDNA and increasing amounts of DIDS (5 μM, 10 μM, 15 μM, 20 μM, 30 μM, 40 μM; lanes 3–8 respectively). Lane 1 contained no protein or DIDS. Lane 2 contained no DIDS. Lane 9 contained 40 μM DIDS without eh Rad51. (C) eh Rad51 (35 μM) incubated with the 32 P-radiolabled dsDNA and increasing concentrations of DIDS (20 μM, 40 μM, 80 μM, 100 μM, 150 μM, 200 μM; lanes 3–8 respectively). Lane 1 lacked protein and DIDS, lane 2 contained no DIDS and lane 9 contained 200 μM DIDS and no protein. (D) eh Rad51 (7 μM) was incubated with radiolabeled ssDNA in the absence (lane 3) and presence of increasing concentrations of DIDS (5 μM, 10 μM, 15 μM, 20 μM, 30 μM, and 40 μM; lanes 4–9) prior to the addition of DNase I. The reaction were deproteinized, and the products were separated using non-denaturing PAGE. Lane 1 contained radiolabeled ssDNA alone, lane 2 contained DNase with radiolabeled ssDNA, and lane 10 contained radiolabeled ssDNA in the presence of 40 μM DIDS and DNase I. Error bars represent SEM (n = 3).

    Journal: Molecular and biochemical parasitology

    Article Title: Characterization of the recombination activities of the Entamoeba histolytica Rad51 recombinase

    doi: 10.1016/j.molbiopara.2016.09.001

    Figure Lengend Snippet: DIDS disrupts the DNA binding activity of eh Rad51. (A) Time course analysis of eh Rad51 ATPase activity in the presence or absence of DIDS (67 μM), with and without ϕX174 ssDNA or linearized ϕX174 dsDNA. Reactions were stopped with the addition of EDTA at the indicated times prior to separation with thin-layer chromatography and phosphorimager analysis. (B) eh Rad51 (7 μM) incubated with 32 P-radiolabeled ssDNA and increasing amounts of DIDS (5 μM, 10 μM, 15 μM, 20 μM, 30 μM, 40 μM; lanes 3–8 respectively). Lane 1 contained no protein or DIDS. Lane 2 contained no DIDS. Lane 9 contained 40 μM DIDS without eh Rad51. (C) eh Rad51 (35 μM) incubated with the 32 P-radiolabled dsDNA and increasing concentrations of DIDS (20 μM, 40 μM, 80 μM, 100 μM, 150 μM, 200 μM; lanes 3–8 respectively). Lane 1 lacked protein and DIDS, lane 2 contained no DIDS and lane 9 contained 200 μM DIDS and no protein. (D) eh Rad51 (7 μM) was incubated with radiolabeled ssDNA in the absence (lane 3) and presence of increasing concentrations of DIDS (5 μM, 10 μM, 15 μM, 20 μM, 30 μM, and 40 μM; lanes 4–9) prior to the addition of DNase I. The reaction were deproteinized, and the products were separated using non-denaturing PAGE. Lane 1 contained radiolabeled ssDNA alone, lane 2 contained DNase with radiolabeled ssDNA, and lane 10 contained radiolabeled ssDNA in the presence of 40 μM DIDS and DNase I. Error bars represent SEM (n = 3).

    Article Snippet: All oligonucleotides indicated as radiolabeled were done so using T4 polynucleotide kinase and [32 P-γ]-ATP as described [ ]. ϕX174 (+) virion ssDNA and ϕX174 replicative form I dsDNA were purchased from New England BioLabs; the ϕX174 replicative form I dsDNA was linearized with Apa LI (New England BioLabs). pBluescript was purified from E. coli using a Plasmid Giga kit (Qiagen).

    Techniques: Binding Assay, Activity Assay, Thin Layer Chromatography, Incubation, Polyacrylamide Gel Electrophoresis

    eh Rad51 hydrolyzes ATP and binds DNA. (A) Purified recombinant eh Rad51 (0.5 μg) on a 12% SDS-polyacrylamide gel stained with Coomassie blue. (B) Time course analysis of eh Rad51 ATPase activity in the absence and presence of ϕX174 ssDNA or linearized ϕX174 dsDNA. (C) Increasing concentrations of eh Rad51 (lanes 2–6) were incubated with 32 P-labeled ssDNA, and were resolved on a 12% polyacrylamide gel. (D) Increasing concentrations of eh Rad51 (lanes 2–6) were incubated with 32 P-labeled dsDNA. The samples were resolved on a 12% polyacrylamide gel. The results for B, C and D were quantified using a phosphorimager and graphed. Lane 1 for C and D contained no protein, and lane 7 for C and D was treated with SDS/PK (S/P). Error bars represent SEM (n = 3).

    Journal: Molecular and biochemical parasitology

    Article Title: Characterization of the recombination activities of the Entamoeba histolytica Rad51 recombinase

    doi: 10.1016/j.molbiopara.2016.09.001

    Figure Lengend Snippet: eh Rad51 hydrolyzes ATP and binds DNA. (A) Purified recombinant eh Rad51 (0.5 μg) on a 12% SDS-polyacrylamide gel stained with Coomassie blue. (B) Time course analysis of eh Rad51 ATPase activity in the absence and presence of ϕX174 ssDNA or linearized ϕX174 dsDNA. (C) Increasing concentrations of eh Rad51 (lanes 2–6) were incubated with 32 P-labeled ssDNA, and were resolved on a 12% polyacrylamide gel. (D) Increasing concentrations of eh Rad51 (lanes 2–6) were incubated with 32 P-labeled dsDNA. The samples were resolved on a 12% polyacrylamide gel. The results for B, C and D were quantified using a phosphorimager and graphed. Lane 1 for C and D contained no protein, and lane 7 for C and D was treated with SDS/PK (S/P). Error bars represent SEM (n = 3).

    Article Snippet: All oligonucleotides indicated as radiolabeled were done so using T4 polynucleotide kinase and [32 P-γ]-ATP as described [ ]. ϕX174 (+) virion ssDNA and ϕX174 replicative form I dsDNA were purchased from New England BioLabs; the ϕX174 replicative form I dsDNA was linearized with Apa LI (New England BioLabs). pBluescript was purified from E. coli using a Plasmid Giga kit (Qiagen).

    Techniques: Purification, Recombinant, Staining, Activity Assay, Incubation, Labeling

    eh Rad51 facilitates plasmid length homologous DNA pairing and DNA strand exchange. (A) Schematic of plasmid length strand exchange assay. Css, circular ssDNA; lds, linearized dsDNA; jm, joint-molecule; nc, nicked-circular; lss, linearized ssDNA. (B) Increasing concentrations of eh Rad51 (lanes 2–8) were incubated with circular ϕX174 ssDNA (css). The reaction was initiated with the introduction of linearized ϕX174 dsDNA (lds) and was deproteinized after 90 min. Reaction products were resolved on an agarose gel and stained with ethidium bromide. Lane 1 contained no protein. (C) The percent product of nicked-circular and total product (jm + nc) were graphed.

    Journal: Molecular and biochemical parasitology

    Article Title: Characterization of the recombination activities of the Entamoeba histolytica Rad51 recombinase

    doi: 10.1016/j.molbiopara.2016.09.001

    Figure Lengend Snippet: eh Rad51 facilitates plasmid length homologous DNA pairing and DNA strand exchange. (A) Schematic of plasmid length strand exchange assay. Css, circular ssDNA; lds, linearized dsDNA; jm, joint-molecule; nc, nicked-circular; lss, linearized ssDNA. (B) Increasing concentrations of eh Rad51 (lanes 2–8) were incubated with circular ϕX174 ssDNA (css). The reaction was initiated with the introduction of linearized ϕX174 dsDNA (lds) and was deproteinized after 90 min. Reaction products were resolved on an agarose gel and stained with ethidium bromide. Lane 1 contained no protein. (C) The percent product of nicked-circular and total product (jm + nc) were graphed.

    Article Snippet: All oligonucleotides indicated as radiolabeled were done so using T4 polynucleotide kinase and [32 P-γ]-ATP as described [ ]. ϕX174 (+) virion ssDNA and ϕX174 replicative form I dsDNA were purchased from New England BioLabs; the ϕX174 replicative form I dsDNA was linearized with Apa LI (New England BioLabs). pBluescript was purified from E. coli using a Plasmid Giga kit (Qiagen).

    Techniques: Plasmid Preparation, Incubation, Agarose Gel Electrophoresis, Staining