Structured Review

NEN Life Science α 32 p atp
Separation of CoA–RNA and pppRNA by PAGE after a specific cleavage by a DNazyme (13). ( A ) Scheme of RNA from transcription and after DNazyme cleavage. In the presence of De-P-CoA, transcription produces a mixture of pppRNA ( N , N +1 and N +2 bands, N = 35mer) and CoA–RNA ( N , N +1 and N +2 bands). A DNazyme (5′-TGATC GGCTAGGCTAGCTACAACGAGGCTGGCCGC) cuts at a specific location (marked by an arrow), resulting in both pppRNA and CoA–RNA with a defined length of 25 nt. The bold A is the initiating nucleotide of transcription. RNA portions removed by the DNazyme are boxed. ( B ) Effect of <t>ATP</t> and De-P-CoA on transcription. After transcription, RNA was digested by the DNazyme and then fractionated by 12% denaturing gel electrophoresis. All transcription reactions were performed with the same concentration of [α- 32 P]ATP (0.1 µM). The relative ratios of [α- 32 P]ATP/ATP from lane 1 to 5 were 1, 1, 2, 5, and 10, respectively. These different ratios were considered in the calculation of total RNA yields (relative to lane 1).
α 32 P Atp, supplied by NEN Life Science, used in various techniques. Bioz Stars score: 86/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/α 32 p atp/product/NEN Life Science
Average 86 stars, based on 2 article reviews
Price from $9.99 to $1999.99
α 32 p atp - by Bioz Stars, 2020-04
86/100 stars

Images

1) Product Images from "Efficient incorporation of CoA, NAD and FAD into RNA by in vitro transcription"

Article Title: Efficient incorporation of CoA, NAD and FAD into RNA by in vitro transcription

Journal: Nucleic Acids Research

doi:

Separation of CoA–RNA and pppRNA by PAGE after a specific cleavage by a DNazyme (13). ( A ) Scheme of RNA from transcription and after DNazyme cleavage. In the presence of De-P-CoA, transcription produces a mixture of pppRNA ( N , N +1 and N +2 bands, N = 35mer) and CoA–RNA ( N , N +1 and N +2 bands). A DNazyme (5′-TGATC GGCTAGGCTAGCTACAACGAGGCTGGCCGC) cuts at a specific location (marked by an arrow), resulting in both pppRNA and CoA–RNA with a defined length of 25 nt. The bold A is the initiating nucleotide of transcription. RNA portions removed by the DNazyme are boxed. ( B ) Effect of ATP and De-P-CoA on transcription. After transcription, RNA was digested by the DNazyme and then fractionated by 12% denaturing gel electrophoresis. All transcription reactions were performed with the same concentration of [α- 32 P]ATP (0.1 µM). The relative ratios of [α- 32 P]ATP/ATP from lane 1 to 5 were 1, 1, 2, 5, and 10, respectively. These different ratios were considered in the calculation of total RNA yields (relative to lane 1).
Figure Legend Snippet: Separation of CoA–RNA and pppRNA by PAGE after a specific cleavage by a DNazyme (13). ( A ) Scheme of RNA from transcription and after DNazyme cleavage. In the presence of De-P-CoA, transcription produces a mixture of pppRNA ( N , N +1 and N +2 bands, N = 35mer) and CoA–RNA ( N , N +1 and N +2 bands). A DNazyme (5′-TGATC GGCTAGGCTAGCTACAACGAGGCTGGCCGC) cuts at a specific location (marked by an arrow), resulting in both pppRNA and CoA–RNA with a defined length of 25 nt. The bold A is the initiating nucleotide of transcription. RNA portions removed by the DNazyme are boxed. ( B ) Effect of ATP and De-P-CoA on transcription. After transcription, RNA was digested by the DNazyme and then fractionated by 12% denaturing gel electrophoresis. All transcription reactions were performed with the same concentration of [α- 32 P]ATP (0.1 µM). The relative ratios of [α- 32 P]ATP/ATP from lane 1 to 5 were 1, 1, 2, 5, and 10, respectively. These different ratios were considered in the calculation of total RNA yields (relative to lane 1).

Techniques Used: Polyacrylamide Gel Electrophoresis, Nucleic Acid Electrophoresis, Concentration Assay

2) Product Images from "Synthesis of adenosine derivatives as transcription initiators and preparation of 5? fluorescein- and biotin-labeled RNA through one-step in vitro transcription"

Article Title: Synthesis of adenosine derivatives as transcription initiators and preparation of 5? fluorescein- and biotin-labeled RNA through one-step in vitro transcription

Journal: RNA

doi: 10.1261/rna.5106403

Effects of N6- or 8-modification of adenosine nucleotides on transcription initiation under the T7 φ2.5 promoter. RNA was prepared in the absence (lane 1 ) or presence of 4 mM of either N6-HDA-AMP (lane 3 ) or 8-HDA-AMP (lane 5 ). Transcription solutions contained 0.25 mM ATP and 1 mM each of GTP, CTP, and UTP. In addition, ~0.1 μM of [α- 32 P]ATP was included to label RNA products for visualization and quantitation. Samples were run to single-nucleotide resolution on an 8% denaturing polyacrylamide gel. Normal transcription produces three RNA bands (lane 1 ). There are N, N+1, and N+2 bands of RNA. After transcription, half of each RNA preparation was reacted with FAM-SE (lanes 2,4,6 , 100 mM FAM-SE in 0.5 M NaHCO 3 , 30 min at room temperature). Amino- and fluorescein-RNA yields are indicated (lanes 1 – 6 ). Compared with normal pppRNA (lane 1 ), the amino-RNA (lane 3 ) and FAM-labeled RNA (lane 4 ) migrate with slower rates, shifting upwards by roughly 1 and 2.4 nt, respectively.
Figure Legend Snippet: Effects of N6- or 8-modification of adenosine nucleotides on transcription initiation under the T7 φ2.5 promoter. RNA was prepared in the absence (lane 1 ) or presence of 4 mM of either N6-HDA-AMP (lane 3 ) or 8-HDA-AMP (lane 5 ). Transcription solutions contained 0.25 mM ATP and 1 mM each of GTP, CTP, and UTP. In addition, ~0.1 μM of [α- 32 P]ATP was included to label RNA products for visualization and quantitation. Samples were run to single-nucleotide resolution on an 8% denaturing polyacrylamide gel. Normal transcription produces three RNA bands (lane 1 ). There are N, N+1, and N+2 bands of RNA. After transcription, half of each RNA preparation was reacted with FAM-SE (lanes 2,4,6 , 100 mM FAM-SE in 0.5 M NaHCO 3 , 30 min at room temperature). Amino- and fluorescein-RNA yields are indicated (lanes 1 – 6 ). Compared with normal pppRNA (lane 1 ), the amino-RNA (lane 3 ) and FAM-labeled RNA (lane 4 ) migrate with slower rates, shifting upwards by roughly 1 and 2.4 nt, respectively.

Techniques Used: Modification, Helicase-dependent Amplification, Quantitation Assay, Labeling

Related Articles

Nucleic Acid Electrophoresis:

Article Title: Efficient incorporation of CoA, NAD and FAD into RNA by in vitro transcription
Article Snippet: Paragraph title: Transcription, DNazyme cleavage and gel electrophoresis ... For quantitation purposes, [α-32 P]ATP (NEN Life Science, Boston, MA) was also added to transcription solutions to internally label RNA transcripts.

In Vitro:

Article Title: Synthesis of adenosine derivatives as transcription initiators and preparation of 5? fluorescein- and biotin-labeled RNA through one-step in vitro transcription
Article Snippet: Paragraph title: Incorporation of 5′- and N6-amino, fluorescein, and biotin derivatives into RNA by in vitro transcription ... The radiolabel, α-32 P-ATP (NEN Life Science), was also included in transcription solutions to internally label RNA transcripts.

Mutagenesis:

Article Title: Lethal Kinesin Mutations Reveal Amino Acids Important for ATPase Activation and Structural Coupling *
Article Snippet: .. [α-32 P]ATP ( > 3000 Ci/mmol) was from NEN Life Sciences (Boston, MA), polyethyleneimine (PEI)-cellulose TLC plates (EM Science of Merck, 20 × 20 cm, plastic backed) were from VWR Scientific (Bridgeport, NJ), Taxol ( Taxus brevifolia ) was from CalBiochem-Nove-Biochem International (San Diego, CA), QIAmp Tissue Kit and Qiaquick gel extraction kit were from Qiagen (Valencia, CA), Thermo Sequenase sequencing kit was from Amersham Pharmacia Biotech, T4 DNA ligase and restriction enzymes were from New England Biolabs (Beverley, MA), Chameleon Double-Stranded Site-Directed Mutagenesis Kit was from Stratagene, Inc. (La Jolla, CA), ATP, GTP, AMP-PNP, S-Sepharose and DEAE-Sephacel were from Amersham Pharmacia Biotech, Bio-Rad Protein Assay, ovalbumin, and IgG were from Bio-Rad. ..

Isolation:

Article Title: Efficient incorporation of CoA, NAD and FAD into RNA by in vitro transcription
Article Snippet: The RNA sequence was from a previously isolated coenzyme-synthesizing ribozyme , CoES7, with the sequence AGGGAAGTGCTACCACA ACUUUAGCCAUAAUGUCACUUCUGCCGCGGGCAU GCGGCCAGCCA. .. For quantitation purposes, [α-32 P]ATP (NEN Life Science, Boston, MA) was also added to transcription solutions to internally label RNA transcripts.

Incubation:

Article Title: Donation of catalytic residues to RNA polymerase active center by transcription factor Gre
Article Snippet: After a 5-min incubation at room temperature, the beads were washed with cold TB without MgCl2 , followed by addition of ATP and MgCl2 to final concentrations of 25 μM and 1 mM, respectively, and subsequent incubation for 15 min at 0°C. .. In the case of the internal labeling of RNA to the solution of open complex, the start mixture (see above) containing 1 μl of [α-32 P]ATP (3,000 Ci/mmol, 3 μM; NEN Life Science Product) was added to obtain TEC-11A.

Labeling:

Article Title: Donation of catalytic residues to RNA polymerase active center by transcription factor Gre
Article Snippet: .. In the case of the internal labeling of RNA to the solution of open complex, the start mixture (see above) containing 1 μl of [α-32 P]ATP (3,000 Ci/mmol, 3 μM; NEN Life Science Product) was added to obtain TEC-11A. ..

Sequencing:

Article Title: Lethal Kinesin Mutations Reveal Amino Acids Important for ATPase Activation and Structural Coupling *
Article Snippet: .. [α-32 P]ATP ( > 3000 Ci/mmol) was from NEN Life Sciences (Boston, MA), polyethyleneimine (PEI)-cellulose TLC plates (EM Science of Merck, 20 × 20 cm, plastic backed) were from VWR Scientific (Bridgeport, NJ), Taxol ( Taxus brevifolia ) was from CalBiochem-Nove-Biochem International (San Diego, CA), QIAmp Tissue Kit and Qiaquick gel extraction kit were from Qiagen (Valencia, CA), Thermo Sequenase sequencing kit was from Amersham Pharmacia Biotech, T4 DNA ligase and restriction enzymes were from New England Biolabs (Beverley, MA), Chameleon Double-Stranded Site-Directed Mutagenesis Kit was from Stratagene, Inc. (La Jolla, CA), ATP, GTP, AMP-PNP, S-Sepharose and DEAE-Sephacel were from Amersham Pharmacia Biotech, Bio-Rad Protein Assay, ovalbumin, and IgG were from Bio-Rad. ..

Article Title: Synthesis of adenosine derivatives as transcription initiators and preparation of 5? fluorescein- and biotin-labeled RNA through one-step in vitro transcription
Article Snippet: The RNA sequence was a 35-mer used in previous transcription studies ( ): AGGGA AGCGGGCAUGCGGCCAGCCAUAGCCGAUCA. .. The radiolabel, α-32 P-ATP (NEN Life Science), was also included in transcription solutions to internally label RNA transcripts.

Article Title: Efficient incorporation of CoA, NAD and FAD into RNA by in vitro transcription
Article Snippet: The RNA sequence was from a previously isolated coenzyme-synthesizing ribozyme , CoES7, with the sequence AGGGAAGTGCTACCACA ACUUUAGCCAUAAUGUCACUUCUGCCGCGGGCAU GCGGCCAGCCA. .. For quantitation purposes, [α-32 P]ATP (NEN Life Science, Boston, MA) was also added to transcription solutions to internally label RNA transcripts.

Quantitation Assay:

Article Title: Efficient incorporation of CoA, NAD and FAD into RNA by in vitro transcription
Article Snippet: .. For quantitation purposes, [α-32 P]ATP (NEN Life Science, Boston, MA) was also added to transcription solutions to internally label RNA transcripts. ..

Thin Layer Chromatography:

Article Title: A Kinesin Mutation That Uncouples Motor Domains and Desensitizes the ?-Phosphate Sensor *
Article Snippet: .. [α-32 P]ATP ( > 3000 Ci/mmol) was from NEN Life Science Products; polyethyleneimine-cellulose TLC plates (EM Science of Merck, 20 × 20 cm, plastic-backed) were from VWR Scientific (Bridgeport, NJ); Taxol ( Taxus brevifolia ) was from Calbiochem-Novabiochem; ATP, GTP, AMP-PNP, and S-Sepharose were from Amersham Pharmacia Biotech (Uppsala, Sweden); Bio-Rad Protein Assay, ovalbumin, IgG, and DEAE-Sephacel were from Bio-Rad. .. K401-4 was bacterially expressed, purified, and characterized as described previously ( ).

Article Title: Lethal Kinesin Mutations Reveal Amino Acids Important for ATPase Activation and Structural Coupling *
Article Snippet: .. [α-32 P]ATP ( > 3000 Ci/mmol) was from NEN Life Sciences (Boston, MA), polyethyleneimine (PEI)-cellulose TLC plates (EM Science of Merck, 20 × 20 cm, plastic backed) were from VWR Scientific (Bridgeport, NJ), Taxol ( Taxus brevifolia ) was from CalBiochem-Nove-Biochem International (San Diego, CA), QIAmp Tissue Kit and Qiaquick gel extraction kit were from Qiagen (Valencia, CA), Thermo Sequenase sequencing kit was from Amersham Pharmacia Biotech, T4 DNA ligase and restriction enzymes were from New England Biolabs (Beverley, MA), Chameleon Double-Stranded Site-Directed Mutagenesis Kit was from Stratagene, Inc. (La Jolla, CA), ATP, GTP, AMP-PNP, S-Sepharose and DEAE-Sephacel were from Amersham Pharmacia Biotech, Bio-Rad Protein Assay, ovalbumin, and IgG were from Bio-Rad. ..

Construct:

Article Title: Efficient incorporation of CoA, NAD and FAD into RNA by in vitro transcription
Article Snippet: For quantitation purposes, [α-32 P]ATP (NEN Life Science, Boston, MA) was also added to transcription solutions to internally label RNA transcripts. .. Two DNA oligos with the sequences CAGTAATACGACTCA CTATTAGGGAAGCGGGCATGCGGCCAGCCATAGCC GATCA and TGATCGGCTATGGCTGGCCGCATGCCCG were used to construct (by PCR) a DNA duplex template, from which a 35 nt RNA sequence AGGGAAGCGGGCAUGCGG CCAGCCAUAGCCGAUCA was transcribed.

Polymerase Chain Reaction:

Article Title: Efficient incorporation of CoA, NAD and FAD into RNA by in vitro transcription
Article Snippet: For quantitation purposes, [α-32 P]ATP (NEN Life Science, Boston, MA) was also added to transcription solutions to internally label RNA transcripts. .. Two DNA oligos with the sequences CAGTAATACGACTCA CTATTAGGGAAGCGGGCATGCGGCCAGCCATAGCC GATCA and TGATCGGCTATGGCTGGCCGCATGCCCG were used to construct (by PCR) a DNA duplex template, from which a 35 nt RNA sequence AGGGAAGCGGGCAUGCGG CCAGCCAUAGCCGAUCA was transcribed.

Gel Extraction:

Article Title: Lethal Kinesin Mutations Reveal Amino Acids Important for ATPase Activation and Structural Coupling *
Article Snippet: .. [α-32 P]ATP ( > 3000 Ci/mmol) was from NEN Life Sciences (Boston, MA), polyethyleneimine (PEI)-cellulose TLC plates (EM Science of Merck, 20 × 20 cm, plastic backed) were from VWR Scientific (Bridgeport, NJ), Taxol ( Taxus brevifolia ) was from CalBiochem-Nove-Biochem International (San Diego, CA), QIAmp Tissue Kit and Qiaquick gel extraction kit were from Qiagen (Valencia, CA), Thermo Sequenase sequencing kit was from Amersham Pharmacia Biotech, T4 DNA ligase and restriction enzymes were from New England Biolabs (Beverley, MA), Chameleon Double-Stranded Site-Directed Mutagenesis Kit was from Stratagene, Inc. (La Jolla, CA), ATP, GTP, AMP-PNP, S-Sepharose and DEAE-Sephacel were from Amersham Pharmacia Biotech, Bio-Rad Protein Assay, ovalbumin, and IgG were from Bio-Rad. ..

Derivative Assay:

Article Title: Synthesis of adenosine derivatives as transcription initiators and preparation of 5? fluorescein- and biotin-labeled RNA through one-step in vitro transcription
Article Snippet: For all RNA transcription experiments, the promoter sequence was derived from the T7 φ2.5 promoter ( ; ; ). .. The radiolabel, α-32 P-ATP (NEN Life Science), was also included in transcription solutions to internally label RNA transcripts.

Article Title: Efficient incorporation of CoA, NAD and FAD into RNA by in vitro transcription
Article Snippet: Transcription promoter sequence was derived from the T7 class II promoter (φ2.5) (Fig. ) ( ). .. For quantitation purposes, [α-32 P]ATP (NEN Life Science, Boston, MA) was also added to transcription solutions to internally label RNA transcripts.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    NEN Life Science α 32 p atp
    Separation of CoA–RNA and pppRNA by PAGE after a specific cleavage by a DNazyme (13). ( A ) Scheme of RNA from transcription and after DNazyme cleavage. In the presence of De-P-CoA, transcription produces a mixture of pppRNA ( N , N +1 and N +2 bands, N = 35mer) and CoA–RNA ( N , N +1 and N +2 bands). A DNazyme (5′-TGATC GGCTAGGCTAGCTACAACGAGGCTGGCCGC) cuts at a specific location (marked by an arrow), resulting in both pppRNA and CoA–RNA with a defined length of 25 nt. The bold A is the initiating nucleotide of transcription. RNA portions removed by the DNazyme are boxed. ( B ) Effect of <t>ATP</t> and De-P-CoA on transcription. After transcription, RNA was digested by the DNazyme and then fractionated by 12% denaturing gel electrophoresis. All transcription reactions were performed with the same concentration of [α- 32 P]ATP (0.1 µM). The relative ratios of [α- 32 P]ATP/ATP from lane 1 to 5 were 1, 1, 2, 5, and 10, respectively. These different ratios were considered in the calculation of total RNA yields (relative to lane 1).
    α 32 P Atp, supplied by NEN Life Science, used in various techniques. Bioz Stars score: 86/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p atp/product/NEN Life Science
    Average 86 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    α 32 p atp - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    84
    NEN Life Science p α atp
    Separation of CoA–RNA and pppRNA by PAGE after a specific cleavage by a DNazyme (13). ( A ) Scheme of RNA from transcription and after DNazyme cleavage. In the presence of De-P-CoA, transcription produces a mixture of pppRNA ( N , N +1 and N +2 bands, N = 35mer) and CoA–RNA ( N , N +1 and N +2 bands). A DNazyme (5′-TGATC GGCTAGGCTAGCTACAACGAGGCTGGCCGC) cuts at a specific location (marked by an arrow), resulting in both pppRNA and CoA–RNA with a defined length of 25 nt. The bold A is the initiating nucleotide of transcription. RNA portions removed by the DNazyme are boxed. ( B ) Effect of <t>ATP</t> and De-P-CoA on transcription. After transcription, RNA was digested by the DNazyme and then fractionated by 12% denaturing gel electrophoresis. All transcription reactions were performed with the same concentration of [α- 32 P]ATP (0.1 µM). The relative ratios of [α- 32 P]ATP/ATP from lane 1 to 5 were 1, 1, 2, 5, and 10, respectively. These different ratios were considered in the calculation of total RNA yields (relative to lane 1).
    P α Atp, supplied by NEN Life Science, used in various techniques. Bioz Stars score: 84/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/p α atp/product/NEN Life Science
    Average 84 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    p α atp - by Bioz Stars, 2020-04
    84/100 stars
      Buy from Supplier

    Image Search Results


    Separation of CoA–RNA and pppRNA by PAGE after a specific cleavage by a DNazyme (13). ( A ) Scheme of RNA from transcription and after DNazyme cleavage. In the presence of De-P-CoA, transcription produces a mixture of pppRNA ( N , N +1 and N +2 bands, N = 35mer) and CoA–RNA ( N , N +1 and N +2 bands). A DNazyme (5′-TGATC GGCTAGGCTAGCTACAACGAGGCTGGCCGC) cuts at a specific location (marked by an arrow), resulting in both pppRNA and CoA–RNA with a defined length of 25 nt. The bold A is the initiating nucleotide of transcription. RNA portions removed by the DNazyme are boxed. ( B ) Effect of ATP and De-P-CoA on transcription. After transcription, RNA was digested by the DNazyme and then fractionated by 12% denaturing gel electrophoresis. All transcription reactions were performed with the same concentration of [α- 32 P]ATP (0.1 µM). The relative ratios of [α- 32 P]ATP/ATP from lane 1 to 5 were 1, 1, 2, 5, and 10, respectively. These different ratios were considered in the calculation of total RNA yields (relative to lane 1).

    Journal: Nucleic Acids Research

    Article Title: Efficient incorporation of CoA, NAD and FAD into RNA by in vitro transcription

    doi:

    Figure Lengend Snippet: Separation of CoA–RNA and pppRNA by PAGE after a specific cleavage by a DNazyme (13). ( A ) Scheme of RNA from transcription and after DNazyme cleavage. In the presence of De-P-CoA, transcription produces a mixture of pppRNA ( N , N +1 and N +2 bands, N = 35mer) and CoA–RNA ( N , N +1 and N +2 bands). A DNazyme (5′-TGATC GGCTAGGCTAGCTACAACGAGGCTGGCCGC) cuts at a specific location (marked by an arrow), resulting in both pppRNA and CoA–RNA with a defined length of 25 nt. The bold A is the initiating nucleotide of transcription. RNA portions removed by the DNazyme are boxed. ( B ) Effect of ATP and De-P-CoA on transcription. After transcription, RNA was digested by the DNazyme and then fractionated by 12% denaturing gel electrophoresis. All transcription reactions were performed with the same concentration of [α- 32 P]ATP (0.1 µM). The relative ratios of [α- 32 P]ATP/ATP from lane 1 to 5 were 1, 1, 2, 5, and 10, respectively. These different ratios were considered in the calculation of total RNA yields (relative to lane 1).

    Article Snippet: For quantitation purposes, [α-32 P]ATP (NEN Life Science, Boston, MA) was also added to transcription solutions to internally label RNA transcripts.

    Techniques: Polyacrylamide Gel Electrophoresis, Nucleic Acid Electrophoresis, Concentration Assay

    Effects of N6- or 8-modification of adenosine nucleotides on transcription initiation under the T7 φ2.5 promoter. RNA was prepared in the absence (lane 1 ) or presence of 4 mM of either N6-HDA-AMP (lane 3 ) or 8-HDA-AMP (lane 5 ). Transcription solutions contained 0.25 mM ATP and 1 mM each of GTP, CTP, and UTP. In addition, ~0.1 μM of [α- 32 P]ATP was included to label RNA products for visualization and quantitation. Samples were run to single-nucleotide resolution on an 8% denaturing polyacrylamide gel. Normal transcription produces three RNA bands (lane 1 ). There are N, N+1, and N+2 bands of RNA. After transcription, half of each RNA preparation was reacted with FAM-SE (lanes 2,4,6 , 100 mM FAM-SE in 0.5 M NaHCO 3 , 30 min at room temperature). Amino- and fluorescein-RNA yields are indicated (lanes 1 – 6 ). Compared with normal pppRNA (lane 1 ), the amino-RNA (lane 3 ) and FAM-labeled RNA (lane 4 ) migrate with slower rates, shifting upwards by roughly 1 and 2.4 nt, respectively.

    Journal: RNA

    Article Title: Synthesis of adenosine derivatives as transcription initiators and preparation of 5? fluorescein- and biotin-labeled RNA through one-step in vitro transcription

    doi: 10.1261/rna.5106403

    Figure Lengend Snippet: Effects of N6- or 8-modification of adenosine nucleotides on transcription initiation under the T7 φ2.5 promoter. RNA was prepared in the absence (lane 1 ) or presence of 4 mM of either N6-HDA-AMP (lane 3 ) or 8-HDA-AMP (lane 5 ). Transcription solutions contained 0.25 mM ATP and 1 mM each of GTP, CTP, and UTP. In addition, ~0.1 μM of [α- 32 P]ATP was included to label RNA products for visualization and quantitation. Samples were run to single-nucleotide resolution on an 8% denaturing polyacrylamide gel. Normal transcription produces three RNA bands (lane 1 ). There are N, N+1, and N+2 bands of RNA. After transcription, half of each RNA preparation was reacted with FAM-SE (lanes 2,4,6 , 100 mM FAM-SE in 0.5 M NaHCO 3 , 30 min at room temperature). Amino- and fluorescein-RNA yields are indicated (lanes 1 – 6 ). Compared with normal pppRNA (lane 1 ), the amino-RNA (lane 3 ) and FAM-labeled RNA (lane 4 ) migrate with slower rates, shifting upwards by roughly 1 and 2.4 nt, respectively.

    Article Snippet: The radiolabel, α-32 P-ATP (NEN Life Science), was also included in transcription solutions to internally label RNA transcripts.

    Techniques: Modification, Helicase-dependent Amplification, Quantitation Assay, Labeling