buffers β gal  (Millipore)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Name:
    Imidocarb dihydrochloride monohydrate
    Description:

    Catalog Number:
    32123
    Price:
    None
    Applications:
    Refer to the product's Certificate of Analysis for more information on a suitable instrument technique. Contact Technical Service for further support.
    Buy from Supplier


    Structured Review

    Millipore buffers β gal
    Imidocarb dihydrochloride monohydrate

    https://www.bioz.com/result/buffers β gal/product/Millipore
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    buffers β gal - by Bioz Stars, 2021-07
    93/100 stars

    Images

    1) Product Images from "Advantages of Hydrogel-Based 3D-Printed Enzyme Reactors and Their Limitations for Biocatalysis"

    Article Title: Advantages of Hydrogel-Based 3D-Printed Enzyme Reactors and Their Limitations for Biocatalysis

    Journal: Frontiers in Bioengineering and Biotechnology

    doi: 10.3389/fbioe.2018.00211

    Michaelis–Menten kinetics of the investigated biocatalytic reactions with freely dissolved enzymes. Kinetic parameters v max and K m were calculated by fitting the data to the Michaelis–Menten function, which is shown including 95% confidence bounds. In the whole figure, each data point represents one sample. (A) β-Gal kinetics for the cleavage of ONPG at pH 4.6 ( n = 3 separate runs). (B) BFD kinetics for the carboligation of benzaldehyde and a respective 2.5-fold excess of acetaldehyde ( n = 2 separate runs). Estimation of the confidence bounds was omitted because of limited data for substrate excess. (C) ADH kinetics for the reduction of acetophenone. (D) ADH kinetics for the reduction of ( S )-HPP, which was previously synthesized by BFD. For ADH kinetics, data points were generated in one batch due to shortage of the enzyme.
    Figure Legend Snippet: Michaelis–Menten kinetics of the investigated biocatalytic reactions with freely dissolved enzymes. Kinetic parameters v max and K m were calculated by fitting the data to the Michaelis–Menten function, which is shown including 95% confidence bounds. In the whole figure, each data point represents one sample. (A) β-Gal kinetics for the cleavage of ONPG at pH 4.6 ( n = 3 separate runs). (B) BFD kinetics for the carboligation of benzaldehyde and a respective 2.5-fold excess of acetaldehyde ( n = 2 separate runs). Estimation of the confidence bounds was omitted because of limited data for substrate excess. (C) ADH kinetics for the reduction of acetophenone. (D) ADH kinetics for the reduction of ( S )-HPP, which was previously synthesized by BFD. For ADH kinetics, data points were generated in one batch due to shortage of the enzyme.

    Techniques Used: Synthesized, Generated

    Conversion curves in batch with enzymes entrapped in hydrogel lattices by following the formation of the respective product over time. (A) β-Gal kinetics for the cleavage of 2.2 mM ONPG at pH 4.6 ( n = 3 separate runs). (B) Formation of ( S )-HPP by BFD starting from 35 mM benzaldehyde and 87.5 mM acetaldehyde ( n = 2 separate runs). (C) ADH-catalyzed reduction of three different concentrations of acetophenone ( n = 2 separate runs). (D) ADH-catalyzed reduction of three different concentrations of ( S )-HPP, provided by BFD reactor experiments ( n = 1). Linear regression with a 95% confidence interval of the slope was applied.
    Figure Legend Snippet: Conversion curves in batch with enzymes entrapped in hydrogel lattices by following the formation of the respective product over time. (A) β-Gal kinetics for the cleavage of 2.2 mM ONPG at pH 4.6 ( n = 3 separate runs). (B) Formation of ( S )-HPP by BFD starting from 35 mM benzaldehyde and 87.5 mM acetaldehyde ( n = 2 separate runs). (C) ADH-catalyzed reduction of three different concentrations of acetophenone ( n = 2 separate runs). (D) ADH-catalyzed reduction of three different concentrations of ( S )-HPP, provided by BFD reactor experiments ( n = 1). Linear regression with a 95% confidence interval of the slope was applied.

    Techniques Used:

    Detected conversion to the respective product compound at the exit of the 3 ml reactor system of one exemplary run. Parameters were (A) β-Gal ( m = 0.38 mg/reactor) with ONPG substrate 2.2 mM, flow rate 0.05 ml/min. (B) BFD ( m = 56 mg/reactor) catalyzing the carboligation of benzaldehyde (25 mM) and acetaldehyde (62.5 mM), flow rate 0.017 ml/min. (C) ADH ( m = 42 mg/reactor) reducing acetophenone (50 mM), flow rate 0.017 ml/min. Reproducibility is shown by a second experiment with identical parameters. (D) ADH ( m = 58 mg/reactor) reducing ( S )-HPP provided by BFD reactor experiments (11 mM), flow rate 0.017 ml/min.
    Figure Legend Snippet: Detected conversion to the respective product compound at the exit of the 3 ml reactor system of one exemplary run. Parameters were (A) β-Gal ( m = 0.38 mg/reactor) with ONPG substrate 2.2 mM, flow rate 0.05 ml/min. (B) BFD ( m = 56 mg/reactor) catalyzing the carboligation of benzaldehyde (25 mM) and acetaldehyde (62.5 mM), flow rate 0.017 ml/min. (C) ADH ( m = 42 mg/reactor) reducing acetophenone (50 mM), flow rate 0.017 ml/min. Reproducibility is shown by a second experiment with identical parameters. (D) ADH ( m = 58 mg/reactor) reducing ( S )-HPP provided by BFD reactor experiments (11 mM), flow rate 0.017 ml/min.

    Techniques Used: Flow Cytometry

    Overview of the studied reactions. (A) Hydrolysis of o-Nitrophenyl-β- d -galactopyranoside (ONPG) by β-Gal yields the monosaccharides galactose and o-nitrophenol. (B) Activity of ADH can be determined by enantioselective reduction of acetophenone to ( R )-phenylethanol. (C) The combination of BFD and ADH in a 2-step cascade reaction. Carboligation of the educts benzaldehyde and acetaldehyde catalyzed by BFD yields the intermediate ( S )-2-hydroxy-1-phenyl-propanone (( S )-HPP), which can be further reduced to the product (1 S ,2 S )-1-phenylpropane-1,2-diol (( S,S )-PPD) by ADH. The redox equivalents are delivered by the cofactor NADPH that is oxidized to NADP + . For in situ regeneration of NADPH 2-propanol was added in excess which is oxidized to acetone by the same ADH.
    Figure Legend Snippet: Overview of the studied reactions. (A) Hydrolysis of o-Nitrophenyl-β- d -galactopyranoside (ONPG) by β-Gal yields the monosaccharides galactose and o-nitrophenol. (B) Activity of ADH can be determined by enantioselective reduction of acetophenone to ( R )-phenylethanol. (C) The combination of BFD and ADH in a 2-step cascade reaction. Carboligation of the educts benzaldehyde and acetaldehyde catalyzed by BFD yields the intermediate ( S )-2-hydroxy-1-phenyl-propanone (( S )-HPP), which can be further reduced to the product (1 S ,2 S )-1-phenylpropane-1,2-diol (( S,S )-PPD) by ADH. The redox equivalents are delivered by the cofactor NADPH that is oxidized to NADP + . For in situ regeneration of NADPH 2-propanol was added in excess which is oxidized to acetone by the same ADH.

    Techniques Used: Activity Assay, In Situ

    Related Articles

    Synthesized:

    Article Title: Illuminating the binding interactions of galactonoamidines during the inhibition of β-galactosidase (E. coli)
    Article Snippet: .. Ethyl acetate, cyclohexane, hexane and 4-methylbenzylamine were distilled prior to use, THF, dichloromethane, DMSO and DMF were dried over neutral aluminium oxide and stored over molecular sieves prior to use; 2-deoxy-D-lyxohexono-1,5-lactone ( 3a ), – p -tolyl-3,4- O -isopropylidene-1-thio-β-D-galactopyranoside ( 4 ), , and p -methylphenyl-4,6- O -benzylidene-1-thio-β-D-galactopyranoside ( 10 ) – were synthesized as described. β-Galactosidase [3.2.1.23] from Escherichia coli was obtained from Sigma-Aldrich as lyophilized powder and used as received. ..

    other:

    Article Title: Synthesis of Oligosaccharides Derived from Lactulose (OsLu) Using Soluble and Immobilized Aspergillus oryzae β-Galactosidase
    Article Snippet: Materials Aspergillus oryzae β-galactosidase (E. C. 3.2.1.23), lactulose, d -fructose, 6-galactobiose, and 50% glutaraldehyde were purchased from Sigma-Aldrich (Steinheim, Germany).

    Article Title: Optimal Immobilization of β-Galactosidase onto κ-Carrageenan Gel Beads Using Response Surface Methodology and Its Applications
    Article Snippet: Lactose is from Arabian medical & Scientific Lab, Dubai, UAE, and β -galactosidase (EC 3.2.1.23) from Aspergillus oryzae , 11.8 U/mg, was purchased from Sigma-Aldrich.

    Article Title: Novel Epoxy Activated Hydrogels for Solving Lactose Intolerance
    Article Snippet: Materials κ -Carrageenan (MW: 154,000), sulfate ester ~25, and chitosan were supplied by Fluka. β -Galactosidase (EC 3.2.1.23) was obtained from Aspergillus oryzae and 11.8 U/mg was obtained from Sigma-Fluka-Aldrich.

    Article Title: Immobilization of β-Galactosidase From Aspergillus oryzae on Electrospun Gelatin Nanofiber Mats for the Production of Galactooligosaccharides
    Article Snippet: Material β-Galactosidase (3.2.1.23) from Aspergillus oryzae ( > 8.0 units/mg solid), gelatin from porcine skin (type A), and lactose monohydrate were obtained from Sigma (Germany).

    Purification:

    Article Title: Advantages of Hydrogel-Based 3D-Printed Enzyme Reactors and Their Limitations for Biocatalysis
    Article Snippet: The products of the reaction cascade, a diastereomeric diol, is of interest for the pharmaceutical industry, as it can be produced with high optical purity (Valinger et al., ; Porta et al., ). .. Enzymes and Buffers β-Gal (EC 3.2.1.23) from A. oryzae and the substrate ONPG were obtained from Sigma-Aldrich (Darmstadt, Germany) and used without further purification. .. Reaction buffer for experiments with β-Gal was sodium citrate (333 mM, pH 4.6) adjusted with NaOH (all obtained from VWR, Radnor, USA, unless specified differently).

    Article Title: Advantages of Hydrogel-Based 3D-Printed Enzyme Reactors and Their Limitations for Biocatalysis
    Article Snippet: The products of the reaction cascade, a diastereomeric diol, is of interest for the pharmaceutical industry, as it can be produced with high optical purity (Valinger et al., ; Porta et al., ). .. β-Gal (EC 3.2.1.23) from A. oryzae and the substrate ONPG were obtained from Sigma-Aldrich (Darmstadt, Germany) and used without further purification. .. Reaction buffer for experiments with β-Gal was sodium citrate (333 mM, pH 4.6) adjusted with NaOH (all obtained from VWR, Radnor, USA, unless specified differently).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Millipore matrine
    <t>Matrine</t> inhibits growth and induces cellular senescence of U251 GBM cells in vivo. A, U251 cells expressing luciferase were orthotopically implanted into athymic nude mice. Tumor growth was monitored using the IVIS‐200 imaging system for detection of bioluminescence. Bioluminescent signals were measured at days 7, 14, 21, and 28 after implantation. B, Bioluminescence values plotted as a function of time in days to assess tumor growth (days 7, 14, 21, and 28). Statistical analyses were performed using permutation test. P ‐value came from the comparison between treated group and control group. C, Overall survival as determined by Kaplan‐Meier survival curves. A log‐rank test was used to assess the statistical significance of the differences ( P
    Matrine, supplied by Millipore, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/matrine/product/Millipore
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    matrine - by Bioz Stars, 2021-07
    94/100 stars
      Buy from Supplier

    99
    Millipore shrna against st6gal i
    EGFR phosphorylation is enhanced in SKOV3 ovarian cancer cells with <t>ST6Gal-I</t> overexpression, but decreased in cells with ST6Gal-I knockdown. a. SKOV3 cells were stably transduced with lentivirus encoding human ST6Gal-I, or alternatively, <t>shRNA</t> for ST6Gal-I. ST6Gal-I overexpression (OE) and knockdown (KD) were confirmed by immunoblotting. EV, OE or KD cell lysates were precipitated by SNA-agarose and immunoblotted for EGFR to detect levels of α2-6 sialylated EGFR. Total cell lysates were immunoblotted for activated EGFR (p-EGFR, pY1068) or total EGFR. b. Densitometric analysis of three independent blots of basal p-EGFR in SKOV3 cells (normalized to β-tubulin). c. Representative p-EGFR immunoblot of EV, OE or KD cells treated with EGF for 5, 15 and 30 min. d. Densitometric analysis of three independent blots of p-EGFR in EGF-treated SKOV3 cells. *, p
    Shrna Against St6gal I, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/shrna against st6gal i/product/Millipore
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    shrna against st6gal i - by Bioz Stars, 2021-07
    99/100 stars
      Buy from Supplier

    93
    Millipore β galactosidase reporter plasmid
    LPS downregulates levels of intestine-specific 5’pcmah-1 transcript and Pi promoter of pcmah in IPI-2I cells. ( a ) A schematic diagram for genomic structure of the pcmah . 5’pcmah-1 and 5’pcmah-2 , two alternative splicing variants of the pcmah , have a distinct transcription initiation site located in exons 0 and 1a, respectively. Each promoter region responsible for intestine specific splicing variant 5’pcmah-1 and housekeeping splicing variant 5’pcmah-2 is indicated by Pi (intestine specific promoter) and Ph (housekeeping promoter), respectively. Shaded boxes indicate the coding exons, while open boxes indicate untranslated exons. Two splicing variants of the pcmah share a common ORF region (shaded arrow boxes). ( b ) IPI-2I cells were treated with 100 ng/mL LPS for 1 h. mRNA expression of pcmah , 5’pcmah-1 , and 5’pcmah-2 were determined by qRT-PCR. Numbers below images indicate fold-change in mRNA expression. ( c ) The indicated 5’ deletion constructs for the Pi promoter region were transiently transfected into IPI-2I cells. After 24 h, the cells were treated with LPS for 1 h. Luciferase and <t>β-galactosidase</t> activity in the transfected cells was measured. For each transfection, luciferase activity was normalized with β-galactosidase activity and the relative value was determined from the ratio of normalized activity and activity in cells transfected with the empty pGL3-basic vector. Transcription factors in the region are indicated. Graphs represent three independent experiments performed in triplicate. Data represent the mean ± SD. * P
    β Galactosidase Reporter Plasmid, supplied by Millipore, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/β galactosidase reporter plasmid/product/Millipore
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    β galactosidase reporter plasmid - by Bioz Stars, 2021-07
    93/100 stars
      Buy from Supplier

    96
    Millipore β galactosidase
    Morphology and senescence changes of adipose‐derived mesenchymal stem cells (ASCs) with or without long‐term FGF2 treatment. A, Microscopic images of suspended ASCs at P5, P10, and P15. Scale bar = 50 μm. B, Quantification of cell diameter revealed a smaller cell diameter of FGF2‐treated ASCs in P5 and P10, but the cell size increased at P15 (n = 7). C, <t>SA‐β‐gal</t> staining of ASCs at P5, P8, and P18. Scale bar = 500 μm. D, Quantification of SA‐β‐gal‐positive cells in 5‐6 randomly selected fields (n = 3). E, Western blot analysis of the senescence marker p21 at different passages. F, Quantification of p21 protein expression was higher in FGF2‐treated ASCs relative to the control after P12 (n = 3 at P17 and n = 4 at other passages). * P
    β Galactosidase, supplied by Millipore, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/β galactosidase/product/Millipore
    Average 96 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    β galactosidase - by Bioz Stars, 2021-07
    96/100 stars
      Buy from Supplier

    Image Search Results


    Matrine inhibits growth and induces cellular senescence of U251 GBM cells in vivo. A, U251 cells expressing luciferase were orthotopically implanted into athymic nude mice. Tumor growth was monitored using the IVIS‐200 imaging system for detection of bioluminescence. Bioluminescent signals were measured at days 7, 14, 21, and 28 after implantation. B, Bioluminescence values plotted as a function of time in days to assess tumor growth (days 7, 14, 21, and 28). Statistical analyses were performed using permutation test. P ‐value came from the comparison between treated group and control group. C, Overall survival as determined by Kaplan‐Meier survival curves. A log‐rank test was used to assess the statistical significance of the differences ( P

    Journal: Cancer Medicine

    Article Title: Matrine induces senescence of human glioblastoma cells through suppression of the IGF1/PI3K/AKT/p27 signaling pathway, et al. Matrine induces senescence of human glioblastoma cells through suppression of the IGF1/PI3K/AKT/p27 signaling pathway

    doi: 10.1002/cam4.1720

    Figure Lengend Snippet: Matrine inhibits growth and induces cellular senescence of U251 GBM cells in vivo. A, U251 cells expressing luciferase were orthotopically implanted into athymic nude mice. Tumor growth was monitored using the IVIS‐200 imaging system for detection of bioluminescence. Bioluminescent signals were measured at days 7, 14, 21, and 28 after implantation. B, Bioluminescence values plotted as a function of time in days to assess tumor growth (days 7, 14, 21, and 28). Statistical analyses were performed using permutation test. P ‐value came from the comparison between treated group and control group. C, Overall survival as determined by Kaplan‐Meier survival curves. A log‐rank test was used to assess the statistical significance of the differences ( P

    Article Snippet: Cells were treated with matrine (M5319‐500MG, Sigma‐Aldrich, St. Louis, MO, USA), an activator of pAKT SC79 (305834‐79‐1; Sigma‐Aldrich), or an inhibitor of PI3K (934389‐88‐5; Sigma‐Aldrich) at the concentrations indicated in the text.

    Techniques: In Vivo, Expressing, Luciferase, Mouse Assay, Imaging

    Proposed model for mechanism of matrine activity on human GBM cells. Matrine suppresses GBM cell growth and invasion by inhibiting PI3K/AKT/p27 signaling and inducing senescence. Decreased IGF1 in matrine‐induced senescent cells enhances response to matrine

    Journal: Cancer Medicine

    Article Title: Matrine induces senescence of human glioblastoma cells through suppression of the IGF1/PI3K/AKT/p27 signaling pathway, et al. Matrine induces senescence of human glioblastoma cells through suppression of the IGF1/PI3K/AKT/p27 signaling pathway

    doi: 10.1002/cam4.1720

    Figure Lengend Snippet: Proposed model for mechanism of matrine activity on human GBM cells. Matrine suppresses GBM cell growth and invasion by inhibiting PI3K/AKT/p27 signaling and inducing senescence. Decreased IGF1 in matrine‐induced senescent cells enhances response to matrine

    Article Snippet: Cells were treated with matrine (M5319‐500MG, Sigma‐Aldrich, St. Louis, MO, USA), an activator of pAKT SC79 (305834‐79‐1; Sigma‐Aldrich), or an inhibitor of PI3K (934389‐88‐5; Sigma‐Aldrich) at the concentrations indicated in the text.

    Techniques: Activity Assay

    Matrine inhibits proliferation and induces cell cycle arrest in GBM cells. A, Growth curves generated with cell viability results determined from the CCK‐8 assay for normal human astrocytes (NHA), U251, U87, and P3 cells treated with different concentrations of matrine for 24, 48, and 72 h. Data points represent the percentage (%; OD450 untreated/OD450 treated) relative to untreated cells at that time point. B, IC50 values for matrine in three glioma cell lines and NHA. C, U251, U87, and P3 cells were treated with 0.2 mmol/L matrine for 72 h. The cells were stained with Apollo 647 (red, representative of EdU) and the nuclear‐specific dye DAPI (blue). Scale bars = 20 μm. D, Graphic representation of the percentage of EdU‐positive U251, U87, and P3 cells treated with different concentrations of matrine for 72 h. Statistical analyses were performed using permutation test. P ‐value came from the comparison between treated group and control group. All data are representative of three independent experiments

    Journal: Cancer Medicine

    Article Title: Matrine induces senescence of human glioblastoma cells through suppression of the IGF1/PI3K/AKT/p27 signaling pathway, et al. Matrine induces senescence of human glioblastoma cells through suppression of the IGF1/PI3K/AKT/p27 signaling pathway

    doi: 10.1002/cam4.1720

    Figure Lengend Snippet: Matrine inhibits proliferation and induces cell cycle arrest in GBM cells. A, Growth curves generated with cell viability results determined from the CCK‐8 assay for normal human astrocytes (NHA), U251, U87, and P3 cells treated with different concentrations of matrine for 24, 48, and 72 h. Data points represent the percentage (%; OD450 untreated/OD450 treated) relative to untreated cells at that time point. B, IC50 values for matrine in three glioma cell lines and NHA. C, U251, U87, and P3 cells were treated with 0.2 mmol/L matrine for 72 h. The cells were stained with Apollo 647 (red, representative of EdU) and the nuclear‐specific dye DAPI (blue). Scale bars = 20 μm. D, Graphic representation of the percentage of EdU‐positive U251, U87, and P3 cells treated with different concentrations of matrine for 72 h. Statistical analyses were performed using permutation test. P ‐value came from the comparison between treated group and control group. All data are representative of three independent experiments

    Article Snippet: Cells were treated with matrine (M5319‐500MG, Sigma‐Aldrich, St. Louis, MO, USA), an activator of pAKT SC79 (305834‐79‐1; Sigma‐Aldrich), or an inhibitor of PI3K (934389‐88‐5; Sigma‐Aldrich) at the concentrations indicated in the text.

    Techniques: Generated, CCK-8 Assay, Staining

    Matrine induces cellular senescence by upregulating p27. A, Western blot analysis for cell cycle‐associated proteins in lysates prepared from U251 and U87 cells treated with matrine for the indicated number of days. The immunoblots are representative of at least two independent experiments with GAPDH serving as a protein loading control. B, Western blot analysis of p27, CDK4, and CDK6 expression in U251 and U87 cells transfected with p27 siRNA for 48 h. C, In situ SA‐β‐gal assay to detect senescent cells. Cells were treated with 0.2 mmol/L matrine or p27 siRNA for 72 h and compared to controls. Scale bars = 20 μm. D, Graphic representation of the percentage of SA‐β‐gal‐positive cells determined in four random fields per sample. All data are expressed as the mean ± the SD of values from experiments performed in triplicate. Statistical analyses were performed using permutation test. P ‐value came from the comparison between treated group and control group or between two treated groups

    Journal: Cancer Medicine

    Article Title: Matrine induces senescence of human glioblastoma cells through suppression of the IGF1/PI3K/AKT/p27 signaling pathway, et al. Matrine induces senescence of human glioblastoma cells through suppression of the IGF1/PI3K/AKT/p27 signaling pathway

    doi: 10.1002/cam4.1720

    Figure Lengend Snippet: Matrine induces cellular senescence by upregulating p27. A, Western blot analysis for cell cycle‐associated proteins in lysates prepared from U251 and U87 cells treated with matrine for the indicated number of days. The immunoblots are representative of at least two independent experiments with GAPDH serving as a protein loading control. B, Western blot analysis of p27, CDK4, and CDK6 expression in U251 and U87 cells transfected with p27 siRNA for 48 h. C, In situ SA‐β‐gal assay to detect senescent cells. Cells were treated with 0.2 mmol/L matrine or p27 siRNA for 72 h and compared to controls. Scale bars = 20 μm. D, Graphic representation of the percentage of SA‐β‐gal‐positive cells determined in four random fields per sample. All data are expressed as the mean ± the SD of values from experiments performed in triplicate. Statistical analyses were performed using permutation test. P ‐value came from the comparison between treated group and control group or between two treated groups

    Article Snippet: Cells were treated with matrine (M5319‐500MG, Sigma‐Aldrich, St. Louis, MO, USA), an activator of pAKT SC79 (305834‐79‐1; Sigma‐Aldrich), or an inhibitor of PI3K (934389‐88‐5; Sigma‐Aldrich) at the concentrations indicated in the text.

    Techniques: Western Blot, Expressing, Transfection, In Situ, β-Gal Assay

    Matrine induces cellular senescence in GBM cells. A, Flow cytometric analysis of apoptosis in cells treated with 0.2 mmol/L matrine for 72 h as determined by annexin V‐ and/or FITC and propidium iodide staining for DNA content. The percentages of annexin V‐ and/or FITC‐positive cells are indicated. B, Western blot analysis of cas‐3, cleaved cas‐3, PARP, cleaved PARP, and β‐tublin expression in protein lysates (20 μg) prepared from U251 cells treated with matrine (0.2 mmol/L) for the indicated days. C, U251 cells in different phases of the cell cycle based on flow cytometric analysis (propidium iodide staining) of cells treated with 0.2 mmol/L matrine for 72 h. All data are expressed as the mean ± the SD of values from experiments performed in triplicate. D, Immunofluorescence staining for γH2AX (red) used to detect DNA damage and abnormal chromatin accumulated in U251 cells, U87, and P3 cells treated with matrine (0.2 mmol/L) for 72 h. Cell nuclei were counterstained with DAPI (blue). Scale bars = 20 μm. E, Graphic representation of cell number and γH2AX‐positive content U251, U87, and P3 cells treated with 0.2 mmol/L matrine for 72 h. Statistical analyses were performed using permutation test. P ‐value came from the comparison between treated group and control group. F, In situ SA‐β‐gal assay to detect senescent cells. U251, U87, and P3 cells were treated with 0.2 mmol/L marine for 72 h. Cellular senescence was examined by SA‐β‐gal staining. Scale bars = 20 μm. G, Graphic representation of the percentage of SA‐β‐gal‐positive cells determined in four random fields per sample. All data are expressed as the mean ± the SD of values from experiments performed in triplicate. Statistical analyses were performed using permutation test. P ‐value came from the comparison between treated group and control group

    Journal: Cancer Medicine

    Article Title: Matrine induces senescence of human glioblastoma cells through suppression of the IGF1/PI3K/AKT/p27 signaling pathway, et al. Matrine induces senescence of human glioblastoma cells through suppression of the IGF1/PI3K/AKT/p27 signaling pathway

    doi: 10.1002/cam4.1720

    Figure Lengend Snippet: Matrine induces cellular senescence in GBM cells. A, Flow cytometric analysis of apoptosis in cells treated with 0.2 mmol/L matrine for 72 h as determined by annexin V‐ and/or FITC and propidium iodide staining for DNA content. The percentages of annexin V‐ and/or FITC‐positive cells are indicated. B, Western blot analysis of cas‐3, cleaved cas‐3, PARP, cleaved PARP, and β‐tublin expression in protein lysates (20 μg) prepared from U251 cells treated with matrine (0.2 mmol/L) for the indicated days. C, U251 cells in different phases of the cell cycle based on flow cytometric analysis (propidium iodide staining) of cells treated with 0.2 mmol/L matrine for 72 h. All data are expressed as the mean ± the SD of values from experiments performed in triplicate. D, Immunofluorescence staining for γH2AX (red) used to detect DNA damage and abnormal chromatin accumulated in U251 cells, U87, and P3 cells treated with matrine (0.2 mmol/L) for 72 h. Cell nuclei were counterstained with DAPI (blue). Scale bars = 20 μm. E, Graphic representation of cell number and γH2AX‐positive content U251, U87, and P3 cells treated with 0.2 mmol/L matrine for 72 h. Statistical analyses were performed using permutation test. P ‐value came from the comparison between treated group and control group. F, In situ SA‐β‐gal assay to detect senescent cells. U251, U87, and P3 cells were treated with 0.2 mmol/L marine for 72 h. Cellular senescence was examined by SA‐β‐gal staining. Scale bars = 20 μm. G, Graphic representation of the percentage of SA‐β‐gal‐positive cells determined in four random fields per sample. All data are expressed as the mean ± the SD of values from experiments performed in triplicate. Statistical analyses were performed using permutation test. P ‐value came from the comparison between treated group and control group

    Article Snippet: Cells were treated with matrine (M5319‐500MG, Sigma‐Aldrich, St. Louis, MO, USA), an activator of pAKT SC79 (305834‐79‐1; Sigma‐Aldrich), or an inhibitor of PI3K (934389‐88‐5; Sigma‐Aldrich) at the concentrations indicated in the text.

    Techniques: Flow Cytometry, Staining, Western Blot, Expressing, Immunofluorescence, In Situ, β-Gal Assay

    Downregulation of IGF1 enhances matrine‐induced cellular senescence in GBM cells. A, Cytokine array to detect secreted protein levels in controls and matrine‐treated U251 for 72 h. B, Fold expression levels of IGF1 as determined in the cytokine assay. Chemiluminescent signals quantified with ImageJ software. C, Results from ELISA performed to detect levels of IGF1 in media collected from control and matrine‐treated U251 and U87 cells. Statistical analyses were performed using permutation test. P ‐value came from the comparison between treated group and control group. D, Western blot analysis of PI3K, pAKT, AKT, p27, and GAPDH expressions in U251 and U87 cells treated with 0.2 mmol/L matrine, exogenous IGF1 (200 ng/mL), or IGF1 antibody (1 mg/mL) for 72 h. E, In situ SA‐β‐gal assay to detect senescent cells. Cells were treated with matrine, exogenous IGF1, or IGF1 antibody for 72 h. Scale bars = 20 μm. F, Graphic representation of the percentage of SA‐β‐gal‐positive cells as determined in four random fields per sample. All data are expressed as the mean ± the SD of values from experiments performed in triplicate. Statistical analyses were performed using analysis of variance in randomized blocks. P ‐value came from the comparison between treated group and control group or between two treated groups

    Journal: Cancer Medicine

    Article Title: Matrine induces senescence of human glioblastoma cells through suppression of the IGF1/PI3K/AKT/p27 signaling pathway, et al. Matrine induces senescence of human glioblastoma cells through suppression of the IGF1/PI3K/AKT/p27 signaling pathway

    doi: 10.1002/cam4.1720

    Figure Lengend Snippet: Downregulation of IGF1 enhances matrine‐induced cellular senescence in GBM cells. A, Cytokine array to detect secreted protein levels in controls and matrine‐treated U251 for 72 h. B, Fold expression levels of IGF1 as determined in the cytokine assay. Chemiluminescent signals quantified with ImageJ software. C, Results from ELISA performed to detect levels of IGF1 in media collected from control and matrine‐treated U251 and U87 cells. Statistical analyses were performed using permutation test. P ‐value came from the comparison between treated group and control group. D, Western blot analysis of PI3K, pAKT, AKT, p27, and GAPDH expressions in U251 and U87 cells treated with 0.2 mmol/L matrine, exogenous IGF1 (200 ng/mL), or IGF1 antibody (1 mg/mL) for 72 h. E, In situ SA‐β‐gal assay to detect senescent cells. Cells were treated with matrine, exogenous IGF1, or IGF1 antibody for 72 h. Scale bars = 20 μm. F, Graphic representation of the percentage of SA‐β‐gal‐positive cells as determined in four random fields per sample. All data are expressed as the mean ± the SD of values from experiments performed in triplicate. Statistical analyses were performed using analysis of variance in randomized blocks. P ‐value came from the comparison between treated group and control group or between two treated groups

    Article Snippet: Cells were treated with matrine (M5319‐500MG, Sigma‐Aldrich, St. Louis, MO, USA), an activator of pAKT SC79 (305834‐79‐1; Sigma‐Aldrich), or an inhibitor of PI3K (934389‐88‐5; Sigma‐Aldrich) at the concentrations indicated in the text.

    Techniques: Expressing, Cytokine Assay, Software, Enzyme-linked Immunosorbent Assay, Western Blot, In Situ, β-Gal Assay

    EGFR phosphorylation is enhanced in SKOV3 ovarian cancer cells with ST6Gal-I overexpression, but decreased in cells with ST6Gal-I knockdown. a. SKOV3 cells were stably transduced with lentivirus encoding human ST6Gal-I, or alternatively, shRNA for ST6Gal-I. ST6Gal-I overexpression (OE) and knockdown (KD) were confirmed by immunoblotting. EV, OE or KD cell lysates were precipitated by SNA-agarose and immunoblotted for EGFR to detect levels of α2-6 sialylated EGFR. Total cell lysates were immunoblotted for activated EGFR (p-EGFR, pY1068) or total EGFR. b. Densitometric analysis of three independent blots of basal p-EGFR in SKOV3 cells (normalized to β-tubulin). c. Representative p-EGFR immunoblot of EV, OE or KD cells treated with EGF for 5, 15 and 30 min. d. Densitometric analysis of three independent blots of p-EGFR in EGF-treated SKOV3 cells. *, p

    Journal: Journal of Ovarian Research

    Article Title: Sialylation of EGFR by the ST6Gal-I sialyltransferase promotes EGFR activation and resistance to gefitinib-mediated cell death

    doi: 10.1186/s13048-018-0385-0

    Figure Lengend Snippet: EGFR phosphorylation is enhanced in SKOV3 ovarian cancer cells with ST6Gal-I overexpression, but decreased in cells with ST6Gal-I knockdown. a. SKOV3 cells were stably transduced with lentivirus encoding human ST6Gal-I, or alternatively, shRNA for ST6Gal-I. ST6Gal-I overexpression (OE) and knockdown (KD) were confirmed by immunoblotting. EV, OE or KD cell lysates were precipitated by SNA-agarose and immunoblotted for EGFR to detect levels of α2-6 sialylated EGFR. Total cell lysates were immunoblotted for activated EGFR (p-EGFR, pY1068) or total EGFR. b. Densitometric analysis of three independent blots of basal p-EGFR in SKOV3 cells (normalized to β-tubulin). c. Representative p-EGFR immunoblot of EV, OE or KD cells treated with EGF for 5, 15 and 30 min. d. Densitometric analysis of three independent blots of p-EGFR in EGF-treated SKOV3 cells. *, p

    Article Snippet: Cells were transduced with lentivirus encoding either the human ST6Gal-I gene (Genecopoeia) or shRNA against ST6Gal-I (Sigma, TRCN00000035432, sequence CCGGCGTGTGCTACTACTACCAGAACTCGAGTTCTGGTAGTAGTAGCACACGTTTTTG).

    Techniques: Over Expression, Stable Transfection, Transduction, shRNA

    Knockdown of ST6Gal-I diminishes EGFR phosphorylation in BxPC3 pancreatic cancer cells. a. Using lentivirus, BxPC3 cells were stably transduced with shRNA for ST6Gal-I, and ST6Gal-I knockdown (KD) was confirmed by immunoblotting. EV or KD cell lysates were precipitated by SNA agarose and immunoblotted for EGFR to detect α2-6 sialylated EGFR. Total cell lysates were immunoblotted for activated EGFR (p-EGFR, pY1068) or total EGFR. b. Densitometric analysis of three independent blots of basal p-EGFR in BxPC3 cells (normalized to β-tubulin). c. Representative p-EGFR immunoblot of EV or KD cells treated with EGF for 5, 15 and 30 min. d. Densitometric analysis of three independent blots of p-EGFR in EGF-treated BxPC3 cells. e. Total cell lysates from EV cells of the OV4, SKOV3 and BxPC3 lines were immunoblotted for ST6Gal-I, p-EGFR (Y1068) or total EGFR. *, p

    Journal: Journal of Ovarian Research

    Article Title: Sialylation of EGFR by the ST6Gal-I sialyltransferase promotes EGFR activation and resistance to gefitinib-mediated cell death

    doi: 10.1186/s13048-018-0385-0

    Figure Lengend Snippet: Knockdown of ST6Gal-I diminishes EGFR phosphorylation in BxPC3 pancreatic cancer cells. a. Using lentivirus, BxPC3 cells were stably transduced with shRNA for ST6Gal-I, and ST6Gal-I knockdown (KD) was confirmed by immunoblotting. EV or KD cell lysates were precipitated by SNA agarose and immunoblotted for EGFR to detect α2-6 sialylated EGFR. Total cell lysates were immunoblotted for activated EGFR (p-EGFR, pY1068) or total EGFR. b. Densitometric analysis of three independent blots of basal p-EGFR in BxPC3 cells (normalized to β-tubulin). c. Representative p-EGFR immunoblot of EV or KD cells treated with EGF for 5, 15 and 30 min. d. Densitometric analysis of three independent blots of p-EGFR in EGF-treated BxPC3 cells. e. Total cell lysates from EV cells of the OV4, SKOV3 and BxPC3 lines were immunoblotted for ST6Gal-I, p-EGFR (Y1068) or total EGFR. *, p

    Article Snippet: Cells were transduced with lentivirus encoding either the human ST6Gal-I gene (Genecopoeia) or shRNA against ST6Gal-I (Sigma, TRCN00000035432, sequence CCGGCGTGTGCTACTACTACCAGAACTCGAGTTCTGGTAGTAGTAGCACACGTTTTTG).

    Techniques: Stable Transfection, Transduction, shRNA

    LPS downregulates levels of intestine-specific 5’pcmah-1 transcript and Pi promoter of pcmah in IPI-2I cells. ( a ) A schematic diagram for genomic structure of the pcmah . 5’pcmah-1 and 5’pcmah-2 , two alternative splicing variants of the pcmah , have a distinct transcription initiation site located in exons 0 and 1a, respectively. Each promoter region responsible for intestine specific splicing variant 5’pcmah-1 and housekeeping splicing variant 5’pcmah-2 is indicated by Pi (intestine specific promoter) and Ph (housekeeping promoter), respectively. Shaded boxes indicate the coding exons, while open boxes indicate untranslated exons. Two splicing variants of the pcmah share a common ORF region (shaded arrow boxes). ( b ) IPI-2I cells were treated with 100 ng/mL LPS for 1 h. mRNA expression of pcmah , 5’pcmah-1 , and 5’pcmah-2 were determined by qRT-PCR. Numbers below images indicate fold-change in mRNA expression. ( c ) The indicated 5’ deletion constructs for the Pi promoter region were transiently transfected into IPI-2I cells. After 24 h, the cells were treated with LPS for 1 h. Luciferase and β-galactosidase activity in the transfected cells was measured. For each transfection, luciferase activity was normalized with β-galactosidase activity and the relative value was determined from the ratio of normalized activity and activity in cells transfected with the empty pGL3-basic vector. Transcription factors in the region are indicated. Graphs represent three independent experiments performed in triplicate. Data represent the mean ± SD. * P

    Journal: International Journal of Molecular Sciences

    Article Title: Gram-Negative Bacterial Endotoxin LPS Induces NeuGc Loss through Ets1-Dependent Downregulation of Intestine-Specific pcmah Transcript in Porcine Intestinal Cells

    doi: 10.3390/ijms21144892

    Figure Lengend Snippet: LPS downregulates levels of intestine-specific 5’pcmah-1 transcript and Pi promoter of pcmah in IPI-2I cells. ( a ) A schematic diagram for genomic structure of the pcmah . 5’pcmah-1 and 5’pcmah-2 , two alternative splicing variants of the pcmah , have a distinct transcription initiation site located in exons 0 and 1a, respectively. Each promoter region responsible for intestine specific splicing variant 5’pcmah-1 and housekeeping splicing variant 5’pcmah-2 is indicated by Pi (intestine specific promoter) and Ph (housekeeping promoter), respectively. Shaded boxes indicate the coding exons, while open boxes indicate untranslated exons. Two splicing variants of the pcmah share a common ORF region (shaded arrow boxes). ( b ) IPI-2I cells were treated with 100 ng/mL LPS for 1 h. mRNA expression of pcmah , 5’pcmah-1 , and 5’pcmah-2 were determined by qRT-PCR. Numbers below images indicate fold-change in mRNA expression. ( c ) The indicated 5’ deletion constructs for the Pi promoter region were transiently transfected into IPI-2I cells. After 24 h, the cells were treated with LPS for 1 h. Luciferase and β-galactosidase activity in the transfected cells was measured. For each transfection, luciferase activity was normalized with β-galactosidase activity and the relative value was determined from the ratio of normalized activity and activity in cells transfected with the empty pGL3-basic vector. Transcription factors in the region are indicated. Graphs represent three independent experiments performed in triplicate. Data represent the mean ± SD. * P

    Article Snippet: Luciferase Reporter AssayFor the luciferase assay, IPI-2I cells were co-transfected with 0.25 pmol of the indicated Ph or Pi promoter constructs and 0.25 µg of β-galactosidase reporter plasmid using polyethylenimine transfection reagent (Polyscienses, Warrington, PA, USA).

    Techniques: Variant Assay, Expressing, Quantitative RT-PCR, Construct, Transfection, Luciferase, Activity Assay, Plasmid Preparation

    Morphology and senescence changes of adipose‐derived mesenchymal stem cells (ASCs) with or without long‐term FGF2 treatment. A, Microscopic images of suspended ASCs at P5, P10, and P15. Scale bar = 50 μm. B, Quantification of cell diameter revealed a smaller cell diameter of FGF2‐treated ASCs in P5 and P10, but the cell size increased at P15 (n = 7). C, SA‐β‐gal staining of ASCs at P5, P8, and P18. Scale bar = 500 μm. D, Quantification of SA‐β‐gal‐positive cells in 5‐6 randomly selected fields (n = 3). E, Western blot analysis of the senescence marker p21 at different passages. F, Quantification of p21 protein expression was higher in FGF2‐treated ASCs relative to the control after P12 (n = 3 at P17 and n = 4 at other passages). * P

    Journal: Stem Cells Translational Medicine

    Article Title: The influence of fibroblast growth factor 2 on the senescence of human adipose‐derived mesenchymal stem cells during long‐term culture. The influence of fibroblast growth factor 2 on the senescence of human adipose‐derived mesenchymal stem cells during long‐term culture

    doi: 10.1002/sctm.19-0234

    Figure Lengend Snippet: Morphology and senescence changes of adipose‐derived mesenchymal stem cells (ASCs) with or without long‐term FGF2 treatment. A, Microscopic images of suspended ASCs at P5, P10, and P15. Scale bar = 50 μm. B, Quantification of cell diameter revealed a smaller cell diameter of FGF2‐treated ASCs in P5 and P10, but the cell size increased at P15 (n = 7). C, SA‐β‐gal staining of ASCs at P5, P8, and P18. Scale bar = 500 μm. D, Quantification of SA‐β‐gal‐positive cells in 5‐6 randomly selected fields (n = 3). E, Western blot analysis of the senescence marker p21 at different passages. F, Quantification of p21 protein expression was higher in FGF2‐treated ASCs relative to the control after P12 (n = 3 at P17 and n = 4 at other passages). * P

    Article Snippet: To evaluate cellular senescence, ASCs were fixed by 4% paraformaldehyde (Sigma, St. Louis, Missouri) at room temperature for 8 minutes and then stained with senescence‐associated β‐galactosidase (SA‐β‐gal) chromogenic substrate solution (Sigma) at 37°C for 16 hours.

    Techniques: Derivative Assay, Staining, Western Blot, Marker, Expressing